Atranorin biosynthesis gene derived from lichens and uses thereof
20250368695 ยท 2025-12-04
Inventors
- Jae Seoun HUR (Suncheon-Si, KR)
- Won Yong KIM (Suncheon-si, KR)
- Hyung Ho HA (Suncheon-si, KR)
- Hangun KIM (Gwangju, KR)
Cpc classification
International classification
Abstract
The present invention relates to an atranorin biosynthesis gene derived from a lichen Stereocaulon alpinum, an Ascochyta rabiei ATR-11 strain (Accession Number: KACC 83048BP) for producing atranorin into which the gene is introduced, and a method of producing atranorin using the above strain. A lichen-derived metabolite, particularly atranorin, may be produced from the Ascochyta rabiei ATR-11 strain into which the atranorin biosynthesis gene according to the present invention is introduced. Atranorin produced from the above strain can be utilized and industrialized in a variety of ways, such as pharmaceutical compositions, food compositions, health functional foods, and feed compositions.
Claims
1. An atranorin biosynthesis gene consisting of one or more selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 3, and SEQ ID NO: 5.
2. The atranorin biosynthesis gene according to claim 1, wherein the atranorin biosynthesis gene is derived from a lichen.
3. The atranorin biosynthesis gene according to claim 1, wherein the lichen is Stereocaulon alpinum.
4. A recombinant expression vector for producing a lichen-derived metabolite, comprising an atranorin biosynthesis gene consisting of one or more selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 3, and SEQ ID NO: 5.
5. The recombinant expression vector for producing a lichen-derived metabolite according to claim 4, wherein the lichen-derived metabolite is one or more selected from the group consisting of 4-O-demethylbarbatic acid, proatranorin I, proatranorin II, proatranorin III, atranorin, and baeomycesic acid.
6. A recombinant microorganism transformed with the recombinant expression according to claim 4.
7. A method of producing a lichen-derived metabolite, comprising a step of culturing the recombinant microorganism according to claim 6.
8. The method of producing a lichen-derived metabolite according to claim 7, wherein the lichen-derived metabolite is one or more selected from the group consisting of 4-O-demethylbarbatic acid, proatranorin I, proatranorin II, proatranorin III, atranorin, and baeomycesic acid.
9. An Ascochyta rabiei ATR-11 strain (Accession Number: KACC 83048BP).
10. The strain according to claim 9, wherein the strain is for producing atranorin.
11. The strain according to claim 9, wherein the train is a strain into which an atranorin biosynthesis gene consisting of one or more selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 3, and SEQ ID NO: 5 is introduced.
12. A method of producing atranorin, comprising a step of culturing the strain according to claim 9.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
DETAILED DESCRIPTION
[0031] Depsides and depsidones series compounds of polyketide origin accumulate in the cortical or medullary layers of lichen thalli. Despite the taxonomic and ecological significance of lichen chemistry and its pharmaceutical potentials, there has been no single genetic evidence linking biosynthetic genes to lichen substances. Thus, the present inventors systematically analyzed lichen polyketide synthases (PKSs) for categorization and identification of biosynthetic gene cluster (BGC) involved in depside/depsidone production. Our in-depth analysis of the inter-species PKS diversity in the genus Cladonia and a related Antarctic lichen Stereocaulon alpinum identified 45 BGC families, linking lichen PKSs to 15 previously characterized PKSs in non-lichenized fungi. Among these, the present inventors identified highly syntenic BGCs found exclusively in lichens producing atranorin (a depside). Heterologous expression of the putative atranorin PKS (coined atr1) yielded 4-O-demethylbarbatic acid found in many lichens as a precursor compound, indicating an intermolecular cross-linking activity of the Atr1 for depside formation. Subsequent introductions of tailoring enzymes into the heterologous host yielded atranorin, one of the most common cortical substances of microlichens. Phylogenetic analysis of fungal PKS revealed that the Atr1 is placed in a novel PKS clade including two conserved lichens specific PKS families likely involved in biosynthesis of depsides and depsidones. Here, the present inventors provide a comprehensive catalog of PKS families of the genus Cladonia and functionally characterized a biosynthetic gene cluster from lichens, establishing a cornerstone for studying genetics and chemical evolution of diverse lichen substances.
Novel Atranorin Biosynthesis Gene
[0032] As one aspect, the present invention provides an atranorin biosynthesis gene consisting of one or more selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 3, and SEQ ID NO: 5.
[0033] The term atranorin used in the present specification has a chemical formula name of 3-hydroxy-4-methoxycarbonyl-2,5-dimethylphenyl-3-formyl-2,4-dihydroxy-6-methyl benzoate, and has a structural formula of [Formula 1] shown below. Such atranorin may be derived from thalli as a secondary metabolite of thalli. The atranorin has been reported to have an effect of inhibiting lung cancer metastasis.
[Formula 1]
[0034] See atranorine (compound 5) in
[0035] Atranorin of the present invention may be used in a meaning of including analogues and derivatives of atranorin.
[0036] The term thallus used in the present specification refers to a trophosome of lichens for seredium, isidium or clonal propagation, consisting of cells of lichen symbiotic algae or cyanobacteria and hyphae of a lichen-forming fungus.
[0037] The term lichen used in the present specification refers to a symbiont living as a complex of fungi (mycobionts) and algae (photobionts), and it has extremely diverse shapes, sizes, and colors, inhabiting mainly on rocks, barks of tree, and soil. The lichens produce primary and secondary metabolites such as didymic acid, strepsilin, sodium usnate, lecanoric acid, and psoromic acid which have excellent bioactivity for antimicrobials (fungi, bacteria, viruses), herbicides, anti-cancer agents, immunomopotentiation, and amelioration of metal illnesses. Therefore, from old times, lichens have been traditionally used as a raw material for foods and medicines in both East and West of the world.
[0038] In the present invention, the atranorin biosynthesis gene is a secondary metabolite derived from a lichen, for example, a gene capable of inducing the expression of atranorin, and may consists of one or more selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 3, and SEQ ID NO: 5. The lichen may be Stereocaulon alpinum but is not limited thereto.
[0039] The base sequence represented by SEQ ID NO: 1 may be named as atr1 gene (NCBI Genbank No. MZ277879.1); the base sequence represented by SEQ ID NO: 3 as atr2 gene (NCBI Genbank No. MZ277878.1); and the base sequence represented by SEQ ID NO: 5 as atr3 gene (NCBI Genbank No. MZ277877.1).
[0040] In addition, the base sequence represented by SEQ ID NO: 1 may be encoded as an atr1 protein (NCBI Genbank No. QXF68953.1) consisting of an amino acid sequence of SEQ ID NO: 2. The base sequence represented by SEQ ID NO: 3 may be encoded as an atr2 protein (NCBI Genbank No. QXF68952.1) consisting of an amino acid sequence of SEQ ID NO: 4. The base sequence represented by SEQ ID NO: 5 may be encoded as an atr3 protein (NCBI Genbank No. QXF68951.1) consisting of an amino acid sequence of SEQ ID NO: 6.
Recombinant Expression Vector for Producing Lichen-Derived Metabolites.
[0041] As another aspect, the present invention provides a recombinant expression vector for producing a metabolite derived from a lichen, including an atranorin biosynthesis gene consisting of one or more selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 3, and SEQ ID NO: 5.
[0042] The atranorin biosynthesis gene is as described above.
[0043] The term vector used in the present specification refers to a DNA preparation containing a specific gene operably linked to a suitable regulatory sequence to enable expression of a target protein in a suitable host, wherein the regulatory sequence includes a promoter capable of initiating transcription, an arbitrary operator sequences for regulating the transcription, a sequence encoding a suitable mRNA ribosome binding site, and a sequence regulating the termination of transcription and translation. After being transformed into a suitable host cell, a vector may be replicated or may function independently of the host genome, and it may be integrated into the genome itself. The vector of the present invention may be prepared using a genetic recombination technology well known in the technical field, and enzymes generally known in the technical field are used for site-specific DNA cleavage and ligation.
[0044] The term expression vector used in the present specification refers to a vector into which a lichen-derived atranorin biosynthesis gene is introduced, wherein it means a recombinant expression vector capable of expressing a lichen-derived metabolite, prepared by introducing a lichen-derived atranorin biosynthesis gene to a heterologous strain, in order to artificially express lichen-derived metabolites that may not be expressed in heterologous microorganisms or host cells on their own.
[0045] Specifically, the expression vector means a vector capable of expressing a lichen-derived metabolite such as atranorin, which is a secondary metabolite derived from lichens, as well as 4-O-demethylbarbatic acid, proatranorin I, proatranorin II, proatranorin III, and baeomycesic acid, in heterologous microorganisms or host cells by the introduced atranorin biosynthesis gene. In the present invention, an expression vector may be used interchangeably with vector or recombinant expression vector.
[0046] The expression vector may preferably include one or more selectable markers. The marker is a nucleic acid sequence that has the characteristics that it may be selected by a conventional chemical method and includes all genes that may distinguish transformed cells from non-transformed cells. Examples include antibiotic resistance genes such as ampicillin, kanamycin, G418, bleomycin, hygromycin, chloramphenicol, and apramycin, but are not limited thereto, and it may be appropriately selected by one of ordinary skill in the art.
[0047] In one embodiment of the present invention, a vector into which an atranorin biosynthesis gene derived from Stereocaulon alpinum is introduced may be transformed into a heterologous chickpea blight fungus Ascochyta rabiei to heterologously express lichen-derived metabolites.
Recombinant Microorganism Loaded with a Recombinant Expression Vector Containing an Atranorin Biosynthetic Gene
[0048] In another aspect, the present invention provides a recombinant microorganism transformed with the above recombinant expression vector.
[0049] The recombinant expression vector is as described above.
[0050] The term transformation used in the present specification refers to a change in the genetic properties of an organism by an externally given DNA. In particular, in the present invention, it refers to introducing a vector including a specific gene, that is, a lichen-derived atranorin biosynthesis gene, to a specific heterologous microorganism so that the gene may be expressed in the specific heterologous microorganism.
[0051] The recombinant expression vector is transformed into a specific heterologous microorganism to produce a recombinant microbial strain. At this time, the transformation method may be used without any particular limitation as long as it is a known technology. For example, a calcium chloride method or an electroporation method (Neumann, et al., EMBO J., 1:841, 1982) may be used for transformation.
[0052] The specific heterogeneous microorganism may be used without limitation as long as it is a microorganism or host cell that widely known in the art. Microorganisms or host cells with a high efficiency of introducing and expressing a lichen-derived atranorin biosynthesis gene of the present invention may be used, and for example, they may include fungi, bacteria, and yeast.
[0053] Specifically, the recombinant microorganism may be a fungus, and more specifically, it may be Ascochyta rabiei.
[0054] More specifically, the recombinant microorganism may be Ascochyta rabiei ATR-11 strain (Accession Number: KACC83048BP).
Method of Producing a Lichen-Derived Metabolite
[0055] In another aspect, the present invention provides a method of producing a lichen-derived metabolite, including a step of culturing the recombinant microorganism.
[0056] As described above, the recombinant microorganism may be a recombinant microorganism into which a recombinant expression vector for producing a lichen-derived metabolite, including an atranorin biosynthesis gene consisting of one or more selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 3, and SEQ ID NO: 5, is introduced.
[0057] The recombinant microorganism may be one producing one or more lichen-derived metabolites selected from the group consisting of 4-O-demethylbarbatic acid, proatranorin I, proatranorin II, proatranorin III, atranorin, and baeomycesic acid, but is not limited thereto.
[0058] Culture conditions of the recombinant microorganism for producing a lichen-derived metabolite may vary depending on the type of transformed recombinant microorganism or host cell. Depending on the type of the recombinant microorganism or host cell, culture may be performed according to conditions known to one of ordinary skill in the art, that is under conventional temperature conditions of, for example, 25 to 40 C., and under conventional pH conditions, for example, pH 6 to 8. Under these conditions, the above lichen-derived metabolites may be mass-produced from a recombinant microorganism or host cell with a high yield.
[0059] As described above, as the recombinant microorganism or hos cell, microorganisms or host cells known in the art with a high efficiency of introducing and expressing a lichen-derived atranorin biosynthesis gene may be used without a limitation. Specifically, the recombinant microorganism may be a fungus, and more specifically, it may be Ascochyta rabiei. More specifically, the recombinant microorganism may be Ascochyta rabiei ATR-11 strain (Accession Number: KACC 83048BP).
[0060] Additionally, as a medium used for culturing (or fermenting) the recombinant microorganism or host cell, one that appropriately satisfies the requirements of a specific microbial strain or host cell may be appropriately selected. The medium may include various carbon sources, nitrogen sources, phosphorus sources, and trace element components. Examples of carbon sources in the medium may be sugars and carbohydrates such as glucose, saccharose, lactose, fructose, maltose, starch, and cellulose, oils, and fats such as soybean oil, sunflower oil, castor oil, and coconut oil, fatty acids such as palmitic acid, stearic acid, and linoleic acid, alcohols such as glycerol and ethanol, and organic acids such as acetic acid, but are not limited thereto. These substances may be used individually or in mixtures. The carbon source may be glycerol, glucose, or a combination thereof. Examples of nitrogen sources in the medium may be peptone, yeast extract, broth, malt extract, corn steep liquor, soybean meal, and urea or inorganic compounds, for example, ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate, and ammonium nitrate, but are not limited thereto. Nitrogen sources may also be used individually or in mixtures. Examples of phosphorus sources may be potassium dihydrogen phosphate or dipotassium hydrogen phosphate or corresponding sodium-containing salts but are not limited thereto. In addition, a culture medium may include metal salts necessary for growth, such as magnesium sulfate or iron sulfate, or may include essential growth substances such as amino acids and vitamins but is not limited thereto. The above raw materials may be added to a culture batchwise or continuously in an appropriate manner during a culture process.
[0061] Additionally, according to the necessary, the pH of the culture may be adjusted by using basic compounds such as sodium hydroxide, potassium hydroxide, and ammonia, or acid compounds such as phosphoric acid or sulfuric acid in an appropriate manner. In addition, foam generation may be suppressed by using an antifoaming agent such as fatty acid polyglycol ester. The temperature of the culture may usually be maintained at 20 C. to 45 C., or 25 C. to 40 C. The culture may be performed continuously until the maximum production of a desired metabolite, for example, one or more lichen-derived secondary metabolites selected from the group consisting of 4-O-dimethylbarbatic acid, proatranorin I, proatranorin II, proatranorin III, atranorin, and baeomycesic acid, is obtained.
[0062] The method of producing a lichen-derived metabolite provided in the present specification may further include a step of recovering or isolating a produced lichen-derived secondary metabolite after the step of culturing described above. A method of recovering or isolating a lichen-derived secondary metabolite produced from a recombinant strain or a culture thereof may be selected from methods that are widely known in the art. Examples of methods of recovering 4-O-dimethylbarbatic acid, proatranorin I, proatranorin II, proatranorin III, atranorin or baeomycesic acid include centrifugation, sonication, filtration, ion exchange chromatography, high-performance liquid chromatography (HPLC), gas chromatography (GC), and the like, but are not limited to these examples.
[0063] The lichen-derived metabolites provided in the present specification may be produced from a recombinant microorganism transformed by selectively introducing one or more of the above-mentioned atranorin biosynthesis genes (see Scheme 1 below).
[Scheme 1]
See FIG. 4A.
[0064] In one embodiment of the present invention, 4-O-dimethylbarbatic acid may be produced by culturing under predetermined conditions a recombinant microorganism into which the atr1 gene consisting of the base sequence of SEQ ID NO: 1 is introduced. At this time, the recombinant microorganism is not limited thereto, but may be phytopathogenic fungus Ascochyta rabiei (As. rabiei).
[0065] In one embodiment of the present invention, proatranorin I may be produced by culturing under predetermined conditions a recombinant microorganism into which the atr1 gene consisting of the base sequence of SEQ ID NO: 1 and the atr3 gene consisting of the base sequence of SEQ ID NO: 5 are introduced. At this time, the recombinant microorganism is not limited thereto, but may be phytopathogenic fungus Ascochyta rabiei (As. rabiei).
[0066] In one embodiment of the present invention, proatranorin II and proatranorin III may be produced by culturing under predetermined conditions a recombinant microorganism into which the atr1 gene consisting of the base sequence of SEQ ID NO: 1 and the atr2 gene consisting of the base sequence of SEQ ID NO: 3 are introduced. At this time, the recombinant microorganism is not limited thereto, but may be phytopathogenic fungus Ascochita rabiei (As. rabiei).
[0067] In one embodiment of the present invention, atranorin may be produced by culturing under predetermined conditions a recombinant microorganism into which the atr1 gene consisting of the base sequence of SEQ ID NO: 1, the atr2 gene consisting of the base sequence of SEQ ID NO: 3, and the atr3 gene consisting of the base sequence of SEQ ID NO: 5 are introduced. At this time, the recombinant microorganism is not limited thereto, but may be phytopathogenic fungus Ascochita rabiei (As. rabiei).
Ascochyta rabiei ATR-11 Strain for Producing Atranorin
[0068] As another aspect, the present invention provides Ascochyta rabiei ATR-11 strain (Accession Number: KACC83048BP).
[0069] The term Ascochyta rabiei used in the present specification refers a phytopathogenic fungus that causes chickpea blight, and it is a heterologous host microorganism used to introduce the lichen-derived atranorin biosynthesis gene described above.
[0070] The Ascochyta rabiei ATR-11 strain (Accession Number: KACC83048BP) is a strain for producing atranorin, deposited to the Korean Agricultural Culture Collection (KACC) of the National Institute of Agricultural Sciences on May 28, 2021, with the Accession Number KACC 83048BP.
[0071] Specifically, the Ascochyta rabiei ATR-11 strain is the above-described strain into which an atranorin biosynthesis gene consisting of one or more selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 3, and SEQ ID NO: 5 is introduced, and it is capable of producing atranorin. Atranorin produced from the above strain can be utilized and industrialized in a variety of ways, such as pharmaceutical compositions, food compositions, health functional foods, and feed compositions.
Method of Producing Atranorin Using Ascochyta rabiei ATR-11 Strain
[0072] As another aspect, the present invention provides a method for producing atranorin, including a step of culturing Ascochyta rabiei ATR-11 strain (Accession Number: KACC83048BP).
[0073] The Ascochyta rabiei ATR-11 strain (Accession Number: KACC 83048BP) is as described above.
[0074] The culture conditions of the Ascochyta rabiei ATR-11 strain (Accession Number: KACC 83048BP) may be a temperature of 15 to 25 C. and a culture duration of 7 to 21 days, preferably, a temperature of 18 to 22 C. and a culture duration of 14 to 18 days, but are not particularly limited thereto.
[0075] In addition, culturing of the Ascochyta rabiei ATR-11 strain (Accession Number: KACC 83048BP) may be performed by using a natural medium or synthetic medium including carbon sources, nitrogen sources, inorganic salts, and the like that may be efficiently utilized by the strain. Carbon sources that may be used include carbohydrates such as glucose, fructose, sucrose, soybean powder, peanut powder, wheat flour, corn powder, dextrin, corn meal, and fructose syrup; starch and hydrolysate of starch; organic acids such as acetic acid and propionic acid; alcohols such as ethanol, propanol, and glycerol; and oils such as soybean oil, olive oil, canola oil, peanut oil, and fish oil. Nitrogen sources include ammonia; ammonium salts of inorganic or organic acids such as ammonium chloride, ammonium sulfate, ammonium acetate, and ammonium phosphate; peptone, meat extract, yeast extract, corn steeping liquid, casein hydrolysate, soybean extract, soybean hydrolysate; and various fermented cells and decomposition products thereof. Amino acids include monosodium glutamate, methionine, lysine, leucine, cysteine, and valine. Inorganic salts include potassium dihydrogen phosphate, dipotassium hydrogen phosphate, magnesium phosphate, magnesium sulfate, sodium chloride, manganese sulfate, copper sulfate, calcium carbonate, and the like.
[0076] The pH of the medium is preferably maintained in a range of 3.0 to 9.0 during culture. The pH of the medium may be adjusted with inorganic or organic acids, alkaline solutions, urea, calcium carbonate, ammonia, and the like.
[0077] After culturing the Ascochyta rabiei ATR-11 strain (Accession Number: KACC 83048BP), various known methods may be used to isolate, purify, and recover atranorin therefrom. For example, after removing the bacterial cells by centrifugation, isolation and purification may be performed by appropriate known methods such as salting out, ethanol precipitation, ultrafiltration membrane, gel filtration chromatography, ion exchange column chromatography, or a combination thereof.
[0078] Production of atranorin using the Ascochyta rabiei ATR-11 strain (Accession Number: KACC 83048BP) is suitable for not only lab-scale production but also large-scale production, and thus is to be commercially applied.
[0079] The atranorin may be atranorin derived from a lichen Stereocaulon alpinum but is not limited thereto.
EXAMPLES
[0080] Hereinafter, the constitution and effects of the present invention will be described in more detail through examples. These examples are only for illustrating the present invention, and the scope of the present invention is not limited by these examples.
Example 1: Phylogenomic Analysis
[0081] To infer the phylogeny of the genome-sequenced 29 LFF (Lichen-forming fungi) and an endophytic fungus Cyanodermella asteris, the present inventors pursued a coalescent-based phylogenomic approach. The culture, genome sequencing and annotation procedures for LFF were described in Example 8. Single-copy ortholog clusters (SCOs) of protein sequences deduced from the 30 annotated genomes were identified using OrthoMCL (v2.0.9) (64) with an inflation factor of 2.5. For each of the 393 SCOs, protein sequences were aligned using MAFFT (v7.310) (65) with the auto setting, and the resulting 393 multiple sequence alignments were trimmed for poorly aligned regions using Gblocks (v0.91b) (66) with the parameter: b4=5. The RAML program (v8.2) (67) was used to calculate 100 maximum likelihood trees for each multiple sequence alignment. To generate coalescent-based trees, the present inventors used ASTRAL-III (v5.7.4) (68) with two multi-locus bootstrapping options (site only resampling and gene/site resampling) and with no bootstrapping option. All trees showed the identical topology.
Example 2: Biosynthetic Gene Cluster Family Analysis
[0082] For BGC identification in the 30 genomes, the genome assembly and annotation files were processed by the antiSMASH program (v5.0+), with a parameter setting: --minimal. For genetic dereplication of BGCs found in the six Cladonia spp. and S. alpinum, the present inventors used the BiG-SCAPE program, in reference to the MIBiG database (v1.4). To analyze BGCs containing at least one iterative type I PKS, the present inventors modified a configuration file domain_whitelist.txt to include only Pfam domains related to iterative type I PKS (PF00109 and PF02801) and ran the BiG-SCAPE program with optional arguments: --mix and --hybrids-off. Based on the Jaccard index of domain types, domain sequence similarity, and domain adjacency index, the BiG-SCAPE program calculates a similarity matrix between pairwise combinations of clusters where smaller values indicate greater BGC similarity. The present inventors evaluated BGC networks using an edge-length cutoff from 0.3-0.8 with a step of 0.1 and considered the network using a cutoff value of 0.5 as a representation of GCFs in the six Cladonia spp. and S. alpinum. Individual networks for PKS families were visualized, using a Python package NetworkX (v2.5), in that edge-width was weighted by squared similarity between a pair of BGCs calculated by BiG-SCAPE. The present inventors used the CORASON program that generates a multi-locus, approximately maximum-likelihood, phylogenetic tree of BGCs including PKS families responsible for production of lichen substances. For the PKS23 family, an OMT (Crg06815) in C. rangiferina was used as the query gene to search for homologous BGCs from a total of 1,527 BGCs detected in the 30 sequenced species. For the PKS1 family, a GAL4-type transcription factor (gene ID: Crg07068) in C. rangiferina was used as the query gene.
Example 3: Phylogenetic Analysis of Fungal NR-PKS
[0083] KS domain of iterative type I PKS has been considered evolutionarily conserved, and thus it can serve as a proxy for the similarity of the entire PKS. The present inventors identified a total of 242 PKSs from the genomes of the six Cladonia spp. and S. alpinum, among which four PKSs (Cgr01615, Cgr03964, Cgr08611, and Cmt10189; see Data Set S2) were missing a KS domain. KS domain sequences were extracted from 238 PKSs using the online tool NaPDoS and aligned using MUSCLE (v3.8.31). For clustering analysis, an all-versus-all similarity matrix for KS domains of 238 PKSs was computed using the AlignBuddy function in the BuddySuite program, with an optional argument: -pi. A heatmap showing percent similarity of KS domains clustered by k-means was generated using an R package Superheat. For fungal NR-PKS phylogeny, the present inventors used concatenated protein sequences of KS and PT domains of 103 NR-PKSs found in the six Cladonia spp. and S. alpinum, and 82 NR-PKSs that have been linked to known compounds in non-lichenized fungi. The present inventors initially identified 106 NR-PKSs in the six Cladonia spp. and S. alpinum, including seven NR-PKSs whose full sequences cannot be reliably defined from the current genome assembly (likely pseudogenes). Among these partial PKSs, three NR-PKSs (Cbo04702, Cma06590, and Cmt06606) lacked either KS or PT domain, and were excluded from the phylogenetic analysis. PT domains of lichen NR-PKSs were identified by aligning with those of previously characterized PKSs. A 6-methylsalicylic acid synthase (6MSAS) responsible for the biosynthesis of patulin (UniProtKB: A0A075TRC0) in Penicillium expansum was set to be an outgroup to fungal NR-PKS phylogeny. Also, four 6MSASs found in four Cladonia spp. were included in the analysis (Cbo07291, Cgr05254, Cmt10005, and Cuc03485). Protein sequences of KS and PT domains were aligned using MAFFT (v7.310) with the auto setting, and spurious sequences or poorly aligned regions from each domain were trimmed using the trimAl program (v1.2), with the gappyout parameter. The resulting multiple sequence alignments for KS and PT domains were concatenated with FASconCAT-G (v1.04). From the concatenated sequences, maximum-likelihood trees were computed with RAML (v8.2), using a gamma distribution for substitution rate across sites with a parameter setting: -m PROTGAMMAWAG. Nodal support was evaluated by 1,000 bootstrap replications. The final tree was rooted to the 6MSAS outgroup and annotated by iTOL (v5.7).
Example 4: Generation of a Clean Host from Ascochyta rabiei
[0084] A split-marker strategy was employed to generate a solanapyrone-minus mutant (clean host). A downstream region of the sol1 (1,208 bp) and an upstream region of the sol3 (1,459 bp) were amplified from gDNA of As. rabiei isolate AR628 (39), using L5/L3 and R5/R3 primer pairs, respectively. A hygromycin phosphotransferase gene (hph) cassette was amplified from pCB1004 plasmid, using a primer pair HYG5/HYG3. L3 and R5 primers have 27 nt-long overhang sequences complementary to the 3 and 5 end of the hph cassette, respectively, such that the amplified sol1 downstream and sol3 upstream regions can be fused to the hph cassette by overlap extension PCR. Finally, split marker constructs were amplified from the fused construct, using N5/HY-R and YG-F/N3 primer pairs. The split marker constructs were introduced into protoplasts of As. rabiei by polyethylene glycol-mediated genetic transformation as described in Hallen-Adams et al. Primers used in the gene replacement were listed in Table 1.
[0085] Information on the primers used in the present invention is summarized in Table 1 below.
TABLE-US-00001 TABLE1 Pirmer Sequence(5'-3') No Description Sol1PpDS33 AGATCTCGGCACGTTTTGATCGC 7 sollpromoter _fwd AAAG cloninginto pDS33 Sol1PpDS33 AAGCTTAGTAATATCTGGCGATG 8 sol1promoter _rev AAGCGTCAG cloninginto pDS33 Inf_Sta046 CAGATATTACTAAGCTCATGGCG 9 PKS23cloning 440_fwd TCTAACCATGAGGAG intopDS35 Inf_Sta046 GTAACGTTAAGTGGATCCTTACA 10 PKS23cloning 440_rev ACTAAAGCTCTCAATCAACCC intopDS35 Sta046440 GGACGATGAGAACGTCCTAG 11 PKS23sequencing check1F Sta046440 CGAGTCAGGTGATCCAGTG 12 PKS23sequencing check2F Sta046440 CCAATCATACTGAGCGCTG 13 PKS23sequencing check3F Sta046440 CACATGTCTGTGGCTTGAG 14 PKS23sequencing check4F Sta046440 CAACTCCGGTGATGATTG 15 PKS23sequencing check5F Sta046440 CAACCCTTCCACATATTGAG 16 PKS23sequencing check6F pII99_sol5 GAATTCAGAGCGACAGTGAAAGC 17 so15promoter _fwd cloninginto pII99 pII99_sol5 AGATCTAGCTAGCTTGGCGTGAT 18 so15promoter _rev GTCAGTCAATGCTG cloninginto pII99(NheI enzymesitein bold) pII99_tef1 GAATTCCAGCCGAGACAGCAGAA 19 teflapromoter a_fwd TCAC cloninginto pII99 pII99_tef1 AGATCTAGCTAGCGTGTTATGTT 20 teflapromoter a_rev TTGTGGAATATAAAAGGG cloninginto pII99(NheI enzymesitein bold) Inf95_Sta0 ATCACGCCAAGCTAGCACGATGA 21 atr3cloninginto 4642_fwd CTTCCGTTGATACAATG pII95 Inf98_Sta0 AAACATAACACGCTAGCACGATG 22 atr3cloninginto 4642_fwd ACTTCCGTTGATACAATG pII98 Inf99_Sta0 GGAGACCGGCAGATCCCGTCACA 23 atr3cloninginto 4642_rev TGTCCGTCATAATAAC pI195andpII98 Inf98_Sta0 AAACATAACACGCTAGAACCATG 24 atr2cloninginto 4643_fwd GCTCTCCTAGACACAATTG pII95 Inf95_Sta0 ATCACGCCAAGCTAGAACCATGG 25 atr2cloninginto 4643_fwd CTCTCCTAGACACAATTG pII98 Inf99_Sta0 GGAGACCGGCAGATCGAGGAGCA 26 atr2cloninginto 4643_rev AAGGAACAAGGAACAG pI195andpII98 pII99_MK5 CGTCAAGAGACCTACGAGACTG 27 ReplacingnptII withbleinthe plasmid tefl::atr2/pII98 pII99_MK3 GCTATACTTCTAGGTCTTGGAAG 28 ReplacingnptII AG withbleinthe plasmid tefl::atr2/pII98 Inf_BLE_pI GTAGGTCTCTTGACGCATTAAGA 29 ReplacingnptII I99_fwd CCTCAGCGCTAGTGG withbleinthe plasmid tefl::atr2/pII98 Inf_BLE_pI GACCTAGAAGTATAGCGGTGTTA 30 ReplacingnptII I99_rev CGGAGCATTCACTAGG withbleinthe plasmid tefl::atr2/pII98 L5 GAGGTCTTCACACCACAAGTTCG 31 Generatingclean host L3 GGCAAAGGAATAGAGTAGATGCC 32 Generatingclean GACCGGGCTCTTGCGTAGTGGTA host CAGATG R5 GTTGACCTCCACTAGCTCCAGCC 33 Generatingclean AAGCGAATAGGTAACAAAGCCAG host CCGAG R3 GAGAATTGCGGCGCAGGATGTTC 34 Generatingclean host N5 CTGACTTTCTTCTTGCAGCCCTG 35 Generatingclean C host N3 CTAACGATGTCGTTAGTCGCCTT 36 Generatingclean G host HYG-F GCTTGGCTGGAGCTAGTGGAG 37 Generatingclean host HYG-R CGGTCGGCATCTACTCTATTCCT 38 Generatingclean T host YG-F CGATGTAGGAGGGCGTGGATATG 39 Generatingclean TC host HY-R TGTAGTGTATTGACCGATTCCTT 40 Generatingclean GCG host P1_fwd GGACGATGAGAACGTCCTAG 41 RT-PCRanalysis P1_rev GAGAGTTCCTCATGCTCGTC 42 RT-PCRanalysis P2_fwd CATCGACGACACGGAGATACTG 43 RT-PCRanalysis P2_rev GACCGTGAGATTCTTTGAAGAGG 44 RT-PCRanalysis Actin1_fwd CAATGGTTCGGGTATGTGCAAG 45 RT-PCRanalysis Actin1_rev GAAGAGCGAAACCCTCGTAGAT 46 RT-PCRanalysis
Example 5: Heterologous Expression of the Atr1 and RT-PCR Analysis
[0086] For efficient expression of foreign genes in the clean host, the present inventors constructed expression vectors that carry either the sol1 gene promoter (pDS35), the sol5 gene promoter (pII95), or translation elongation factor 1 alpha gene promoter (pII98). Then, the atr1, atr2 and atr3 genes were individually cloned to the expression vectors. Details on expression vector construction and cloning procedures are described in Text S1. For heterologous expression of the atr1, the sol1::atr1/pDS35 plasmid (5-10 g) was used to transform the clean host. Putative transformants were subcultured on potato dextrose agar (PDA; BD Biosciences) containing 100 g/ml of nourseothricin sulfate (clonNAT; GoldBio). Two transformants, designated as Sta04644-T16 and Sta04644-T25, exhibited resistant to the selective agent, and were subcultured on PDA overlaid with a nylon membrane for RNA extraction. After two weeks of culture, mycelia growing on PDA were scraped off from the nylon membrane with a single-edge razor blade and were subjected to total RNA extraction. Total RNA was extracted from hyphae ground in liquid nitrogen, using TRIzol reagent (Thermo Fisher Scientific), according to the manufacturer's instruction, with additional extraction steps: one phenol (pH 4.6)-chloroform-isoamyl alcohol (25:24:1) extraction followed by one chloroform extraction step after the initial TRIzol-chloroform phase separation. RNA pellets were dissolved in 88 L of nuclease-free water and subjected to genomic DNA digestion by DNase treatment (Qiagen). Then, RNA samples were concentrated using the RNA Clean & Concentrator (Zymo research). The present inventors confirmed expression and intron splicing of the atr1 with four introns in RT-PCR analysis. Two primer sets were designed: (i) to amplify a flanking region of the first intron located at the 5 region of the atr1 coding sequence, and (ii) to amplify a region harboring the second, third and fourth (the last) introns at the 3 region of the atr1 coding sequence. Two hundred nanogram of total RNA was reverse-transcribed, and the atr1 and actin1 (as a positive control) were amplified, using a OneStep RT-PCR kit (Qiagen). Primers used in RT-PCR analysis and plasmid constructions were listed in the above Table 1.
Example 6: Generation of a Heterologous Host Producing Atranorin
[0087] For introduction of tailoring enzymes into a atr1-expressing strain (Sta04644-T25), the four resulting plasmids (sol5::atr2/pII95, tef1::atr2/pII98, sol5::atr3/pII95, and tef1::atr3/pII98) were individually transformed into the Sta04644-T25 strain, and putative transformants were subcultured on PDA containing 200 g/ml of G418 disulfate (Sigma-Aldrich). Transformants resistant to G418 disulfate were selected for metabolite identification. A strain harboring both sol1::atr1/pDS35 and sol5::atr3/pII95 was used for the generation of an atranorin-producing strain, which exhibited the greatest production of compound 2(proatranorin), the immediate precursor of atranorin. Since a neomycin phosphotransferase II gene (nptII) cassette that confer resistance to G418 disulfate was already integrated into the strain producing compound 2, the present inventors replaced the nptII cassette in the tef1::atr2/pII98 plasmid with a bleomycin resistant protein gene (ble), the tef1::atr2/pII98 plasmid was amplified using a primer pair Inf_BLE_pII99_fwd and Inf_BLE_pII99_rev, and the ble was amplified from pAC1750. Then, the two PCR products were fused, using the In-Fusion HD Cloning Kit (Takara). The resulting plasmid was transformed into the strain producing compound 2, and putative transformants were subcultured on PDA containing 200 g/ml of Zeocin (a member of bleomycin family distributed by Thermo Fisher Scientific).
[0088] To select transformants that produce atranorin, the chemical profile of transformants resistant to Zeocin were compared to that of a S. alpinum voucher specimen (the Korea National Arboretum accession: KHL0017342) from which the genome-sequenced LFF had been originally isolated. Detailed methodologies for HPLC, LC-MS/MS, and NMR spectroscopic analyses for culture extracts and purified compounds were fully described in Examples 11 to 13.
Example 7: Data Availability
[0089] This whole genome shotgun project has been deposited at DDBJ/ENA/GenBank under accessions, JAFEKC000000000, JAEUBB000000000, and JAEUBA000000000 (BioProject: PRJNA693578, PRJNA693575, and PRJNA693574) for C. borealis, Parmelia cf. squarrosa, and S. alpinum, respectively. Raw LC-MS/MS data were deposited at the MassIVE database (http://massive.ucsd.edu) under the accession no. MSV000087081).
Example 8: Genome Sequencing and Annotation
[0090] LFF were isolated from C. borealis and S. alpinum collected from the King George Island, Antarctica (S621351 W584632) and Parmelia cf. squarrosa collected from Mt. Deogyu, South Korea (N355124 E1274454). The LFF were cultured for 3-6 months on malt extract agar media (BD Biosciences). Genomic DNAs were extracted using a standard phenol/chloroform extraction method and were sequenced on an Illumina HiSeq2000 or NovaSeq6000 instrument, generating 150 nucleotide paired-end reads. Illumina adaptors were trimmed, read quality was assessed, and contigs were assembled at Macrogen Inc. (Seoul, South Korea). Details on genome assembly statistics, including previously sequenced genomes, were provided in Data Set S1 in the supplemental material. The genome assemblies retrieved from the NCBI database were annotated using GenSAS (v.6.0) annotation pipeline. Default settings were used unless otherwise noted. In brief, low complexity regions and repeats were masked using RepeatModeler (v1.0.11) and RepeatMasker (v4.0.7) (www.repeatmasker.org), setting the DNA source to Fungi. A masked consensus sequence was generated on which ab initio gene prediction was performed using the following tools: (i) Augustus (v3.3.1), selecting A. nidulans as a trained organism, (ii) GeneMarkES (v4.33), (iii) Genscan (v1.0), using a parameter setting for Human and other vertebrates, and (iv) GlimmerM (v2.5.1), selecting Aspergillus as a trained organism. For homology-based prediction, the NCBI reference transcript and protein databases for Fungi were searched, using (v) BLAST+ (v2.7.1) and (vi) DIAMOND (v0.9.22), respectively. For the consensus gene model prediction using EVidenceModeler (v06-25-2012), the above-mentioned standalone gene predictions were weighted as follows: (i)-five, (ii)-ten, (iii)-one, (iv)-one, (v)-five, and (vi)-five. The genome annotations were assessed with BUSCO (v5b) using the Ascomycota_odb9 data set.
Example 9: Expression Vector Construction for PKS Expression
[0091] The pDS23 plasmid carries a nourseothricin acetyltransferase gene (nat) cassette as a selection marker and an enhanced green fluorescent protein (eGFP) under the control of the constitutive promoter of glyceraldehyde-3-phosphate dehydrogenase gene (G3PD) derived from Aspergillus nidulans. To replace the G3PD promoter with multiple cloning sites in pDS23, the plasmid was linearized by AvrII and HindIII restriction enzymes, and a synthetic DNA (57-bp long) harboring several restriction enzyme sites (NheI, AatII, SacI, PmeI, BglII, and SacII) was cloned between the AvrII and HindIII sites of the plasmid. The resulting plasmid was named pDS33. To generate an expression vector that carries a native promoter of As. rabiei, the 1,270-bp DNA fragment containing the sol1 (encoding solanapyrone synthase) gene promoter amplified from gDNA of As. rabiei isolate AR628 was cloned to pDS33 precut with BglII and HindIII, yielding the pDS35 plasmid. The coding sequence of atr1 (Sta04644; see Data Set S2 in the supplemental material) was amplified with a primer pair Inf Sta046440 fwd and Inf Sta046440 rev (7,829 bp) and cloned to the pDS35 linearized by HindIII and BamHI, in replace of eGFP, using the In-Fusion HD Cloning Kit (Takara), which resulted in the plasmid sol1::atr1/pDS35.
Example 10: Expression Vector Construction for Tailoring Enzyme Expression
[0092] The pII99 plasmid carries a neomycin phosphotransferase II gene (nptII) cassette as a selection marker. To generate an expression vector that carries the promoter of the sol5 (encoding a Diels-Alderase that catalyzes the last step of solanapyrone biosynthesis), the 579-bp DNA fragment containing the sol5 promoter amplified from gDNA of As. rabiei AR628 strain was cloned to pII99 precut with EcoRI and BglII, yielding the pII95 plasmid. To introduce an additional restriction enzyme site, the revere primer for the sol5 promoter amplification was designed to have NheI site (see Table 1). The pII95 plasmid was digested with NheI and BglII, and the PCR products of the atr3 (Sta04642) or atr2 (Sta04643) amplified from gDNA of S. alpinum was fused to the precut plasmid, resulting in the plasmids, sol5::atr3/pII95 and sol5::atr2/pII95. Similarly, to generate an expression vector that carries the constitutive promoter of translation elongation factor 1 alpha gene (tef1) derived from A. nidulans, the plasmid pII98 was generated by cloning the 880-bp DNA fragment containing the tef1 promoter amplified from the pAC1750 plasmid into pII99, and the coding sequences plus terminator regions of the atr3 and atr2 were individually fused into the pII98 precut with NheI and BglII, generating the plasmids, tef1::atr3/pII98 and tef1::atr2/pII98.
Example 11: HPLC Analysis and Metabolite Purification
[0093] For metabolite extraction and profiling, transformants were grown on PDA for 2-3 weeks and the whole agar containing fungal colony was excised from the Petri dish and soaked into 10 ml of ethyl acetate in a 50 ml falcon tube. After sonication for 30 min, an aliquot of 1 ml of solution was transferred to a 1.5 ml microcentrifuge tube, evaporated to dryness, reconstituted with 100 l of methanol, and subjected to a high-performance liquid chromatography (HPLC) analysis. Pieces of the S. alpinum voucher specimen (20-30 mg) were soaked into 300 l of acetone in a 2 ml microcentrifuge tube. After sonication for 30 min, the sample was filtered through 0.4 mm syringe membrane before injection to HPLC. Chemical profiling of transformants was performed using a Prominence Modular LC-20A HPLC instrument (Shimadzu). The samples were analyzed using a YMC-Pack ODS-A (column size, 1504.6 mm; particle size, 5 m; pore size, 12 nm; at 40 C.) and using a photodiode array detector at 254 nm (SPD-M20A, range 180-700 nm). The mobile phase was composed of distilled water/trifluoroacetic acid (99.9:0.1, v/v) for pump A and methanol/trifluoroacetic acid (99.9:0.1, v/v) for pump B. The HPLC analysis was performed using a gradient program at a flow rate of 1.0 ml/min: 0-30 min, 20-100%; 30-40 min, 100%; 40-52 min, 20% of pump B. The present inventors used the lichen substance database for HPLC analysis to identify metabolites found in lichen specimens (15). For structural identification, the present inventors purified compounds 1, 2, and 4 from culture extracts of transformants producing the compounds as major metabolites. Twenty PDA cultures were extracted three times with ethyl acetate. Culture extracts were evaporated to dryness on a Rotavapor (Buchi), reconstituted with methanol, and subjected to preparative HPLC. Separation was achieved on a HPLC at a flow rate of 2.2 ml/min, using the Kromasil C18-column (25010 mm, 5 m, 10 nm; at 40 C.), with UV monitoring at 254 nm. The compound 1 was purified using 66% acetonitrile (tR=9.86 min; 9.5 mg); compound 2 was purified using 85% acetonitrile (t.sub.R=9.77 min; 6.2 mg); compound 4 was purified using 80% acetonitrile (tR=9.60 min; 2.1 mg). Solvents were buffered with 0.1% trifluoroacetic acid. The purified compounds were subjected to NMR spectroscopic analyses.
Example 12: LC-MS/MS Analysis for Identifying Products
[0094] Culture extracts were 20-folds diluted with methanol and filtered with a 0.22 m PTFE filter. The LC-MS analysis was performed on a Waters Acquity I-Class UPLC system coupled to a Waters VION IMS QTOF mass spectrometer (Waters Co.), which was equipped with an electrospray ionization interface. The mobile phase was comprised of 0.1% formic acid in water (pump A) and acetonitrile (pump B). A stepwise gradient method at a constant flow rate of 0.3 ml/min was used to elute the column with the following conditions: 20-100% of pump B (0-9 min), followed by 3 min of washing and 3 min of reconditioning. The injection volume was 2 l. The column temperature and sample organizer were maintained at 40 C. and 20 C., respectively. Tandem MS analyses were performed in data-independent acquisition (MS.sup.E), negative ion mode with the m/z 50-1500 Da range and acquisition times of 0.2 s. The low collision energy for the detection of the precursor ions was set to 6 eV, while the high collision energy for fragmentation was set to 20-40 eV. The ionization conditions were set as follows: the capillary voltage was 2.5 kV, the cone voltage was 40 V, the source temperature was 100 C., the desolvation temperature was 250 C., the cone gas flow was 0 l/h, and the desolvation gas flow was 800 l/h. High-purity nitrogen was used as the nebulizer and auxiliary gas, and argon was used as the collision gas. The [M-H].sup. ion of leucine enkephalin at m/z 554.2615 was used as the lock mass to ensure mass accuracy and reproducibility. MS/MS spectral data matching of major compounds detected in transformants was performed by the feature-based molecular networking workflow in GNPS after the preprocessing using MS-DIAL.
Example 13: NMR Spectroscopic Data Summary
13-1: 4-O-demethylbarbatic acid (Compound 1)
[0095] .sup.1H NMR (400 MHz, CD.sub.3COCD.sub.3): .sub.H 11.65 (s, OH), 6.73 (s, 1H), 6.47 (s, 1H), 2.68 (s, 3H), 2.63 (s, 3H), 2.12 ( s, 3H2); .sup.13C NMR (100 MHz, CD.sub.3COCD.sub.3): .sub.C 170.4, 164.0, 163.3, 160.6, 153.0, 140.9, 140.7, 116.7, 116.6, 111.3, 109.6, 109.2, 103.6, 23.8, 23.1, 8.6, 7.3; .sup.13C NMR signals for carboxyl group were not observed or very-low-intensity maybe owing to the long relaxation times of these carbon nuclei, .sub.C of carboxyl group was 174.1 in published data. The 1H NMR and .sup.13C NMR data were comparable to published data. HRESIMS m/z 345.0972 [M-H].sup. (calcd. for C.sub.18H.sub.17O.sub.7, 345.0974); the MS/MS spectrum is deposited in the GNPS spectral library.
13-2: Proatranorin I (Compound 2)
[0096] .sup.1H NMR (400 MHz, CDCl.sub.3): .sub.H 11.90 (s, OH), 11.70 (s, OH), 6.50 (s, 1H), 6.29 (s, 1H), 3.96 (s, 3H), 2.60 (s, 3H), 2.52 (s, 3H), 2.12 (s, 3H), 2.07 (s, 3H); .sup.13C NMR (100 MHz, CDCl.sub.3): .sub.C 172.4, 170.3, 164.2, 162.9, 159.0, 152.6, 140.7, 139.8, 117.0, 116.4, 111.2, 110.1, 109.0, 104.2, 52.3, 24.6, 24.1, 9.4, 7.7; 1H NMR (400 MHz, CDCl.sub.3) data was comparable to published data; .sup.13C NMR (100 MHz, CDCl.sub.3) data was comparable to 4-O-demethylbarbatic acid (Compound 1) data, except that there was one more oxygen-methyl carbon (.sub.C 52.3) in compound 2. HRESIMS m/z 359.1132 [M-H].sup. (calcd. for C.sub.19H.sub.19O.sub.7, 359.1131); the MS/MS spectrum is deposited in the GNPS spectral library.
13-3: Proatranorin III (Compound 4)
[0097] .sup.1H NMR (400 MHz, CDCl.sub.3): .sub.H 12.54 (s, OH), 12.45 (s, OH), 11.77(s, OH), 10.35(s, CHO), 6.54 (s, 1H), 6.40 (s, 1H), 2.68 (s, 3H), 2.59 (s, 3H), 2.08 (s, 3H); 1H NMR (400 MHz, CDCl.sub.3) data was comparable to published data of atranorin (Compound 5), except that there was missing a methyl group (.sub.H 3.99) at the carboxyl group in (Compound 4). HRESIMS m/z 359.0771 [M-H].sup. (calcd. for C18H15O8, 359.0767); the MS/MS spectrum is deposited in the GNPS spectral library.
Example 14: PKS Families in the Genus Cladonia
[0098] Forty-five gene cluster families (GCFs) including at least one iterative type I PKS gene were identified, using the Big-SCAPE program. Biosynthetic gene clusters (BGCs) of PKS1, PKS2, PKS4, PKS5, PKS15 and PKS16 families were conserved in the six Cladonia species plus S. alpinum, and BGCs of PKS3 and PKS10 families were conserved in the six Cladonia species. Previously, Timsina et al. identified thirteen PKS families conserved in species in the Cladonia chlorophaea species complex (PKS1, PKS2, PKS3, PKS5, PKS7, PKS10, PKS11, PKS12, PKS13, PKS14, PKS15, PKS16 and MSAS). The present inventors also identified these PKS families in our gene cluster network analysis (
Example 15: Genetic Dereplication of Cladonia BGCs (Biosynthetic Gene Clusters)
[0099] To link unknown biosynthetic gene clusters in the six Cladonia spp. and S. alpinum to known compounds in other fungi, GCFs predicted by the Big-SCAPE program were coupled to previously characterized BGCs deposited in the MIBiG (Minimal Information about a Biosynthetic Gene cluster) database (v.1.4). As a result, eight GCFs and seven singleton BGCs were linked to known BGCs found in non-lichenized fungi (
Example 15-1: PKS8
[0100] The PKS8, also known as methylphloroacetophenone synthase (MPAS) in C. uncialis, is known to be involved in biosynthesis of usnic acid, based on phylogenetic analysis and gene expression study. A GCF of the PKS8/MPAS family is shared by C. borealis, C. metacorallifera, C. rangiferina, and C. uncialis. However, among these four Cladonia species, usnic acid has not been detected in C. rangiferina.
Example 15-2: PKS14
[0101] The putative 6-hydroxymellein BGC found in C. uncialis (BGC0001489) formed a GCF with PKS14 BGCs in C. borealis and C. grayi. The roles of the gene members of the 6-hydroxymellein BGC were tentatively assigned based on the terrein biosynthetic pathway, in which terA and terB act in concert to biosynthesize 6-hydroxymellein in A. terreus. In the present inventor's network analysis, the terrein BGC (MIBiG accession: BGC0000161) was not linked to the 6-hydroxymellein BGCs in the three Cladonia species, likely due to gene content variation observed between them; only three genes (terA, terB and terD) among the eleven gene members of the terrein BGC in A. terreus were conserved in the 6-hydroxymellein BGCs in the three Cladonia species.
Example 15-3: PKS13 PKS15
[0102] BGCs of the PKS15 family conserved in the six Cladonia spp. and S. alpinum were linked to many previously characterized BGCs including a 1,3,6,8-tetrahydroxynaphthalene (T4HN) synthase responsible for melanin production in diverse fungi. For brevity,
Example 15-4: PKS16
[0103] The putative grayanic BGC found in C. grayi (BGC0001266) is conserved in the six Cladonia spp. and S. alpinum. The PKS16 BGC was proposed to produce orsellinic acid-derived grayanic acid (a depsidone) that is found in C. grayi.
Example 15-5: PKS17
[0104] A GCF of the PKS17 family, shared by C. borealis, C. macilenta and C. metacorallifera, was linked to a BGC (BGC0001583) for the biosynthesis of emodin, an anthraquinone produced by many different fungi. In addition to the four core enzymes (an NR-PKS, metallo--lactamase, decarboxylase and anthrone oxygenase) that are necessary and sufficient for emodin biosynthesis, a few more tailoring enzymes including a cytochrome P450 monooxygenase were found in the homologous Cladonia BGCs. The P450 monooxygenase showed 39% sequence identity with the ClaM that mediates the coupling of two emodin derivatives in Cladosporium fulvum, suggesting that the P450 enzyme may be involved in biosynthesis of skyrin. Intriguingly, another BGC harboring the four core genes for emodin biosynthesis was found in the genome of C. macilenta, although in different arrangement with the PKS17 BGCs. This second BGC inC. macilenta for putative emodin biosynthesis formed a GCF with the PKS18 BGC in C. uncialis, which was homologous to the BGC of pestheic acid, an emodin derivative, found in Pestalotiopsis fici.
Example 15-6: PKS34
[0105] A GCF of the PKS34 family shared byC. macilenta and C. metacorallifera was linked to a BGC (BGC0001242) for the biosynthesis of fusarubin, the red mycelial pigment produced by Fusarium fujikuroi. However, the BGC contents were highly variable; only putative homologs of fsr1 (encoding an NR-PKS), fsr4 (encoding an alcohol dehydrogenase) and fsr5 (encoding a short-chain dehydrogenase) in the fusarubin BGC can be found in the PKS34 BGCs.
Example 15-7: PKS37
[0106] The patulin BGC (BGC0000120) in Penicillium expansum was connected to a GCF of the PKS37 family shared by C. borealis, C. metacorallifera and C. uncialis. Among the 15 gene members of the patulin BGC, ten genes homologous to patF-patO can be found in the three Cladonia spp. (except for patF in C. borealis), which are necessary for the biosynthesis of neopatulin, the immediate precursor of patulin. Homologs of patD and patE responsible for the final conversion of neopatulin to patulin were absent in the Cladonia genomes. Instead, other tailoring enzymes found were an epimerase in C. metacorallifera and C. uncialis, a TauD-like dioxygenase in C. borealis and C. uncialis, and two short chain dehydrogenases in C. uncialis.
BGC Example 16: Singleton BGCs Connected to the MIBiG Database
[0107] Several previously characterized BGCs were connected to BGCs found in a single species (singleton BGCs). These singleton BGCs tend to exhibit little gene content variation and high sequence similarity to corresponding BGCs found in non-lichenized fungi, suggesting recent introductions of these BGCs into lichens. These likely horizontally transferred BGCs from non-lichenized fungi were as follows: the sorbicillin BGC (BGC0001404) linked to a BGC inC. macilenta, the terreic acid BGC (BGC0000160) linked to a BGC in C. grayi, the hypothemycin BGC (BGC0000076) linked to a BGC in C. rangiferina, the curvupallides BGC (BGC0001563) linked to a BGC in C. uncialis, and the depudecin BGC (BGC0000046) linked to a BGC in S. alpinum. The monascorubrin BGC (BGC0000099) and betaenones BGC (BGC0001264) were also connected to BGCs in C. uncialis in the present inventors' network analysis, as well as in an earlier study on homology mapping of C. uncialis PKSs.
Example 17: Notes on Homology Mapping of Cladonia PKS Families
Example 17-1: Homology Mapping of Conserved Lichen PKS Families
[0108] Although gene cluster network analysis ascribed many lichen BGCs to known compounds with high likelihood, there may be more homologous BGCs that were not connected to previously characterized BGCs in non-lichenized fungi, due to high gene content variations. Therefore, the present inventors performed BLAST searches of 45 PKS families against the NCBI non-redundant protein sequences database to identify Cladonia PKS families homologous to PKS genes with known compounds.
Example 17-2: PKS4
[0109] The PKS4 family encodes an R-PKS enzyme conserved in the six Cladonia spp. and S. alpinum. The PKS4 family can be found in lichenized and non-lichenized fungi and appears to have undergone co-evolution with the physically-associated type III PKS.
Example 17-3: PKS5
[0110] The PKS5 family was conserved in the six Cladonia spp. and S. alpinum, encoding a PKS-NRPS hybrid enzyme that showed a high sequence similarity to the xenolozoyenone PKS in Glarea lozoyensis (39) (56% at protein sequence level). Homologs of the PKS5 family can be found in diverse fungi (39). Interestingly, two tandem genes encoding R-PKS and NRPS enzymes for the xenolozoyenone biosynthesis in G. lozoyensis are co-transcribed into one dicistronic mRNA under the control of the same promoter. Thus, it needs to be examined whether the PKS5 family in lichens also encodes two separate polypeptides for R-PKS and NRPS enzymes or a single peptide for a PKS-NRPS hybrid enzyme.
Example 17-4: PKS9
[0111] The PKS9 family was shared by C. borealis, C. macilenta, C. metacorallifera and C. uncialis, which is similar to an NR-PKS (MpaC) responsible for the biosynthesis of mycophenolic acid derived from 5-methylorsellinic acid in Penicillium brevicompactum (44% protein sequence identity), as described in a previous homology mapping study. Also, the PKS9 family showed 43-45% protein sequence identity to NR-PKSs (AdrD, AndM, AusA, NvfA, PrhL and Trt4) involved in the biosynthesis of meroterpenoids derived from 3,5-dimethylorsellinic acid in Aspergillus and Penicillium species. However, the PKS9 BGCs in the Cladonia genomes lacked biosynthetic genes related to terpene biosynthesis, such as prenyltransferase and terpene cyclase.
Example 17-5: PKS18
[0112] The PKS18 family shared by inC. macilenta and C. uncialis showed 64-68% protein sequence identity to an NR-PKS (PtaA) involved in the biosynthesis of pestheic acid, an emodin derivative, in Pestalotiopsis fici, as described in a previous homology mapping study.
Example 17-6: PKS21
[0113] A purple pigment biruloquinone was first discovered in a foliose lichen Parmelia birulae. Although biruloquinone has not been found in Cladonia species in nature, the present inventors previously identified a chemical variant of the genome-sequenced mycobiont isolated from C. macilenta, producing biruloquinone in axenic culture. The present inventors tentatively assigned the PKS21 family to the biosynthesis of biruloquinone by the whole-transcriptome comparison between the biruloquinone producer and non-producer.
Example 17-7: PKS22
[0114] A red pigment cristazarin, a naphthazarin derivative, was originally identified from a mycobiont culture of C. cristatella. The present inventors established an optimum culture condition for cristazarin production in a mycobiont isolated from the genome-sequenced C. metacorallifera and ascribed the PKS22 family to the biosynthesis of cristazarin, based on the observation that the PKS23 was highly upregulated in cristazarin-inducing conditions in C. metacorallifera.
Example 17-8: PKS24
[0115] The PKS24 family was shared by C. borealis, C. macilenta, C. metacorallifera and S. alpinum. The PKS24 BGC in C. metacorallifera was slightly different from the ones in the other three species, with a fragmented PKS24 gene. The PKS24 family formed a monophyletic clade maximally supported by 100% bootstrap with FgPKS14 involved in orsellinic acid biosynthesis in Fusarium graminearum, showing 46-48% protein sequence identity to FgPKS14 (
Example 17-9: PKS30
[0116] The PKS30 family showed 52-53% protein sequence identity to an NR-PKS (wA) responsible for the biosynthesis of the conidial yellow pigment (aka. YWA1), a naphthopyrone produced by A. nidulans. The PKS30 BGCs conserved in C. borealis, C. macilenta, C. metacorallifera and C. uncialis are likely involved in the biosynthesis of the red apothecial pigment, rhodocladonic acid, albeit the pigment has not been detected in C. uncialis. There were only two GCFs (the PKS21 and PKS30 families) shared by the three red apothecial pigment producers, C. borealis, C. macilenta and C. metacorallifera. The PKS21 and PKS30 families belong to the NR-PKS Groups III and IV, respectively, which include NR-PKSs involved in the biosynthesis of naphthopyrone-derived compounds (
Example 17-10: PkeA
[0117] BGCs shared by C. borealis and C. metacorallifera included an NR-PKS showing 63-65% protein sequence identity to PKeA (also known as DbaI) responsible for the biosynthesis of felinones in A. nidulans. The present inventors refrained from assigning a PKS family number for the NR-PKSs homologous to PkeA/DbaI, as these PKS genes appear to have arisen through horizontal transfer and may be specific to a certain lineage of Cladonia, as with the other Cladonia NR-PKSs that belong to the Group VII (e.g., sorbicillin BGC in C. macilenta).
Example 18: Metabolic Potentials of Lichen
[0118] To examine evolutionary relationships of LFF and compare their genome-encoded metabolic potentials, a coalescent-based tree of 393 single-copy orthologous genes was reconstructed, using eight genomes that we have sequenced and 22 genome assemblies available in the NCBI database and JGI website, as of September 2020. A majority of the sequenced species (26 out of 30) belong to the Lecanoromycetes and four LFF were placed outside of the Lecanoromycetes: Arthonia radiata (Arthoniomycetes), Endocarpon pusillum (Eurotiomycetes), Sclerophora sanguinea (Coniocybomycetes) and Viridothelium virens (Dothideomycetes). Barring the genomes of Alectoria sarmentosa and Cetradonia linearis, completeness of the genomes assessed by BUSCO analysis was greater than 91% (
[0119] Table 2 below summarizes the lichen materials reported in the genome-sequence analysis of 30 species.
TABLE-US-00002 TABLE 2 speices Lichen substances Cladonia macilenta barbatic acid, didymic acid Cladonia metacorallifera thamnolic acid), usnic acid, didymic acid Cladonia borealis barbatic acid, usnic acid Cladonia uncialis squamatic acid, usnic acid Cladonia rangiferina atranorin, fumaprotocetraric acid Cladonia grayi grayanic acid, fumaprotocetraric acid Cetradonia linearis Stereocaulon alpinum lobaric acid, atranorin, stictic acid Letharia lupina atranorin, norstictic acid Letharia columbiana atranorin Pseudevernia furfuracea olivetoric acid, physodic acid, atranorin/ chloroatranorin Alectoria sarmentosa alectoronic acid, usnic acid Evernia prunastri lecanoric acid/evernic acid, physodic acid, atranorin/chloroatranorin, salazinic acid, usnic acid Parmelia sp. atranorin/chloroatranorin, salazinic acid KoRLI021559 Usnea florida thamnolic acid, norstictic acid/salazinic acid, usnic acid Usnea hakonensis usnic acid Ramalina intermedia sekikaic acid, atranorin, usnic acid Ramalina peruviana sekikaic acid, usnic acid Xanthoria parietina parietin/fallacinol/parietinic acid/emodin Xanthoria elegans parietin Gyalolechia flavorubescens parietin/fallacinol/fragilin/emodin Lobaria pulmonaria gyrophoric acid, atranorin, norstictic acid/ salazinic acid Umbilicaria pustulata lecanoric acid/gyrophoric acid/umbilicaric acid, skyrin Umbilicaria hispanica lecanoric acid/gyrophoric acid/umbilicaric acid, skyrin Umbilicaria muehlenbergii lecanoric acid/gyrophoric acid Cyanodermella asteris skyrin Sclerophora sanguinea Arthonia radiata Not detected Viridothelium virens lichexanthone Endocarpon pusillum
Example 19: Genetic Dereplication of Cladonia PKSs
[0120] To search for PKS genes involved in biosynthesis of lichen polyketides, namely depside and depsidone series compounds, the present inventors focused on 226 BGCs harboring at least one PKS in the six Cladonia spp. plus a related Antarctic lichen S. alpinum, from which a total of 242 PKSs were identified. The present inventors first conducted clustering analysis of the conserved ketosynthase (KS) domains of each PKS and identified a number of clusters that are suggestive of homologous relationships. Twelve PKS families described in an earlier study on the Cladonia chlorophaea species complex were also detected in our clustering analysis, indicating that a significant proportion of PKS genes are conserved in the genus Cladonia. However, little is known about their products. Therefore, the present inventors linked BGCs to known compounds in non-lichenized fungi, using the Big-SCAPE program that maps BGC diversity onto sequence similarity networks. The network analysis was used to graphically summarize three attributes of BGCs: (i) PKS families associated with the network (numbers), (ii) species distribution across the network (nodes), and (iii) degrees of similarity between pairs of BGCs (edges) (
Example 20: Identification of Putative Atranorin BGC
[0121] The gene cluster network analysis in the six Cladonia spp. and S. alpinum revealed that the PKS23 family among the 45 GCFs may be involved in biosynthesis of atranorin, the major cortical substance of diverse macrolichens, as it was the sole GCF shared by the two atranorin producers, C. rangiferina and S. alpinum (
[0122] Table 3 below summarizes the information on the PKS23 biosynthetic gene cluster of Cladonia rangiferina.
TABLE-US-00003 TABLE 3 Iden- ORFa Size BLASTP tity Conserved E- (Crg) (aa) homolog.sup.b (%) domain value 06811 744 MFS mono- 71 Sugar transporter 1e105 saccharide (Pfam00083) transporter 06812 306 export control 68 chitin synthase 1e131 protein) CHS7- III catalytic like subunit (Pfam12271) 06813 495 TFIIH complex 58 TFIIH complex 1e82 p47 subunit subunit Ssl1-like (Pfam04056) 06814 549 MES multidrug 50 major facilitator 9e31 transporter superfamily (atr4) (Pfam07690) 06815 346 Trt5, O- 37 SAM- dependent 1e04 methyl- methyltransferase transferase (Pfam08241) (atr3) 06816 508 Cytochrome 43 Cytochrome P450 3e57 P450 (Pfam00067) monooxygenase (atr2) 06817 2,513 non-reducing 44 SAT-KS-AT-PT- polyketide ACP-MT-TE synthase (atr1) 06818 472 hypothetical 33 phospho- 4e08 protein transferase enzyme family (Pfam01636) 06819 2,377 reducing 40 KS-AT-DH-ER- polyketide KR-ACP synthase (R-PKS) 06820 184 hypothetical 40 domain of 5e22 protein unknown function, DUF3237 (Pfam11578) 06821 301 hypothetical 34 domain of 2e09 protein unknown function, DUF2306 (Pfam10067) 06822 236 hypothetical 28 (not detected) protein 06823 356 hypothetical 32 (not detected) protein 06824 565 putative 41 flavin-binding 3e14 dimethylaniline monooxygenase- monooxygenase like (Pfam00743) aORF: Open reading frame of C. rangiferina); the synthetic core genes are highlighted in. .sup.bFor BLAST searches, the NCBI non-redundant protein sequence database for four Aspergillus species is used: Aspergillus fumigatus (taxid: 746128), A. nidulans (taxid: 162425), A. niger (taxid: 5061), and A. terreus (taxid: 33178).
[0123] To examine presence of conversed PKS23 BGCs in other lichens that produce atranorin, the present inventors adopted the CORASON pipeline that is useful for studying conservation and variation of BGCs within and across GCFs. The protein sequence of the OMT in the PKS23 BGC in C. rangiferina was queried against a total of 1,527 BGCs detected in the 30 genomes. The present inventors identified 15 BGCs each harboring an OMT that showed a significant hit (>33% protein sequence identity) (
Example 21: Reconstruction of Atranorin Biosynthetic Pathway
[0124] Despite arduous efforts made for heterologous expression of lichen PKS genes in well-established heterologous hosts, such as A. nidulans and A. oryzae, the attempts were unsuccessful for yet-unknown reasons (11, 23). Thus, the present inventors set out to establish a new heterologous expression system, using a plant pathogenic fungus Ascochyta rabiei (Dothideomycetes). On the basis of the chemical structure and the predicted functions of three biosynthetic genes in putative atranorin BGCs, a polyketide pathway for atranorin can be envisioned (
[0125] As the biosynthesis of atranorin from compound 1 requires oxidation of a methyl group and methylation of the carboxyl group within each of the two 3MOA units (
Example 22: a Novel Phylogenetic Clade of PKS Responsible for Biosynthesis of Lichen Substances
[0126] To study the evolutionary relationships of fungal NR-PKS and the Atr1 responsible for atranorin production, the present inventors reconstructed a phylogenetic tree of the concatenated sequences of conserved KS and product template (PT) domains of 103 NR-PKSs found in the six Cladonia spp. and S. alpinum, and 82 NR-PKSs that have been linked to known compounds in non-lichenized fungi. Fungal NR-PKSs were hitherto largely classified into eight groups (Groups I-VIII) in previous phylogenetic analyses (7, 8, 42-44). Here, the present inventors identified a novel NR-PKS group (Group IX) supported by 100% bootstrap, which contained the PKS23 family as well as the PKS1 and PKS2 families (
ACCESSION NUMBER
[0127] Depository institution: Korea Agricultural and Biotechnology [0128] Research Institute (KACC) [0129] Accession number: KACC83048BP [0130] Accession date: May 28, 2021