APPLICATIONS OF O2-INSENSITIVE FORMATE DEHYDROGENASE
20250357519 ยท 2025-11-20
Assignee
Inventors
Cpc classification
C12P3/00
CHEMISTRY; METALLURGY
H01M2250/30
ELECTRICITY
H01M8/16
ELECTRICITY
C12N11/02
CHEMISTRY; METALLURGY
Y02E60/50
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
International classification
H01M8/16
ELECTRICITY
C12N11/02
CHEMISTRY; METALLURGY
C12P3/00
CHEMISTRY; METALLURGY
Abstract
Disclosed are methods and apparatuses utilizing an O.sub.2-insensitive FDH2 from the sulfate-reducing bacterium (SRB) Desulfovibrio vulgaris Hildenborough (DvH). The O.sub.2-insensitive FDH2 may be applied to a biofuel cell for generating electricity and generating hydrogen peroxide. The biofuel cell can also be applied to wearable or implantable devices as a power source. The O.sub.2-insensitive FDH2 can also be used in other applications not applying a fuel cell, such as hydrogen peroxide generation, a formate testing kit, or carbon capture applications.
Claims
1. A biofuel cell, comprising: a chamber, a bioanode comprising formate dehydrogenase (DvH-FDH2) derived from Desulfovibrio vulgaris Hildenborough adsorbed thereon, a biocathode comprising laccase, bilirubin oxidase, or cytochrome cbd oxidase (CydCBD) adsorbed thereon, and an electrolyte comprising a buffer including formate, wherein the bioanode and the biocathode are electrically connected to form an electric circuit, and wherein the DvH-FDH2 is O.sub.2-insensitive.
2. The biofuel cell of claim 1, wherein the DvH-FDH2 is an enzyme having a first subunit represented by SEQ ID NO: 31 and a second subunit represented by SEQ ID NO: 32.
3. The biofuel cell of claim 1, wherein the DvH-FDH2 has a first subunit having 90% or more identity to SEQ ID NO: 31 and a second subunit having 90% or more identity to SEQ ID NO: 32.
4. The biofuel cell of claim 1, wherein the biocathode comprises the CydCBD adsorbed thereon, the CydCBD being an enzyme having a first subunit represented by SEQ ID NO: 33 and a second subunit represented by SEQ ID NO: 34.
5. The biofuel cell of claim 1, wherein the CydCBD has a first subunit having 90% or more identity to SEQ ID NO: 33 and a second subunit having 90% or more identity to SEQ ID NO: 34.
6. The biofuel cell of claim 1, wherein at least one of the bioanode and the biocathode further comprises undecaheme cytochrome c (UHC) represented by SEQ ID NO: 35 adsorbed thereon.
7. The biofuel cell of claim 1, further comprising an O.sub.2 bubbler or pump which provides Oz to the electrolyte.
8. The biofuel cell of claim 1, further comprising a gas permeable membrane disposed in the chamber between the bioanode and the biocathode.
9. An implantable device comprising the biofuel cell of claim 1.
10. The implantable medical device according to claim 9, wherein the implantable medical device is a contact lens.
11. The implantable medical device according to claim 9, wherein the implantable medical device is a pacemaker.
12. A method of generating electricity comprising: providing the biofuel cell of claim 1, and exposing the electrolyte to open air, or providing air to the electrolyte by an O.sub.2 bubbler or pump.
13. A kit for generating hydrogen peroxide, comprising: a matrix having formate dehydrogenase (DvH-FDH2) derived from Desulfovibrio vulgaris Hildenborough immobilized thereon, the DvH-FDH2 being O.sub.2-insensitive, and a source of oxygenated formate, and an apparatus which flows oxygenated formate to the matrix.
14. A method of generating hydrogen peroxide, comprising: providing the kit of claim 13, flowing oxygenated formate to the matrix, and collecting generated hydrogen peroxide.
15. A kit for detecting formate, comprising: a reaction buffer, a formate standard, and formate dehydrogenase (DvH-FDH2) derived from Desulfovibrio vulgaris Hildenborough, the DvH-FDH2 being O.sub.2-insensitive, and a mediator dye.
16. A method of detecting formate in a sample, comprising: providing the kit of claim 15, obtaining a standard curve using the formate standard, treating the sample with the reaction buffer, the DvH-FDH2, and the mediator, providing air to the sample, and detecting a change in color with a spectrophotometer to quantify an amount of the formate in the sample.
17. A device for converting carbon dioxide in air to formate, comprising: a chamber, an electrolyte comprising a buffer including formate, a bioanode comprising an enzyme adsorbed thereon, the enzyme being capable of injecting electrons into the electrolyte, a biocathode comprising formate dehydrogenase (DvH-FDH2) derived from Desulfovibrio vulgaris Hildenborough adsorbed thereon, and an air supply which injects air containing carbon dioxide into the electrolyte, wherein the bioanode and biocathode are electrically connected to an electric circuit, and wherein the DvH-FDH2 is O.sub.2-insensitive.
18. A method for converting carbon dioxide in air to formate, comprising: providing the device of claim 17, providing electrical power to the bioanode so that the bioanode generates electrons to transfer to the biocathode, and injecting air containing carbon dioxide into the electrolyte.
Description
BRIEF DESCRIPTION OF DRAWINGS
[0013]
[0014]
[0015]
[0016]
[0017]
[0018]
[0019]
[0020]
[0021]
[0022]
[0023]
[0024]
[0025]
[0026]
[0027]
[0028]
[0029]
[0030]
[0031]
[0032]
[0033]
[0034]
[0035]
[0036]
[0037]
[0038]
[0039]
[0040]
[0041]
[0042]
[0043]
[0044]
[0045]
[0046]
[0047]
[0048]
[0049]
[0050]
[0051]
[0052]
[0053]
[0054]
[0055]
[0056]
[0057]
[0058]
[0059]
[0060]
[0061]
[0062]
[0063]
[0064]
[0065]
[0066]
[0067]
[0068]
[0069]
[0070]
[0071]
[0072]
[0073]
[0074]
[0075]
[0076]
[0077]
[0078]
DETAILED DESCRIPTION OF THE INVENTION
I. Definitions
[0079] Unless otherwise noted, technical terms are used according to conventional usage. Definitions of common terms in molecular biology may be found, for example, in Benjamin Lewin, Genes VII, published by Oxford University Press, 2000 (ISBN 019879276X); Kendrew et al. (eds.); The Encyclopedia of Molecular Biology, published by Blackwell Publishers, 1994 (ISBN 0632021829); and Robert A. Meyers (ed.), Molecular Biology and Biotechnology: a Comprehensive Desk Reference, published by Wiley, John & Sons, Inc., 1995 (ISBN 0471186341); and other similar technical references.
[0080] As used herein, a or an may mean one or more. As used herein when used in conjunction with the word comprising, the words a or an may mean one or more than one. As used herein another may mean at least a second or more. Furthermore, unless otherwise required by context, singular terms include pluralities and plural terms include the singular.
[0081] As used herein, about refers to a numeric value, including, for example, whole numbers, fractions, and percentages, whether or not explicitly indicated. The term about generally refers to a range of numerical values (e.g., +/5-10% of the recited value) that one of ordinary skill in the art would consider equivalent to the recited value (e.g., having the same function or result). In some instances, the term about may include numerical values that are rounded to the nearest significant figure.
[0082] As used herein, the term O2-insensitive and similar phrases refer to an enzyme which maintains its enzymatic functionality in the presence of a gaseous environment of up to 42% O.sub.2.
II. The Present Invention
[0083] As will be discussed herein, the invention relates to an O.sub.2 insensitive FDH and its various applications. The DvH-FDH2 is described herein (sometimes referred to simply as FDH) has a first subunit represented by SEQ ID NO: 31 and a second subunit represented by SEQ ID NO: 32. However, the FDH is not limited to this. Rather, an FDH may be utilized which has one or more additions, deletions, or substitutions relative to SEQ ID NOs: 31 and 32. For instance, the first and second FDH subunits may each have 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NOs: 31 and 32 respectively, as long as the FDH has the required reducing and oxidizing function.
[0084] In a biofuel cell, the FDH can be applied to an anode by adsorption, such that a very thin film of the FDH is generated on the surface of the electrode. Such adsorption can be performed, for example, by placing a protein solution including the FDH directly on the electrode, such as a pyrolytic graphite edge electrode (PGEE), letting the solution dry for a few minutes, washing off excess protein molecules, and then immersing the electrode into the electrolyte solution. This represents direct electrocatalysis because the protein is directly in contact with the electrode. Alternatively, the same procedure can be performed on a multiwalled carbon nanotube (MWCNT)-modified electrode, with the MWCNT being adsorbed onto the electrode in a similar manner as the protein. In this case, the MWCNT are sandwiched between the protein and the electrode.
[0085] As another alternative, undecaheme cytochrome c (UHC) can be adsorbed onto the electrode first, and then the FDH is adsorbed to the same surface. Since the FDH is tightly associated with UHC in nature, providing UHC to the electrode first can reduce the occurrence of FDH denaturation or loss of function during the adsorption process.
[0086] The material of the electrode is not limited, but may be, for example pyrolytic graphite edge electrode (PGEE) coated with multiwalled carbon nanotubes (MWCNT). Other alternative materials for the electrode include boron-doped diamond, carbon cloth, glassy carbon, carbon paper, and other materials known in the art. The surface of the electrode may be further derivatized, by chemical or enzymatic derivatization, to improve the binding of the protein to the electrode. Alternatively, the electrode may be pre-coated with an antibiotic, such as polymyxin.
[0087] In the fuel cell, the FDH anode is coupled with a cathode having a similar structure to the anode. The cathode may have adsorbed thereon either laccase or bilirubin oxidase (BOx). The source of the laccase and BOx is not limited, as long as it is stable and interacts with the electrode. Examples of the laccase include those derived from Trametes versicolor (Millipore Sigma catalog #38429) and Agaricus bisporus (Millipore Sigma catalog #40452). Examples of the BOx include that derived from Myrothecium verrucaria (Millipore Sigma catalog #B0390). As another alternative, the cathode may have adsorbed thereon a cytochrome oxidase (COX), such as cytochrome cbd oxidase (CydCBD, which includes the subunits CydAc and CydA). CydCBD will be discussed in greater detail below. In addition to laccase, BOx or CydCBD, UHC may be first adsorbed onto the cathode. The cathode enzyme is adsorbed to the cathode in a similar manner as the FDH is adsorbed to the anode, described above.
[0088] As described below, a bacterial integral membrane supercomplex (also known as the respirasome) is made up of three proteins: formate dehydrogenase (FDH), undecaheme cytochrome c (UHC), and cytochrome oxidase (COX). Through expression of this complex in the native host and subsequent purification/characterization, it has been found that this respirasome efficiently couples formate oxidation to oxygen reduction. In this hardwired system, electrons derived from formate oxidation to carbon dioxide are used to reduce dioxygen, resulting in the production of water. It is noted that the term hardwired refers to the components of the five subunit protein complex not being in dynamic equilibrium, but rather being fixed in relative position/communication. Accordingly, electrons derived from formate oxidation by FDH are transferred through to the cytochrome oxidase via an internal wire composed of iron-sulfur clusters and hemes without interruption, diffusion, or rearrangement. Unlike known biofuel cells which use the glucose/oxygen couple and have a lower potential difference (about 1.2 V), the disclosed biofuel cell which uses the formate/oxygen pair has a higher potential difference (about 1.7 V).
[0089] In the biofuel cell, the above-discussed electrodes are submerged in chamber including a liquid electrolyte and are electrically connected form an electrical circuit. The electrolyte may comprise a buffer, with formate and O.sub.2 dissolved therein. Examples of a suitable buffer include Tris, sodium phosphate, and potassium phosphate, generally at a concentration of from 100 mM to 1 M. The buffer may also be a mixed system of several buffers to ensure operation between pH values of 3.5 to 10. The electrolyte may also include up to 1 M sodium chloride or up to 1 M potassium chloride as additional salts to adjust ionic strength. However, in some situations, the amount of O.sub.2 dissolved in the electrolyte may be insufficient. In such a case, additional O.sub.2 may be pumped or bubbled into the electrolyte, particularly for the electrode. The buffer should have a pH of about 8. Optionally, a gas-permeable membrane may separate the bioanode and biocathode chambers. However, it is preferred to include the gas-permeable membrane, in order to prevent reagents in the two chambers from mixing, but allowing H.sup.+ to diffuse across the membrane. This is particularly relevant in situations where the enzymatic conditions, such as pH are different in the two chambers. The structure of the gas-permeable membrane is not particularly limited. For additional information on gas-permeable membranes, see textbook Biofuel Cells: Materials and Challenges.sup.222, particularly pages 34-35, 72-79, 125-126, 137, and 146-151 and Li et al..sup.223. Alternatively, laminar flow may be used instead of a membrane to separate the electrolyte solutions (see page 35 of citation 222).
[0090] The distance between the anode and cathode is not particularly limited. FDH2 has a binding constant (K.sub.m) for formate in the low micromolar range. Thus, the reaction will proceed even if the relative concentration of FDH2 and formate are both low. In the present application, kinetics experiments were done with an enzyme concentration of 1.6 nM and formate and formate in the range of 0 to 100 M. Additionally, the density of adsorption of enzymes on the electrodes, and the sizes of the electrodes will determine the current as long as the cathode is not limiting. Additionally, the biofuel cell may include a reference electrode (RE) (not pictured) to measure the electrochemical potentials and a counter electrode (CE) (not pictured) to complete the circuit. Specifically, the RE helps to determine the precise potential difference between the CE and working electrode (WE; bioanode or biocathode). A simplified structure of the biofuel cell is illustrated in
[0091] The disclosed O.sub.2 insensitive FDH has many practical applications. First, the O.sub.2-insensitive FDH may be used in a biofuel cell to generate electricity, as noted above. In order to generate electricity, the anode and cathode of the fuel cell are immersed in chamber including an electrolyte containing formate, and are electrically connected to form an electrical circuit. The enzymatic reaction is allowed to proceed, thereby generating electricity. The solubility of oxygen at 23 C. in water equilibrated to air is about 260 uM. As such, oxygen is readily resupplied from the air if the solution is agitated and open to the air. However, in a case where oxygen is utilized in the biocathode, the oxygen could be limiting. In this situation, direct bubbling with O.sub.2 would prevent oxygen being limiting. Such bubbling to provide supplemental oxygen should be needed if the overall current is high relative to the volume of the electrolyte or due to increased adsorptivity of the enzyme on the electrode surface. The FDH bioanode is preferably in an environment of pH 8. The biocathode is preferably in an environment of the optimal pH of the enzyme used, and therefore may require an electrolyte and buffer appropriate to such enzyme. The concentration of the enzyme on the cathode may be adjusted as appropriate..sup.197 Additionally, a biofuel cell including the O.sub.2-insensitive FDH may be applied to various known types of wearable electronics or implantable devices, such as a pacemaker, biosensor or contact lens..sup.192 Use of a miniaturized fuel cell in such an implantable device would eliminate the need for a battery being included in the device. The O.sub.2 naturally present in the body would serve to power the miniaturized biofuel cell.
[0092] Additionally, the O.sub.2-insensitive FDH may be used in several applications other than fuel cells. For instance, the O.sub.2-insensitive FDH can be used to generate hydrogen peroxide in an environmentally safe manner. To date, industrial manufacturing of hydrogen peroxide is performed chemically. However, the O.sub.2-insensitive FDH can be mixed with formate and O.sub.2 to generate hydrogen peroxide enzymatically. For example, this can be accomplished by immobilizing the FDH on a matrix, and then flowing oxygenated formate through the matrix. The FDH will then simultaneously oxidize the formate and reduce the O.sub.2, thereby generating stoichiometric amounts of hydrogen peroxide Alternatively, hydrogen peroxide may be generated by providing the FDH in a solution, and allowing the above-noted reaction to proceed.
[0093] Another application of the O.sub.2-insensitive FDH is a formate detection kit. Formate could be detected either in bulk or in smaller samples, such as a 96-well plate. The formate detection kit includes: (i) a reaction buffer, (ii) a formate standard as a control, (c) the FDH, and (d) a mediator dye such as phenazine ethosulfate/dichlorophenol indophenol, tetrazolium, or the like to detect formate the sample. The user would first run a control to generate a standard curve, thereby bracketing the formate concentration to be detected. Then, the user preferably would treat their sample with the buffer, the FDH and the mediator, and expose the sample to air. Instead of O.sub.2 in air, other electron acceptors can be used, such as ferricyanide, PES/DCPIP, tetrazolium, etc. Next, the user would detect a change in color with a spectrophotometer to quantify the amount of formate. Such a formate detection kit could measure formate levels in the skin, gut, soil, or seawater for example. As for detection in the skin, this could be achieved by applying electronic skins that incorporate the FDH. This could be useful in personal nutrition, noninvasive metabolite profiling, including in exercise metabolomics, identification of biomarkers, and in specific diagnosis of certain skin disorders. As to the detection of formate in the gut, this could be applied by providing a non-invasive capsule which would allow recording of formic acid levels detected by the FDH using microelectronics. Additionally, the O.sub.2-insensitive FDH also can be applied to a device which serves as a safety indicator in the manufacture of methanol or chemical with reactive methyl groups, because the formate metabolite would rise with exposure.
[0094] Another embodiment is a fuel cell which allows for simultaneous generation of electricity and H.sub.2O.sub.2. In this embodiment, FDH2 is adsorbed on both an anaerobic anode (dehydrogenase activity) and an aerobic cathode (formate oxidase activity). This is illustrated in
[0095] Additionally, the O.sub.2-insensitive FDH can be applied to carbon capture strategies by running the DvH-FDH2 catalyzed reaction in reverse. In the above-discussed biofuel cell, a forward reaction proceeds (formate oxidation, which produces CO.sub.2 as product and 2 electrons). The electrons to flow through the bioanode and through the electric circuit reach the biocathode. In other words, electrons from formate oxidation flow onto the anode through electrical wires that connect the bioanode to the biocathode and onto an oxidase, while the aqueous connection between the two parts of the cell (or salt bridge) allows for charge balance (migration of positive charge in the form of protons or cation) to complete the circuit. The enzyme on the biocathode (for example, BOx, laccase, or a CydCBD enzyme) uses the two electrons to reduce O.sub.2 to H.sub.2O. This reaction requires 4 electrons and 4 protons 2O.sub.2+4H.sup.++4e.sup..fwdarw.2H.sub.2O; or O.sub.2+2H.sup.++2e.sup..fwdarw.2H.sub.2O). However, the reaction can be reversed to consume CO.sub.2 from air (or other sources such as burning oil, gas, biomass, or directly from seawater) as substrate and generate formate, which is a microbial feedstock. Formate as a feedstock is metabolically equivalent to H.sub.2, thus it can be considered a stable storage form of H.sub.2 and CO.sub.2. Although several FDH enzymes from different bacteria have been investigated for their ability to catalyze the reverse reaction, none of these can perform the reverse reaction in air, due to their O.sub.2-sensitivity.
[0096] However, since the disclosed FDH is O.sub.2-insensitive, it can be applied to the capture of CO.sub.2 without inactivating the enzyme in air. Nearly all sources of CO.sub.2 are contaminated with other gases, including carbon monoxide and O.sub.2. However, the O.sub.2 insensitive FDH is unaffected by carbon monoxide and O.sub.2 and, therefore, can be used for carbon capture and related green applications.
[0097] Whereas the forward reaction releases electrons, the reverse reaction requires input of electrons. Although reactions using some chemicals such as viologens (the same molecules that in the context of a polymer gel confer protection from O.sub.2) have been attempted, these will cease to work in air. This is because they will readily oxidize before being able to donate the electrons to the protein.
[0098] This problem can be avoided by using an electrode to inject electrons into the enzyme so that it can reduce CO.sub.2 and produce formate. This is illustrated for example in
[0099] It should also be noted that in the carbon capture application, the electrochemical cell configuration is reversed. That is, the O.sub.2-insensitive FDH is immobilized on the biocathode, rather than the bioanode, so that it can obtain electrons from the bioanode. Air, containing CO.sub.2, is bubbled or pumped into the catholyte. Alternatively, sodium carbonate or sodium bicarbonate, both of which serve as a CO.sub.2 source when dissolved in water, could be used. Note that the CO.sub.2 reduction reaction must be performed at pH 6 or below so that enough CO.sub.2 remains in solution. In this case, the bioanode enzyme could be photosystem II.sup.198, photosystem I, or any other system that can serve as electron acceptors.
[0100] As another alternative to electrode delivery, cadmium sulfide (CdS) or cadmium selenide (CdSe) quantum dots (QD) can be used in a manner similar to that disclosed in Edwards et al..sup.191 CdS or CdSe can be used to serve as an electron source when light is shined on the QD. Additionally, the QD can be derivatized (or modified) in numerous ways to help the enzyme favorably interact with it. Additionally, hydrogen peroxide is generated in this method.
[0101] Next, details are provided with respect to operation and structure of the O.sub.2-insensitive FDH. As noted above, the DvH-FDH2 has a first subunit represented by SEQ ID NO: 31 and a second subunit represented by SEQ ID NO: 32. However, the FDH is not limited to this. Rather, an FDH may be utilized which has one or more additions, deletions, or substitutions relative to SEQ ID NOs: 31 and 32. For instance, the first and second FDH subunits may each have 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with SEQ ID NOs: 31 and 32 respectively, as long as the FDH has the required reducing function.
[0102] The FDH can be produced on its own, or as part of a five-gene operon represented by SEQ ID NO: 36. This operon described in 2004 as part of the genome sequence of DvH.sup.57. Although DvH-FDH2 was isolated and partially characterized in 2011.sup.68, the characterization was performed in the complete absence of O.sub.2. Therefore, it was not previously known that the FDH is O.sub.2-insensitive. The five-gene operon includes the following genes: (i) DVU2481, encoding the small subunit fdnH2 of FDH2, (ii) DVU2482, encoding large subunit fdnG2 of FDH2, (iii) DVU2483, encoding an 11-heme undecaheme cytochrome c (uhc), (iv) DVU2484, encoding monoheme cytochrome c (mhc), also known as CydAc, the catalytic subunit of cytochrome cbd oxidase (CydCBD), and (v) DVU2485, encoding a formerly hypothetical protein (hyp), now characterized subunit of CydCBD and referred to as CydA. The structure of the operon is illustrated in
[0103] Robust Expression Platform for Facile Production of Highly Pure O.sub.2-Insensitive Metallo-FDHs. There are three distinct fdh loci in the DvH genome.sup.69 (
[0104] Aerobic In-Gel Catalysis of Recombinant DvH-FDH2. Literature precedents exist for anaerobic activity staining of FDHs in native polyacrylamide gels using 2,3,5-triphenyltetrazolium chloride.sup.68,71 or phenazine methosulfate (PMS)/nitroblue tetrazolium chloride (NBT)..sup.72-74 However, this has not been achieved for any FDH in air. Because O.sub.2-insensitive group 5 [NiFe]-hydrogenases have been zymographically visualized using redox dyes,.sup.75 a similar approach was considered with DvH-FDH2. When native polyacrylamide gel strips containing recombinant DvH-FDH2 were incubated aerobically with NBT and formate, a single dark blue colored band appeared within two minutes (
[0105] [4Fe-4S] Metalloclusters, Tungstopterin, and Selenocysteine Remain Unaffected by O.sub.2 During Catalytic Turnover. Metal specificity profiles of SRB FDHs remain incompletely described.sup.77. Moreover, the nature of redox centers in DvH-FDH2 has not been established..sup.68 Because DvH-FDH1 and DvH-FDH2 exhibit 61% protein sequence identity (large catalytic subunit) and share all the metal coordination sites within the two subunits (
TABLE-US-00001 TABLE 1 ICP-MS quantification of metal cofactors in DvH-FDH2 Replicate 1 [Metal] Replicate 2 [Metal] Replicate 3 [Metal] Metal Predicted ng mL.sup.1 M ng mL.sup.1 M ng mL.sup.1 M* Observed Fe 16 82 2.8 1.47 0.05 42.8 0.76 35 0.1 0.625 17 1 Mo 1 ND ND ND ND ND ND ND Se 1 4.3 0.1 0.055 0.002 2.2 0.028 2.5 0.1 0.032 0.7 0.1 W 1 15.09 0.02 0.083 0.003 8 0.044 7.5 0.1 0.41 1 0.1 Errors are standard deviations from triplicate measurements using protein samples derived from three independent preparations; ND, not detected *N = 2, SEM < 0.001
[0106] Electronic and Electron Paramagnetic Resonance (EPR) Spectral Signatures of DvH-FDH2 are Virtually Invariant in Air. The bulk of metallo-FDH electronic spectra in the primary literature have been measured under anaerobic conditions to avoid inactivation my molecular O.sub.2..sup.16,19,23,32,78 Although aerobic spectra exist for an O.sub.2-tolerant Mo-Cys-FDH stabilized by 10 mM nitrate,.sup.40 their utility remains unclear, for the addition of formate did not afford a characteristic spectral change. Similarly, formate-reduced spectra in air are not available for metallo-FDHs characterized from either methanotrophs.sup.36 or methylotrophs..sup.79 Here, the first functional validation of a W-Sec-FDH in air via electronic spectroscopy is shown. Aerobically purified DvH-FDH2 is brown in color and shows a broad S.fwdarw.Fe.sup.3+ charge transfer transition at 412 nm (
[0107] To evaluate the predictions made via UV/visible spectroscopy, electron paramagnetic resonance (EPR) measurements were taken. The oxidized enzyme is EPR-silent and specifically devoid of signals that might be attributed to oxidized [3Fe-4S] clusters [
[0108] The relative intensities of the two signals at a ratio of 1:0.75 are essentially independent of whether formate or dithionite was used as a reductant, either aerobically or anaerobically. The integrated intensity amounts to 4.10.2 spins per protomer, indicating that both dithionite and formate result in full reduction of all four [4Fe-4S] clusters of the protein. This conclusion is consistent with the observed UV/visible absorption changes (
[0109] The simulated spectrum for the formate-reduced DvH-FDH2 prepared under aerobic conditions and collected at 15K from
TABLE-US-00002 TABLE 2 EPR simulation parameters for W.sup.V and reduced Fe/S centers of Fdh2 Tungsten coupling g tensors constants.sup.a Relative Center g.sub.1 g.sub.2 g.sub.3 g.sub.ave A.sub.1 A.sub.2 A.sub.3 distribution W.sup.V1.sup.b 1.982 1.876 1.849 1.902 232 119 151 10 W.sup.V2.sup.b 1.988 1.904 1.849 1.914 233.sup.c 131 125 0.54 Fe/S1.sup.d 2.045 1.943 1.904 1.964 1.0 Fe/S2.sup.d 2.058 1.910 1.888 1.952 0.75 .sup.aIn MHZ; in the absence of multi-frequency data, coupling constants are approximate .sup.bSpectrum collected at 108K .sup.cFixed during simulations .sup.dSpectrum collected at 15K
[0110] When 150 M enzyme is incubated with dithionite under anaerobic conditions for an extended amount of time (12 hours or more) and the spectrum is collected at 108K, an additional pair of signals are obtained (
Full Progress Curves Reveal High Catalytic Efficiency Under Atmospheric Conditions and Lack of Enzyme Inactivation or Product Inhibition. Solution enzyme kinetics investigations of metallo-FDHs have not directly probed formate depletion or CO.sub.2 production. Instead, low-potential artificial electron acceptors, most commonly benzyl viologen (BV; E.sub.m,7=360 mV.sup.32) and methyl viologen (MV; E.sub.m,7=446 mV.sup.32) for the forward and reverse reactions, respectively, have been routinely used as surrogates to report on catalytic robustness. Although cautions have been raised against trusting kinetic parameters derived from the use of these inefficient and slow redox mediators.sup.27,85, they continue to be favored. Mo-Cys-FDHs offer an alternative by making it possible to track NAD.sup.+ reduction or NADH oxidation..sup.32,40 Unfortunately, this strategy cannot be extended to all metallo-FDHs and it is prone to yield false-positive results when interrogating aerobic CO.sub.2 reduction with aerotolerant FDHs..sup.26 To further complicate matters, FDHs from sulfate-reducing bacteria (SRB) are in a class of their own (Table 3). Moreover, there are no reports on metallo-FDH enzymology that has disclosed a complete set of raw absorbance versus time data used to extract kinetic parameters. Table 3: Literature stead-state kinetics parameters of SRB-FDHs
TABLE-US-00003 T [BV] [Enzyme] K.sub.m System Organism pH ( C.) (mM) (nM) k.sub.cat (s.sup.1) (M) Reference W- Da 8.0 37 7.5 35 241 10 Mota FDH1.sup.WT (2011); Mota et al (2011) W- Dg 8.0 37 7.5 35 174 51 Mota FDH1.sup.WT (2011); Mota et al (2011) W- DvH 7.6 RT 2 0.0124 3684 1 Da Silva FDH1.sup.WT et al (2011) W- DvH 7.6 RT 2 1.4 1100 NR Miller et FDH1.sup.REC al (2018) W- DvH 7.6 RT 2. 1.4 940 NR Szczesny FDH1.sup.REC et al (2019) W- DvH 7.6 RT 2 1.4 1104 62 NR Oliveira et FDH1.sup.WT al (2020) W- DvH 7.6 RT 2 1.4 1310 50 16.9 2.8 Oliveira et FDH1.sup.REC al (2020) W- DvH 7.6 RT 2 1.4 1144 NR Alvarez- FDH1.sup.REC Malmagro et al (2021) ??- DvH 7.6 RT 2 0.48 81 4 Da Silva FDH2.sup.WT et al (2011) Mo- Dd 7.6 37 7.5 35 357 18 65 8 Rivas et al FDH3.sup.WT (2007) Mo- Dd 8.0 37 7.5 35 347 64 Mota FDH3.sup.WT (2011); Mota et al (2011) Mo- DvH 7.6 RT 2 0.25 262 8 Da Silva FDH3.sup.WT et al (2011) Mo- Dd 8.0 22 5 1 543 57 Maia et al FDH3.sup.WT (2016) SRB, sulfate-reducing bacteria; WT, wild-type natively-purified protein; REC, recombinant; W-, tungsten-containing; Mo-, molybdenum-containing; ??, metal status unknown; NR, not reported; likely to be similar to the value reported by Oliveira et al (2020); RT, room temperature; BV, benzyl viologen; DvH, Desulfovibrio vulgaris Hildenborough; Dd, D. desulfuricans; Dg, D. gigas; Da, D. alaskensis. Additional experimental details shared by Drs. Luisa Maia and Ins Pereira have been included here for the sake of completeness. The FDH probed in the present application is ??- FDH2.sup.WT.
[0111] To resolve these uncertainties, solution enzyme kinetics approaches were explored capable of yielding results with functional information content. First, a qualitative assessment of electron acceptor specificity was performed. See video at pubs.acs.org/doi/suppl/10.1021/acscatal.2c00316/suppl_file/cs2c00316_si_002.mp4 or ndownloader.figstatic.com/files/36617584.
[0112] The video visualizes aerobic formate oxidation. Video playback is in real time and the time stamps described below is in hours:minutes:seconds format. Experimental conditions are identical to those specified in Figure S38. PES/DCPIP reduction is shown first. FDH2 is added at 00.00:09. The reaction goes to completion within the next 11 s (00:00:20). Ferricyanide (FC) reduction is initiated at 00:00:24. Reaction completes around 00:02:05. Aerobic BV reduction setup is ready at 00:02:11. Observe that the cuvette is exposed to air and stirring is enabled. BV reduction is triggered at 00:02:14. Blue schlieren is transiently visible as streaks but quickly disappears. Stirring is stopped 00:02:30 to prevent further oxygenation of the reaction mixture. Blue color begins to develop at 00:03:40 and dominates the solution by 00:04:00. At 00:04:05 the cuvette is stoppered to slow down O.sub.2 entry into the cuvette. At 00.04:26 stirring commences, resulting in the complete mixing of the solution. The BV reduction measurements conducted in air should not be confused with what had been reported by Maia et al (2016). Authors of the latter work exposed the reaction vessel to air only after anaerobic BV reduction was completed. Consequently, Maia et al had no way to assess whether the reaction continued to progress in the presence of O.sub.2 or ceased completely. The BV reaction mix was under atmospheric O.sub.2 until the reduction was complete. It was never made anaerobic by N2/Ar sparging. Nor was any other method used to make the solution anaerobic. This visual demonstration serves as incontrovertible direct proof that electrons derived from formate oxidation simultaneously end up on two different electron acceptors.
[0113] Two chemically distinct artificial electron acceptors were then settled on, one each from the low- (BV) and high-potential [phenazineethosulfate (PES)]E.sub.m,7=+65 mV.sup.86 categories. The advantage of the latter is that it can be readily coupled with dichlorophenolindophenol (DCPIP) (E.sub.m,7=+217 mV.sup.86) for facile acquisition of kinetics data both in air and under argon. Second, conditions were identified under which full-progress curves could be measured. Such an approach is only possible for stable enzymes that catalyze a single-substrate irreversible reaction in the absence of enzyme inactivation or product inhibition..sup.87-90 Third, simultaneously analysis was performed of several full-progress curves using dynamic simulation-based global fitting.sup.89 to extract k.sub.cat and k.sub.cat/K.sub.m. This strategy overcomes the limitations of classical steady-state analysis, such as the use of only the first few seconds of data, unreliable initial-velocity values, and overparameterization..sup.84 To benchmark these models (Schemes 1 and S1), source BV enzyme kinetics data was obtained that formed the basis of Figures S3 and 1C of Maia et al..sup.10 (D. desulfuricans FDH3) and Oliveira et al..sup.23 (DvHFDH1), respectively. Global fitting of the steady-state progress curves from Maia allowed for recapitulation of the published values (
[0114] Because the original characterization of native DvH-FDH2by the same laboratory that has reported extensively on DvHFDH1was done using 2 mM BV (see Table 3).sup.68, reproduction of the published results with aerobically purified recombinant DvH-FDH2. However, the enzyme was added to the reaction mix without any preactivation using thiols or formate. Although DvH-FDH2 displays redox activity in air (
[0115] Collectively, the observations above suggest that BV is not a good electron acceptor for DvH-FDH2. To test this hypothesis, activity assays were independently pursued with the PES/DCPIP pair. As has been observed for other dehydrogenases.sup.91, PES served as an efficient electron acceptor for DvH-FDH2 (
[0116] See Scheme 1 below:
##STR00003##
##STR00004##
TABLE-US-00004 TABLE 4 Steady-state kinetics of DvH-FDH2 Electron Reaction Km k.sub.cat/K.sub.m Enzyme acceptor condition k.sub.cat (s.sup.1) (M) (M.sup.1s.sup.1)* Replicates Reference FDH2.sup.WT BV (2 Anaerobic 81 4 20 1 da Silva et mM) al (2011) FDH2.sup.Rec BV (2 Anaerobic 68 5 3.5 0.9 19.4 5.2 3 This mM) application FDH2.sup.Rec BV (20 Anaerobic 111 16 7 3 15.8 7.1 3 This mM) application FDH2.sup.Rec PES/DCPIP Anaerobic 220 5 5.5 0.5 40 4 5 This application FDH2.sup.Rec PES/DCPIP Air 317 14 7 1 45.3 6.3 10 This application Initial velocities were calculated using ICEKAT, utilizing the first 10-12 seconds of data *standard error values for k.sub.cat/K.sub.m estimated according to Johnson (2019)
TABLE-US-00005 TABLE 5 Parameters gleaned from full progress curve analysis Electron K.sub.m k.sub.cat/K.sub.m Product Enzyme Product acceptor k.sub.cat (s.sup.1) (M)* (M.sup.1s.sup.1) stoichiometry ** inactivation inhibition 2 mM BV 47 2 2.1 0.1 22 1.1 2BV.sup.+: 1F No No (anaerobic) DCPIP 258 3 3.7 0.3 69 6 1DCPIP:1F No No (anaerobic) DCPIP 354 5 4.5 0.4 79 6 1DCPIP:1F No No (air) Errors for k.sub.cat and k.sub.cat/K.sub.m via confidence contour analysis implemented in FitSpace Explorer *Standard error values for K.sub.m (calculated from k.sub.cat and k.sub.cat/K.sub.m) estimated according to Johnson (2019) ** F, formate, BV+, reduced benzylviologen
[0117] Catalytic Redundancy or Gain of a New Enzyme Function? Exploiting the Peck-Gest Paradigm to Seek Insights Into How FDHs May Have Evolved to Achieve Aerobic Catalysis. Full progress curve analysis establishes that both k.sub.cat and k.sub.cat/K.sub.m are severely underestimated when BV is used as the electron acceptor. It also reveals a preference for the latter viz., whereas DvH-FDH2 favors high-potential acceptors, such as PES/DCPIP or NBT; DvH-FDH1 is highly active with BV.sup.23. Such linkages take on special significance when multiple FDHs encoded by the same organism are compared. Peck and Gest.sup.92 discovered two types of FDH in Escherichia coli solely based on their preference for artificial electron acceptorsone was linked to phenazine methosulfate (PMS)/DCPIP and its expression was confined to O.sub.2/nitrate-respiring cells while the other was BV-linked and unique to non-respiring cells (reviewed by Stewart.sup.51). It is now clear that Fdh-N is DCPIP-linked,.sup.73 and Fdh-H is BV-linked. The third poorly characterized variant of E. coli, Fdh-O, is also DCPIP-linked..sup.54 Extending the Peck-Gest paradigm to DvHonly the second microbe for which all three FDHs have now been characterized. It would be predicted that the BV-linked FDH1 is involved in anaerobic respiration and that the DCPIP-linked FDH2 plays a role in aerobic respiration. It has already been established that FDH1 is essential for anaerobic sulfate respiration when formate serves as the electron donor..sup.62 Biological function of FDH2 remains to be elucidated. It is herein proven that catalytic parameters derived from viologen-based measurements lack functional information content to make predictions about how well a given FDH would perform under aerobic conditions. Instead, high catalytic performance on BV only guarantees activity under anaerobic conditions. It is possible that confirmation bias has boosted reliance on viologen-based kinetics and stymied efforts to uncover O.sub.2-immune FDHs that can reversibly function in air. This is best exemplified by DvH-FDH2, which exhibits the lowest TN with BV (Table 3) and yet is the most O.sub.2-insensitive of all metallo-FDHs characterized to date from any bacterium. Therefore, biological context must factor critically into future search efforts aimed at discovering air insensitive FDHs.
[0118] CO2 is the Product of Aerobic Formate Oxidation by DvH-FDH2. Although several metallo-FDHs have been investigated, there is just one report in the literature describing the product resulting from enzymatic oxidation of formate under anaerobic conditions..sup.31 In all remaining works, product formation is implied based on the reduction of a natural (NAD.sup.+) or artificial electron acceptor, which is often BV. Although two different artificial electron acceptors were used in this study, further product analysis in air was studied. At pH 7.5, combining DvH-FDH2 with isotopically labeled .sup.13C-formate readily yields a discernible H.sup.13CO.sub.3.sup. resonance at 162.93 ppm (
[0119] FOX Activity Generates H.sub.2O.sub.2, Enabling Oxygen Insensitivity of DvH-FDH2. A striking characteristic of FDH is that it can catalyze BV reduction in air (See video at pubs.acs.org/doi/suppl/10.1021/acscatal.2c00316/suppl_file/cs2c00316_si_002.mp4 or ndownloader.figstatic.com/files/36617584.). No other FDH is known which is capable of accomplishing this feat. Although transient-blue schlieren appears immediately upon enzyme addition, there is a substantial lag before the reaction mix turns completely blue. This critical observation formed the basis of the hypothesis that O.sub.2 is a cosubstrate for the biocatalyst. To understand how DvH-FDH2 deals with O.sub.2, a Clark-type O.sub.2 electrode was used to determine whether formate oxidation under atmospheric conditions is coupled to O.sub.2 reduction. Addition of enzyme to formate-containing aerobic buffer led to robust O.sub.2 consumption (
##STR00005##
[0120] A calculation of the electron flux that leads to H.sub.2O.sub.2 formation was attempted..sup.95,96 The x/y value in
[0121] Inclusion of catalase abolished the fluorescence signal, and the denatured enzyme failed to yield H.sub.2O.sub.2(
[0122] Next, superoxide (O.sub.2.sup..Math.) generation.sup.103 by DvH-FDH2 was assessed. Because addition of superoxide dismutase (SOD) had a negligible effect on both quantification (
##STR00006##
[0123] Taken together, these results establish for the first-time FOX activity of a metallo-FDH. Based on IUPAC-IUB nomenclature,.sup.107 the term oxidase (EC 1.1.3) is reserved for enzymes, which utilize O.sub.2 as the electron acceptor. In this case, formate oxidation is coupled to 2e.sup. reduction of O.sub.2 by DvHFDH2, resulting in 65 to 100% H.sub.2O.sub.2 production (reaction 3). It is projected that roughly 0-35% O.sub.2 is reduced to H.sub.2O by a 4e process (reaction 2). From a mechanistic perspective, this is reminiscent of how O.sub.2 insensitivity is achieved in some [NiFe]-hydrogenases..sup.108 However, given the high level of difficulty associated with detecting and quantifying H.sub.2O, only a handful of studies have been performed using redox enzymes..sup.98,101,109,110 Ongoing .sup.17ONMR studies should allow clarification of the stoichiometry of O.sub.2 reduction.
[0124] Co-occurrence of FOX and FDH Activities Is a Consequence of Metal-Based Electron Bifurcation. To better understand the redox biochemistry of DvH-FDH2, the results (
##STR00007##
[0125] Here, ox and red represent the oxidized and reduced forms of the enzyme, respectively, while F denotes formate. When DvH-FDH2 couples formate oxidation to the reduction of electron acceptors other than O.sub.2, it functions as a dehydrogenase (reaction 6). The kinetic (
[0126] Despite nearly a century of research, the precise mechanism(s) of FDH catalysis remains incompletely understood. Indeed, several structures have been determined,.sup.15,23,116,117 but none reveal a bound formate or CO.sub.2 near the tungstopterin cofactor (Wco). Nor do they consider radiation-induced photoreduction of protein crystals during X-ray data collection,.sup.118-120 thus raising questions about the significance of structures labeled oxidized or reduced. Not surprisingly, five mechanisms have been advanced to explain FDH catalysis with hydride (2e.sup. and a H.sup.+) transfer from formate to the Mo/W center being the most favored..sup.13,121 This paucity of essential information has led us to rationalize concurrent FDH and FOX reactions from first principles. Thus, the rapid equilibrium model.sup.122 is combined with Moser-Dutton formalism.sup.123,124 to help interpret the vagaries of electron transfer processes in DvH-FDH2. At the outset, six electrons would be needed for complete enzyme reduction-two for Wco (reactions 8 and 9) and one each for the four [4Fe-4S] clusters (reaction 10;
##STR00008##
[0127] Since formate is a two-electron donor, it would take 3 mol of the substrate to fully reduce all the redox sites in DvH-FDH2 (reaction 6). When O.sub.2 reacts with the completely reduced enzyme, nearly 3 mol of H.sub.2O.sub.2 are produced (reaction 7). Therefore, transfer of electrons from formate to Wco likely constitutes the rate-limiting step. Once the latter is accomplished, electrons are expected to rapidly equilibrate within the system via intramolecular transfer events. The iron-sulfur clusters are expected to function as electron sinks, facilitating the substrate to repeatedly inject electrons into Wco when cytochrome c is also involved. This scenario would require modification if both formate oxidation and O.sub.2 reduction were to occur at Wco. In any case, where electron flux is concerned, the redox equilibria would be expected to generate 48 unique enzyme microstates at varying levels of reduction. As the intramolecular electron equilibration is expected to be rapid, the reactivities of formate and O.sub.2 with the enzyme will be determined by the relative reduction potentials of their respective product-bound states (reactions 6 and 7). Meanwhile, understanding the mechanism of O.sub.2 activation is central to the question of how FOX activity is enabled. There are two possibilities. First, Wco may be directly involved. As precedent, the Mo-center of plant sulfite oxidase generates.sup.125 O.sub.2.sup..Math. as a product. Second, the large subunit [4Fe-4S] cluster is a potential candidate for producing H.sub.2O.sub.2 via reactions 11 and 12..sup.126
##STR00009##
[0128] Such sequelae are thought to irreversibly damage the clusters,.sup.105 and there is no evidence for this occurring in DvH-FDH2. Alternatively, by analogy with O.sub.2-insensitive [NiFe] hydrogenases, one of the [4Fe-4S] clusters of FDH2 could reduce O.sub.2 without being damaged during the process. Based on the structural prediction for DvHFDH2, it is expected for the O.sub.2 reduction site to be within the coordination distance of either W or the [4Fe-4S] cluster ligated to the large subunit. Extending this logic to cytochrome c (a one-electron acceptor; reaction 13),
##STR00010##
[0129] a plausible electron transfer path can be charted: formate.fwdarw.W.fwdarw.[4Fe-4S].fwdarw.Cyt c.
[0130] It is believed that both Uhc and equine cytochrome c target a site near the last [4Fe-4S] cluster of the small subunit. Thus, in the context of a macromolecular electron acceptor, formate oxidation and cytochrome c reduction sites are separated by 50 , which is beyond the tunneling distances where Moser-Dutton ruler operates (ca. 8-20 ).
[0131] Thus, it is unambiguous that there are at least two thermodynamically favored electron transfer paths in DvH-FDH2 to facilitate the simultaneous reduction of cytochrome c and O.sub.2 (reaction 14).
##STR00011##
[0132] A mechanism is shown to explain how this is accomplished (
[0133] However, new computational models predict that sites with normally distributed (uncrossed) potentials are EB-competent as well..sup.136 Considering that proton-coupled electron transfer.sup.137 must occur during both formate oxidation and O.sup.2 reduction, it is posited that inverted potentials likely dominate at the Wco site during catalysis. Consistent with this assessment, an extremely weak W(V) EPR signature is observed with aerobically or anaerobically formate-reduced DvH-FDH2 (
[0134] The MBEB mechanism is consistent with what has already been advanced in the context of QBEB or FBEB. Insofar as the gold-standard [butyryl-CoA dehydrogenase (Bcd)-electron transfer flavoprotein (EtfAB) complex devoid of iron-sulfur clusters].sup.139 undergoes FBEB in air utilizing two exergonic branches,.sup.14 allowing O.sub.2 to pick up the low-potential electron destined for ferredoxin,.sup.141 DvH-FDH2 engages MBEB to achieve a similar outcome (
[0135] System-level consequences are often overlooked when the focus is restricted to an enzyme or a mechanism thereof. This is true for FDH as well. Even though EB is an energy coupling mechanism, prevailing models cannot explain why the disruption of QBEB.sup.143 or reduction potentials.sup.145 fails to affect organismal growth and/or electron transfer pathways. Nonetheless, these unexpected outcomes hint that the cellular bioenergetic machinery is poised to seamlessly adapt to fluctuations in signals, circuits, and environmental conditions. Envisioning the big picture, testable hypotheses were carefully considered that emerge from the discovery of an O.sub.2-insensitive FDH. One of these focuses on energetic coupling via aerobic FBEB. To put it in perspective, FBEB is currently thought to be primarily beneficial to strict anaerobes. This confirmation bias stems from the view that electron transfer to ferredoxin is possible only when O.sub.2 is absent. As a result, clostridia are thought to stop benefitting from this mechanism once they encounter oxygenic conditions..sup.141 However, FBEB-capable human pathogens, such as Clostridioides difficile (formerly Clostridium difficile), retain growth in the presence of 2% O.sub.2. Nothing is known about whether FBEB contributes to the cellular energy expenditure in these oxic niches. If indeed Azotobacter vinelandii.sup.147 (an obligate aerobe with a hypoxic intracellular milieu) is a candidate for FBEB, so should be C. difficile. More importantly, it has been demonstrated that O.sub.2-evolving cyanobacteria utilize a mode of growth, which requires electron transfer to ferredoxin under aerobic conditions..sup.148 Although the authors do not invoke FBEB, those findings advance the hypothesis that O.sub.2-insensitive FDHs support energy coupling via aerobic FBEB. DvH-FDH2 is localized to the periplasm and, therefore, is unlikely to encounter ferredoxin or NAD.sup.+. However, O.sub.2-insensitive metallo-FDHs resident in the cytosol are likely well equipped to initiate FBEB under aerobic conditions. It is proposed that Methylosinus trichosporium OB3b FDH36,37 is a suitable candidate for exploring aerobic FBEB. It has also been noted that the inverted flavin potentials associated with this cytosolic enzyme.sup.36 may render it FBEB-competent, but such arguments did not take the following into consideration..sup.149 First, M. trichosporium (Mt) is an aerobic methanotroph, requiring O.sub.2 and methane for growth. Second, addition of formate to its growth culture leads to an increase in intracellular NADH levels. Third, in vitro reconstitutions have implied that NAD.sup.+-dependent FDH from Mt must reduce ferredoxin first before nitrogenase activity can be enabled..sup.150 Fourth, unpublished results.sup.151 show that flavin semiquinone is highly destabilized in Mt-FDH, with no more than 15% being detectable by EPR. Collectively, these observations engender confidence in the feasibility of aerobic FBEB. Since Gottschalkia acidurici (formerly Clostridium genus) FDH has already been shown to mediate FBEB under anaerobic conditions,.sup.152 it should be possible to properly assess how its Mt counterpart performs under aerobiosis. Empirical results from such investigations would inform the extent to which aerobes and facultative anaerobes exploit FBEB to meet their energy demands.
[0136] Molecular Basis of DvH-FDH2 O.sub.2 Insensitivity. In their phylogenetic analysis, Oliveira et al.sup.23 began with over 6000 FDH sequences and reduced it by an order of magnitude in an effort to understand how the variability impacts catalytic mechanism and O.sub.2 stability. Here, the sequence space was narrowed to just two closely related paralogsone of these (DvH-FDH1) is unable to achieve catalysis in the presence of O.sub.2 while the other (DvH-FDH2) thrives in air. To gain atomic insights, a de novo structure of the latter was built using AlphaFold2.1.sup.153 (
[0137] Although the active-site residues are largely conserved between FDH2 and FDH1, there are several differences in the vicinity of the tungsten center (compare
[0138] [4Fe-4S] clusters are prone to oxidative damage,.sup.105,126 and enzymes harboring them would be expected to be inactivated by H.sub.2O.sub.2 generated during aerobic catalysis..sup.157 However, this does not happen with DvH-FDH2. As a corollary, cellular experiments with the Campylobacter group of bacteria have shown that they harbor an FDH capable of producing H.sub.2O.sub.2..sup.158-160 In these organisms, H.sub.2O.sub.2 functions as a terminal electron acceptor in respiration..sup.95,96,161 E. coli capitalizes on H.sub.2O.sub.2 in a similar fashion..sup.162 Therefore, the environment of the active-site proximal [4Fe-4S] cluster was examined to glean insights. Strikingly, there are three substitutions (Y52F, S85T, and A236.fwdarw.S235) within a 5 radius (
[0139] Impact The findings reported here have broad utility in disparate fields of research. The current state of the art in formate/air biofuel cells is limited to mediated electron transfer because O.sub.2-sensitive metallo-FDHs need protection from redox polymer films to operate..sup.166 Consequently, a true formate/air biofuel cell is yet to be fabricated. DvH-FDH2 should be able to work in the absence of protective matrices and power biofuel cells via direct electron transfer. DvH-FDH2 should be able to work in the absence of protective matrices and power BFCs via direct electron transfer. All metallo-FDHs are thought to be capable of catalyzing the CO.sub.2 reduction reaction (CO2RR)..sup.14 However, there is no known biocatalyst that accomplishes CO2RR in air..sup.167 Also, it is not possible to test this reaction with low-potential artificial electron donors (e.g., MV) because they react with O.sub.2..sup.168 Since the redox cofactors of DvH-FDH2 are O.sub.2-insensitive, there is a high probability of exploiting bioelectrocatalysis to run the reverse reaction aerobically. Considering that an O.sub.2-insensitive [NiFe]hydrogenase has been successfully shown to perform aerobic bioelectrocatalysis,.sup.169-171 it should be possible to achieve the same with DvHFDH2. It is anticipated that redox bifurcation would also be in operation during aerobic CO2RR. If this prediction holds true, it will facilitate deeper understanding of a bifurcating site in the context of two fundamentally distinct reaction trajectories-formate oxidation and CO2RR. Photoexcited CdS nanodots.sup.172 offer an independent strategy for injecting electrons into the enzyme's active site. In conjunction with time-resolved infrared spectroscopy,.sup.173 CO2RR can be probed in greater detail. Surprisingly, despite the distinctive IR signature of CO.sub.2,.sup.174 only two relevant enzymes have been investigated using IR spectroscopy in the past five decades..sup.175,176 Structure-function relationships of DvH-FDH2 should inform tunability of catalytic bias,.sup.177 limits to electrocatalytic reversibility,.sup.178 and design of biomimetic metallosynthetics..sup.179 Aerobic formatotrophs couple formate oxidation (reaction 1) to O.sub.2 reduction,.sup.8,57 generating an energy equivalency of about 1.25 V. The ability to aerially manipulate DvH-FDH2 will enable strategies for shedding light on unusual bioenergetics.
III. Examples
Example 1: Construction of fdh Deletion Strains
[0140] The naming schemes for the fdh genes follow the convention established previously.sup.68. DvH deletion strains (Table 6) were constructed using methods already described.sup.191,200. Briefly, for the deletion of each predicted operon, two plasmids were constructed: one to create a marker-exchange deletion and another to remove the marker. Both plasmids are suicide vectors and require at least one homologous recombination event to occur to provide the selectable phenotypes. A phenotypic screen was performed to determine if a double recombination event took place, thereby increasing the likelihood of choosing isolates that had the desired genotype. Each vector contained a cloned copy of at least 300 bp upstream and a similar DNA region downstream of the operon targeted for deletion that were captured in a vector backbone containing the pUC origin of replication and a gene conferring spectinomycin-resistance. The plasmids were constructed by the sequence and ligation independent cloning (SLIC) technique.sup.201 with amplicons obtained from PCR using the primers found in Table 7 (Integrated DNA Technologies, Coralville, IA) and the Herculase II DNA polymerase (Life Technologies, Grand Island, NY). For the marker-exchange plasmids, the two DNA regions up- and down-stream are separated by an artificial, two-gene operon including aph(3)-IIa (conferring antibiotic resistance to 50 g kanamycin/mL in E. coli and 400 g G418/mL in DvH) and the counter-selectable marker uracil phosphoribosyltransferase (upp, DVU1025) genes. The marker-exchange plasmids were introduced by electroporation into a strain containing a deletion of the upp gene and the operon to be deleted. The transformed DvH cells were allowed to recover overnight at 34 C., as previously described.sup.200. The cells were then grown for 3-5 days on solidified MO medium supplemented with yeast extract (Y), lactate (L), and sulfate (S4) (hereafter referred to as MOYLS4 medium).sup.202 containing G418 to select for transformants. Single isolates were screened for sensitivity to 100 g spectinomycin/mL (consistent with the double homologous recombination event), sensitivity to 40 g 5-fluorouracil/mL (5FU.sup.S; to ensure the counter-selection of 5FU resistance (5FU.sup.R) would be effective) and maintenance of resistance to G418. A putative marker-exchange deletion isolate was then chosen and transformed with the marker-less deletion plasmid, as described above. The transformed cells were recovered, plated on medium containing 5FU and the three phenotypic markers again screened. For the marker-less deletion isolates, however, isolates were selected that were 5FU-resistant and G418-sensitive showing that the marker exchange cassette had been removed from the cell by double homologous recombination. Up to three isolates with the desired antibiotic-resistance phenotype were further analyzed by Southern blot. Once confirmed, one of these isolates was chosen as the marker-less deletion mutant.
TABLE-US-00006 TABLE 6 Strains and plasmids used in this study Strain or plasmid Genotype and relevant features Source Desulfovibrio vulgaris strains Desulfovibrio vulgaris Wild-type strain, ATCC 29579 ATCC Hildenborough JW710 Desulfovibrio vulgaris Keller et al., 2009 Hildenborough upp 5FU.sup.r JW2103 JW710 fdh2 This application JW2109 JW710 fdh3 aph(3)-IIa: upp This application G418.sup.r 5FU.sup.s JW2111 JW710 fdh3 This application JW2115 JW710 fdh1 This application JW2117 JW710 fdh2 fdh3 This application JW2120 JW710 fdh3 fdh1 aph(3)- This application IIa: upp G418.sup.r 5FU.sup.s JW2121 JW710 fdh3 fdh1 This application JW2123 JW710 fdh1 fdh2 This application JW2126 JW710 fdh3 fdh1 fdh2 This application aph(3)-IIa: upp G418.sup.r 5FU.sup.s JW2127 JW710 fdh3 fdh1 fdh2 This application CSR21210 JW2121 transformed with This application pJEG127 CSR21271 JW2127 transformed with This application pJEG132 Escherichia coli strains -select deoR endA1 recA1 relA1 gyrA96 Bioline hsdr17(r.sub.k m.sub.k+) supE44 thi-1 (lacZYA-argFU169) 80lacZM15 F- - Plasmids pCR8/GW/TOPO plasmid used to amplify pUC-Sp.sup.r Life Technologies fragment, Sp.sup.r pMO746 plasmid containing aph(3)-II: upp Parks et al., (2013) 2-gene operon, Ap.sup.r, Km.sup.r pMO2100 plasmid containing upstream and This application downstream regions of fdh-2 on either side of aph(3)-II: upp (used to construct marker-exchange deletion), Sp.sup.r, Km.sup.r pMO2102 plasmid containing upstream and This application downstream regions of fdh-2 (used to construct marker-less deletion), Sp.sup.r pMO2108 plasmid containing upstream and This application downstream regions of fdh-3 on either side of aph(3)-II: upp (used to construct marker-exchange deletion), Sp.sup.r, Km.sup.r pMO2110 plasmid containing upstream and This application downstream regions of fdh-3 (used to construct marker-less deletion), Sp.sup.r pMO2112 plasmid containing upstream and This application downstream regions of fdh-1 on either side of aph(3)-II: upp (used to construct marker-exchange deletion), Sp.sup.r, Km.sup.r pMO2114 plasmid containing upstream and This application downstream regions of fdh-1 (used to construct marker-less deletion), Sp.sup.r pMO9075 Plasmid used for genetic Keller et al (2011) complementation and/or gene Parks et al (2013) expression in Desulfovibrio strains. It contains Kmr gene- aph(3)-II promoter, pGB1, Sp.sup.r, and RBS. pJEG127 pMO9075 containing the This application DVU2482-2481 insert pJEG132 pMO9075 containing the This application DVU2482strII-2481 insert fdh1, fdh2, and fdh3 represent deletion of DVU0586-0588, DVU2481-2485, and DVU2809-2812 operons in DvH, respectively.
TABLE-US-00007 TABLE7 Primersusedinthisstudy Primername Primersequence Application SpecRpUC-F CCAGCCAGGACAGAAATGCCTCG(SEQ AmplificationofpUC- IDNO:1) Sp.sup.rfragment SpecRpUC-R ATGTGAGCAAAAGGCCAGCAAAAGGC AmplificationofpUC- (SEQIDNO:2) Sp.sup.rfragment KangeneProm CCGGAATTGCCAGCTGGGGCGC(SEQID Amplificationof Nterm NO:3) aph(3)-IIaandupp fragment uppgeneCterm CTTACTTGGTGCCGAATATCTTGTCGC Amplificationof (SEQIDNO:4) aph(3)-IIaandupp fragment DVU2481-5-upF GCCTTTTGCTGGCCTTTTGCTCACAT Amplificationof CACTCTTGCGCGAGGAAAGC(SEQID upstreamregionof NO:5) DVU2481-5 DVU2481-5-upR GCGACAAGATATTCGGCACCAAGTAAG Amplificationof GGGAAGGCATTAACCGATACTTG(SEQ upstreamregionof IDNO:6) DVU2481-5,specific formarker-exchange plasmid DVU2481-5-dnF GCGCCCCAGCTGGCAATTCCGG Amplificationof CCGACTGGATACGCAACACC(SEQID downstreamregionof NO:7) DVU2481-5,specific formarker-exchange plasmid DVU2481-5-dnR CGAGGCATTTCTGTCCTGGCTGG Amplificationof CCTGTTCGGACTCTCGATGTTC(SEQID downstreamregionof NO:8) DVU2481-5 DVU2809-12-upF GCCTTTTGCTGGCCTTTTGCTCACAT Amplificationof CAGAACCTCATCGCCATGC(SEQIDNO: upstreamregionof 9) DVU2809-12 DVU2809-12-upR GCGACAAGATATTCGGCACCAAGTAAG Amplificationof TCCTCTCCTTGTTGATGCCCTG(SEQID upstreamregionof NO:10) DVU2809-12,specific formarker-exchange plasmid DVU2809-12-dnF GCGCCCCAGCTGGCAATTCCGG Amplificationof GGGAATGTCGTCTCACGCAG(SEQID downstreamregionof NO:11) DVU2809-12,specific formarker-exchange plasmid DVU2809-12-dnR CGAGGCATTTCTGTCCTGGCTGG Amplificationof GTTTCCGGCAAGGTCAAGG(SEQIDNO: downstreamregionof 12) DVU2809-12 DVU0586-88-upF GCCTTTTGCTGGCCTTTTGCTCACAT Amplificationof TGGGCGTACAGTTCGGTATC(SEQID upstreamregionof NO:13) DVU0586-8 DVU0586-88-upR GCGACAAGATATTCGGCACCAAGTAAG Amplificationof GTGACAAAGCAACGCATCTTGTG(SEQ upstreamregionof IDNO:14) DVU0586-8,specific formarker-exchange plasmid DVU0586-88-dnF GCGCCCCAGCTGGCAATTCCGG Amplificationof TCTGCCGAAGAAAGATGCCTG(SEQID downstreamregionof NO:15) DVU0586-8,specific formarker-exchange plasmid DVU0586-88-dnR CGAGGCATTTCTGTCCTGGCTGG Amplificationof AGACCGTCCATCTCGTCTGC(SEQID downstreamregionof NO:16) DVU0586-8 DVU2481-85- GGGAAGGCATTAACCGATACTTG(SEQ Amplificationof MLD-upR IDNO:17) upstreamregionof DVU2481-85,specific formarker-less deletionplasmid DVU2481-85- CAAGTATCGGTTAATGCCTTCCC Amplificationof MLD-dnF CCGACTGGATACGCAACACC(SEQID downstreamregionof NO:18) DVU2481-85,specific formarker-less deletionplasmid DVU2809-12- TCCTCTCCTTGTTGATGCCCTG(SEQID Amplificationof MLD-upR NO:19) upstreamregionof DVU2809-12,specific formarker-less deletionplasmid DVU2809-12- CAGGGCATCAACAAGGAGAGGA Amplificationof MLD-dnF GGGAATGTCGTCTCACGCAG(SEQID downstreamregionof NO:20) DVU2809-12,specific formarker-less deletionplasmid DVU0586-88- GTGACAAAGCAACGCATCTTGTG(SEQ Amplificationof MLD-upR IDNO:21) upstreamregionof DVU0586-88,specific formarker-less deletionplasmid DVU0586-88- CACAAGATGCGTTGCTTTGTCAC Amplificationof MLD-dnF TCTGCCGAAGAAAGATGCCTG(SEQID downstreamregionof NO:22) DVU0586-88,specific formarker-less deletionplasmid pMO9075slic_F CAAGGATCTGATGGCGCAGGG(SEQID Amplificationof NO:23) pMO9075backbone pMO9075slic_R ATGGTACCTCCTGGGACTGCATTGCAG Amplificationof GGCTTCCCAACCT(SEQIDNO:24) pMO0975backbone 2481_pmo_R GATCGTGATCCCCTGCGCCATCAGATCC Amplificationof TTGTCAGGCGAAAGGACGCAGGCGCAA DvH-FDH2from CAA(SEQIDNO:25) genomicDNA 2482_pmo_F GCAGTCCCAGGAGGTACCATATGCGAA Amplificationof TGCCTCGCAGAACGTTC(SEQIDNO:26) DvH-FDH2from genomicDNA 2482_strII_R TCATTTTTCGAACTGCGGGTGGCTCCAA Amplificationof GCGCTGGCCTTGCGCAGGTTGACCATG DvH-FDH2-strII AA(SEQIDNO:27) strII_2481_F TGGAGCCACCCGCAGTTCGAAAAATGA Amplificationof TGGCGCGCCATCAGAAGACTTGAT(SEQ DvH-FDH2-strII IDNO:28) Underlined regions represent overhangs necessary for assembling the fragments by SLIC.
[0141] For operon deletions, the upstream and downstream regions, respectively, included 858 bp and 806 bp (fdh1; DVU0586-0588), 795 bp and 878 bp (fdh2; DVU2485-2481), and 976 bp and 970 bp (fdh3; DVU2809-2812). Parental strain JW710.sup.200 was used for the deletion of fdh1 and fdh3. Confirmation by Southern blot was accomplished by digesting the genomic DNA of the parental and putative deletion strains with AgeI (NEB, Ipswich, MA), separating the DNA fragments by gel electrophoresis, and probing with the upstream region.
Example 2: Plasmid Construction
[0142] pMO9075 backbone was amplified via Phusion polymerase (New England Biolabs #E0553S) using the primers pMo9075 slic_F and pMo9075 slic_R, separated on 0.6% TAE (BioRad QBI 351-008-131) agarose gel (BioRad 161-3102) and purified via gel extraction (Qiagen #28704). Inserts were amplified with Phusion polymerase via standard reaction conditions. Primers 2482_pmo_F and 2481_pmo_R were used to amplify FDH2 for cloning into pMO9075. Primers 2482_pmo_F and 2482_strII_R were used to amplify DVU2482, introducing the upstream vector flank to DVU2482 and a StrepII tag to the 3-end of DVU2482. Primers strII_2481_F and 2481_pmo_R were used to amplify DVU2481 with StrepII-tag overlap (while maintaining native intergenic spacer) and downstream vector flank. Amplicons were separated in 0.6% TAE agarose gels and purified by gel extraction. Inserts were assembled with vector backbone via overlap assembly using Gibson cloning (New England Biolabs #M5510A). Assembly reactions were used to transform E. coli -select chemically competent cells (Bioline BIO-85026) and colonies were selected on YT glucose plus 50 mg/mL spectinomycin HCl (Sigma-Aldrich S9007). For positive clones, 50 mL of transformant was grown in MDAG-11 formulated in house.sup.203 supplemented with spectinomycin, and the plasmid was purified using a Qiagen Plasmid Midi Kit (Qiagen 12943).
Example 3: Bacterial Growth
[0143] DvH strains were grown on MOYLS4 medium (see Protocol 1 below), which was adjusted to pH 7.2 with NaOH. Thioglycolate was added after equilibration to dinitrogen (Airgas NI NF200 or research grade) and before bottling. For generating inocula, media were bottled anaerobically under dinitrogen (5 psi), 50 mL per 100 mL serum bottle (Duran Wheaton Kimble 223747) with butyl rubber stopper (Chemglass CLS-4209-14) and aluminum crimp seal (Wheaton 20-0000AS). For larger volumes, glass media bottles (Pyrex 1395500, 13951L; Fisher 06-414-1C/06-41401D) were sealed with no. 6 neoprene stoppers (RPI-259100-6) and capped with media bottle lid with a center bore to access the stopper. Bottles were autoclaved and vitamins were syringed in from a filter sterilized (RPI 256131) 1 stock just before inoculation. Protocol 1: MO medium for cultivating Desulfovibrio strains. When supplemented with yeast extract (Y), lactate (L) and sulfate (S4) it is referred to as MOYLS4. Note that DvH can also be grown in the absence of L, wherein formate (F; 60 mM) serves as the electron donor. In this case, acetate (A; 10 mM) must be included as the carbon source. Therefore, formatotrophic growth medium is referred to as MOYFAS4 (see
Materials:
[0144] Serum bottles 100 mL (Wheaton) [0145] Media bottles 500 mL, 1000 mL, 2000 mL (Gibco or Duran); caps modified in-house to include a 7 mm center bore. [0146] Butyl rubber stoppers (Chemglass CLS-4209-14) [0147] Neoprene stoppers size 6 (RPI-259100-6) cut to original height [0148] Magnetic stirrer
Equipment:
[0149] Autoclave [0150] Gas manifold [0151] pH meter
Reagents:
TABLE-US-00008 Magnesium chloride hexahydrate Sigma-Aldrich M9272 BCBT8684 Ammonium Chloride Sigma A9434-1KG SLBS1591V Calcium Chloride dihydrate Acros 207780010 A014020501 Tris HCl Fisher BP153-500 200711 Iron (III) Chloride Hexahydrate Acros 423705000 lot A013817901 EDTA Fisher BP120-1 lot 055880 Yeast Extract- Sigma-Aldrich 92144-5KG-F BCBQ9331V Thioglycolate Sigma T0632-25g STBH2638 Sodium DL-lactate 60% syrup Sigma L1375-500mL SLBR4194V Sodium Sulfate Sigma-Aldrich 239313-2.5KG SLBT9903 Potassium phosphate dibasic Fluka 60353 1167325 Sodium phosphate monobasic Fluka 71505 1203314 Manganese Chloride tetrahydrate Acros Organics 2058950000 A012429101 Cobalt Chloride hexahydrate Sigma C3169 70K3698 Zinc Chloride hexahydrate Sigma Z-4875 20K0264 Sodium molybdate dehydrate Sigma M1003 085K0098 Boric Acid Sigma B-7660 042K0150 Nickel Chloride ICN 155825 8649C Copper Chloride dehydrate Sigma C-6917 121K0014 Sodium Selenate Sigma S8295-25G SLBD3716V Sodium Tungstate dehydrate Aldrich 223336-5g MKBV3962V Biotin Sigma-Aldrich B4501-1g SLBS3069V Folic Acid Sigma F7876-1g SLBN1618V Pyridoxine HCl RPI P50240-10.0 10874462 Thiamine HCl Sigma T-4625 062K0103 Riboflavin Sigma R-4500 072K0887 Nicotinic Acid Sigma N-4126 052K0200 DL Pantothenic Acid Sigma P-2250 013K0583 4-Aminobenzoic Acid Sigma A9878-5G MKBZ3723V Lipoic Acid Sigma T5625-500g SLBS2381V Choline Chloride Fisher AC110290500 A0400838 Vitamin B12 Sigma V-2876 112K0646 Sodium hydroxide Fisher BP359-500 lot 201811 Sodium Resazurin Aldrich 199303-1G MKBP2801V
Solutions
TABLE-US-00009 Trace Metals Stock solution (1 L) (g) Manganese Chloride tetrahydrate 0.5 Cobalt chloride hexahydrate 0.3 Zinc Chloride 0.2 Sodium molybdate dihydrate 0.05 Boric Acid 0.02 Nickel chloride 0.09 Copper chloride dihydrate 0.002 Sodium selenate 0.006 Sodium tungstate dihydrate 0.008
TABLE-US-00010 Vitamins solution working stock (10x) (g) Biotin 0.02 Folic Acid 0.02 Pyridoxine HCl 0.1 Thiamine HCl 0.05 Riboflavin 0.05 Nicotinic Acid 0.05 DL Pantothenic Acid 0.05 4-Aminobenzoic Acid 0.05 Lipoic Acid 0.05 Choline Chloride 2 Vitamin B12 0.01 [0152] pH 7.0 with KOH. Filter, sterilize and store at 20 C.
Vitamins Solution Working Stock (1)
[0153] 10 mL of 10 filter sterilized into 90 mL of anaerobic (N.sub.2 sparged) water. Stored at 4 C. and in the dark.
Sodium Resazurin 0.1%
[0154] 0.1 g [0155] 100 mL water
0.5 M EDTA
[0156] 93 g EDTA [0157] pH to 8.0 with NaOH [0158] volume to 500 mL with MilliQ water
FeCl/EDTA Solution 125 mM/250 mM-4.8 mL [0159] 0.162 g Iron chloride Hexahydate [0160] 2.4 mL water [0161] 2.4 mL 0.5 M EDTA
TABLE-US-00011 Potassium/Sodium Phosphate 1M per L Potassium Phosphate dibasic 87 g Sodium phosphate monobasic 78 g
MOYLS4 Medium 1 L
[0162] To 800 mL MiliQ water add: [0163] 1.6 g Magnesium Chloride hexahydrate [0164] 1.06 g Ammonium Chloride [0165] 0.088 g Calcium Chloride dihydrate [0166] 2 mL Potassium/Sodium Phosphate solution [0167] 6 mL Mo-Trace elements [0168] 4.73 g Tris HCl (or 15 mL 2M-pH 7.2) [0169] 1 g yeast extract [0170] 11.2 mL sodium lactate 60% [0171] 4.26 g Sodium sulfate [0172] 0.16 mL sodium resazurin 0.1% [0173] 0.48 mL Iron chloride/EDTA 125 mM/250 mM (see Methods) [0174] Bring to 1 L and pH to 7.2 with 4M sodium hydroxide. [0175] Bubble under N.sub.2 gas with stirring for 1 hr [0176] Add 0.14 g Sodium Thioglycolate
[0177] Cap bottle with number 6 neoprene stopper and medium bottle cap with center bore hole, or distribute under N.sub.2 to serum bottles (50 mL per 100 mL bottle) and cap with butyl rubber stopper and aluminum crimp seal.
[0178] Autoclave liquid cycle. Cool to room temperature.
[0179] To finish medium, add 1 vitamin stock at 0.5 mL per 50 mL, just prior to inoculation by sterile anaerobic transfer. Add desired antibiotics at this time as well.
Example 4: Transformation
[0180] DvH strains were grown in 50 mL MOYLS4 in 100 mL serum bottle at 37 C with nitrogen headspace to near stationary phase and chilled on ice. Cells were aerobically spun down in a 50 mL conical centrifuge tube (Corning 430828) at 7,500g for 5 min, then washed twice in 17 mL of ice cold 15 mM Tris pH 7.2, 10% glycerol supplemented to 1 mM with dithiothreitol. The final pellet was resuspended to 1 mL in the same buffer. A 100 L aliquot of cells was aerobically mixed on ice with 7.5 L from plasmid midi prep (2-3 g plasmid) and electroporated at 1.5 kV in an Eppendorf electroporator 2510 (1 mm gap cuvette; MBP #5510). 1 mL of sterile anaerobic MOYLS4 was immediately added and the entire volume was transferred to a bottle of MOYLS4. The bottle was incubated at 37 C (Glascol, Micro-expressoin Vertiga shaker). Once the culture recovered and became densely turbid, transfers were made to fresh medium containing 100 g/mL spectinomycin HCl. After two rounds of growth with spectinomycin selection, freezer stocks in 10% glycerol were made. For colony selection the same medium supplemented with 1.5% agar, 5 mM cysteine, 1 mM sodium sulfide, and 100 g/mL spectinomycin was used and kept in gas tight jars with an AnaeroGen 3.5 L Gas generating system pack (Oxoid). Colonies were picked into selective medium using a sterile 1 mL syringe (Becton Dickinson 309659) fitted with an 18-gauge needle.
Example 5: 10 L Carboy Growth of DvH-FDH2 Producing Strain CSR21271
[0181] For each carboy, the strain was transferred from 10% glycerol freezer stock in MOYLS4 medium; 0.5 mL of stock added to a 50 mL bottle of anaerobic MOYLS4 medium, supplemented with vitamins and 100 g/mL spectinomycin hydrochloride. Transfers were made by nitrogen purged syringe with 23-gauge needles (Becton Dickinson 305190). The culture was incubated overnight at 37 C or until mid-exponential phase of growth. 20 mL of the overnight culture was used to inoculate a 500 mL bottle of MOYLS4 medium, containing vitamins and 100 g/mL Spectinomycin HCl. The 500 mL culture was incubated overnight at 37 C. 10 Liters of MOYLS4 medium in 2 L bottles, prewarmed, sterile, aerobic, with iron and EDTA withheld, was poured into a sterile 10 L polypropylene carboy (Thermo 2250-0020). The medium was completed by addition of filter sterilized vitamins, spectinomycin hydrochloride (Ig dissolved in 15 mL water; 100 g/mL final) and 4.8 mL of iron chloride (125 mM; Acros 423705000)/EDTA (250 mM; Fisher BP120-1) solution. The carboy was closed and purged with nitrogen via a butyl rubber stopper port (Chemglass CLS-4209-14) affixed to the lid (
Example 6: Protein Expression and Purification
[0182] Strep-tag II-tagged DvH-FDH2 was purified from strain CSR21271 (see Table 6). Unless specified otherwise all the following steps were done at 4 C and under atmospheric conditions. Nitrate, azide, or thiols were not used at any step of the purification or storage. Cells (18 g) were suspended in six volumes of 50 mM sodium phosphate (Fluka 71505, Sigma-Aldrich S0786), pH 7.4, containing 150 mM sodium chloride and 1 mL of 50Complete Proteinase inhibitor (Roche 45582400; 1 tablet in 1 mL of MilliQ water), by gentle pipetting in cold buffer. Cells were lysed using an Avestin C3 homogenizer and cell debris spun down at 4500g (Beckman Avanti HP-26 XPI) for 15 min. Membrane vesicles were removed by centrifugation at 285,000g 1 hr (Beckman Optima L100XP). The clarified lysate was then fractionated by ammonium sulfate precipitation with fractions pelleted at 10,000g for 10 min and the 40-70% saturating fraction was retained and exchanged via centrifugal concentrator (Amicon 30 kDA molecular weight cutoff) into 100 mM Tris-HCL buffer pH 8, containing 150 mM NaCl and 1 mM EDTA. The sample was loaded on to streptactin-XT superflow resin (IBA-LifeSciences) and the column was washed with 40 volumes of the same buffer. StrepII-tagged protein was eluted by several column volumes of 100 mM Tris-HCl buffer, pH 8, containing 150 mM NaCl, 1 mM EDTA, and 50 mM biotin (IBA-LifeSciences 2-1016-005). The protein was concentrated via centrifugal concentrator (Amicon 30 kDA MWCO) and exchanged into 20 mM Tris-HCl buffer pH 8.0, with or without 10% glycerol (Sigma-Aldrich 49770) and stored at 80 C for future use. The protein concentration was estimated by BCA assay (Thermo Fisher) versus a BSA standard.
Example 7: Gel Electrophoresis
[0183] DvH-FDH2 was separated on a Nupage 4-12% Bis-Tris Gel (Thermo Fisher). The running buffer was 1MES-SDS. The sample was loaded as 5 L of 12 M DvH-FDH2 in 62.5 mM Tris-HCl buffer, containing 1.5% SDS, 10% sucrose, 0.0075% bromphenol blue, pre-incubated at room temp (23 C) for 30 minutes and then heated 5 minutes at 50 C. The protein was run alongside Precision plus Kaleidoscope prestained standards (Bio-Rad #1610375) for 100 minutes at 100 Volts (Invitrogen mini gel talk A25977). The gel was fixed in 40% methanol, 10% acetic acid, stained in 30% methanol, 10% acetic acid, and 0.05% Coomassie blue G-250, and destained in 8% acetic acid. Gels were scanned with a gel doc imager (Bio-Rad).
Example 8: Chromogenic Visualization (In-Gel Assay)
[0184] DvH-FDH2 was separated on a standard Tris buffered 5% polyacrylamide gel, 2.6% crosslinker gel supplemented with 0.05% triton X-100 (Fisher BP151-100). The running buffer was 25 mM Tris, 192 mM glycine and 0.05% triton X-100 (v/v). Every other lane was loaded with 7.5 L of 3 M FDH2 in 20% sucrose, 0.25M Tris pH 6.9, 0.05% triton, 0.0125% bromphenol blue. Electrophoresis was conducted at 100 V for 209 minutes, 10 mA limit at 4 C. Lanes were cut into strips then assayed in 10 mL of 0.24 mg/mL nitroblue tetrazolium (NBT; Invitrogen N6495) in 20 mM Tris pH 8.0 with or without 10 mM formate (added as 100 L of 1 M). Strips were incubated with shaking for 15 minutes and then washed with MilliQ water for 35 min, and then scanned on a Bio-Rad Gel Doc imager.
Example 9: NBT Strip Assay
[0185] 3 mm strips of chromatography paper (Whatman), cut with a paper cutter, were soaked with a solution of 300 M NBT (1 mL of 3 mM in water), 30 M PMS (Sigma P9625) (1 mL of 300 M in ethanol) in 8 mL Tris-buffered saline pH 7.5, with or without 10 mM formate (Aldrich 798630-500 g) (100 L of 1 M in water). Strips were then spotted with 5 L of 12 M enzyme or control solution (buffer only) and monitored for color development. PMS was added to the NBT solutions to 30 M final from a 30 mM stock in water before soaking the strips. For the NBT only experiment, strips of Whatman chromatography paper (8.8 cm.sup.2) were soaked with 140 L of 293 M NBT in 20 mM Tris pH 8.0 with or without 10 mM sodium formate. FDH2 was spotted onto strips as a 5 L drop of 12 M of enzyme in 20 mM Tris pH 8.0.
Example 10: Metal Analysis
[0186] Inductively coupled plasma mass spectrometry (ICP-MS; iCAP-RQ Thermo Scientific) was used in the KED mode to assess the metal stoichiometry of DvH-FDH2. Protein samples were prepared by vortexing each protein sample for 10 seconds followed by centrifugation at 100g for 20 seconds. 25 L of each sample were put into 15 mL conical tubes followed by the addition of 200 L of Optima grade HNO.sub.3. Samples were digested for 20 minutes at room temperature followed by the addition of 9.775 mL of Millipore H.sub.2O for a final acid matrix of 2% HNO.sub.3 (v/v). QCS27 was used as a multi-element standard as well as W individual standard. The following isotopes were chosen for analysis: .sup.56,57Fe, .sup.63,65Cu, .sup.77,78,82Se, .sup.95,96,98Mo, and .sup.182,183,184W. The internal standards selected for analysis were: .sup.6Li, .sup.45Sc, .sup.89Y .sup.115In, .sup.209Bi. All sample were run with one survey run and three main peak jumping runs.
[0187] Enzymology. Protein Concentration Assessment. Because TN (k.sub.cat) calculation requires that the enzyme concentrations be determined accurately, four approaches were utilized (a) quantification via known extinction coefficients (F) of [4Fe-4S] clusters with .sub.410=15,000 M.sup.1 cm.sup.1 per [4Fe-4S].sup.2+ cluster.sup.181 or .sub.410=4000 M.sup.1 cm.sup.1 per Fe atom;.sup.81 (b) evaluating the extinction coefficient of DvH-FDH2 via electronic spectroscopy; (c) bicinchoninic acid assay (Thermo Fisher) versus a BSA standard; and (d) cross-checking values with .sub.410=43,446M.sup.1 cm.sup.1 reported for DvH-FDH1..sup.23 Using these strategies, the final concentration of DvH-FDH2 used in all enzyme kinetics and O.sub.2 reduction measurements was estimated to be in the range of 1.1-1.6 nM. Since significant systematic errors are associated with enzyme concentration determination via dyebinding or electronic spectroscopy, the results are typically calibrated via quantitative amino acid analysis..sup.182 Furthermore, cluster concentrations would be independently assessed by iron.sup.183 and sulfide.sup.184 analysis. These corrections could not be made here. Unless specified otherwise, the highest protein concentration value (1.6 nM) was used to derive kinetic parameters.
[0188] Evaluation of Electron Acceptor Specificity. BV, PMS, 1-methoxy-phenazinemethosulfate (mPMS; Dojindo M003-10), PES, DCPIP, water-soluble tetrazolium-1 (WST-1; Fisher/Dojindo NC1343907), potassium ferricyanide (FC; Sigma 244023), and O.sub.2 were tested for their ability to accept electrons derived from enzymatic formate oxidation. Reaction conditions are described in the legends to
Example 11: Benzyl Viologen Assay
[0189] In this assay, the one-electron reduction of BV (colorless) by DvH-FDH2 produces BV.sup.+ (blue or purple), which is followed spectrophotometrically..sup.28,185 The workflow is described in
Example 12: Phenazine Ethosulfate (PES)/Dichlorophenolindophenol (DCPIP) Assay
[0190] In this dye-linked assay, PES (E.sub.m,7=+65 mV) serves as the primary electron acceptor. Following its reduction by FDH2, PES nonenzymatically transfers electrons to a second dye, DCPIP, facilitating spectrophotometric detection..sup.91 Workflows are described in
Example 13: Data Analysis
[0191] For classical steady-state kinetics, initial velocities (guided by residual plots) were obtained using ICEKAT..sup.188 KinTek Explorer.sup.84,89 (version 10.1.6, KinTek Corporation) was used to perform global fitting of enzyme kinetics data to Schemes 1 and S1. This is based on numerical integration of rate equations. Confidence contour analysis was carried out to assess whether the parameters were properly constrained by the data.
Example 14: Spectroscopy. Electronic Data Analysis
[0192] FDH2 spectra were collected at 23 C in 50 mM Tris pH 8.0 using a screw cap 1 cm pathlength quartz cuvette (Starna; 1-SOG_10_GL14s with GL14S cap). For aerobic spectra the spectrum of air equilibrated enzyme was collected, formate was added to 10 mM and the formate reduced spectrum was collected. The sample was then capped with silicone septa (Starna GL14/SI) and 10 L of 2 mM of dithionite was added under argon before collecting a spectrum. For anaerobic measurements, FDH2 was gassed with argon in the sealed cuvette before addition of formate or dithionite. Reduced spectra were also measured using dithionite as the sole reductant (in the absence of formate). Dithionite was prepared in an anaerobic buffer immediately before use.
Example 15: Electron Paramagnetic Resonance (EPR)
[0193] All samples were prepared in 20 mM Tris-HCl, pH 7.6 containing 10% glycerol (v/v). Anaerobic samples were first purged with Ar and then transferred to septum-sealed, Ar-flushed EPR tubes and reduced with either 20 mM anaerobic sodium formate or 4 mM anaerobic sodium dithionite. Aerobic samples were reduced directly in open EPR tubes with either 20 mM sodium formate or 2 mM sodium dithionite. All samples were subsequently frozen in a dry ice/ethanol bath, then transferred to liquid nitrogen for storage. The anaerobic sample reduced with sodium dithionite was incubated for 12 h prior to freezing.
[0194] EPR spectra were recorded using a Brker EMX spectrometer operating WinEPR version 4.33 acquisition software and equipped with a Bruker ER 4119HS high sensitivity X-band cavity and gaussmeter. Temperature was controlled with a Brker variable temperature unit and a liquid nitrogen or liquid helium cryostat. For purposes of comparison, all spectra were calibrated to a microwave frequency of 9.385 GHz. Integration of the iron-sulfur EPR signals was performed using spectra collected at 15 K, using Megasphaera elsdenii ferredoxin (product of locus AL 641500; UniProtKB-P00201) as a standard. Detailed instrument settings are included in the figure captions. Simulations were performed using the EasySpin 4.5.5 software package..sup.189 Simulations included a weight term, which was used to estimate the relative contribution of each component to the composite spectrum.
Example 16: Nuclear Magnetic Resonance
[0195] NMR data were recorded on an Agilent DD2 500 MHz spectrometer equipped with a 5 mm quadruple (.sup.1H, .sup.13C, .sup.15N, .sup.31P) PFG Penta Probe, which was maintained at 25 C. .sup.13C data were acquired with 70332 points with a spectral width of 30,478 Hz, 242 ppm centered at 110 ppm, with proton-decoupling on throughout the experiment (1 s delay between transients and 1.15 s of acquisition time) and the number of transients collected ranged from 64 to 1024. The fids were zero-filled and multiplied with a 3-Hz line-broadening function prior to Fourier-transformation; the final size of the spectrum was 65536 points. Proton data were recorded with 16384 points with a spectral width of 7530 Hz (15 ppm centered at 4.7 ppm) with pre-saturation (2 s) to suppress the water peak; 1 s delay between transients were used. Additional parameters are detailed in the supplement. .sup.13C-formate (9.5-10.5 mM in 100 mM sodium phosphate buffer, pH 6 or 7.5) and .sup.13C-sodium bicarbonate (4.8 mM in 100 mM sodium phosphate buffer, pH 6) reference spectra were first collected using standard 5 mm thin-walled NMR tubes (Wilmad). 10% D.sub.2O was used to obtain internal signal lock. Subsequently, 1.3 M of DvH-FDH2 was added to the tube containing .sup.13C-formate (pH 7.5), mixed, and spectra were recollected. Upon completion, 2 mM PES was added to the same tube, mixed, and remeasured. Independently, this process was repeated with .sup.13C-formate at pH 6. NMR data were processed with MestReNova NMR suite version 14.2.1-27684.
Example 17: Quantification of O.SUB.2 .Reduction; Oxygen Consumption
[0196] A Clark-type O.sub.2 electrode (Hansatech Instruments Oxygraph.sup.+System) was used to measure O.sub.2 uptake at 23 C. The electrode was calibrated with dithionite. Order of reagent additions are described in the respective figure legends. A Clark-type O.sub.2 electrode (Oxygraph Plus System from Hansatech Instruments, UK) was used to monitor changes in the dissolved O.sub.2 concentration, which corresponds to 267 M at 23 C. O.sub.2 saturation under these conditions would be equivalent to 1.27 mM. A decrease in the O.sub.2 level would indicate that O.sub.2 was being consumed during aerobic catalysis. Conversely, O.sub.2 evolution would be diagnostic of catalase activity. The electrode was calibrated each time before use with air-saturated water and dithionite as per the manufacturer's instructions. Freshly made reagent stocks and buffer solutions were used throughout. 1 mL reactions were performed at 23 C. in a closed cell using air-saturated 100 mM Tris-HCl, pH 8, containing 1 mM EDTA (Fisher BP120-1). The latter was added to limit adventitious metal ions from mediating O.sub.2 consumption. After obtaining a stable baseline with the buffer, 10 mM formate was added, and the baseline was allowed to stabilize. The reaction was started by the addition of 50 nM DvH-FDH2. Once the O.sub.2 consumption plateaued, 2 M catalase (Sigma C1345-G) was added. Catalase catalyzes the redox disproportionation of H.sub.2O.sub.2 to water and dioxygen (2H.sub.2O.sub.2.fwdarw.2H.sub.2O+O.sub.2). To test the effect of additives, the order of addition was changed. For example, to test whether DvH-FDH2 had catalase activity, H.sub.2O.sub.2 was added to the buffer first, followed by the enzyme. Similarly, to assess the effect of superoxide dismutase (SOD) on O.sub.2 uptake, SOD (Sigma S5395-15KU; 250 U/mL) was the first component to be added. SOD catalyzes the dismutation of superoxide radical anion: O.sub.2.sup..Math.+2H.sup.+.fwdarw.2H.sub.2O.sub.2+O.sub.2. O.sub.2 consumption rates were calculated as described before..sup.190 Initial velocities were determined from the slopes of [O.sub.2] versus time traces after subtracting O.sub.2 consumption under the same experimental conditions without FDH2.
Example 18: Quantification of O2 Reduction; H.SUB.2.O.SUB.2 .Production
[0197] Amplex Red (AR) Method. 5 mg of AR (Invitrogen A12222) was dissolved in 0.9725 mL of neat dimethyl sulfoxide (DMSO) to yield a 20 mM solution. Horseradish peroxidase (HRP) (Sigma P8250-5ku) was prepared at a concentration of 10 U/mL (45.5 g/mL) in sodium phosphate pH 7.4. Prior to the assay, a 2 working solution was prepared from 10.6 L of 20 mM AR, 80 L of HRP, 1.6 L of 0.5 M diethylenetriaminepentaacetic acid (DTPA; TCI D0504), and 3.9 mL of 50 mM sodium phosphate pH 7.4 and kept in the dark. Production of H.sub.2O.sub.2 was measured by preparing reaction mixtures in a Costar 3915 black flatbottom 96-well plate. Reactions used 50 mM sodium phosphate pH 7.4, with desired amounts of sodium formate added from a 50 M stock and initiated by addition of 5 L of 32 nM DvH-FDH2 in the same buffer to a volume of 50 L. This approach allowed H.sub.2O.sub.2 generation to commence prior to the introduction of the AR/HRP mixture. A H.sub.2O.sub.2 (Sigma-Aldrich H1009-100 mL) standard curve was generated in the same buffer to a volume of 50 L. Detection was initiated by addition of 50 L of the 2AR/HRP working solution, and fluorescence was scanned in top read mode at medium sensitivity on a SpectraMax M2 (Molecular Devices) plate reader (excitation 530 nm and emission 590 nm) every 4 min for 12 min (23 C.). Independently, it was assessed whether outcomes differed when the order of addition was varied. Therefore, in one set of assays, 5 L of 32 nM FDH2 was added after AR/HRP. Here, 0.5 mM DTPA was used instead of 0.1 mM.
[0198] Coumarin Boronic Acid (CBA) Assay. 10 mg of coumarin boronic acid (CBA) Cayman Chemicals 14051) was dissolved in 3.33 mL of DMSO. 101 L of the CBA stock and 1.6 L 0.5MDTPA were added to 3.9 mL 50 mM sodium phosphate pH 7.4 to produce a 2 working solution. The remaining steps essential identical to those used in the AR assay except that the plate was shaken at 400 rpm in an incubator (23 C.) for 15 min prior to CBA addition. Fluorescence detection was initiated by addition of 50 L of the CBA 2 working solution, and the plate was scanned in fluorescence mode (excitation 332 nm and emission 470 nm). This method was also used in the context of redox bifurcation to quantify H.sub.2O.sub.2 production by DvH-FDH2 in the presence of 30 M cytochrome c. Independently, the latter was incubated with H.sub.2O.sub.2 for the same duration (in the absence of DvH-FDH2) to assess the extent of peroxidase activity. Cytochrome c concentration was estimated as follows: oxidized .sub.410=106.1 mM.sup.1 cm.sup.1 and reduced .sub.550=29.5 mM.sup.1 cm.sup.1.
[0199] The following controls were common to both CBA and AR assays. (1) Heat-denatured DvH-FDH2, (2) addition of catalase (100 U/mL), (3) addition of SOD (10 U/mL), (4) FDH2 omitted, (5) fluorogenic substrate excluded, (6) formate excluded, and (7) buffer only.
Example 19: Quantification of O.SUB.2 .Reduction; Superoxide Generation
[0200] Native (Sigma C2506) and partially acetylated (Sigma C4186) equine heart cytochrome were used to assess superoxide production by DvH-FDH2. The integrity of oxidized cytochrome c was validated by establishing the presence of a 695 nm transition. The reduction of 30 M (native) or 60 M (partially acetylated) cytochrome c by DvH-FDH2 was followed at 550 nm in a 1 cm pathlength cell (Shimadzu UV-2600i spectrophotometer). A 2-fold higher concentration of acetylated cytochrome c was used to offset its slightly weaker reactivity with superoxide..sup.104 The reaction mix (total volume 2.5 mL) was stirred (Cowie 001.1609) at 300 rpm (Quantum T2/Peltier unit) and maintained at 25 C. For aerobic experiments, open-top styrene disposable cuvettes (Brand 75907D) were used. For anaerobic measurements under argon, screw-capped quartz cuvettes (Starna 1-SOG-10_GL14-S) sealed with Suba-Seal 13 white rubber septa (Sigma Z167258) were used. To 50 mM Tris-HCl buffer, pH 8, containing cytochrome c, FDH2 (1.6 nM final) was added first to obtain the background signal. Subsequently, 10 M formate was added to start the reaction. Upon completion, 2 mM dithionite was spiked into the mix to estimate the amount of remaining oxidized protein. Controls devoid of formate, enzyme, and cytochrome c were also employed. The effect of SOD (10-100 U/mL) or catalase (100-400 U/mL) was tested independently.
[0201] Example 20. Structural Analysis. Protein alignments were constructed using MUSCLE or MAFFT. Structural alignments were performed using Chimera v1.16. Amino acid sequences of the large (DVU2482) and small (DVU2481) subunits of DvHFDH2 were input together for running structure predictions using a modified version of AlphaFold2.1..sup.153 Because this algorithm does not recognize Sec, a Cys was substituted and Tat signal peptide (see
Example 21: FDH Electrodes
[0202] Unless stated specifically, all chemicals were purchased from Sigma Aldrich. Highly oriented pyrolytic graphite (HOPG) were obtained from Bruker AFM Probes. Multi-walled carbon nanotubes (MWCNTs) were purchased from Cheap Tubes (catalog number 030303). Ethylene glycol diglycidyl ether (EGDGE) was obtained from Polysciences, Inc. Known synthesis of benzyl viologen modified linear polyethyleneimine (BV-LPEI), naphoquinone modified linear polyethyleneimine (NQ-LPEI) and cobaltocene modified poly allyl amine (Cc-PAA) was used.sup.224-226.
[0203] The electrodes were prepared as follows. Enzyme preparation: DvH-FDH2 shipped frozen on dry ice in a buffer containing 50% glycerol was first solvent exchanged via centrifugation to remove the glycerol. The buffer used for this purpose was 50 mM Tris-HCl buffer, pH 8. This resulted in a final enzyme concentration of approximately 10 mg/mL. The enzyme sample was prepared immediately before being used for immobilization. Preparation of Multi-walled carbon nanotube (MWCNT) suspension: COOH-functionalized MWCNTs were added to 100% isopropanol at a final concentration of 5 mg/mL. The resulting suspension was disrupted by sonication for 1 h. The final suspension was then left to stand for an additional hour prior to use. Stored at room temperature (methodology is identical to that reported in Milton 2017.sup.197).
[0204] HOPG was cut into 5 mm12 mm1 mm. No other modification was done. The HOPG electrode is made up of graphite layers. Therefore, washing is not required. Instead, Scotch tape was used to peel off the layer, resulting in a clean surface. 10 L of 5 mg mL-1 MWCNTs dispersion in isopropanol was deposited on the clean electrode surface and the isopropanol was allowed to dry in air. This happened in less than 3 minutes. After this step, the MWCNTs were adsorbed to the electrode surface. The incubation time did not make a difference in the adsorption process. All the deposition was done on the largest square surface (12 mm*12 mm).
[0205] Electrochemistry buffers and solutions: Freshly prepared 50 mM Tris-HCl buffer, pH 8.0. A formate solution (1 M) was prepared using this 50 mM Tris-HCl buffer.
[0206] Electrochemistry equipment: Bioelectrodes were initially evaluated using cyclic voltammetry with a potentiostat operating in a standard 3-electrode half-cell configuration. Typically, a large platinum counter electrode was used along with common reference electrode (saturated calomel electrode). Methodology identical to that used in Milton 2017.sup.197.
[0207] Using a positive displacement pipette, 10 L of the MWCNTs suspension was first deposited onto the surface of HOPG to yield an approximate loading of 0.33 mg/cm2. Subsequently, once the electrode was dry (3-5 min at room temperature), 5 L of the enzyme solution was placed onto the modified surface (MWCNTs, using electrode area of 0.15 cm2) of the HOPG and left to dry for 90 mins. The resulting electrode was neither rinsed nor washed before use. Initially, bioelectrodes were electrochemically cycled for 10 complete cycles at 50 mV/s before the real measurement. This allowed for removal of any unbound enzyme on the electrode. During electrocatalytic measurements, the electrolyte solutions were not stirred.
[0208] As to the Laccase cathode, anthracene-modified MWCNTs were added to 150 L of laccase solution (20 mg ml.sup.1 in pH 6.5 citrate/phosphate buffer, 0.2 M). The resulting mixture was sonicated for 10 mins and then vortexed. 50 L TBAB-Nafion solution was added and one more sonication/vortex was performed. This mixture was evenly painted on 3 Toray paper electrodes (0.8 cm2).
[0209] As to the FDH anode modified with redox polymers, 21 L of BV-LPEI or NQ-LPEI (10 mg/mL), 9 L of FDH (10 mg/mL) and 1.125 L of EGDGE (10% in water) were mixed and then vortexed. 10 L of the mixture was deposited on the Toray paper electrode (0.25 cm.sup.2) and dried for 3 hours. 21 L of Cc-PAA (5 mg/ml), 9 L of FDH (10 mg/mL) and 1.125 L of EGDGE (3% in water) were mixed and then vortexed. 10 L of the mixture was deposited on the Toray paper electrode (0.25 cm2) and dried for 3 hours.
[0210] To test these electrodes, solution-based electrochemistry was utilized, in which 0.12 mg/mL FDH solution (50 mM Tris-HCl buffer, pH 8.0) was tested with 150 M mediator.
[0211] The results are shown in
[0212]
[0213]
[0214] Finally,
[0215] While the invention has been described with reference to certain particular embodiments thereof, those skilled in the art will appreciate that various modifications may be made without departing from the spirit and scope of the invention. The scope of the appended claims is not to be limited to the specific embodiments described.
REFERENCES
[0216] All patents and publications mentioned in this specification are indicative of the level of skill of those skilled in the art to which the invention pertains. Each cited patent and publication is incorporated herein by reference in its entirety. All of the following references have been cited in this application: [0217] (1) Pinske, C.; Sawers, R. G. Anaerobic Formate and Hydrogen Metabolism. EcoSal Plus 2016, 7. DOI: 10.1128/ecosalplus.ESP-0011-2016 [0218] (2) Hughes, E. R.; Winter, M. G.; Duerkop, B. A.; Spiga, L.; Furtado de Carvalho, T.; Zhu, W.; Gillis, C. C.; Buttner, L.; Smoot, M. P.; Behrendt, C. L.; Cherry, S.; Santos, R. L.; Hooper, L. V.; Winter, S. E. Microbial Respiration and Formate Oxidation as Metabolic Signatures of Inflammation-Associated Dysbiosis. Cell Host Microbe 2017, 21, 208-219. [0219] (3) Ternes, D.; Tsenkova, M.; Pozdeev, V. I.; Meyers, M.; Koncina, E.; Atatri, S.; Schmitz, M.; Karta, J.; Schmoetten, M.; Heinken, A.; Rodriguez, F.; Delbrouck, C.; Gaigneaux, A.; Ginolhac, A.; Nguyen, T. T. D.; Grandmougin, L.; Frachet-Bour, A.; Martin-Gallausiaux, C.; Pacheco, M.; Neuberger-Castillo, L.; Miranda, P.; Zuegel, N.; Ferrand, J. Y.; Gantenbein, M.; Sauter, T.; Slade, D. J.; Thiele, I.; Meiser, J.; Haan, S.; Wilmes, P.; Letellier, E. The gut microbial metabolite formate exacerbates colorectal cancer progression. Nat. Metab. 2022, 4, 458-475. [0220] (4) FEEDAP. Scientific opinion on the safety and efficacy of formic acid when used as a technological additive for all animal species. EFSA J. 2014, 12, 3827. [0221] (5) Yishai, O.; Lindner, S. N.; Gonzalez de la Cruz, J.; Tenenboim, H.; Bar-Even, A. The formate bio-economy. Curr. Opin. Chem. Biol. 2016, 35, 1-9. [0222] (6) Du, D.; Lan, R.; Humphreys, J.; Tao, S. Progress in inorganic cathode catalysts for electrochemical conversion of carbon dioxide into formate or formic acid. J. Appl. Electrochem. 2017, 47, 661-678. [0223] (7) Kar, S.; Rauch, M.; Leitus, G.; Ben-David, Y.; Milstein, D. Highly efficient additive-free dehydrogenation of neat formic acid. Nat. Catal. 2021, 4, 193-201. [0224] (8) Roden, E. E.; Jin, Q. Thermodynamics of microbial growth coupled to metabolism of glucose, ethanol, short-chain organic acids, and hydrogen. Appl. Environ. Microbiol. 2011, 77, 1907-1909. [0225] (9) Windman, T.; Zolotova, N.; Schwandner, F.; Shock, E. L. Formate as an energy source for microbial metabolism in chemosynthetic zones of hydrothermal ecosystems. Astrobiology 2007, 7, 873-890. [0226] (10) Amenabar, M. J.; Colman, D. R.; Poudel, S.; Roden, E. E.; Boyd, E. S. Electron acceptor availability alters carbon and energy metabolism in a thermoacidophile. Environ. Microbiol. 2018, 20, 2523-2537. [0227] (11) Crable, B. R.; Plugge, C. M.; McInerney, M. J.; Stams, A. J. Formate formation and formate conversion in biological fuels production. Enzyme Res. 2011, 2011, 532-536. [0228] (12) Sawers, G. The hydrogenases and formate dehydrogenases of Escherichia coli. Antonie van Leeuwenhoek 1994, 66, 57-88. [0229] (13) Maia, L. B.; Moura, I.; Moura, J. J. G. Carbon Dioxide UtilisationThe Formate Route. In Enzymes for Solving Humankind's Problems: Natural and Artificial Systems in Health, Agriculture, Environment, and Energy; Moura, J. J. G., Moura, I., Maia, L. B., Eds.; Springer Nature: Switzerland, 2021; pp 29-81. [0230] (14) Niks, D.; Hille, R. Molybdenum- and tungsten-containing formate dehydrogenases and formylmethanofuran dehydrogenases: Structure, mechanism, and cofactor insertion. Protein Sci. 2019, 28, 111-122. [0231] (15) Boyington, J. C.; Gladyshev, V. N.; Khangulov, S. V.; Stadtman, T. C.; Sun, P. D. Crystal structure of formate dehydrogenase H: catalysis involving Mo, molybdopterin, selenocysteine, and an Fe.sub.4S.sub.4 cluster. Science 1997, 275, 1305-1308. [0232] (16) Niks, D.; Hille, R. Reductive activation of CO.sub.2 by formate dehydrogenases. Methods Enzymol. 2018, 613, 277-295. [0233] (17) Sebban, C.; Blanchard, L.; Bruschi, M.; Guerlesquin, F. Purification and characterization of the formate dehydrogenase from Desulfovibrio vulgaris Hildenborough. FEMS Microbiol. Lett. 1995, 133, 143-149. [0234] (18) ElAntak, L.; Dolla, A.; Durand, M.-C.; Bianco, P.; Guerlesquin, F. Role of the tetrahemic subunit in Desulfovibrio vulgaris hildenborough formate dehydrogenase. Biochemistry 2005, 44, 14828-14834. [0235] (19) Costa, C.; Teixeira, M.; LeGall, J.; Moura, J. J. G.; Moura, I. Formate dehydrogenase from Desulfovibrio desulfuricans ATCC 27774: isolation and spectroscopic characterization of the active sites (heme, iron-sulfur centers and molybdenum). JBIC, J. Biol. Inorg. Chem. 1997, 2, 198-208. [0236] (20) Maia, L. B.; Fonseca, L.; Moura, I.; Moura, J. J. G. Reduction of Carbon Dioxide by a Molybdenum-Containing Formate Dehydrogenase: A Kinetic and Mechanistic Study. J. Am. Chem. Soc. 2016, 138, 8834-8846. [0237] (21) Riederer-Henderson, M. A.; Peck Jr, H. D. In Vitro Requirements for Formate Dehydrogenase Activity from Desulfovibrio. Can. J. Microbiol. 1986, 32, 425-429. [0238] (22) Almendra, M. J.; Brondino, C. D.; Gavel, O.; Pereira, A. S.; Tavares, P.; Bursakov, S.; Duarte, R.; Caldeira, J.; Moura, J. J. G.; Moura, I. Purification and characterization of a tungsten-containing formate dehydrogenase from Desulfovibrio gigas. Biochemistry 1999, 38, 16366-16372. [0239] (23) Oliveira, A. R.; Mota, C.; Mourato, C.; Domingos, R. M.; Santos, M. F. A.; Gesto, D.; Guigliarelli, B.; Santos-Silva, T.; Romo, M. J.; Cardoso Pereira, I. A. Toward the Mechanistic Understanding of Enzymatic CO.sub.2 Reduction. ACS Catal. 2020, 10, 3844-3856. (24) Rivas, M. G.; Gonzlez, P. J.; Brondino, C. D.; Moura, J. J. G.; Moura, I. EPR characterization of the molybdenum(V) forms of formate dehydrogenase from Desulfovibrio desulfuricans ATCC 27774 upon formate reduction. J. Inorg. Biochem. 2007, 101, 1617-1622. [0240] (25) de Bok, F. A. M.; Hagedoorn, P.-L.; Silva, P. J.; Hagen, W. R.; Schiltz, E.; Fritsche, K.; Stams, A. J. M. Two W-containing formate dehydrogenases (CO.sub.2-reductases) involved in syntrophic propionate oxidation by Syntrophobacter fumaroxidans. Eur. J. Biochem. 2003, 270, 2476-2485. [0241] (26) Yu, X.; Niks, D.; Mulchandani, A.; Hille, R. Efficient reduction of CO.sub.2 by the molybdenum-containing formate dehydrogenase from Cupriavidus necator (Ralstonia eutropha). J. Biol. Chem. 2017, 292, 16872-16879. [0242] (27) Bassegoda, A.; Madden, C.; Wakerley, D. W.; Reisner, E.; Hirst, J. Reversible interconversion of CO.sub.2 and formate by a molybdenum-containing formate dehydrogenase. J. Am. Chem. Soc. 2014, 136, 15473-15476. [0243] (28) Axley, M. J.; Grahame, D. A. Kinetics for formate dehydrogenase of Escherichia coli formate-hydrogenlyase. J. Biol. Chem. 1991, 266, 13731-13736. [0244] (29) Kpebe, A.; Benvenuti, M.; Guendon, C.; Rebai, A.; Fernandez, V.; Le Laz, S.; Etienne, E.; Guigliarelli, B.; Garcia-Molina, G.; de Lacey, A. L.; Baffert, C.; Brugna, M. A new mechanistic model for an O.sub.2-protected electron-bifurcating hydrogenase, Hnd from Desulfovibrio fructosovorans. Biochim. Biophys. Acta, Bioenerg. 2018, 1859, 1302-1312. [0245] (30) Axley, M. J.; Grahame, D. A.; Stadtman, T. C. Escherichia coli formate-hydrogen lyase. Purification and properties of the selenium-dependent formate dehydrogenase component. J. Biol. Chem. 1990, 265, 18213-18218. [0246] (31) Khangulov, S. V.; Gladyshev, V. N.; Dismukes, G. C.; Stadtman, T. C. Selenium-containing formate dehydrogenase H from Escherichia coli: a molybdopterin enzyme that catalyzes formate oxidation without oxygen transfer. Biochemistry 1998, 37, 3518-3528. [0247] (32) Friedebold, J.; Bowien, B. Physiological and biochemical characterization of the soluble formate dehydrogenase, a molybdoenzyme from Alcaligenes eutrophus. J. Bacteriol. 1993, 175, 4719-4728. [0248] (33) Scherer, P. A.; Thauer, R. K. Purification and properties of reduced ferredoxin: CO.sub.2 oxidoreductase from Clostridium pasteurianum, a molybdenum iron-sulfur-protein. Eur. J. Biochem. 1978, 85, 125-135. [0249] (34) Kroger, A.; Winkler, E.; Innerhofer, A.; Hackenberg, H.; Schagger, H. The formate dehydrogenase involved in electron transport from formate to fumarate in Vibrio succinogenes. Eur. J. Biochem. 1979, 94, 465-475. [0250] (35) Jollie, D. R.; Lipscomb, J. D. Formate dehydrogenase from Methylosinus trichosporium OB3b. Methods Enzymol. 1990, 188, 331-334. [0251] (36) Jollie, D. R.; Lipscomb, J. D. Formate dehydrogenase from Methylosinus trichosporium OB3b. Purification and spectroscopic characterization of the cofactors. J. Biol. Chem. 1991, 266, 21853-21863. [0252] (37) Yoch, D. C.; Chen, Y. P.; Hardin, M. G. Formate dehydrogenase from the methane oxidizer Methylosinus trichosporium OB3b. J. Bacteriol. 1990, 172, 4456-4463. [0253] (38) Blanchard, J. S.; Cleland, W. W. Kinetic and chemical mechanisms of yeast formate dehydrogenase. Biochemistry 1980, 19, 3543-3550. [0254] (39) Robinson, W. E.; Bassegoda, A.; Blaza, J. N.; Reisner, E.; Hirst, J. Understanding How the Rate of CH Bond Cleavage Affects Formate Oxidation Catalysis by a Mo-Dependent Formate Dehydrogenase. J. Am. Chem. Soc. 2020, 142, 12226-12236. [0255] (40) Hartmann, T.; Leimkhler, S. The oxygen-tolerant and NAD+-dependent formate dehydrogenase from Rhodobacter capsulatus is able to catalyze the reduction of CO.sup.2 to formate. FEBS J. 2013, 280, 6083-6096. [0256] (41) Stickland, L. H. The bacterial decomposition of formic acid. Biochem. J. 1929, 23, 1187-1198. [0257] (42) Stephenson, M.; Stickland, L. H. Hydrogenlyases: Bacterial enzymes liberating molecular hydrogen. Biochem. J. 1932, 26, 712-724. [0258] (43) Gale, E. F. Formic dehydrogenase of Bacterium coli: its inactivation by oxygen and its protection in the bacterial cell. Biochem. J. 1939, 33, 1012-1027. [0259] (44) Pinsent, J. The need for selenite and molybdate in the formation of formic dehydrogenase by members of the coli-aerogenes group of bacteria. Biochem. J. 1954, 57, 10-16. [0260] (45) Itagaki, E.; Fujita, T.; Sato, R. Solubilization and properties of formate dehydrogenase and cytochrome b1 from Escherichia coli. J. Biochem. 1962, 52, 131-141. [0261] (46) Linnane, A. W.; Wrigley, C. W. Fragmentation of the Electron Transport Chain of Escherichia Coli. Preparation of a Soluble Formate Dehydrogenase-Cytochrome B1 Complex. Biochim. Biophys. Acta 1963, 77, 408-418. [0262] (47) Gray, C. T.; Gest, H. Biological Formation of Molecular Hydrogen. Science 1965, 148, 186-192. [0263] (48) Ruiz-Herrera, J.; Alvarez, A. A physiological study of formate dehydrogenase, formate oxidase, and hydrogenlyase from Escherichia coli K-12. Antonie van Leeuwenhoek 1972, 38, 479-491. [0264] (49) Ljungdahl, L. G. Formate Dehydrogenases: Role of Molybdenum, Tungsten, and Selenium. In Molybdenum and Molybdenum-Containing Enzymes; Coughlan, M. P., Ed.; Pergamon: New York, 1980; pp 463-486. [0265] (50) Pichinoty, F. Recherche des activites formiate-oxydase, hydrogene-lyase, hydrogenase et formiate-deshydrogenase chez quelques enterobacteriaceae. Ann. Inst. Pasteur 1969, 117, 3-15. [0266] (51) Stewart, V. Nitrate respiration in relation to facultative metabolism in enterobacteria. Microbiol. Rev. 1988, 52, 190-232. [0267] (52) Finney, A. J.; Sargent, F. Formate hydrogenlyase: A group 4[NiFe]-hydrogenase in tandem with a formate dehydrogenase. Adv. Microb. Physiol. 2019, 74, 465-486. [0268] (53) Sawers, G.; Heider, J.; Zehelein, E.; Bock, A. Expression and operon structure of the sel genes of Escherichia coli and identification of a third selenium-containing formate dehydrogenase isoenzyme. J. Bacteriol. 1991, 173, 4983-4993. [0269] (54) Soboh, B.; Pinske, C.; Kuhns, M.; Waclawek, M.; Ihling, C.; Trchounian, K.; Trchounian, A.; Sinz, A.; Sawers, G. The respiratory molybdo-selenoprotein formate dehydrogenases of Escherichia coli have hydrogen: benzyl viologen oxidoreductase activity. BMC Microbiol. 2011, 11, 173. [0270] (55) Abaibou, H.; Pommier, J.; Benoit, S.; Giordano, G.; Mandrand-Berthelot, M. A. Expression and characterization of the Escherichia coli fdo locus and a possible physiological role for aerobic formate dehydrogenase. J. Bacteriol. 1995, 177, 7141-7149. [0271] (56) Benoit, S.; Abaibou, H.; Mandrand-Berthelot, M.-A. Topological analysis of the aerobic membrane-bound formate dehydrogenase of Escherichia coli. J. Bacteriol. 1998, 180, 6625-6634. [0272] (57) Unden, G.; Steinmetz, P. A.; Degreif-Dunnwald, P. The Aerobic and Anaerobic Respiratory Chain of Escherichia coli and Salmonella enterica: Enzymes and Energetics. EcoSal Plus 2014, 6. DOI: 10.1128/ecosalplus.ESP-0005-2013 [0273] (58) Richardson, D.; Sawers, G. Structural biology. PMF through the redox loop. Science 2002, 295, 1842-1843. [0274] (59) Yagi, T. Formate: cytochrome oxidoreductase of Desulfovibrio vulgaris. J. Biochem. 1969, 66, 473-478. [0275] (60) Yagi, T. Monoheme cytochromes. Methods Enzymol. 1994, 243, 104-118. [0276] (61) Keller, K. L.; Wall, J. D.; Chhabra, S. Methods for engineering sulfate reducing bacteria of the genus Desulfovibrio. Methods Enzymol. 2011, 497, 503-517. [0277] (62) Rabus, R.; Venceslau, S. S.; Wohlbrand, L.; Voordouw, G.; Wall, J. D.; Pereira, I. A. C. A Post-Genomic View of the Ecophysiology, Catabolism and Biotechnological Relevance of Sulphate-Reducing Prokaryotes. Adv. Microb. Physiol. 2015, 66, 55-321. [0278] (63) Price, M. N.; Wetmore, K. M.; Waters, R. J.; Callaghan, M.; Ray, J.; Liu, H.; Kuehl, J. V.; Melnyk, R. A.; Lamson, J. S.; Suh, Y.; Carlson, H. K.; Esquivel, Z.; Sadeeshkumar, H.; Chakraborty, R.; Zane, G. M.; Rubin, B. E.; Wall, J. D.; Visel, A.; Bristow, J.; Blow, M. J.; Arkin, A. P.; Deutschbauer, A. M. Mutant phenotypes for thousands of bacterial genes of unknown function. Nature 2018, 557, 503-509. [0279] (64) Lefevre, C. T.; Howse, P. A.; Schmidt, M. L.; Sabaty, M.; Menguy, N.; Luther, G. W., III; Bazylinski, D. A. Growth of magnetotactic sulfate-reducing bacteria in oxygen concentration gradient medium. Environ. Microbiol. Rep. 2016, 8, 1003-1015. [0280] (65) Schoeffler, M.; Gaudin, A.-L.; Ramel, F.; Valette, O.; Denis, Y.; Hania, W. B.; Hirschler-Ra, A.; Dolla, A. Growth of an anaerobic sulfate-reducing bacterium sustained by oxygen respiratory energy conservation after O.sub.2-driven experimental evolution. Environ. Microbiol. 2019, 21, 360-373. [0281] (66) Muyzer, G.; Stams, A. J. M. The ecology and biotechnology of sulphate-reducing bacteria. Nat. Rev. Microbiol. 2008, 6, 441-454. [0282] (67) Verhagen, M. F. J. M.; Wolbert, R. B. G.; Hagen, W. R. Cytochrome c553 from Desulfovibrio vulgaris (Hildenborough). Electrochemical properties and electron transfer with hydrogenase. Eur. J. Biochem. 1994, 221, 821-829. [0283] (68) da Silva, S. M.; Pimentel, C.; Valente, F. M. A.; Rodrigues-Pousada, C.; Pereira, I. A. C. Tungsten and molybdenum regulation of formate dehydrogenase expression in Desulfovibrio vulgaris Hildenborough. J. Bacteriol. 2011, 193, 2909-2916. [0284] (69) Heidelberg, J. F.; Seshadri, R.; Haveman, S. A.; Hemme, C. L.; Paulsen, I. T.; Kolonay, J. F.; Eisen, J. A.; Ward, N.; Methe, B.; Brinkac, L. M.; Daugherty, S. C.; Deboy, R. T.; Dodson, R. J.; Durkin, A. S.; Madupu, R.; Nelson, W. C.; Sullivan, S. A.; Fouts, D.; Haft, D. H.; Selengut, J.; Peterson, J. D.; Davidsen, T. M.; Zafar, N.; Zhou, L.; Radune, D.; Dimitrov, G.; Hance, M.; Tran, K.; Khouri, H.; Gill, J.; Utterback, T. R.; Feldblyum, T. V.; Wall, J. D.; Voordouw, G.; Fraser, C. M. The genome sequence of the anaerobic, sulfate-reducing bacterium Desulfovibrio vulgaris Hildenborough. Nat. Biotechnol. 2004, 22, 554-559. [0285] (70) Lpez, S.; Prieto, M.; Dijkstra, J.; Dhanoa, M. S.; France, J. Statistical evaluation of mathematical models for microbial growth. Int. J. Food Microbiol. 2004, 96, 289-300. [0286] (71) de Bok, F. A. M.; Roze, E. H. A.; Stams, A. J. M. Hydrogenases and formate dehydrogenases of Syntrophobacter fumaroxidans. Antonie van Leeuwenhoek 2002, 81, 283-291. [0287] (72) Hartwig, S.; Pinske, C.; Sawers, R. G. Chromogenic assessment of the three molybdo-selenoprotein formate dehydrogenases in Escherichia coli. Biochem. Biophys. Rep. 2015, 1, 62-67. [0288] (73) Enoch, H. G.; Lester, R. L. The purification and properties of formate dehydrogenase and nitrate reductase from Escherichia coli. J. Biol. Chem. 1975, 250, 6693-6705. [0289] (74) Pinske, C.; Jaroschinsky, M.; Sargent, F.; Sawers, G. Zymographic differentiation of [NiFe]-hydrogenases 1, 2 and 3 of Escherichia coli K-12. BMC Microbiol. 2012, 12, 134. [0290] (75) Schafer, C.; Friedrich, B.; Lenz, 0. Novel, oxygen-insensitive group 5 [NiFe]-hydrogenase in Ralstonia eutropha. Appl. Environ. Microbiol. 2013, 79, 5137-5145. [0291] (76) Altman, F. P. Tetrazolium Salts and Formazans; Gustav Fischer Verlag: Stuttgart, 1976. [0292] (77) Hagen, W. R. Tungsten-Containing Enzymes. In Molybdenum and Tungsten Enzymes: Biochemistry; Hille, R., Schulzke, C., Kirk, M. L., Eds.; The Royal Society of Chemistry: Cambridge, 2017; pp 313-342. [0293] (78) Gladyshev, V. N.; Boyington, J. C.; Khangulov, S. V.; Grahame, D. A.; Stadtman, T. C.; Sun, P. D. Characterization of crystalline formate dehydrogenase H from Escherichia coli. Stabilization, EPR spectroscopy, and preliminary crystallographic analysis. J. Biol. Chem. 1996, 271, 8095-8100. (79) Laukel, M.; Chistoserdova, L.; Lidstrom, M. E.; Vorholt, J. A. The tungsten-containing formate dehydrogenase from Methylobacterium extorquens AMI: purification and properties. Eur. J. Biochem. 2003, 270, 325-333. [0294] (80) Orme-Johnson, W. H. Iron-sulfur proteins: structure and function. Annu. Rev. Biochem. 1973, 42, 159-204. [0295] (81) Sweeney, W. V.; Rabinowitz, J. C. Proteins containing 4Fe-4S clusters: an overview. Annu. Rev. Biochem. 1980, 49, 139-161. [0296] (82) Raaijmakers, H.; Teixeira, S.; Dias, J. M.; Almendra, M. J.; Brondino, C. D.; Moura, I.; Moura, J. J. G.; Romo, M. J. Tungstencontaining formate dehydrogenase from Desulfovibrio gigas: metal identification and preliminary structural data by multi-wavelength crystallography. J. Biol. Inorg Chem. 2001, 6, 398-404. [0297] (83) Koehler, B. P.; Mukund, S.; Conover, R. C.; Dhawan, I. K.; Roy, R.; Adams, M. W. W.; Johnson, M. K. Spectroscopic characterization of the tungsten and iron centers in aldehyde ferredoxin oxidoreductases from two hyperthermophilic archaea. J. Am. Chem. Soc. 1996, 118, 12391-12405. [0298] (84) Johnson, K. A. New standards for collecting and fitting steady state kinetic data. Beilstein J. Org. Chem. 2019, 15, 16-29. [0299] (85) Silveira, C. M.; Besson, S.; Moura, I.; Moura, J. J.; Almeida, M. G. Measuring the cytochrome C nitrite reductase activity-practical considerations on the enzyme assays. Bioinorg. Chem. Appl. 2010, 1-8. [0300] (86) Prince, R. C.; Linkletter, S. J. G.; Dutton, P. L. The thermodynamic properties of some commonly used oxidation-reduction mediators, inhibitors and dyes, as determined by polarography. Biochim. Biophys. Acta 1981, 635, 132-148. [0301] (87) Duggleby, R. G.; Clarke, R. B. Experimental designs for estimating the parameters of the Michaelis-Menten equation from progress curves of enzyme-catalyzed reactions. Biochim. Biophys. Acta 1991, 1080, 231-236. [0302] (88) Schweins, T.; Geyer, M.; Scheffzek, K.; Warshel, A.; Kalbitzer, H. R.; Wittinghofer, A. Substrate-assisted catalysis as a mechanism for GTP hydrolysis of p21ras and other GTP-binding proteins. Nat. Struct. Biol. 1995, 2, 36-44. [0303] (89) Johnson, K. A. Fitting enzyme kinetic data with KinTek Global Kinetic Explorer. Methods Enzymol. 2009, 467, 601-626. [0304] (90) Stroberg, W.; Schnell, S. On the estimation errors of KM and V from time-course experiments using the Michaelis-Menten equation. Biophys. Chem. 2016, 219, 17-27. [0305] (91) Jahn, B.; Jonasson, N. S. W.; Hu, H.; Singer, H.; Pol, A.; Good, N. M.; den Camp, H. J. M. O.; Martinez-Gomez, N. C.; Daumann, L. J. Understanding the chemistry of the artificial electron acceptors PES, PMS, DCPIP and Wurster's Blue in methanol dehydrogenase assays. J. Biol. Inorg Chem. 2020, 25, 199-212. [0306] (92) Peck, H. D., Jr.; Gest, H. Formic dehydrogenase and the hydrogenlyase enzyme complex in coli-aerogenes bacteria. J. Bacteriol. 1957, 73, 706-721. [0307] (93) Xiang, D.; Magana, D.; Dyer, R. B. CO2 reduction catalyzed by mercaptopteridine on glassy carbon. J. Am. Chem. Soc. 2014, 136, 14007-14010. [0308] (94) Merritt, M. E.; Harrison, C.; Storey, C.; Jeffrey, F. M.; Sherry, A. D.; Malloy, C. R. Hyperpolarized 13C allows a direct measure of flux through a single enzyme-catalyzed step by NMR. Proc. Natl. Acad. Sci. U.S.A. 2007, 104, 19773-19777. [0309] (95) Niekus, H. G. D.; Stouthamer, A. H. Formate oxidase in glutaraldehyde-treated Campylobacter sputorum subspecies bubulus. FEMS Microbiol. Lett. 1981, 11, 83-87. [0310] (96) Goodhew, C. F.; elKurdi, A. B.; Pettigrew, G. W. The microaerophilic respiration of Campylobacter mucosalis. Biochim. Biophys. Acta 1988, 933, 114-123. [0311] (97) Weissgerber, T. L.; Winham, S. J.; Heinzen, E. P.; Milin-Lazovic, J. S.; Garcia-Valencia, O.; Bukumiric, Z.; Savic, M. D.; Garovic, V. D.; Milic, N. M. Reveal, Don't Conceal: Transforming Data Visualization to Improve Transparency. Circulation 2019, 140, 1506-1518. [0312] (98) Miner, K. D.; Mukherjee, A.; Gao, Y.-G.; Null, E. L.; Petrik, I. D.; Zhao, X.; Yeung, N.; Robinson, H.; Lu, Y. A designed functional metalloenzyme that reduces O2 to H2O with over one thousand turnovers. Angew. Chem., Int. Ed. Engl. 2012, 51, 5589-5592. [0313] (99) Kakeshpour, T.; Bax, A. NMR characterization of H.sub.2O.sub.2 hydrogen exchange. J. Magn. Reson. 2021, 333, 107092. [0314] (100) Kalyanaraman, B.; Darley-Usmar, V.; Davies, K. J. A.; Dennery, P. A.; Forman, H. J.; Grisham, M. B.; Mann, G. E.; Moore, K.; Roberts, L. J., II; Ischiropoulos, H. Measuring reactive oxygen and nitrogen species with fluorescent probes: challenges and limitations. Free Radical Biol. Med. 2012, 52, 1-6. [0315] (101) Wulff, P.; Day, C. C.; Sargent, F.; Armstrong, F. A. How oxygen reacts with oxygen-tolerant respiratory [NiFe]-hydrogenases. Proc. Natl. Acad. Sci. U.S.A. 2014, 111, 6606-6611. [0316] (102) Zielonka, J.; Sikora, A.; Joseph, J.; Kalyanaraman, B. Peroxynitrite is the major species formed from different flux ratios of co-generated nitric oxide and superoxide: direct reaction with boronate-based fluorescent probe. J. Biol. Chem. 2010, 285, 14210-14216. [0317] (103) Tarpey, M. M.; Fridovich, I. Methods of detection of vascular reactive species: nitric oxide, superoxide, hydrogen peroxide, and peroxynitrite. Circ. Res. 2001, 89, 224-236. [0318] (104) Azzi, A.; Montecucco, C.; Richter, C. The use of acetylated ferricytochrome c for the detection of superoxide radicals produced in biological membranes. Biochem. Biophys. Res. Commun. 1975, 65, 597-603. [0319] (105) Lu, Z.; Imlay, J. A. When anaerobes encounter oxygen: mechanisms of oxygen toxicity, tolerance and defence. Nat. Rev. Microbiol. 2021, 19, 774-785. [0320] (106) Koppenol, W. H.; Stanbury, D. M.; Bounds, P. L. Electrode potentials of partially reduced oxygen species, from dioxygen to water. Free Radical Biol. Med. 2010, 49, 317-322. [0321] (107) McDonald, A. G.; Boyce, S.; Tipton, K. F. ExplorEnz: the primary source of the IUBMB enzyme list. Nucleic Acids Res. 2009, 37, D593-D597. [0322] (108) Lu, Y.; Koo, J. O.sub.2 sensitivity and H.sub.2 production activity of hydrogenases-A review. Biotechnol. Bioeng. 2019, 116, 3124-3135. [0323] (109) Shaw, R. W.; Rife, J. E.; O'Leary, M. H.; Beinert, H. Oxidation of reduced cytochrome c oxidase with .sup.18O.sub.2. A search for mu-oxo-bridged metal species in the oxidized enzyme. J. Biol. Chem. 1981, 256, 1105-1107. [0324] (110) Lauterbach, L.; Lenz, O. Catalytic production of hydrogen peroxide and water by oxygen-tolerant [NiFe]-hydrogenase during H.sub.2 cycling in the presence of O.sub.2. J. Am. Chem. Soc. 2013, 135, 17897-17905. [0325] (111) Massey, V.; Harris, C. M. Milk xanthine oxidoreductase: the first one hundred years. Biochem. Soc. Trans. 1997, 25, 750-755. [0326] (112) Pimviriyakul, P.; Chaiyen, P. Overview of flavin-dependent enzymes. Enzymes 2020, 47, 1-36. [0327] (113) Liu, J.; Chakraborty, S.; Hosseinzadeh, P.; Yu, Y.; Tian, S.; Petrik, I.; Bhagi, A.; Lu, Y. Metalloproteins containing cytochrome, iron-sulfur, or copper redox centers. Chem. Rev. 2014, 114, 4366-4469. [0328] (114) Radi, R.; Thomson, L.; Rubbo, H.; Prodanov, E. Cytochrome c catalyzed oxidation of organic molecules by hydrogen peroxide. Arch. Biochem. Biophys. 1991, 288, 112-117. [0329] (115) Velayutham, M.; Hemann, C.; Zweier, J. L. Removal of H(2)O(2) and generation of superoxide radical: role of cytochrome c and NADH. Free Radical Biol. Med. 2011, 51, 160-170. [0330] (116) Raaijmakers, H.; Macieira, S.; Dias, J. M.; Teixeira, S.; Bursakov, S.; Huber, R.; Moura, J. J. G.; Moura, I.; Romo, M. J. Gene sequence and the 1.8 A crystal structure of the tungsten-containing formate dehydrogenase from Desulfovibrio gigas. Structure 2002, 10, 1261-1272. [0331] (117) Radon, C.; Mittelstdt, G.; Duffus, B. R.; Burger, J.; Hartmann, T.; Mielke, T.; Teutloff, C.; Leimkhler, S.; Wendler, P. Cryo-EM structures reveal intricate FeS cluster arrangement and charging in Rhodobacter capsulatus formate dehydrogenase. Nat. Commun. 2020, 11, 1912. [0332] (118) Lee, D.-S.; Nioche, P.; Hamberg, M.; Raman, C. S. Structural insights into the evolutionary paths of oxylipin biosynthetic enzymes. Nature 2008, 455, 363-368. [0333] (119) Sommerhalter, M.; Lieberman, R. L.; Rosenzweig, A. C. X-ray crystallography and biological metal centers: is seeing believing? Inorg. Chem. 2005, 44, 770-778. [0334] (120) Bowman, S. E. J.; Bridwell-Rabb, J.; Drennan, C. L. Metalloprotein Crystallography: More than a Structure. Acc. Chem. Res. 2016, 49, 695-702. [0335] (121) Yang, J. Y.; Kerr, T. A.; Wang, X. S.; Barlow, J. M. Reducing CO.sub.2 to HCO.sub.2() at Mild Potentials: Lessons from Formate Dehydrogenase. J. Am. Chem. Soc. 2020, 142, 19438-19445. [0336] (122) Palmer, G.; Olson, J. S. Concepts and approaches to the understanding of electron transfer processes in enzymes containing multiple redox centers. In Molybdenum and Molybdenum-Containing Enzymes; Coughlan, M. P., Ed.; Pergamon Press: Oxford, 1980; pp 187-220. [0337] (123) Page, C. C.; Moser, C. C.; Chen, X.; Dutton, P. L. Natural engineering principles of electron tunnelling in biological oxidation-reduction. Nature 1999, 402, 47-52. [0338] (124) Osyczka, A.; Moser, C. C.; Daldal, F.; Dutton, P. L. Reversible redox energy coupling in electron transfer chains. Nature 2004, 427, 607-612. [0339] (125) Byrne, R. S.; Hnsch, R.; Mendel, R. R.; Hille, R. Oxidative half-reaction of Arabidopsis thaliana sulfite oxidase: generation of superoxide by a peroxisomal enzyme. J. Biol. Chem. 2009, 284, 35479-35484. [0340] (126) Nicolet, Y.; Fontecilla-Camps, J. C. Iron-sulfur clusters and molecular oxygen:function, adaptation, degradation, and repair. In Iron-Sulfur Clusters in Chemistry and Biology; Rouault, T. A., Ed., 2014; pp 359-385. [0341] (127) Kayastha, K.; Vitt, S.; Buckel, W.; Ermler, U. Flavins in the electron bifurcation process. Arch. Biochem. Biophys. 2021, 701, 108796. [0342] (128) Crofts, A. R. The modified Q-cycle: A look back at its development and forward to a functional model. Biochim. Biophys. Acta, Bioenerg. 2021, 1862, 148417. [0343] (129) Sarewicz, M.; Pintscher, S.; Pietras, R.; Borek, A.; Bujnowicz, .; Hanke, G.; Cramer, W. A.; Finazzi, G.; Osyczka, A. Catalytic Reactions and Energy Conservation in the Cytochrome bc1 and b6f Complexes of Energy-Transducing Membranes. Chem. Rev. 2021, 121, 2020-2108. [0344] (130) Buckel, W.; Thauer, R. K. Flavin-Based Electron Bifurcation, A New Mechanism of Biological Energy Coupling. Chem. Rev. 2018, 118, 3862-3886. [0345] (131) Wise, C. E.; Ledinina, A. E.; Yuly, J. L.; Artz, J. H.; Lubner, C. E. The role of thermodynamic features on the functional activity of electron bifurcating enzymes. Biochim. Biophys. Acta, Bioenerg. 2021, 1862, 148377. [0346] (132) Baymann, F.; Schoepp-Cothenet, B.; Duval, S.; Guiral, M.; Brugna, M.; Baffert, C.; Russell, M. J.; Nitschke, W. On the Natural History of Flavin-Based Electron Bifurcation. Front Microbiol. 2018, 9, 1357. [0347] (133) Ian Ragan, C. Structure of NADH-ubiquinone reductase (complex I). Curr. Top. Bioenerg. 1987, 15, 1-36. [0348] (134) Nitschke, W.; Russell, M. J. Redox bifurcations: mechanisms and importance to life now, and at its origin: a widespread means of energy conversion in biology unfolds. Bioessays 2012, 34, 106-109. [0349] (135) Peters, J. W.; Beratan, D. N.; Schut, G. J.; Adams, M. W. W. On the nature of organic and inorganic centers that bifurcate electrons, coupling exergonic and endergonic oxidation-reduction reactions. Chem. Commun. 2018, 54, 4091-4099. [0350] (136) Yuly, J. L.; Zhang, P.; Ru, X.; Terai, K.; Singh, N.; Beratan, D. N. Efficient and reversible electron bifurcation with either normal or inverted potentials at the bifurcating cofactor. Chem 2021, 7, 1870. [0351] (137) Agarwal, R. G.; Coste, S. C.; Groff, B. D.; Heuer, A. M.; Noh, H.; Parada, G. A.; Wise, C. F.; Nichols, E. M.; Warren, J. J.; Mayer, J. M. Free Energies of Proton-Coupled Electron Transfer Reagents and Their Applications. Chem. Rev. 2022, 122, 1-49. [0352] (138) Bol, E.; Bevers, L. E.; Hagedoorn, P.-L.; Hagen, W. R. Redox chemistry of tungsten and iron-sulfur prosthetic groups in Pyrococcus furiosus formaldehyde ferredoxin oxidoreductase. J. Biol. Inorg Chem. 2006, 11, 999-1006. [0353] (139) Li, F.; Hinderberger, J.; Seedorf, H.; Zhang, J.; Buckel, W.; Thauer, R. K. Coupled ferredoxin and crotonyl coenzyme A (CoA) reduction with NADH catalyzed by the butyryl-CoA dehydrogenase/Etf complex from Clostridium kluyveri. J. Bacteriol. 2008, 190, 843-850. [0354] (140) Aboulnaga, E.-H.; Pinkenburg, O.; Schiffels, J.; El-Refai, A.; Buckel, W.; Selmer, T. Effect of an oxygen-tolerant bifurcating butyryl coenzyme A dehydrogenase/electron-transferring flavoprotein complex from Clostridium difficile on butyrate production in Escherichia coli. J. Bacteriol. 2013, 195, 3704-3713. [0355] (141) Chowdhury, N. P.; Kahnt, J.; Buckel, W. Reduction of ferredoxin or oxygen by flavin-based electron bifurcation in Megasphaera elsdenii. FEBS J. 2015, 282, 3149-3160. [0356] (142) Yuly, J. L.; Zhang, P.; Lubner, C. E.; Peters, J. W.; Beratan, D. N. Universal free-energy landscape produces efficient and reversible electron bifurcation. Proc. Natl. Acad. Sci. U.S.A. 2020, 117, 21045-21051. [0357] (143) Rutherford, A. W.; Osyczka, A.; Rappaport, F. Back-reactions, short-circuits, leaks and other energy wasteful reactions in biological electron transfer: redox tuning to survive life in O(2). FEBS Lett. 2012, 586, 603-616. [0358] (144) Gran-Scheuch, A.; Parra, L.; Fraaije, M. W. Systematic assessment of uncoupling in flavoprotein oxidases and monooxygenases. ACS Sustainable Chem. Eng. 2021, DOI: 10.1021/acssuschemeng. 1c02012. [0359] (145) Pintscher, S.; Kuleta, P.; Cieluch, E.; Borek, A.; Sarewicz, M.; Osyczka, A. Tuning of Hemes b Equilibrium Redox Potential Is Not Required for Cross-Membrane Electron Transfer. J. Biol. Chem. 2016, 291, 6872-6881. [0360] (146) Kint, N.; Morvan, C.; Martin-Verstraete, I. Oxygen response and tolerance mechanisms in Clostridioides difficile. Curr. Opin. Microbiol. 2022, 65, 175-182. [0361] (147) Ledbetter, R. N.; Garcia Costas, A. M.; Lubner, C. E.; Mulder, D. W.; Tokmina-Lukaszewska, M.; Artz, J. H.; Patterson, A.; Magnuson, T. S.; Jay, Z. J.; Duan, H. D.; Miller, J.; Plunkett, M. H.; Hoben, J. P.; Barney, B. M.; Carlson, R. P.; Miller, A.-F.; Bothner, B.; King, P. W.; Peters, J. W.; Seefeldt, L. C. The Electron Bifurcating FixABCX Protein Complex from Azotobacter vinelandii: Generation of Low-Potential Reducing Equivalents for Nitrogenase Catalysis. Biochemistry 2017, 56, 4177-4190. [0362] (148) Wang, Y.; Chen, X.; Spengler, K.; Terberger, K.; Boehm, M.; Appel, J.; Barske, T.; Timm, S.; Battchikova, N.; Hagemann, M.; Gutekunst, K. Pyruvate:ferredoxin oxidoreductase and low abundant ferredoxins support aerobic photomixotrophic growth in cyanobacteria. Elife 2022, 11, No. e71339. [0363] (149) Zuchan, K.; Baymann, F.; Baffert, C.; Brugna, M.; Nitschke, W. The dyad of the Y-junction- and a flavin module unites diverse redox enzymes. Biochim. Biophys. Acta, Bioenerg. 2021, 1862, 148401. [0364] (150) Chen, Y.-P.; Yoch, D. C. Reconstitution of electron transport system that couples formate oxidation to nitrogenase in Methylosinus trichosporium OB3b. J. Gen. Microbiol. 1988, 134, 3123-3128. [0365] (151) Jollie, D. R. Structure and mechanism of formate dehydrogenase isolated from the methanotroph, Methylosinus trichosporium OB3b. PhD Dissertation, University of Minnesota, Minneapolis, 1992. [0366] (152) Wang, S.; Huang, H.; Kahnt, J.; Thauer, R. K. Clostridium acidurici electron-bifurcating formate dehydrogenase. Appl. Environ. Microbiol. 2013, 79, 6176-6179. [0367] (153) Jumper, J.; Evans, R.; Pritzel, A.; Green, T.; Figurnov, M.; Ronneberger, O.; Tunyasuvunakool, K.; Bates, R.; Zidek, A.; Potapenko, A.; Bridgland, A.; Meyer, C.; Kohl, S. A. A.; Ballard, A. J.; Cowie, A.; Romera-Paredes, B.; Nikolov, S.; Jain, R.; Adler, J.; Back, T.; Petersen, S.; Reiman, D.; Clancy, E.; Zielinski, M.; Steinegger, M.; Pacholska, M.; Berghammer, T.; Bodenstein, S.; Silver, D.; Vinyals, O.; Senior, A. W.; Kavukcuoglu, K.; Kohli, P.; Hassabis, D. Highly accurate protein structure prediction with AlphaFold. Nature 2021, 596, 583-589. [0368] (154) Holm, L. Using Dali for Protein Structure Comparison. Methods Mol. Biol. 2020, 2112, 29-42. [0369] (155) Reich, H. J.; Hondal, R. J. Why Nature Chose Selenium. ACS Chem. Biol. 2016, 11, 821-841. [0370] (156) Evans, R. M.; Krahn, N.; Murphy, B. J.; Lee, H.; Armstrong, F. A.; Soll, D. Selective cysteine-to-selenocysteine changes in a [NiFe]-hydrogenase confirm a special position for catalysis and oxygen tolerance. Proc. Natl. Acad. Sci. U.S.A. 2021, 118, No. e2100921118. [0371] (157) Sen, A.; Imlay, J. A. How Microbes Defend Themselves From Incoming Hydrogen Peroxide. Front Immunol. 2021, 12, 667343. [0372] (158) Niekus, H. G. D.; Van Doorn, E.; De Vries, W.; Stouthamer, A. H. Aerobic growth of Campylobacter sputorum subspecies bubulus with formate. J. Gen. Microbiol. 1980, 118, 419-428. [0373] (159) Ohta, H.; Gottschal, J. C. Formate oxidation by Wolinella recta ATCC 33238 with oxygen as electron acceptor. FEMS Microbiol. Lett. 1988, 50, 163-168. [0374] (160) Hoffman, P. S.; Goodman, T. G. Respiratory physiology and energy conservation efficiency of Campylobacter jejuni. J. Bacteriol. 1982, 150, 319-326. [0375] (161) Taylor, A. J.; Kelly, D. J. The function, biogenesis and regulation of the electron transport chains in Campylobacter jejuni: New insights into the bioenergetics of a major food-borne pathogen. Adv. Microb. Physiol. 2019, 74, 239-329. [0376] (162) Khademian, M.; Imlay, J. A. Escherichia coli cytochrome c peroxidase is a respiratory oxidase that enables the use of hydrogen peroxide as a terminal electron acceptor. Proc. Natl. Acad. Sci. U.S.A. 2017, 114, E6922-E6931. [0377] (163) del Barrio, M.; Guendon, C.; Kpebe, A.; Baffert, C.; Fourmond, V.; Brugna, M.; Lger, C. Valine to cysteine mutation further increases oxygen tolerance of Escherichia coli NiFe hydrogenase Hyd-1. ACS Catal. 2019, 9, 4084-4088. [0378] (164) Nishikawa, K.; Ogata, H.; Higuchi, Y. Structural basis of the function of [NiFe]-hydrogenases. Chem. Lett. 2020, 49, 164-173. [0379] (165) Noor, N. D. M.; Matsuura, H.; Nishikawa, K.; Tai, H.; Hirota, S.; Kim, J.; Kang, J.; Tateno, M.; Yoon, K.-S.; Ogo, S.; Kubota, S.; Shomura, Y.; Higuchi, Y. Redox-dependent conformational changes of a proximal [4Fe-4S] cluster in Hyb-type [NiFe]-hydrogenase to protect the active site from O2. Chem. Commun. 2018, 54, 12385-12388. [0380] (166) Sakai, K.; Kitazumi, Y.; Shirai, O.; Takagi, K.; Kano, K. High-Power Formate/Dioxygen Biofuel Cell Based on Mediated Electron Transfer Type Bioelectrocatalysis. ACS Catal. 2017, 7, 5668-5673. [0381] (167) Meneghello, M.; Lger, C.; Fourmond, V. Electrochemical Studies of CO.sub.2-Reducing Metalloenzymes. Chemistry 2021, 27, 17542-17553. [0382] (168) Ruth, J. C.; Spormann, A. M. Enzyme electrochemistry for industrial applicationsA perspective on future area of focus. ACS Catal. 2021, 11, 5951-5967. [0383] (169) Cracknell, J. A.; Vincent, K. A.; Ludwig, M.; Lenz, O.; Friedrich, B.; Armstrong, F. A. Enzymatic oxidation of H2 in atmospheric O.sub.2: the electrochemistry of energy generation from trace H2 by aerobic microorganisms. J. Am. Chem. Soc. 2008, 130, 424-425. [0384] (170) Vincent, K. A.; Cracknell, J. A.; Lenz, O.; Zebger, I.; Friedrich, B.; Armstrong, F. A. Electrocatalytic hydrogen oxidation by an enzyme at high carbon monoxide or oxygen levels. Proc. Natl. Acad. Sci. U.S.A. 2005, 102, 16951-16954. [0385] (171) Vincent, K. A.; Cracknell, J. A.; Clark, J. R.; Ludwig, M.; Lenz, O.; Friedrich, B.; Armstrong, F. A. Electricity from low-level H2 in still airan ultimate test for an oxygen tolerant hydrogenase. Chem. Commun. 2006, 5033-5035. [0386] (172) Utterback, J. K.; Ruzicka, J. L.; Keller, H. R.; Pellows, L. M.; Dukovic, G. Electron Transfer from Semiconductor Nanocrystals to Redox Enzymes. Annu. Rev. Phys. Chem. 2020, 71, 335-359. [0387] (173) Greene, B. L.; Vansuch, G. E.; Chica, B. C.; Adams, M. W. W.; Dyer, R. B. Applications of Photogating and Time Resolved Spectroscopy to Mechanistic Studies of Hydrogenases. Acc. Chem. Res. 2017, 50, 2718-2726. [0388] (174) Falk, M.; Miller, A. G. Infrared spectrum of carbon dioxide in aqueous solution. Vib. Spectrosc. 1992, 4, 105-108. [0389] (175) Riepe, M. E.; Wang, J. H. Infrared studies on the mechanism of action of carbonic anhydrase. J. Biol. Chem. 1968, 243, 2779-2787. [0390] (176) Muthusamy, M.; Burrell, M. R.; Thorneley, R. N. F.; Bornemann, S. Real-time monitoring of the oxalate decarboxylase reaction and probing hydron exchange in the product, formate, using fourier transform infrared spectroscopy. Biochemistry 2006, 45, 10667-10673. [0391] (177) Mulder, D. W.; Peters, J. W.; Raugei, S. Catalytic bias in oxidation-reduction catalysis. Chem. Commun. 2021, 57, 713-720. [0392] (178) Fourmond, V.; Plumer, N.; Lger, C. Reversible catalysis. Nat. Rev. Chem. 2021, 5, 348-360. [0393] (179) Shafaat, H. S.; Yang, J. Y. Uniting biological and chemical strategies for selective CO.sub.2 reduction. Nat. Catal. 2021, 4, 928-933. [0394] (180) Magalon, A.; Alberge, F. Distribution and dynamics of OXPHOS complexes in the bacterial cytoplasmic membrane. Biochim. Biophys. Acta 2016, 1857, 198-213. [0395] (181) Orme-Johnson, W. H.; Orme-Johnson, N. R. In Iron-Sulfur Proteins; Spiro, T. G., Ed.; Wiley-Interscience: New York, 1982; pp 67-96. [0396] (182) Rutherfurd, S. M.; Dunn, B. M. Quantitative amino acid analysis. Curr. Protoc. Protein Sci. 2011, 63, 321. [0397] (183) Beinert, H. Micro methods for the quantitative determination of iron and copper in biological material. Methods Enzymol. 1978, 54, 435-445. [0398] (184) Beinert, H. Semi-micro methods for analysis of labile sulfide and of labile sulfide plus sulfane sulfur in unusually stable iron-sulfur proteins. Anal. Biochem. 1983, 131, 373-378. [0399] (185) Jones, R. W.; Garland, P. B. Sites and specificity of the reaction of bipyridylium compounds with anaerobic respiratory enzymes of Escherichia coli. Effects of permeability barriers imposed by the cytoplasmic membrane. Biochem. J. 1977, 164, 199-211. [0400] (186) Ghosh, R.; Quayle, J. R. Phenazine ethosulfate as a preferred electron acceptor to phenazine methosulfate in dye-linked enzyme assays. Anal. Biochem. 1979, 99, 112-117. [0401] (187) Jahn, B.; Pol, A.; Lumpe, H.; Barends, T. R. M.; Dietl, A.; Hogendoorn, C.; Op den Camp, H. J. M.; Daumann, L. J. Similar but Not the Same: First Kinetic and Structural Analyses of a Methanol Dehydrogenase Containing a Europium Ion in the Active Site. Chembiochem 2018, 19, 1147. [0402] (188) Olp, M. D.; Kalous, K. S.; Smith, B. C. ICEKAT: an interactive online tool for calculating initial rates from continuous enzyme kinetic traces. BMC Bioinf 2020, 21, 186. [0403] (189) Stoll, S.; Schweiger, A. EasySpin, a comprehensive software package for spectral simulation and analysis in EPR. J. Magn. Reson. 2006, 178, 42-55. [0404] (190) Brautigan, D. L.; Ferguson-Miller, S.; Margoliash, E. Mitochondrial cytochrome c: preparation and activity of native and chemically modified cytochromes c. Methods Enzymol. 1978, 53, 128-164. [0405] (191) Edwards, E.; Bren, K., Light-driven catalysis with engineered enzymes and biomimetic systems, Biotechnology and Applied Biochemistry, Vol. 67, Issue 4, July/August 2020, 463-483. [0406] (192) Haque, S.; Yasir, M.; Cosnier, S., Recent advancements in the field of flexible/wearable enzyme fuel cells, Biosensors and Bioelectronics, 214 (2002), 114545. [0407] (193) Hardt, S.; Stapf, S; Filmon, D.; Birrell, J.; Rudiger, O.; Fourmond, V.; Leger, C.; Plumere, N., Reversible H2 oxidation and evolution by hydrogenase embedded in a redox polymer film, Nature Catalysis, Vol. 4, March 2021, 251-258. [0408] (194) Voller, J.; Air-Stable [FeFe] hydrogenases, Natura Catalysis, Vol. 1, August 2018, 564. [0409] (195) Plumere, N.; Rudiger, O.; Alsheikh, A.; Williams, R.; Vivekananthan, J.; Poller, S.; Schuhmann, W.; Lubitz, W., A redox hydrogel protects hydrogenase from high-potential deactivation and oxygen damage, Nature Chemistry, Vol. 6, September 2014, 822-827. [0410] (196) Graham, J.; Niks, D.; Zane G.; Gui, Q.; Hom, K.; Hille, R.; Wall, J., Raman, C., How a Formate Dehydrogenase Responds to Oxygen: Unexpected O.sub.2 Insensitivity of an Enzyme Harboring Tungstopterin, Selenocysteine, and [4Fe-4S] Clusters, ACS Catal. 2022, 12, 10449-10471. [0411] (197) Milton, R., FAD-Dependent Glucose Dehydrogenase Immobilization and Mediation Within a Naphthoquinone Redox Polymer, Shelley D. Minteer (ed.), Enzyme Stabilization and Immobilization: Methods and Protocols, Methods in Molecular Biology, vol. 1504, DOI 10.1007/978-1-4939-6499-4_15, Springer Science+Business Media New York 2017 [0412] (198) Sokol, K.; Robinson, W.; Oliveira, A.; Warnan, J.; Nowaczyk, M.; Ruff, A.; Pereira, I.; Reisner, E, Photoreduction of CO.sub.2 with a Formate Dehydrogenase Driven by Photosystem II Using a Semi-artificial Z-Scheme Architecture. J. Am. Chem. Soc., 2018, 140, 48, 16418-16422. [0413] (199) Hillesland, K. L.; Lim, S.; Flowers, J. J.; Turkarslan, S.; Pinel, N.; Zane, G. M.; Elliott, N.; Qin, Y.; Wu, L.; Baliga, N. S.; Zhou, J.; Wall, J. D.; Stahl, D. A., Erosion of functional independence early in the evolution of a microbial mutualism. Proc Natl Acad Sci USA 2014, 111, 14822-7. [0414] (200) Keller, K. L.; Bender, K. S.; Wall, J. D., Development of a markerless genetic exchange system for Desulfovibrio vulgaris Hildenborough and its use in generating a strain with increased transformation efficiency. Appl Environ Microbiol 2009, 75, 7682-91. [0415] (201) Li, M. Z.; Elledge, S. J., Harnessing homologous recombination in vitro to generate recombinant DNA via SLIC. Nat Methods 2007, 4, 251-6. [0416] (202) Zane, G. M.; Yen, H. C.; Wall, J. D., Effect of the deletion of qmoABC and the promoter-distal gene encoding a hypothetical protein on sulfate reduction in Desulfovibrio vulgaris Hildenborough. Appl Environ Microbiol 2010, 76, 5500-9. [0417] (203) Studier, F. W., Protein production by auto-induction in high density shaking cultures. Protein Expr Purif 2005, 41, 207-34. [0418] (204) Parks, J. M.; Johs, A.; Podar, M.; Bridou, R.; Hurt, R. A., Jr.; Smith, S. D.; Tomanicek, S. J.; Qian, Y.; Brown, S. D.; Brandt, C. C.; Palumbo, A. V.; Smith, J. C.; Wall, J. D.; Elias, D. A.; Liang, L., The genetic basis for bacterial mercury methylation. Science 2013, 339, 1332-5. [0419] (205) Teufel, F.; Almagro Armenteros, J. J.; Johansen, A. R.; Gislason, M. H.; Pihl, S. I.; Tsirigos, K. D.; Winther, O.; Brunak, S.; von Heijne, G.; Nielsen, H., SignalP 6.0 predicts all five types of signal peptides using protein language models. Nat Biotechnol 2022. [0420] (206) Mota, C. S.; Rivas, M. G.; Brondino, C. D.; Moura, I.; Moura, J. J.; Gonzalez, P. J.; Cerqueira, N. M., The mechanism of formate oxidation by metal-dependent formate dehydrogenases. J Biol Inorg Chem 2011, 16, 1255-68. [0421] (207) Mota, C. S.; Valette, O.; Gonzalez, P. J.; Brondino, C. D.; Moura, J. J.; Moura, I.; Dolla, A.; Rivas, M. G., Effects of molybdate and tungstate on expression levels and biochemical characteristics of formate dehydrogenases produced by Desulfovibrio alaskensis NCIMB 13491. J Bacteriol 2011, 193, 2917-23. [0422] (208) Miller, M.; Robinson, W. E.; Oliveira, A. R.; Heidary, N.; Kornienko, N.; Warnan, J.; Pereira, I. A. C.; Reisner, E., Interfacing Formate Dehydrogenase with Metal Oxides for the Reversible Electrocatalysis and Solar-Driven Reduction of Carbon Dioxide. Angew Chem Int Ed Engl 2019, 58, 4601-4605. [0423] (209) Szczesny, J.; Ruff, A.; Oliveira, A. R.; Pita, M.; Pereira, I. A.; De Lacey, A. L.; Schuhmann, W., Electroenzymatic CO2 fixation using redox polymer/enzyme-modified gas diffusion electrodes. ACS Energy Lett 2020, 5, 321-327.(210) Alvarez-Malmagro, J.; Oliveira, A. R.; Gutierrez-Sanchez, C.; Villajos, B.; Pereira, I. A. C.; Velez, M.; Pita, M.; De Lacey, A. L., Bioelectrocatalytic Activity of W-Formate Dehydrogenase Covalently Immobilized on Functionalized Gold and Graphite Electrodes. ACS Appl Mater Interfaces 2021, 13, 11891-11900. [0424] (211) Rivas, M. G.; Gonzalez, P. J.; Brondino, C. D.; Moura, J. J.; Moura, I., EPR characterization of the molybdenum(V) forms of formate dehydrogenase from Desulfovibrio desulfuricans ATCC 27774 upon formate reduction. J Inorg Biochem 2007, 101, 1617-22. [0425] (212) Lissolo, T.; Pulvin, S.; Thomas, D., Reactivation of the hydrogenase from Desulfovibrio gigas by hydrogen. Influence of redox potential. J Biol Chem 1984, 259, 11725-9. [0426] (213) Tagawa, K.; Arnon, D. I., Oxidation-reduction potentials and stoichiometry of electron transfer in ferredoxins. Biochim Biophys Acta 1968, 153, 602-13. [0427] (214) Jones, R. W., The topography of the membrane-bound hydrogenase of Escherichia coli explored by non-physiological electron acceptors [proceedings]. Biochem Soc Trans 1979, 7, 724-5. [0428] (215) McKellar, R. C.; Sprott, G. D., Solubilization and properties of a particulate hydrogenase from Methanobacterium strain G2R. J Bacteriol 1979, 139, 231-8. [0429] (216) Graf, E.-G.; Thauer, R. K., Hydrogenase from Methanobacterium thermoautotrophicum, a nickel-containing enzyme. FEBS Lett 1981, 136, 163-169. [0430] (217) Arp, D. J.; Burris, R. H., Kinetic mechanism of the hydrogen-oxidizing hydrogenase from soybean nodule bacteroids. Biochemistry 1981, 20, 2234-40. [0431] (218) Rosner, B. M.; Schink, B., Purification and characterization of acetylene hydratase of Pelobacter acetylenicus, a tungsten iron-sulfur protein. J Bacteriol 1995, 177, 5767-72. [0432] (219) Mukund, S.; Adams, M. W., Glyceraldehyde-3-phosphate ferredoxin oxidoreductase, a novel tungsten-containing enzyme with a potential glycolytic role in the hyperthermophilic archaeon Pyrococcus furiosus. J Biol Chem 1995, 270, 8389-92. [0433] (220) Gross, R.; Simon, J.; Kroger, A., Periplasmic methacrylate reductase activity in Wolinella succinogenes. Arch Microbiol 2001, 176, 310-3. [0434] (221) Selwyn, M. J., A simple test for inactivation of an enzyme during assay. Biochim Biophys Acta 1965, 105, 193-5. [0435] (222) Biofuel Cells: Materials and Challenges, Eds. Inamuddin, M. A. Ahamed, R. Boddula, M. Rezakazemi (2021), John Wiley & Sons. [0436] (223) Li, W.; Sheng, G.; Liu, X.; Yu, H., Recent advances in the separators for microbial fuel cells, Bioresource Technology, Vol. 102, Issue 1, January 2011, p. 244-252. [0437] (224) Milton, R. D.; Hickey, D. P.; Abdellaoui, S.; Lim, K.; Wu, F.; Tan, B.; Minteer, S. D., Rational design of quinones for high power density biofuel cells. Chemical science 2015, 6 (8), 4867-4875. [0438] (225) Yuan, M.; Sahin, S.; Cai, R.; Abdellaoui, S.; Hickey, D. P.; Minteer, S. D.; Milton, R. D., Creating a Low-Potential Redox Polymer for Efficient Electroenzymatic CO2 Reduction. Angewandte Chemie 2018, 130 (22), 6692-6696. [0439] (226) Quah, T.; Milton, R. D.; Abdellaoui, S.; Minteer, S. D., Bioelectrocatalytic NAD+/NADH interconversion: transformation of an enzymatic fuel cell into an enzymatic redox flow battery. Chemical Communications 2017, 53 (60), 8411-8414.