Optimized genetic tool for modifying bacteria
12473527 · 2025-11-18
Assignee
Inventors
Cpc classification
C12N2310/20
CHEMISTRY; METALLURGY
C12N15/111
CHEMISTRY; METALLURGY
Y02E50/10
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
C12N15/74
CHEMISTRY; METALLURGY
C12N9/22
CHEMISTRY; METALLURGY
C12N15/113
CHEMISTRY; METALLURGY
International classification
C12N9/22
CHEMISTRY; METALLURGY
C12N15/90
CHEMISTRY; METALLURGY
C12N15/74
CHEMISTRY; METALLURGY
C12N15/113
CHEMISTRY; METALLURGY
C12N15/11
CHEMISTRY; METALLURGY
C12N15/10
CHEMISTRY; METALLURGY
Abstract
Methods, tools and kits allowing genetic modification, involving in particular a nucleic acid sequence used to facilitate the transformation of bacteria of the phylum Firmicutes, the sequence comprising i) all or part of the sequence SEQ ID NO: 126 and ii) a sequence allowing the modification of the genetic material of a bacterium and/or expression, within a bacterium, of a DNA sequence partially or totally absent from the genetic material present within the wild-type version of the bacterium are provided. Also provided are genetically modified bacteria and uses thereof, in particular for producing a solvent, preferably on an industrial scale.
Claims
1. A bacterium C. beijerinckii deposited under deposit number LMG P-31277 with BCCM-LMG or a genetically modified version thereof, wherein said genetically modified version is sensitive to an amphenicol and lacks pNF2.
2. The bacterium according to claim 1, wherein said bacterium is C. beijerinckii deposited under deposit number LMG P-31277 with BCCM-LMG.
3. The bacterium according to claim 1, wherein said bacterium is a genetically modified version of C. beijerinckii deposited under deposit number LMG P-31277 with BCCM-LMG, wherein said genetically modified version is sensitive to an amphenicol and lacks pNF2.
Description
FIGURES
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
(18) Amplification of about 1.5 kb if the strain still possesses the gene catB, or of about 900 bp if this gene has been deleted.
(19)
(20)
(21)
(22)
(23)
(24)
(25)
(26)
(27)
(28)
(29)
(30)
(31)
(32)
(33)
(34)
(35)
(36)
EXAMPLES
Example No. 1
(37) Material and Methods
(38) Culture Conditions
(39) C. acetobutylicum DSM 792 was cultured in 2YTG medium (Tryptone 16 g.Math.l.sup.1, yeast extract 10 g.Math.l.sup.1, glucose 5 g.Math.l.sup.1, NaCl 4 g.Math.l.sup.1). E. coli NEB10B was cultured in LB medium (Tryptone 10 g.Math.l.sup.1, yeast extract 5 g.Math.l.sup.1, NaCl 5 g.Math.l.sup.1). The solid media were prepared by adding 15 g.Math.l.sup.1 of agarose to the liquid media. Erythromycin (at concentrations of 40 or 500 mg.Math.l.sup.1 respectively in 2YTG or LB medium), chloramphenicol (25 or 12.5 mg.Math.l.sup.1 respectively in solid or liquid LB) and thiamphenicol (15 mg.Math.l.sup.1 in 2YTG medium) were used when necessary.
(40) Handling of the Nucleic Acids
(41) All the enzymes and kits used were used following the suppliers' recommendations.
(42) Construction of the Plasmids
(43) The plasmid pCas9.sub.acr (SEQ ID NO: 23), shown in
(44) The plasmid pGRNA.sub.ind (SEQ ID NO: 82) was constructed by cloning an expression cassette (SEQ ID NO: 83) of a gRNA under the control of the promoter Pcm-2tetO1 (Dong et al., 2012) synthesized by Eurofins Genomics in the SacI site of the vector pEC750C (SEQ ID NO: 106) (Wasels et al., 2017).
(45) The plasmids pGRNA-xylB (SEQ ID NO: 102), pGRNA-xylR (SEQ ID NO: 103), pGRNA-glcG (SEQ ID NO: 104) and pGRNA-bdhB (SEQ ID NO: 105) were constructed by cloning the respective primer pairs 5-TCATGATTTCTCCATATTAGCTAG-3 and 5-AAACCTAGCTAATATGGAGAAATC-3, 5-TCATGTTACACTTGGAACAGGCGT-3 and 5-AAACACGCCTGTTCCAAGTGTAAC-3 5-TCATTTCCGGCAGTAGGATCCCCA-3 and 5-AAACTGGGGATCCTACTGCCGGAA-3, 5-TCATGCTTATTACGACATAACACA-3 and 5-AAACTGTGTTATGTCGTAATAAGC-3 within the plasmid pGRNA.sub.ind (SEQ ID NO: 82) digested with BsaI.
(46) The plasmid pGRNA-bdhB (SEQ ID NO: 79) was constructed by cloning the DNA fragment obtained by assembly by overlapping PCR of the PCR products obtained with the primers 5-ATGCATGGATCCAAACGAACCCAAAAAGAAAGTTTC-3 and 5-GGTTGATTTCAAATCTGTGTAAACCTACCG-3 on the one hand, 5-ACACAGATTTGAAATCAACCACTTTAACCC-3 and 5-ATGCATGTCGACTCTTAAGAACATGTATAAAGTATGG-3 on the other hand, in the vector pGRNA-bdhB digested with BamHI and SacI.
(47) The plasmid pGRNA-bdhAbdhB (SEQ ID NO: 80) was constructed by cloning the DNA fragment obtained by assembly by overlapping PCR of the PCR products obtained with the primers 5-ATGCATGGATCCAAACGAACCCAAAAAGAAAGTTTC-3 and 5-GCTAAGTTTTAAATCTGTGTAAACCTACCG-3 on the one hand, 5-ACACAGATTTAAAACTTAGCATACTTCTTACC-3 and 5-ATGCATGTCGACCTTCTAATCTCCTCTACTATTTTAG-3 on the other hand, in the vector pGRNA-bdhB digested with BamHI and SacI.
(48) Transformation
(49) C. acetobutylicum DSM 792 was transformed according to the protocol described by Mermelstein et al., 1993. Selection of transformants of C. acetobutylicum DSM 792 already containing an expression plasmid of Cas9 (pCas9.sub.ind or pCas9.sub.acr) transformed with a plasmid containing an expression cassette of a gRNA was carried out on 2YTG solid medium containing erythromycin (40 mg.Math.l.sup.1), thiamphenicol (15 mg.Math.l.sup.1) and lactose (40 nM).
(50) Induction of Expression of Cas9
(51) Induction of expression of cas9 was carried out by growing the transformants obtained on a 2YTG solid medium containing erythromycin (40 mg.Math.l.sup.1), thiamphenicol (15 mg.Math.l.sup.1) and the inducer of expression of cas9 and gRNA, aTc (1 mg.Math.l.sup.1).
(52) Amplification of the Locus bdh
(53) Control of the editing of the genome of C. acetobutylicum DSM 792 at the level of the locus of the genes bdhA and bdhB was effected by PCR using the enzyme Q5 High-Fidelity DNA Polymerase (NEB) with V1 (5-ACACATTGAAGGGAGCTTTT-3) and V2 (5-GGCAACAACATCAGGCCTTT-3) primers.
(54) Results
(55) Transformation Efficiency
(56) In order to evaluate the effect of insertion of the gene acrIIA4 on the transformation frequency of the expression plasmid of cas9, various gRNA expression plasmids were transformed into the DSM 792 strain containing pCas9.sub.ind (SEQ ID NO: 22) or pCas9.sub.acr (SEQ ID NO: 23), and the transformants were selected on a medium supplemented with lactose. The obtained transformation frequencies are presented in
(57) Generation of bdhB and bdhAbdhB Mutants
(58) The targeting plasmid containing the gRNA expression cassette targeting bdhB (pGRNA-bdhBSEQ ID NO: 105) as well as two derived plasmids containing repair matrices allowing deletion of the bdhB gene alone (pGRNA-bdhBSEQ ID NO: 79) or of the bdhA and bdhB genes (pGRNA-bdhAbdhBSEQ ID NO: 80) were transformed into the DSM 792 strain containing pCas9.sub.ind (SEQ ID NO: 22) or pCas9.sub.acr (SEQ ID NO: 23). The obtained transformation frequencies are presented in Table 2:
(59) TABLE-US-00002 TABLE 2 DSM 792 pCas9.sub.ind pCas9.sub.acr pEC750C 32.6 27.1 CFU .Math. g.sup.1 24.9 27.8 CFU .Math. g.sup.1 pGRNA-bdhB 0 CFU .Math. g.sup.1 17.0 10.7 CFU .Math. g.sup.1 pGRNA-bdhB 0 CFU .Math. g.sup.1 13.3 4.8 CFU .Math. g.sup.1 pGRNA- 0 CFU .Math. g.sup.1 33.1 13.4 CFU .Math. g.sup.1 bdhAbdhB
(60) Transformation frequencies of the DSM 792 strain containing pCas9.sub.ind or pCas9.sub.acr with plasmids targeting bdhB. The frequencies are expressed as number of transformants obtained per g of DNA used in the transformation, and represent the mean values of at least two independent experiments.
(61) The transformants obtained underwent a step of induction of the expression of the CRISPR/Cas9 system by passage on a medium supplemented with anhydrotetracycline, aTc (
(62) The desired modifications were confirmed by PCR on the genomic DNA of two aTc-resistant colonies (
(63) Conclusions
(64) The genetic tool based on CRISPR/Cas9 described in Wasels et al. (2017) uses two plasmids: the first plasmid, pCas9.sub.ind, contains cas9 under the control of a promoter inducible with aTc, and the second plasmid, derived from pEC750C, contains the expression cassette of a gRNA (placed under the control of a second promoter inducible with aTc) as well as an editing matrix allowing repair of the double-strand break induced by the system.
(65) However, the inventors observed that certain gRNAs still seemed to be too toxic, despite control of their expression as well as of that of Cas9 by means of aTc-inducible promoters, consequently limiting the transformation efficiency of the bacteria by the genetic tool and therefore modification of the chromosome.
(66) In order to improve this genetic tool, the cas9 expression plasmid was modified, by inserting an anti-CRISPR gene, acrIIA4, under the control of a lactose-inducible promoter. The transformation efficiencies of different gRNA expression plasmids could thus be improved very significantly, allowing transformants for all the plasmids tested to be obtained.
(67) It has also been possible to perform editing of the locus bdhB within the genome of C. acetobutylicum DSM 792, using plasmids that could not be introduced into the DSM 792 strain containing pCas9.sub.ind. The frequencies of modification observed are the same as those observed previously (Wasels et al., 2017), with 100% of the tested colonies modified.
(68) In conclusion, modification of the cas9 expression plasmid allows better control of the Cas9-gRNA ribonucleoprotein complex, advantageously facilitating the production of transformants in which the action of Cas9 can be triggered in order to obtain mutants of interest.
Example No. 2
(69) Material and Methods
(70) Culture Conditions
(71) C. beijerinckii DSM 6423 was cultured in 2YTG medium (Tryptone 16 g L.sup.1, yeast extract 10 g L.sup.1, glucose 5 g L.sup.1, NaCl 4 g L.sup.1). E. coli NEB 10-beta and INV110 were cultured in LB medium (Tryptone 10 g L.sup.1, yeast extract 5 g L.sup.1, NaCl 5 g L.sup.1). The solid media were prepared by adding 15 g L.sup.1 of agarose to the liquid media. Erythromycin (at concentrations of 20 or 500 mg L.sup.1 respectively in 2YTG or LB medium), chloramphenicol (25 or 12.5 mg L.sup.1 respectively in solid or liquid LB), thiamphenicol (15 mg L.sup.1 in 2YTG medium) or spectinomycin (at concentrations of 100 or 650 mg L.sup.1 respectively in LB or 2YTG medium) were used if necessary.
(72) Nucleic Acids and Plasmid Vectors
(73) All the enzymes and kits used were used following the suppliers' recommendations.
(74) The PCR assays on colonies observed the following protocol:
(75) An isolated colony of C. beijerinckii DSM 6423 is resuspended in 100 L of Tris 10 mM pH 7.5 EDTA 5 mM. This solution is heated at 98 C. for 10 min without stirring. 0.5 L of this bacterial lysate can then be used as PCR matrix in reactions of 10 L with Phire (Thermo Scientific), Phusion (Thermo Scientific), Q5 (NEB) or KAPA2G Robust (Sigma-Aldrich) polymerase.
(76) The list of the primers used for all of the constructions (name/DNA sequence) is detailed below:
(77) TABLE-US-00003 catB_fwd: TGTTATGGATTATAAGCGGCTCGAGGACGTCAAA CCATGTTAATCATTGC catB_rev: AATCTATCACTGATAGGGACTCGAGCAATTTCACC AAAGAATTCGCTAGC catB_gRNA_ AATCTATCACTGATAGGGACTCGAGGGGCAAAAGT rev: GTAAAGACAAGCTTC RH076: CATATAATAAAAGGAAACCTCTTGATCG RH077: ATTGCCAGCCTAACACTTGG RH001: ATCTCCATGGACGCGTGACGTCGACATAAGGTAC AGGAATTAGAGCAGC RH002: TCTATCTCCAGCTCTAGACCATTATTATTCCTCCA- AGTTTGCT RH003: ATAATGGTCTAGAGCTGGAGATAGATTATTTGGTA CTAAG RH004: TATGACCATGATTACGAATTCGAGCTCGAAGCGCT TATTATTGCATTAGC pEX-fwd: CAGATTGTACTGAGAGTGCACC pEX-rev: GTGAGCGGATAACAATTTCACAC pEC750C-fwd: CAATATTCCACAATATTATATTATAAGCTAGC M13-rev: CAGGAAACAGCTATGAC RH010: CGGATATTGCATTACCAGTAGC RH011: TTATCAATCTCTTACACATGGAGC RH025: TAGTATGCCGCCATTATTACGACA RH134: GTCGACGTGGAATTGTGAGC pNF2_fwd: GGGCGCACTTATACACCACC pNF2_rev: TGCTACGCACCCCCTAAAGG RH021: ACTTGGGTCGACCACGATAAAACAAGGTTTTAAGG RH022: TACCAGGGATCCGTATTAATGTAACTATGATATCA ATTCTTG aad9-fwd2: ATGCATGGTCCCAATGAATAGGTTTACACTTACTT TAGTTTTATGG aad9-rev: ATGCGAGTTAACAACTTCTAAAATCTGATTACCAA TTAG RH031: ATGCATGGATCCCAATGAATAGGTTTACACTTACT TTAGTTTTATGG RH032: ATGCGAGAGCTCAACTTCTAAAATCTGATTACCAA TTAG RH138: ATGCATGGATCCGTCTGACAGTTACCAGGTCC RH139: ATGCGAGAGCTCCAATTGTTCAAAAAAATAATGGC GGAG RH140: ATGCATGGATCCCGGCAGTTTTTCTTTTTCGG RH141: ATGCGAGAGCTCGGTTAAATACTAGTTTTTAGTTA CAGAC
(78) The following plasmid vectors were prepared:
(79) Plasmid No. 1: pEX-A258-catB (SEQ ID NO: 17)
(80) It contains the synthesized DNA fragment catB cloned in the plasmid pEX-A258. This fragment catB comprises i) an expression cassette of a guide RNA targeting the gene catB (chloramphenicol resistance gene encoding a chloramphenicol-O-acetyltransferaseSEQ ID NO: 18) of C. beijerinckii DSM6423 under the control of an anhydrotetracycline-inducible promoter (expression cassette: SEQ ID NO: 19), and ii) an editing matrix (SEQ ID NO: 20) comprising 400 bp homologues located upstream and downstream of the gene catB.
(81) Plasmid No. 2: pCas9ind-catB (cf.
(82) It contains the fragment catB amplified by PCR (primers catB_fwd and catB_rev) and cloned in pCas9ind (described in patent application WO2017/064439SEQ ID NO: 22) after digestion of the various DNAs with the XhoI restriction enzyme.
(83) Plasmid No. 3: pCas9acr (cf.
(84) Plasmid No. 4: pEC750S-uppHR (cf.
(85) It contains a repair matrix (SEQ ID NO: 25) used for deleting the gene upp and consisting of two homologous DNA fragments upstream and downstream of the gene upp (respective sizes: 500 (SEQ ID NO: 26) and 377 (SEQ ID NO: 27) base pairs). The assembly was obtained using the Gibson cloning system (New England Biolabs, Gibson assembly Master Mix 2). For this purpose, the parts upstream and downstream were amplified by PCR starting from the genomic DNA of the strain DSM 6423 (cf. Mat Gerando et al., 2018 and accession number PRJEB11626 (https://www.ebi.ac.uk/ena/data/view/PRJEB11626)) using the respective primers RH001/RH002 and RH003/RH004. These two fragments were then assembled in pEC750S linearized beforehand by enzymatic restriction (SalI and SacI restriction enzymes).
(86) Plasmid No. 5: pEX-A2-gRNA-upp (cf.
(87) This plasmid comprises the DNA fragment gRNA-upp corresponding to an expression cassette (SEQ ID NO: 29) of a guide RNA targeting the gene upp (protospacer targeting upp (SEQ ID NO: 31)) under the control of a constitutive promoter (non-coding RNA of sequence SEQ ID NO: 30), inserted in a replication plasmid designated pEX-A2.
(88) Plasmid No. 6: pEC750S-upp (cf.
(89) It has the plasmid pEC750S-uppHR (SEQ ID NO: 24) as base and in addition contains the DNA fragment comprising an expression cassette of a guide RNA targeting the gene upp under the control of a constitutive promoter.
(90) This fragment was inserted in a pEX-A2, called pEX-A2-gRNA-upp. The insert was then amplified by PCR with the primers pEX-fwd and pEX-rev, and then digested with the restriction enzymes XhoI and NcoI. Finally, this fragment was cloned by ligation in pEC750S-uppHR digested beforehand with the same restriction enzymes to obtain pEC750S-upp.
(91) Plasmid No. 7: pEC750C-upp (cf.
(92) The cassette comprising the guide RNA as well as the repair matrix were then amplified with the primers pEC750C-fwd and M13-rev. The amplicon was digested with enzymatic restriction with the enzymes XhoI and SacI, and then cloned by enzymatic ligation in pEC750C to obtain pEC750C-upp.
(93) Plasmid No. 8: pGRNA-pNF2 (cf.
(94) This plasmid has pEC750C as base and contains an expression cassette of a guide RNA targeting the plasmid pNF2 (SEQ ID NO: 118).
(95) Plasmid No. 9: pCas9ind-gRNcatB (cf.
(96) It contains the sequence encoding the guide RNA targeting the locus catB amplified by PCR (primers catB_fwd and catBgRNA_rev) and cloned in pCas9ind (described in patent application WO2017/064439) after digestion of the various DNAs with the restriction enzyme XhoI and ligation.
(97) Plasmid No. 10: pNF3 (cf.
(98) It contains a part of the pNF2, in particular comprising the replication origin and a gene encoding a plasmid replication protein (CIBE_p20001), amplified with the primers RH021 and RH022. This PCR product was then cloned at the level of the restriction sites SalI and BamHI in the plasmid pUC19 (SEQ ID NO: 117).
(99) Plasmid No. 11: pEC751S (cf.
(100) It contains all the elements of pEC750C (SEQ ID NO: 106), except the chloramphenicol resistance gene catP (SEQ ID NO: 70). The latter was replaced with the gene aad9 of Enterococcus faecalis (SEQ ID NO: 130), which confers spectinomycin resistance. This element was amplified with the primers aad9-fwd2 and aad9-rev starting from the plasmid pMTL007S-E1 (SEQ ID NO: 120) and cloned in the sites AvaII and HpaI of pEC750C, in place of the gene catP (SEQ ID NO: 70).
(101) Plasmid No. 12: pNF3S (cf.
(102) It contains all the elements of pNF3, with an insertion of the gene aad9 (amplified with the primers RH031 and RH032 starting from pEC751S) between the sites BamHI and SacI.
(103) Plasmid No. 13: pNF3E (cf.
(104) It contains all the elements of pNF3, with an insertion of the gene ermB of Clostridium difficile (SEQ ID NO: 131) under the control of the promoter miniPthl. This element was amplified starting from pFW01 with the primers RH138 and RH139 and cloned between the sites BamHI and SacI of pNF3E.
(105) Plasmid No. 14: pNF3C (cf.
(106) It contains all the elements of pNF3, with an insertion of the gene catP of Clostridium perfringens (SEQ ID NO: 70). This element was amplified starting from pEC750C with the primers RH140 and RH141 and cloned between the sites BamHI and SacI of pNF3E.
(107) Results No. 1
(108) Transformation of the Strain C. beijerinckii DSM 6423
(109) The plasmids were introduced and replicated in a strain of E. coli dam.sup. dcm.sup. (INV110, Invitrogen). This makes it possible to remove the methylations of the Dam and Dcm type on the plasmid pCas9ind-catB before introducing it by transformation in the DSM 6423 strain according to the protocol described by Mermelstein et al. (1993), with the following modifications: the strain is transformed with a larger amount of plasmid (20 g), at an OD.sub.600 of 0.8, and with the following electroporation parameters: 100, 25 F, 1400 V. Spreading on a Petri dish containing erythromycin (20 g/mL) thus made it possible to obtain transformants of C. beijerinckii DSM 6423 containing the plasmid pCas9ind-catB.
(110) Induction of Expression of Cas9 and Production of the Strain C. beijerinckii DSM 6423 catB (C. beijerinckii IFP962 catB)
(111) Several erythromycin-resistant colonies were then taken up in 100 L of culture medium (2YTG) and then diluted in series up to a dilution factor of 10.sup.4 in culture medium. For each colony, eight L of each dilution was deposited on a Petri dish containing erythromycin and anhydrotetracycline (200 ng/mL), making it possible to induce expression of the gene encoding the nuclease Cas9.
(112) After extraction of genomic DNA, deletion of the gene catB within the clones that had grown on this dish was verified by PCR, using the primers RH076 and RH077 (cf.
(113) Verification of the Sensitivity of the Strain C. beijerinckii DSM 6423 catB to Thiamphenicol
(114) To ensure that deletion of the gene catB does indeed confer new thiamphenicol sensitivity, comparative analyses were carried out on agar medium. Precultures of C. beijerinckii DSM 6423 and C. beijerinckii DSM 6423 catB were carried out on 2YTG medium and then 100 L of these precultures was spread on 2YTG agar media supplemented or not with thiamphenicol at a concentration of 15 mg/L. It can be seen from
(115) Deletion of the Gene Upp by the CRISPR-Cas9 Tool in the Strain C. beijerinckii DSM 6423 catB
(116) A clone of the strain C. beijerinckii DSM 6423 catB was transformed beforehand with the vector pCas9.sub.acr that does not have a methylation at the level of the motifs recognized by methyltransferases of the dam and dcm type (prepared from a bacterium Escherichia coli having the dam.sup. dcm.sup. genotype). Presence of the plasmid pCas9.sub.acr maintained in the strain C. beijerinckii DSM 6423 was verified by PCR on a colony with the primers RH025 and RH134.
(117) An erythromycin-resistant clone was then transformed with pEC750C-upp demethylated beforehand. The colonies thus obtained were selected on medium containing erythromycin (20 g/mL), thiamphenicol (15 g/mL) and lactose (40 mM).
(118) Several of these clones were then resuspended in 100 L of culture medium (2YTG) and then diluted in series in culture medium (up to a dilution factor of 10.sup.4). Five L of each dilution was deposited on a Petri dish containing erythromycin, thiamphenicol and anhydrotetracycline (200 ng/mL) (cf.
(119) For each clone, two colonies resistant to aTc were tested by colony PCR with primers intended for amplifying the locus upp (cf.
(120) Deletion of the Natural Plasmid pNF2 by the CRISPR-Cas9 Tool in the Strain C. beijerinckii DSM 6423 catB
(121) A clone of the strain C. beijerinckii DSM 6423 catB was transformed beforehand with the vector pCas9.sub.ind that does not have a methylation at the level of the motifs recognized by methyltransferases of the Dam and Dcm type (prepared from a bacterium Escherichia coli having the dam.sup. dcm genotype). The presence of the plasmid pCas9.sub.ind within the strain C. beijerinckii DSM6423 was verified by PCR with the primers pCas9.sub.ind fwd (SEQ ID NO: 42) and pCas9.sub.ind_rev (SEQ ID NO: 43) (cf.
(122) An erythromycin-resistant clone was then used for transforming pGRNA-pNF2, prepared from a bacterium Escherichia coli having the dam.sup. dcm.sup. genotype.
(123) Several colonies obtained on medium containing erythromycin (20 g/mL) and thiamphenicol (15 g/mL) were resuspended in culture medium and diluted in series up to a dilution factor of 10.sup.4. Height L of each dilution was deposited on a Petri dish containing erythromycin, thiamphenicol and anhydrotetracycline (200 ng/mL) in order to induce expression of the CRISPR/Cas9 system. Absence of the natural plasmid pNF2 was verified by PCR with the primers pNF2_fwd (SEQ ID NO: 39) and pNF2_rev (SEQ ID NO: 40) (cf.
(124) Conclusions
(125) In the course of this work, the inventors succeeded in introducing and maintaining various plasmids within the strain Clostridium beijerinckii DSM 6423. They succeeded in suppressing the gene catB using a CRISPR-Cas9 tool based on the use of a single plasmid. The thiamphenicol sensitivity of the recombinant strains obtained was confirmed by assays in agar medium.
(126) This deletion enabled them to use the CRISPR-Cas9 tool more efficiently, requiring two plasmids described in patent application FR1854835. Two examples demonstrating the advantage of this application were carried out: deletion of the gene upp and removal of a natural plasmid that is not essential for the strain Clostridium beijerinckii DSM 6423.
(127) Results No. 2
(128) Transformation of the Strains of C. beijerinckii
(129) The plasmids prepared in the strain of E. coli NEB 10-beta are also used for transforming the strain C. beijerinckii NCIMB 8052. However, for C. beijerinckii DSM 6423, the plasmids are introduced beforehand and replicated in a strain of E. coli dam.sup. dcm.sup. (INV110, Invitrogen). This makes it possible to remove the methylations of the Dam and Dcm type on the plasmids of interest before introducing them by transformation into the strain DSM 6423.
(130) The transformation is otherwise carried out similarly for each strain, i.e. according to the protocol described by Mermelstein et al. 1992, with the following modifications: the strain is transformed with a larger amount of plasmid (5-20 g), at an OD.sub.600 of 0.6-0.8, and the electroporation parameters are 100, 25F, 1400 V. After 3 h of regeneration in 2YTG, the bacteria are spread on a Petri dish (2YTG agar) containing the desired antibiotic (erythromycin: 20-40 g/mL; thiamphenicol: 15 g/mL; spectinomycin: 650 g/mL).
(131) Comparison of the Transformation Efficiencies of the Strains of C. beijerinckii DSM 6423
(132) Transformations were carried out in biological duplicate in the following strains of C. beijerinckii: DSM 6423 wild-type, DSM 6423 catB and DSM 6423 catB pNF2 (
(133) The results indicate an increase in the transformation efficiency by a factor of about 15-20, attributable to the loss of the natural plasmid pNF2.
(134) The transformation efficiency has also been tested for the plasmid pEC750C, which confers thiamphenicol resistance, only in the strains DSM 6423 catB (IFP962 catB) and DSM 6423 catB pNF2 (IFP963 catB pNF2), since the wild-type strain is resistant to this antibiotic (
(135) Comparison of the Transformation Efficiencies of the Plasmids pNF3 with Other Plasmids
(136) In order to determine the transformation efficiency of plasmids containing the replication origin of the natural plasmid pNF2, the plasmids pNF3E and pNF3C were introduced into the strain C. beijerinckii DSM 6423 catB pNF2. The use of vectors containing erythromycin or chloramphenicol resistance genes makes it possible to compare the transformation efficiency of the vector depending on the nature of the resistance gene. The plasmids pFW01 and pEC750C were also transformed. These two plasmids contain resistance genes to different antibiotics (erythromycin and thiamphenicol respectively) and are commonly used for transforming C. beijerinckii and C. acetobutylicum.
(137) As shown in
(138) Verification of the Transformability of the Plasmids pNF3 in Other Strains/Species
(139) To illustrate the possibility of using this new plasmid in other solventogenic strains of Clostridium, the inventors carried out a comparative analysis of the transformation efficiencies of the plasmids pFW01, pNF3E and pNF3S in the ABE strain C. beijerinckii NCIMB 8052 (
(140) The results demonstrate that the strain NCIMB 8052 is transformable with the plasmids based on pNF3, which proves that these vectors are applicable to the species C. beijerinckii in the broad sense.
(141) The applicability of the suite of synthetic vectors based on pNF3 was also tested in the reference strain DSM 792 of C. acetobutylicum. A transformation test thus showed that it is possible to transform this strain by means of the plasmid pNF3C (Transformation efficiency of 3 colonies observed per g of DNA transformed against 120 colonies/g for the plasmid pEC750C).
(142) Verification of the Compatibility of the Plasmids pNF3 with the Genetic Tool Described in Application FR18/73492
(143) Patent application FR18/73492 describes the strain catB as well as the use of a CRISPR/Cas9 system with two plasmids requiring the use of an erythromycin resistance gene and a thiamphenicol resistance gene. To demonstrate the advantage of the new suite of plasmids pNF3, the vector pNF3C was transformed into the strain catB already containing the plasmid pCas9.sub.acr. The transformation, carried out in duplicate, showed an transformation efficiency of 0.6250.125 colonies/g of DNA (meanstandard error), which proves that a vector based on pNF3C can be used in combination with pCas9.sub.acr in the strain catB.
(144) In parallel with these results, a part of the plasmid pNF2 comprising its replication origin (SEQ ID NO: 118) could be reused successfully for creating a new suite of shuttle vectors (SEQ ID NO: 119, 123, 124 and 125), modifiable at will, in particular allowing their replication in a strain of E. coli as well as their reintroduction in C. beijerinckii DSM 6423. These new vectors have advantageous transformation efficiencies for carrying out gene editing for example in C. beijerinckii DSM 6423 and derivatives thereof, in particular using the CRISPR/Cas9 tool comprising two different nucleic acids.
(145) These new vectors could also be tested successfully in another strain of C. beijerinckii (NCIMB 8052), and Clostridium species (in particular C. acetobutylicum), demonstrating their applicability in other organisms of the phylum Firmicutes. A test was also carried out on Bacillus.
(146) Conclusions
(147) These results demonstrate that suppression of the natural plasmid pNF2 significantly increases the transformation frequencies of the bacterium that contained it (by a factor of about 15 for pFW01 and by a factor of about 2000 for pEC750C). This result is particularly interesting in the case of bacteria of the genus Clostridium, which are known to be difficult to transform, and in particular for the strain C. beijerinckii DSM 6423, which has a low transformation efficiency naturally (lower than 5 colonies/g of plasmid).
REFERENCES
(148) Banerjee, A., Leang, C., Ueki, T., Nevin, K. P., & Lovley, D. R. (2014). Lactose-inducible system for metabolic engineering of Clostridium ljungdahlii. Applied and environmental microbiology, 80(8), 2410-2416. Chen J.-S., Hiu S. F. (1986) Acetone-butanol-isopropanol production by Clostridium beijerinckii (synonym, Clostridium butylicum). Biotechnol. Lett. 8:371-376. Cui, L., & Bikard, D. (2016). Consequences of Cas9 cleavage in the chromosome of Escherichia coli. Nucleic acids research, 44(9), 4243-4251. Currie, D. H., Herring, C. D., Guss, A. M., Olson, D. G., Hogsett, D. A., & Lynd, L. R. (2013). Functional heterologous expression of an engineered full length CipA from Clostridium thermocellum in Thermoanaerobacterium saccharolyticum. Biotechnology for biofuels, 6(1), 32. DiCarlo, J. E., Norville, J. E., Mali, P., Rios, X., Aach, J., & Church, G. M. (2013). Genome engineering in Saccharomyces cerevisiae using CRISPR-Cas systems. Nucleic acids research, 41(7), 4336-4343. Dong, H., Tao, W., Zhang, Y., & Li, Y. (2012). Development of an anhydrotetracycline-inducible gene expression system for solvent-producing Clostridium acetobutylicum: A useful tool for strain engineering. Metabolic engineering, 14(1), 59-67. Dong, D., Guo, M., Wang, S., Zhu, Y., Wang, S., Xiong, Z., . . . & Huang, Z. (2017). Structural basis of CRISPR-SpyCas9 inhibition by an anti-CRISPR protein. Nature, 546(7658), 436. Dupuy, B., Mani, N., Katayama, S., & Sonenshein, A. L. (2005). Transcription activation of a UV-inducible Clostridium perfringens bacteriocin gene by a novel factor. Molecular microbiology, 55(4), 1196-1206. Egholm, M., Buchardt, O., Nielsen, P. E., & Berg, R. H. (1992). Peptide nucleic acids (PNA). Oligonucleotide analogs with an achiral peptide backbone. Journal of the American Chemical Society, 114(5), 1895-1897. Fonfara, I., Le Rhun, A., Chylinski, K., Makarova, K. S., Lecrivain, A. L., Bzdrenga, J., . . . & Charpentier, E. (2013). Phylogeny of Cas9 determines functional exchangeability of dual-RNA and Cas9 among orthologous type II CRISPR-Cas systems. Nucleic acids research, 42(4), 2577-2590. Garcia-Doval C, Jinek M. Molecular architectures and mechanisms of Class 2 CRISPR-associated nucleases. Curr Opin Struct Biol. 2017 December; 47:157-166. doi: 10.1016/j.sbi.2017.10.015 Ajouter au projet Citavi par DOI. Epub 2017 Nov. 3. Review. George H. A., Johnson J. L., Moore W. E. C., Holdeman, L. V., Chen J. S. (1983) Acetone, Isopropanol, and Butanol Production by Clostridium beijerinckii (syn. Clostridium butylicum) and Clostridium aurantibutyricum. Appl. Env. Microbiol. 45:1160-1163. Gonzales y Tucker R D, Frazee B. View from the front lines: an emergency medicine perspective on clostridial infections in injection drug users. Anaerobe. 2014 December; 30:108-15. Hartman, A. H., Liu, H., & Melville, S. B. (2011). Construction and characterization of a lactose-inducible promoter system for controlled gene expression in Clostridium perfringens. Applied and environmental microbiology, 77(2), 471-478. Heap, J. T., Ehsaan, M., Cooksley, C. M., Ng, Y. K., Cartman, S. T., Winzer, K., & Minton, N. P. (2012). Integration of DNA into bacterial chromosomes from plasmids without a counter-selection marker. Nucleic acids research, 40(8), e59-e59. Heap, J. T., Kuehne, S. A., Ehsaan, M., Cartman, S. T., Cooksley, C. M., Scott, J. C., & Minton, N. P. (2010). The ClosTron: mutagenesis in Clostridium refined and streamlined. Journal of microbiological methods, 80(1), 49-55. Heap, J. T., Pennington, O. J., Cartman, S. T., Carter, G. P., & Minton, N. P. (2007). The ClosTron: a universal gene knock-out system for the genus Clostridium. Journal of microbiological methods, 70(3), 452-464. Heap, J. T., Pennington, O. J., Cartman, S. T., & Minton, N. P. (2009). A modular system for Clostridium shuttle plasmids. Journal of microbiological methods, 78(1), 79-85. Hidalgo-Cantabrana, C., O'Flaherty, S., & Barrangou, R. (2017). CRISPR-based engineering of next-generation lactic acid bacteria. Current opinion in microbiology, 37, 79-87. Hiu S. F., Zhu C.-X., Yan R.-T., Chen J.-S. (1987) Butanol-ethanol dehydrogenase and butanol-ethanol-isopropanol dehydrogenase: different alcohol dehydrogenases in two strains of Clostridium beijerinckii (Clostridium butylicum). Appl. Env. Microbiol. 53:697-703. Huang, H., Chai, C., Li, N., Rowe, P., Minton, N. P., Yang, S., & Gu, Y. (2016). CRISPR/Cas9-based efficient genome editing in Clostridium ljungdahlii, an autotrophic gas-fermenting bacterium. ACS synthetic biology, 5(12), 1355-1361. Huggins, A. S., Bannam, T. L. and Rood, J. I. (1992) Comparative sequence analysis of the catB gene from Clostridium butylicum. Antimicrob. Agents Chemother. 36, 2548-2551. Ismaiel A. A., Zhu C. X., Colby G. D., Chen, J. S. (1993). Purification and characterization of a primary-secondary alcohol dehydrogenase from two strains of Clostridium beijerinckii. J. Bacteriol. 175:5097-5105. Jinek, M., Chylinski, K., Fonfara, I., Hauer, M., Doudna, J. A., & Charpentier, E. (2012). A programmable dual-RNA-guided DNA endonuclease in adaptive bacterial immunity. Science, 337(6096), 816-821. Jones D. T., Woods D. R. (1986) Acetone-butanol fermentation revisited. Microbiological Reviews 50:484-524. Kolek J., Sedlar K., Provaznik I., Patakova P. (2016). Dam and Dcm methylations prevent gene transfer into Clostridium pasteurianum NRRL B-598: development of methods for electrotransformation, conjugation, and sonoporation. Biotechnol Biofuels. 9:14. Li, Q., Chen, J., Minton, N. P., Zhang, Y., Wen, Z., Liu, J., . . . & Gu, Y. (2016). CRISPR-based genome editing and expression control systems in Clostridium acetobutylicum and Clostridium beijerinckii. Biotechnology journal, 11(7), 961-972. Makarova, K. S., Haft, D. H., Barrangou, R., Brouns, S. J., Charpentier, E., Horvath, P., . . . & Van Der Oost, J. (2011). Evolution and classification of the CRISPR-Cas systems. Nature Reviews Microbiology, 9(6), 467. Makarova, K. S., Wolf, Y. I., Alkhnbashi, 0. S., Costa, F., Shah, S. A., Saunders, S. J., . . . & Horvath, P. (2015). An updated evolutionary classification of CRISPR-Cas systems. Nature Reviews Microbiology, 13(11), 722. Marino, N. D., Zhang, J. Y., Borges, A. L., Sousa, A. A., Leon, L. M., Rauch, B. J., . . . & Bondy-Denomy, J. (2018). Discovery of widespread type I and type V CRISPR-Cas inhibitors. Science, 362(6411), 240-242. Mt de Grando, H., Wasels, F., Bisson, A., Clment, B., Bidard, F., Jourdier E., Lopez-Contreras A., Lopes Ferreira N. (2018). Genome and transcriptome of the natural isopropanol producer Clostridium beijerinckii DSM 6423. BMC genomics. 19:242. Mearls, E. B., Olson, D. G., Herring, C. D., & Lynd, L. R. (2015). Development of a regulatable plasmid-based gene expression system for Clostridium thermocellum. Applied microbiology and biotechnology, 99(18), 7589-7599. Mermelstein, L. D., & Papoutsakis, E. T. (1993). In vivo methylation in Escherichia coli by the Bacillus subtilis phage phi 3T I methyltransferase to protect plasmids from restriction upon transformation of Clostridium acetobutylicum ATCC 824. Applied and environmental microbiology, 59(4), 1077-1081. Mermelstein L. D., Welker N. E., Bennett G. N., Papoutsakis E. T. (1992). Expression of cloned homologous fermentative genes in Clostridium acetobutylicum ATCC 824 10:190-195. Mermelstein L. D., Welker N. E., Bennett G. N., Papoutsakis E. T. (1993). Expression of cloned homologous fermentative genes in Clostridium acetobutylicum ATCC 824 10:190-195. Moon H G, Jang Y S, Cho C, Lee J, Binkley R, Lee S Y. One hundred years of clostridial butanol fermentation. FEMS Microbiol Lett. 2016 February; 363(3). Nagaraju, S., Davies, N. K., Walker, D. J. F., Kopke, M., & Simpson, S. D. (2016). Genome editing of Clostridium autoethanogenum using CRISPR/Cas9. Biotechnology for biofuels, 9(1), 219. Nariya, H., Miyata, S., Kuwahara, T., & Okabe, A. (2011). Development and characterization of a xylose-inducible gene expression system for Clostridium perfringens. Applied and environmental microbiology, 77(23), 8439-8441. Newcomb, M., Millen, J., Chen, C. Y., & Wu, J. D. (2011). Co-transcription of the celC gene cluster in Clostridium thermocellum. Applied microbiology and biotechnology, 90(2), 625-634. Pawluk, A., Davidson, A. R., & Maxwell, K. L. (2018). Anti-CRISPR: Discovery, mechanism and function. Nature Reviews Microbiology, 16(1), 12 Poehlein A., Solano J. D. M., Flitsch S. K., Krabben P., Winzer K., Reid S. J., Jones D. T., Green E., Minton N. P., Daniel R., Drre P. (2017). Microbial solvent formation revisited by comparative genome analysis. Biotechnol Biofuels. 10:58. Pyne, M. E., Bruder, M. R., Moo-Young, M., Chung, D. A., & Chou, C. P. (2016). Harnessing heterologous and endogenous CRISPR-Cas machineries for efficient markerless genome editing in Clostridium. Scientific reports, 6. Rauch, B. J., Silvis, M. R., Hultquist, J. F., Waters, C. S., McGregor, M. J., Krogan, N. J., & Bondy-Denomy, J. (2017). Inhibition of CRISPR-Cas9 with bacteriophage proteins. Cell, 168(1-2), 150-158. Rajewska M., Wegrzyn K, Konieczny I., FEMS Microbiol Rev. 2012 March; 36(2). AT-rich region and repeated sequencesthe essential elements of replication origins of bacterial replicons:408-34. Ransom, E. M., Ellermeier, C. D., & Weiss, D. S. (2015). Use of mCherry red fluorescent protein for studies of protein localization and gene expression in Clostridium difficile. Applied and environmental microbiology, 81(5), 1652-1660. Rogers P., Chen J.-S., Zidwick M. (2006) in The prokaryotes. 3rd edition, Vol. 1, edited by Dworkin M (Springer, New York, USA, 2006). 3rd edition, Vol. 1, pp. 672-755. Schwarz S, Kehrenberg C, Doublet B, Cloeckaert A. Molecular basis of bacterial resistance to chloramphnicol and florfenicol. FEMS Microbiol Rev. 2004 November; 28(5):519-42. Stella S, Alcn P, Montoya G. Class 2 CRISPR-Cas RNA-guided endonucleases: Swiss Army knives of genome editing. Nat Struct Mol Biol. 2017 November; 24(11):882-892. doi: 10.1038/nsmb.3486. Wang, S., Dong, S., Wang, P., Tao, Y., & Wang, Y. (2017). Genome Editing in Clostridium saccharoperbutylacetonicum N1-4 with the CRISPR-Cas9 System. Applied and Environmental Microbiology, 83(10), e00233-17. Wang Y, Li X, Milne C B, et al. Development of a gene knockout system using mobile group II introns (Targetron) and genetic disruption of acid production pathways in Clostridium beijerinckii. Appl Environ Microbiol. 2013; 79(19): 5853-63. Wang, Y. et al. Markerless chromosomal gene deletion in Clostridium beijerinckii using CRISPR/Cas9 system. J. Biotechnol. 2015. 200: 1-5. Wang, Y., Zhang, Z. T., Seo, S. O., Lynn, P., Lu, T., Jin, Y. S., & Blaschek, H. P. (2016). Bacterial genome editing with CRISPR-Cas9: deletion, Integration, single nucleotide modification, and desirable clean mutant selection in Clostridium beijerinckii as an example. ACS synthetic biology, 5(7), 721-732. Wasels, F., Jean-Marie, J., Collas, F., Lpez-Contreras, A. M., & Ferreira, N. L. (2017). A two-plasmid inducible CRISPR/Cas9 genome editing tool for Clostridium acetobutylicum. Journal of microbiological methods. 140:5-11. Xu, T., Li, Y., Shi, Z., Hemme, C. L., Li, Y., Zhu, Y., . . . & Zhou, J. (2015). Efficient genome editing in Clostridium cellulolyticum via CRISPR-Cas9 nickase. Applied and environmental microbiology, 81(13), 4423-4431. Yadav, R., Kumar, V., Baweja, M., & Shukla, P. (2018). Gene editing and genetic engineering approaches for advanced probiotics: A Review. Critical reviews in food science and nutrition, 58(10), 1735-1746. Yue Chen, Bruce A. McClane, Derek J. Fisher, Julian I. Rood, Phalguni Gupta; Construction of an Alpha Toxin Gene Knockout Mutant of Clostridium perfringens Type A by Use of a Mobile Group II Intron; Appl. Environ. Microbiol. November 2005, 71 (11) 7542-7547; DOI: 10.1128/AEM.71.11.7542-7547.2005. Zhang, J., Liu, Y. J., Cui, G. Z., & Cui, Q. (2015). A novel arabinose-inducible genetic operation system developed for Clostridium cellulolyticum. Biotechnology for biofuels, 8(1), 36. Zhang C., Tinggang L. Jianzhong H. (2018) Characterization and genome analysis of a butanol-isopropanol-producing Clostridium beijerinckii strain BGS1. Biotechnol Biofuels (2018) 11:280. Zhong, J., Karberg, M., & Lambowitz, A. M. (2003). Targeted and random bacterial gene disruption using a group II intron (targetron) vector containing a retrotransposition-activated selectable marker. Nucleic acids research, 31(6), 1656-1664.