Expression cassette for expressing gene comprising overlapping open reading frames in insect cell and application thereof

12473571 ยท 2025-11-18

Assignee

Inventors

Cpc classification

International classification

Abstract

The disclosure discloses an expression cassette for expressing a gene including overlapping open reading frames in an insect cell and an application thereof. The expression cassette includes from 5 to 3 and operably linked: a promoter capable of driving transcription in the insect cell; an artificially constructed sequence; the overlapping open reading frames missing only a first translation start codon; wherein the artificially constructed sequence includes a native or engineered intron with splicing activity in the insect cell, the intron includes ATG or the intron is located between any two adjacent nucleotides in ATG. A recombinant adeno-associated virus vector including the expression cassette of the disclosure regulates relative expressions of VP1, VP2, and VP3 proteins, and relative expressions of Rep78 and Rep52 proteins by using a designed intron sequence and through an intron splicing function for large-scale production of rAAV.

Claims

1. An expression cassette for expressing a gene comprising overlapping open reading frames in an insect cell, comprising from 5 to 3 and operably linked: a promoter capable of driving transcription in the insect cell; an artificially constructed sequence comprising a 5 part of a first open reading frame; a 3 part of the first open reading frame comprising at least one additional open reading frame; wherein the artificially constructed sequence comprises a native or engineered intron with splicing activity in the insect cell, the intron comprises a translation start codon ATG of the first open reading frame or the intron is located between any two adjacent nucleotides in ATG, so that the 5 part of the first open reading frame lacks a translation start codon, and the intron does not comprise a promoter capable of driving transcription in the insect cell; the at least one additional open reading frame comprises at least one additional translation start codon; the expression cassette can only transcribe a precursor mRNA in the insect cell, and -during a post-transcriptional processing process, a translation start codon AUG in the artificially constructed sequence is retained or deleted or a translation start codon AUG is formed in the artificially constructed sequence only through an alternative splicing function of the intron, thereby implementing translation and expression of different overlapping open reading frames.

2. The expression cassette according to claim 1, wherein the artificially constructed sequence comprises from 5 to 3 and operably linked: a 5 part of the intron; a translation start codon ATG; a 3 part of the intron; a nucleotide sequence encoding a 2A self-cleaving polypeptide.

3. The expression cassette according to claim 2, wherein the 2A self-cleaving polypeptide is a T2A peptide, a P2A peptide, an E2A peptide, or an F2A peptide.

4. The expression cassette according to claim 1, wherein the artificially constructed sequence comprises from 5 to 3 and operably linked: a first-5-terminal intron donor upstream of a codon ATG; a second-5-terminal intron donor downstream of the codon ATG; and a 3-terminal intron receptor downstream of the codon ATG.

5. The expression cassette according to claim 1, wherein a 5-terminal nucleotide of the intron is GTNN, and a 3-terminal nucleotide of the intron is NNAG, wherein N is any one of four nucleotides, A, T, C, and G.

6. The expression cassette according to claim 1, wherein the gene comprising the overlapping open reading frames is a cap gene of AAV or a rep gene of AAV.

7. The expression cassette according to claim 1, wherein the promoter is a polh promoter or a p10 promoter.

8. The expression cassette according to claim 7, wherein the gene comprising the overlapping open reading frames is a cap gene of AAV, and the promoter is the p10 promoter.

9. The expression cassette according to claim 7, wherein the gene comprising the overlapping open reading frames is a rep gene of AAV, and the promoter is the polh promoter.

10. A nucleic acid molecule, comprising the expression cassette according to claim 1.

11. A nucleic acid molecule, comprising: a first expression cassette and a second expression cassette, wherein each of the first expression cassette and the second expression cassette is the expression cassette according to claim 1, and a gene expressed by the second expression cassette is different from a gene expressed by the first expression cassette.

12. The nucleic acid molecule according to claim 11, wherein the second expression cassette is in an antisense orientation with respect to the first expression cassette.

13. The nucleic acid molecule according to claim 11, wherein the second expression cassette is in a sense orientation with respect to the first expression cassette.

14. The nucleic acid molecule according to claim 10, further comprising: an exogenous gene and an AAV inverted terminal repeat sequence located at two terminals of the exogenous gene.

15. The nucleic acid molecule according to claim 14, wherein the exogenous gene is a reporter gene, and the reporter gene is at least one of a chloramphenicol acetyltransferase encoding gene, a -galactosidase encoding gene, a -glucuronidase encoding gene, a Renilla luciferase encoding gene, an alkaline phosphatase encoding gene, a firefly luciferase encoding gene, a green fluorescent protein encoding gene, and a red fluorescent protein encoding gene.

16. The nucleic acid molecule according to claim 14, wherein the exogenous gene is a gene encoding a drug polypeptide, and the drug polypeptide is at least one of lipoprotein esterase, apolipoprotein, cytokine, interleukin, and interferon.

17. A vector, comprising the expression cassette according to claim 1.

18. The vector according to claim 17, wherein the vector is an insect cytocompatible vector.

19. An insect cell, comprising the expression cassette according to claim 1.

20. The insect cell according to claim 19, wherein the expression cassette is integrated into a genome of the insect cell.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIG. 1 is a schematic diagram of expression regulation of a cap gene and a rep gene in wild-type AAV of the disclosure.

(2) FIG. 2 is a schematic diagram of expression regulation of an expression cassette I of a cap gene in Example 1 of the disclosure, wherein content A is a schematic diagram of a DNA strand of the expression cassette I of the cap gene; content B is a schematic diagram of translation and expression of a VP1 protein when an intron including a first start codon AUG is not spliced during a post-transcriptional processing process; content C is a schematic diagram of translation and expression of VP2 and VP3 proteins after the intron including the first start codon AUG is spliced during the post-transcriptional processing process.

(3) FIG. 3 is a schematic diagram of expression regulation of an expression cassette II of a cap gene in Example 3 of the disclosure, wherein content A is a schematic diagram of a DNA strand of the expression cassette II of the cap gene; content B is a schematic diagram of premature termination of translation of a VP protein when neither a first intron nor a second intron is spliced during a post-transcriptional processing process; content C is a schematic diagram of translation and expression of a VP1 protein after the second intron is spliced during the post-transcriptional processing process; content D is a schematic diagram of translation and expression of VP2 and VP3 proteins after the first intron is spliced during the post-transcriptional processing process.

(4) FIG. 4 is a schematic diagram of expression regulation of an expression cassette III of a cap gene in Example 5 of the disclosure, wherein content A is a schematic diagram of a DNA strand of the expression cassette III of the cap gene; content B is a schematic diagram of translation and expression of VP2 and VP3 proteins when an intron is not pruned during the post-transcriptional processing process; content C is a schematic diagram of translation and expression of a VP1 protein after the intron is pruned during the post-transcriptional processing process.

(5) FIG. 5 is a schematic diagram of expression regulation of an expression cassette I of a rep gene in Example 2 of the disclosure, wherein content A is a schematic diagram of a DNA strand of the expression cassette I of the rep gene; content B is a schematic diagram of translation and expression of a Rep78 protein when an intron including a first start codon AUG is not spliced during a post-transcriptional processing process; content C is a schematic diagram of translation and expression of a Rep52 protein after the intron including the first start codon AUG is spliced during the post-transcriptional processing process.

(6) FIG. 6 is a schematic diagram of expression regulation of an expression cassette II of a rep gene in Example 4 of the disclosure, wherein content A is a schematic diagram of a DNA strand of the expression cassette II of the rep gene; content B is a schematic diagram of premature termination of translation of a VP protein when neither a first intron nor a second intron is spliced during a post-transcriptional processing process; content C is a schematic diagram of translation and expression of a Rep78 protein after the second intron is spliced during the post-transcriptional processing process; content D is a schematic diagram of translation and expression of a Rep52 protein after the first intron is spliced during the post-transcriptional processing process.

(7) FIG. 7 is a schematic diagram of expression regulation of an expression cassette III of a rep gene in Example 6 of the disclosure, wherein content A is a schematic diagram of a DNA strand of the expression cassette III of the rep gene; content B is a schematic diagram of translation and expression of a Rep52 protein when an intron is not spliced during a post-transcriptional processing process; content C is a schematic representation of translation and expression of a Rep78 protein after the intron is spliced during the post-transcriptional processing process.

(8) FIG. 8 is a western blot detection diagram of recombinant baculovirus vectors Ac1, Ac2, Ac3, and Ac4 including an expression cassette I of a cap gene in Example 7 of the disclosure and a recombinant baculovirus vector Ac0 expressing a VP protein prepared in Comparative Example.

(9) FIG. 9 is a western blot detection diagram of a recombinant baculovirus vector Ac5 including an expression cassette I of a rep gene expressing a Rep protein in Example 7 of the disclosure.

(10) FIG. 10 is a western blot detection diagram of recombinant baculovirus vectors Ac6 and Ac7 including an expression cassette II of a cap gene in Example 7 of the disclosure and a recombinant baculovirus vector Ac0 expressing a VP protein prepared in Comparative Example.

(11) FIG. 11 is a western blot detection diagram of a recombinant baculovirus vector Ac8 including an expression cassette II of a rep gene expressing a Rep protein in Example 7 of the disclosure.

(12) FIG. 12 is a western blot detection diagram of recombinant baculovirus vectors Ac9 and Ac10 including an expression cassette III of a cap gene in Example 7 of the disclosure and a recombinant baculovirus vector Ac0 expressing a VP protein prepared in Comparative Example.

(13) FIG. 13 is a western blot detection diagram of a recombinant baculovirus vector Ac11 including an expression cassette III of a rep gene expressing a Rep protein in Example 7 of the disclosure.

(14) FIG. 14A, FIG. 14B, and FIG. 14C are silver-stained detection images of a purified recombinant AAV virion subjected to SDS-PAGE after a host cell is transfected with recombinant AAV bacmids CRI-0, CRI-1, CRI-2, CRI-3, CRI-4, CRI-5, CRI-6, CRI-7, and CRI-8 in Example 10 of the disclosure and show three capsid proteins VP1/VP2/VP3.

(15) FIG. 15 is an effect image of a purified recombinant AAV virion infecting a 293T cell after a host cell is transfected with recombinant AAV bacmids CRI-0, CRI-1, CRI-2, CRI-3, CRI-4, CRI-5, CRI-6, CRI-7, and CRI-8 in Example 10 of the disclosure.

(16) FIG. 16A, FIG. 16B, and FIG. 16C are silver-stained detection images of a purified recombinant AAV virion subjected to SDS-PAGE after a host cell is transfected with recombinant AAV bacmids CRI-9, CRI-10, CRI-11, CRI-12, CRI-13, CRI-14, CRI-15, CRI-16, and CRI-17 in Example 11 of the disclosure and show three capsid proteins VP1/VP2/VP3.

(17) FIG. 17 is an effect image of a purified recombinant AAV virion infecting a 293T cell after a host cell is transfected with recombinant AAV bacmids CRI-9, CRI-10, CRI-11, CRI-12, CRI-13, CRI-14, CRI-15, CRI-16, and CRI-17 in Example 11 of the disclosure.

DETAILED DESCRIPTION OF DISCLOSED EMBODIMENTS

(18) In order for the objectives, technical solutions, and advantages of the disclosure to be clearer, the disclosure will be further described in detail below with reference to the drawings and the embodiments. It should be understood that the specific embodiments described herein are only used to explain the disclosure, but not to limit the disclosure.

Terminology Explanation

(19) As used herein, the term operably linked refers to the linkage of polynucleotide (or polypeptide) sequences in a functional relationship. Two nucleotide sequences are operably linked when the two nucleotide sequences are placed in a functional relationship. For example, a transcriptional regulatory sequence (for example, a promoter) is operably linked to a gene encoding sequence if the transcriptional regulatory sequence affects the transcription of the gene encoding sequence.

(20) The term expression cassette refers to a nucleic acid construct including an operably linked encoding sequence and regulatory sequence when introduced into a host cell, which respectively cause transcription and/or translation of an RNA or a polypeptide. The expression cassette is understood to include a promoter that allows transcription to start, an open reading frame for a target gene, and a transcription terminator. Typically, a promoter sequence is placed upstream of the target gene at a distance compatible with expression control of the target gene.

(21) The term open reading frame (ORF) is a normal nucleotide sequence of a structural gene that has the potential to encode a protein or a polypeptide and has no stop codon to interrupt translation starting with a start codon and ending with a stop codon. On an mRNA strand, a ribosome starts to translate from the start codon, synthesizes a polypeptide strand along a mRNA sequence and continues until the stop codon is encountered, and the elongation reaction of the polypeptide strand is stopped.

(22) The term vector refers to a nucleic acid molecule, such as a plasmid vector, a cosmid vector, an artificial chromosome, a phage vector, and other viral vectors designed to transport, transfer, and/or store a genetic material, and express the genetic material and/or integrate the genetic material into a chromosomal DNA of a host cell. The vector usually consists of at least three basic units, that is, a replication origin, a selectable marker, and a multiple cloning site.

(23) The term intron, also known as a spacer sequence, refers to a segment without an encoding function in a gene or an mRNA molecule, which is an intervening sequence in a eukaryotic cell DNA. An intron sequence is transcribed in an mRNA precursor, removed by splicing, and ultimately absent from a mature mRNA molecule. According to whether the splicing process is spontaneous or processed by a spliceosome, the intron is divided into a self-splicing intron and a spliceosome intron. The self-splicing intron is a special type of intron and is a ribozyme that may be excised by its own function to leave the mRNA. The intron involved in the disclosure is the spliceosome intron. The splicing of such intron requires the help of a spliceosome. There are a splicing donor sequence and a splicing acceptor sequence at two terminals of the intron sequence, which are sequences on two sides of severing and rejoining sites. The spliceosome is a ribonucleoprotein complex dynamically composed of a small nuclear RNA (snRNA) and a protein factor. The spliceosome recognizes a splicing site of the mRNA precursor and catalyzes a splicing reaction, completely splices the intron, and then reconnects upstream and downstream RNA sequences.

(24) The term AAV serotype: since the discovery of AAV, more than 100 AAV serotypes or mutants have been isolated from adenoviruses, humans, primates, and some mammals, of which AAV1-9 is mainly applied. The main difference between rAAV vectors of different serotypes is differences in capsid proteins. Different AAV serotypes have certain differences in infection efficiency and tissue specificity.

(25) The genome structures of all known adeno-associated virus serotypes are very similar. AAV is a single-stranded DNA virus with a simple genome structure and a full length of about 4.7 kb. As shown in FIG. 1, a genome includes an expression cassette of a rep gene, an expression cassette of a cap gene, and an AAV inverted terminal repeat (ITR) sequence located at two terminals of the genome. ITR is a palindromic structure of 125 nucleotides at the two terminals of the genome, which can form a self-complementary inverted T hairpin structure and is a cis-acting element required for the start of DNA replication and the packaging of a recombinant AAV genome into an infectious virion. As a defective virus, AAV cannot replicate independently in the absence of a helper virus, so AAV can only be integrated into a chromosome of a host cell at a specific point and is in a latent state. In the presence of the helper virus, the increased expression level of the rep gene may rescue the AAV genome integrated in the chromosome of the host cell, which is massively replicated to obtain AAV DNA. A single-stranded rAAV genome is packaged into the infectious virion under the function of a VP capsid protein. The cap gene encodes a structural VP capsid protein, which includes 3 overlapping open reading frames, respectively encoding three subunits, VP1, VP2, and VP3. VP1, VP2, and VP3 include different start codons and share one stop codon, and VP1 and VP2 share a VP3 sequence. An N-terminal of VP1 has a conserved phospholipase A2 sequence. The sequence is related to the escape of a virus from a body and is critical for infectivity. The VP2 protein is not essential for assembly or infection. A core of the VP3 protein consists of a conserved 3-barrel motif, which determines differences in receptors that different serotypes of AAV interact with the host cell. The correct ratio of the three proteins in wild-type AAV is 3:3:54, which is approximately 1:1:10. The rep gene encodes four overlapping multifunctional proteins Rep78, Rep68, Rep52, and Rep40. The Rep78 and Rep68 proteins participate in the replication and integration of AAV and may be combined with a specific sequence in the ITR. The Rep52 and Rep40 proteins have helicase and ATPase activities, and participate in the assembly of a virus while participating in the replication of a single-stranded genome. Whether in a mammalian cell or an insect cell, unspliced mRNA encoding the Rep78 and Rep52 proteins is sufficient for the requirements for preparing rAAV.

(26) The nucleic acid molecule mentioned in the disclosure may be a DNA molecule or an RNA molecule. It is known to persons skilled in the art that an RNA sequence is substantially similar to or has a certain degree of sequence identity with a DNA sequence, and thymine (T) in the DNA sequence may be considered equivalent to uracil (U) in the RNA sequence.

(27) The intron mentioned in the disclosure may be a native intron or an engineered intron and has splicing activity in the insect cell, but the source is not limited to the insect cell.

(28) An expression cassette for expressing a gene including overlapping open reading frames in an insect cell provided by the disclosure includes from 5 to 3 and operably linked: a promoter capable of driving transcription in the insect cell; an artificially constructed sequence; the overlapping open reading frames missing only a first translation start codon; wherein the artificially constructed sequence includes a native or engineered intron with splicing activity in the insect cell, the intron includes a translation start codon ATG or the intron is located between any two adjacent nucleotides in ATG; during a post-transcriptional processing process, through an alternative splicing function of the intron, a translation start codon AUG in the artificially constructed sequence is retained or deleted or a translation start codon AUG is formed in the artificially constructed sequence, thereby implementing regulation of translation and expression of different protein encoding genes in the overlapping open reading frames.

(29) In some embodiments, by using the alternative splicing function of the intron, the expression cassette including the intron may be used for correct expression of a AAV VP capsid protein or predominant expression of a Rep protein in the insect cell, wherein the overlapping open reading frames in the cap gene encode AAV capsid proteins VP1, VP2, and VP3, and the overlapping open reading frames in the rep gene encode Rep78 and Rep52 proteins.

(30) In some embodiments, by using the alternative splicing function of the intron, the expression cassette including the intron may be used to express VP capsid proteins of various simian viruses 40 (SV40) in the insect cell. SV40 is a double-stranded DNA virus with a 5.2 kb covalently closed circular genome, which also includes three capsid proteins VP1, VP2, and VP3. The VP3 protein is a truncated form of the VP2 protein, and VP3 and VP2 share a stop codon. A 5 part of a VP1 encoding sequence overlaps with a 3 part of VP2 and VP3 encoding sequences, but does not have the same open reading frame. In the mammalian cell, the expression of the VP proteins is regulated by an intron splicing mechanism. When the expression cassette of the disclosure is used to express the SV40 capsid protein in the insect cell, ORF that only lacks the first translation start codon in the expression cassette is a VP protein encoding sequence that only lacks the translation start codon ATG of the VP2 protein. The regulation of relative expression of the VP2 and VP3 proteins can be implemented by using the intron splicing strategy of the disclosure.

(31) In some embodiments, the gene including the overlapping open reading frames is a cap gene of AAV, the overlapping open reading frames that only lack the first translation start codon is a VP protein encoding sequence that only lacks a translation start codon ATG of a VP1 protein, and the artificially constructed sequence includes from 5 to 3 and operably linked: a 5 part of the intron; a translation start codon ATG; a 3 part of the intron; a nucleotide sequence encoding a 2A self-cleaving polypeptide.

(32) The disclosure mutates an intron splicing site at an N-terminal of the VP1 protein encoding sequence of wild-type AAV, so that a spliceosome in the insect cell cannot recognize the splicing site. The 5 part (a splicing donor sequence or a splicing acceptor sequence) of the intron upstream of the start codon ATG and the 3 part (a splicing acceptor sequence or a splicing donor sequence) of the intron downstream of the ATG form a complete intron splicing site, as shown in FIG. 2. During the post-transcriptional processing process, if the spliceosome in the insect cell recognizes the intron splicing site and catalyzes a splicing reaction, an AUG-start site at the front end of the mRNA is removed. When a ribosome recognizes the start codon of the VP2 protein from 5 to 3, the VP2 protein can be translated and expressed. Since the VP2 start codon is a suboptimal codon ACG, it will cause the leakage of ribosome scanning, so the VP3 protein can be translated and expressed. If the intron splicing site is not recognized and the AUG-start site is not removed, the mRNA is translated from the first AUG and the VP1 protein is expressed. The relative expression levels of the capsid proteins VP1, VP2, and VP3 are controlled through the splicing function with a certain probability of the intron. However, when the VP1 protein is translated and expressed, an additional sequence (that is, a part of the intron sequence) from the first AUG start codon of the mRNA to the N-terminal of the VP1 protein sequence is also translated, which affects the normal expression of the VP1 protein. Therefore, an encoding sequence of a 2A self-cleaving polypeptide is introduced into the expression cassette provided by the disclosure.

(33) The 2A self-cleaving polypeptide is a type of peptide fragment with 18-22 amino acid residues in length, which can induce self-cleavage of a recombinant protein including a 2A peptide in the cell. The peptide has a sequence motif, which often causes the ribosome to fail to connect at the final junction between glycine (G) and proline (P), thereby causing a cleavage effect, so that a C-terminal of the 2A self-cleaving polypeptide is disconnected from the N-terminal of the VP1 protein to obtain the normal VP1 protein. According to different virus sources, there are currently four commonly used 2A peptides: T2A, P2A, E2A, and F2A, and the amino acid sequences thereof are respectively shown in SEQ ID No.36 to SEQ ID No.39. The four 2A peptides may all be applied to the technical solution of the disclosure, and the embodiment of the disclosure takes T2A as an example.

(34) In some embodiments, the gene including the overlapping open reading frames is the cap gene of AAV, the overlapping open reading frames that only lack the first translation start codon is the VP protein encoding sequence that only lacks the translation start codon ATG of the VP1 protein, and the artificially constructed sequence includes from 5 to 3 and operably linked: a 5 part of a first intron; a translation start codon ATG; a 5 part of a second intron; a 3 part of the intron; wherein there is a stop codon in the 5 part of the second intron, the stop codon may be TAA, TAG, or TGA, and the number of nucleotides between the stop codon and the translation start codon ATG is a multiple of 3.

(35) The disclosure mutates an intron splicing site at an N-terminal of the VP1 protein encoding sequence of wild-type AAV, so that a spliceosome in the insect cell cannot recognize the splicing site. The 5 part of the first intron upstream of the start codon ATG and the 3 part of the intron downstream of the ATG form a complete first intron splicing site, and the 5 part of the second intron downstream of the ATG and the 3 part of the intron form a complete second intron splicing site, as shown in FIG. 3. During the post-transcriptional processing process, if the spliceosome in the insect cell recognizes the first intron splicing site and catalyzes a splicing reaction, an AUG-start site at the front end of the mRNA is removed. When a ribosome recognizes the start codon of the VP2 protein from 5 to 3, the VP2 protein can be translated and expressed. Since the VP2 start codon is a suboptimal codon ACG, it will cause the leakage of ribosome scanning, so the VP3 protein can be translated and expressed. If the spliceosome in the insect cell recognizes the second intron splicing site and catalyzes a splicing reaction, and the AUG-start site is not removed, the mRNA is translated from the first AUG and the VP1 protein is expressed. If the spliceosome in the insect cell neither splices the first intron splicing site nor the second intron splicing site, the mRNA is translated from the first AUG and is stopped at the stop codon inside the 5 part of the second intron, the translation is stopped prematurely, and the VP1, VP2, and VP3 proteins are not translated. The relative expression levels of the capsid proteins VP1, VP2, and VP3 are controlled through the splicing function with different probabilities of different introns.

(36) In some embodiments, the gene including the overlapping open reading frames is the cap gene of AAV, the overlapping open reading frames that only lack the first translation start codon is the VP protein encoding sequence that only lacks the translation start codon ATG of the VP1 protein, and the artificially constructed sequence includes from 5 to 3 and operably linked: an adenine nucleotide (A), the intron, a thymine nucleotide (T), and a guanine nucleotide (G); or an adenine nucleotide (A), a thymine nucleotide (T), the intron, and a guanine nucleotide (G).

(37) The disclosure mutates an intron splicing site at an N-terminal end of the VP1 protein encoding sequence of wild-type AAV, so that a spliceosome in the insect cell cannot recognize the splicing site, as shown in FIG. 4 (in the drawing, the intron is inserted between ATs of the ATG as an example). During the post-transcriptional processing process, if the spliceosome in the insect cell recognizes the intron splicing site inserted into the translation start codon AUG of the VP1 protein and catalyzes a splicing reaction, the intron is spliced, a complete AUG translation start site is formed, the mRNA is translated from the first AUG, and the VP1 protein is expressed. If the intron splicing site is not recognized and the intron is not spliced, the complete AUG translation start site cannot be formed. When a ribosome recognizes the start codon of the VP2 protein from 5 to 3, the VP2 protein can be translated and expressed. Since the VP2 start codon is a suboptimal codon ACG, which will cause the leakage of ribosome scanning, the VP3 protein can be translated and expressed. The relative expression levels of the capsid proteins VP1, VP2, and VP3 are controlled through the splicing function with a certain probability of the intron.

(38) In some embodiments, the gene including the overlapping open reading frames is the rep gene of AAV, the overlapping open reading frames that only lack the first translation start codon is the Rep protein encoding sequence that only lacks the translation start codon ATG of the Rep78 protein, and the artificially constructed sequence includes from 5 to 3 and operably linked: a 5 part of the intron; a translation start codon ATG; a 3 part of the intron; a nucleotide sequence encoding a 2A self-cleaving polypeptide.

(39) The disclosure mutates one or more possible translation start sites upstream of the translation start codon of the Rep52 protein in the Rep78 protein encoding sequence of wild-type AAV, so that a ribosome in the insect cell cannot recognize the sites. The 5 part of the intron upstream of the codon ATG and the 3 part of the intron downstream of the ATG form a complete intron splicing site, as shown in FIG. 5. During the post-transcriptional processing process, if a spliceosome recognizes the intron splicing site and catalyzes a splicing reaction, an AUG-start site at the front end of the mRNA is removed, the ribosome recognizes the start codon of the Rep52 protein from 5 to 3, and the Rep52 protein can be translated and expressed. If the intron splicing site is not recognized and the AUG-start site is not removed, the mRNA is translated from the first AUG. Since the 2A self-cleaving polypeptide has a self-cleaving function, the C-terminal of the 2A self-cleaving polypeptide is cleaved to release the Rep78 protein. The relative expression levels of the Rep78 protein and the Rep52 protein are controlled through the splicing function with a certain probability of the intron.

(40) In some embodiments, the gene including the overlapping open reading frames is the rep gene of AAV, the overlapping open reading frames that only lack the first translation start codon is the Rep protein encoding sequence that only lacks the translation start codon ATG of the Rep78 protein, and the artificially constructed sequence includes from 5 to 3 and operably linked: a 5 part of the first intron; a translation start codon ATG; a second the 5 part of the intron; a 3 part of the intron; wherein there is a stop codon in the 5 part of the second intron, the stop codon may be TAA, TAG, or TGA, and the number of nucleotides between the stop codon and the translation start codon ATG is a multiple of 3.

(41) The disclosure mutates one or more possible translation start sites upstream of the translation start codon of the Rep52 protein in the Rep78 protein encoding sequence of wild-type AAV, so that a ribosome in the insect cell cannot recognize the sites. The 5 part of the first intron upstream of the codon ATG and the 3 part of the intron downstream of the ATG form a complete first intron splicing site, the 5 part of the second intron downstream of the ATG and the 3 part of the intron form a complete second intron splicing site, as shown in FIG. 6. During the post-transcriptional processing process, if a spliceosome in the insect cell recognizes the first intron splicing site and catalyzes a splicing reaction, an AUG-start site at the front end of the mRNA is removed. When the ribosome recognizes the start codon of the Rep52 protein from 5 to 3, the Rep52 protein can be translated and expressed. If the spliceosome in the insect cell recognizes the second intron splicing site and catalyzes a splicing reaction, and the AUG-start site is not removed, the mRNA is translated from the first AUG, and the Rep78 protein is expressed. If the spliceosome in the insect cell neither splices the first intron splicing site nor the second intron splicing site, the mRNA is translated from the first AUG and is stopped at the stop codon inside the 5 part of the second intron, the translation is stopped prematurely, and the Rep78 and Rep52 proteins are not translated. The relative expression levels of the Rep78 protein and the Rep52 protein are controlled through the splicing function with different probabilities of different introns.

(42) In some embodiments, the gene including the overlapping open reading frames is the rep gene of AAV, the overlapping open reading frames that only lack the first translation start codon is the Rep protein encoding sequence that only lacks the translation start codon ATG of the Rep78 protein, and the artificially constructed sequence includes from 5 to 3 and operably linked: an adenine nucleotide (A), the intron, a thymine nucleotide (T), and a guanine nucleotide (G); or an adenine nucleotide (A), a thymine nucleotide (T), the intron, and a guanine nucleotide (G).

(43) The disclosure mutates one or more possible translation start sites upstream of the translation start codon of the Rep52 protein in the Rep78 protein encoding sequence of wild-type AAV, so that a ribosome in the insect cell cannot recognize the sites, as shown in FIG. 7 (in the drawing, the intron is inserted between ATs of the ATG as an example). During the post-transcriptional processing process, if a spliceosome in the insect cell recognizes the intron splicing site inserted into the translation start codon AUG of the Rep78 protein and catalyzes a splicing reaction, the intron is spliced, a complete AUG translation start site is formed, the mRNA is translated from the first AUG, and the Rep78 protein is expressed. If the intron splicing site is not recognized and the intron is not spliced, the complete AUG translation start site cannot be formed, the ribosome recognizes the start codon of the Rep52 protein from 5 to 3, and the Rep52 protein be translated. The relative expression levels of the Rep78 protein and the Rep52 protein are controlled through the splicing function with a certain probability of the intron.

(44) In some embodiments, preferably, a 5-terminal nucleotide of the intron is GTNN, and a 3-terminal nucleotide of the intron is NNAG, wherein N represents any one of four nucleotides A, T, C, and G. More specifically, a 5-terminal nucleotide of the first intron and a 5-terminal nucleotide of the second intron are both GTNN, and the 3-terminal nucleotide of the intron is NNAG, which can regulate the VP1, VP2, and VP3 proteins to be translated and expressed closer to a stoichiometric ratio to facilitate packaging into appropriate capsids. Similarly, the translation and expression level of the Rep78 protein is lower than the Rep52 protein to facilitate higher vector yield.

(45) In some embodiments, the nucleotide sequence of the intron is the sequence shown in SEQ ID No.2, SEQ ID No.3, SEQ ID No.4, SEQ ID No.5, SEQ ID No.15, SEQ ID No. 16, SEQ ID No.20, or SEQ ID No.21. As known to persons skilled in the art, the variant of the intron sequence may be used in the technical solution of the disclosure. In certain structures, a sequence having similarity to the nucleotide sequence of the intron of the disclosure may be used, such as a sequence whose 5-terminal is at least 40%, 50%, 60%, 70%, 80%, or 90% identical to the sequence GTAAGTATCG, or a sequence whose 5-terminal is at least 40%, 50%, 60%, 70%, 80%, or 90% identical to the sequence GTAAGTATTC; or a sequence whose 3-terminal is at least 40%, 50%, 60%, 70%, 80%, or 90% identical to the sequence CCTTTTCCTTTTTTTTTCAG, a sequence whose 3-terminal is at least 40%, 50%, 60%, 70%, 80%, or 90% identical to the sequence AAACATTATTTATTTTGCAG, or a sequence whose 3-terminal is at least 40%, 50%, 60%, 70%, 80%, or 90% identical to the sequence CATTTTGGATATTGTTTCAG.

(46) In some embodiments, the VP capsid protein encoded by the cap gene may be the capsid protein of any AAV serotype, such as AAV serotype 2, AAV serotype 5, AAV serotype 8, and AAV serotype 9. The intron sequence and the splicing strategy involved in the disclosure are applicable to the correct expression of the VP capsid proteins of the existing various AAV serotypes.

(47) In some embodiments, the promoter capable of driving transcription of the cap gene and the rep gene in the insect cell may be a polh promoter or a p10 promoter. Preferably, the expression cassette of the cap gene adopts the p10 promoter, and the expression cassette of the rep gene adopts the polh promoter.

(48) The disclosure also provides a nucleic acid molecule including the expression cassette of the cap gene and/or the expression cassette of the rep gene. The nucleic acid may include expression cassettes arranged in tandem, that is, in the same polarity or in an antisense orientation. Therefore, the expression cassette of the cap gene may be in an antisense orientation with respect to the expression cassette of the rep gene or may be in a sense orientation with respect to the expression cassette of the rep gene.

(49) The disclosure also provides a recombinant adeno-associated virus vector, preferably an insect cell-compatible vector, which includes the expression cassette of the cap gene and the expression cassette of the rep gene. The expression cassette of the cap gene is preferably the expression cassette constructed by the disclosure, and the expression cassette of the rep gene is preferably the gene expression cassette constructed by the disclosure. It should be understood that the rAAV vector also includes an exogenous gene and an AAV inverted terminal repeat sequence located at two terminals of the exogenous gene. ITR acts on the replication packaging and the site-directed integration of AAV, helping the vector to form a stable cyclic polymer and chromatin-like structure in the host cell, so that the vector can exist stably in the host cell for a long time, and the exogenous gene can also be continuously and stably expressed. The exogenous gene may be at least one nucleotide sequence encoding a gene of interest (GOI) product. The gene of interest product may be a therapeutic gene product, which is specifically a polypeptide, an RNA molecule (siRNA), or other gene products, such as but not limited to lipoprotein esterase, apolipoprotein, cytokine, interleukin, or interferon; may also be a reporter protein to assess transformation and expression of the vector, such as but not limited to, a fluorescent protein (a green fluorescent protein GFP, a red fluorescent protein RFP), chloramphenicol acetyltransferase, -galactosidase, -glucuronidase, Renilla luciferase, firefly luciferase, or alkaline phosphatase.

(50) On the other hand, the disclosure also provides an application of the recombinant adeno-associated virus vector for preparing a recombinant adeno-associated virus in an insect cell. The introduction of the vector into the insect cell can implement the expression of the VP1, VP2, and VP3 proteins in the correct stoichiometric ratio of 1:1:10, thereby packaging to produce the recombinant adeno-associated virus, which has a high packaging rate, and most of the known AAV serotypes (for example, AAV2, AAV5, AAV8, and AAV9) all have better infectivity. At the same time, the expression levels of the Rep78 and Rep52 proteins are controlled within a reasonable range, so that the AAV vector can be stably and massively produced in the insect cell. Also, the recombinant adeno-associated virus vector including the expression cassette of the cap gene may be used to produce an AAV capsid in vitro.

(51) On the other hand, the disclosure also provides an insect cell. The insect cell includes the expression cassette of the cap gene and/or the rep gene of AAV and may also include the expression cassette of the exogenous gene. At least one of the expression cassettes may be integrated into the genome of the host insect cell for stable expression, or the insect cell may transiently carry the nucleic acids including the expression cassettes.

(52) In some embodiments, the insect cell may be any insect cell, such as but not limited to a Spodoptera frugiperda cell, a Trichoderma cell, a Drosophila cell, or a mosquito cell, preferably a Spodoptera frugiperda cell sf9.

(53) In another aspect, the disclosure also provides a cell culture, which includes the insect cell and a culture medium.

(54) In some embodiments, the culture medium includes an AAV genome.

(55) On the other hand, the disclosure also provides a recombinant adeno-associated virion, which is obtained by culturing the insect cell under conditions capable of producing the recombinant adeno-associated virion, and then recovering.

(56) The above technical solutions are described in detail below with reference to specific examples.

Example 1 Construction of a Recombinant Baculovirus Vector Including an Expression Cassette I of a Cap Gene of AAV Serotype 9

(57) (1) Construction of the expression cassette I of the cap gene: see FIG. 2, the expression cassette I of the cap gene sequentially includes a p10 promoter, an intron, a nucleotide sequence encoding a T2A peptide, and a nucleotide sequence encoding a VP protein of AAV serotype 9 lacking only a translation start codon ATG of a VP1 protein from 5 to 3. The nucleotide sequence of the p10 promoter is shown in SEQ ID No.1. In the expression cassette I of the cap gene, the example specifically provides 4 introns whose nucleotide sequences are respectively shown in SEQ ID No.2 to SEQ ID No.5, and the introns all include the translation initiation start codon ATG. The nucleotide sequence encoding the T2A peptide is shown in SEQ ID No.6. The nucleotide sequence encoding the VP protein of AAV serotype 9 is shown in SEQ ID No. 7, and an amino-terminal thereof has at least one nucleotide mutation, which is used to eliminate possible cleavage sites in the encoding sequence. The sequences were connected through artificial direct synthesis or overlap extension PCR amplification to respectively obtain constructs 9K-1, 9K-2, 9K-3, and 9K-4 whose nucleotide sequences are respectively shown in SEQ ID No.8 to SEQ ID No.11.

(58) (2) Construction of a recombinant baculovirus vector: the construct 9K-1 was cloned into a pFastBac vector to prepare a transfer plasmid. The plasmid was transformed into a DH10Bac strain, and the recombinant baculovirus vector Ac1 was obtained through Tn7 transposition. Similarly, a recombinant baculovirus vector Ac2 including 9K-2, a recombinant baculovirus vector Ac3 including 9K-3, and a recombinant baculovirus vector Ac4 including 9K-4 were obtained.

Example 2 Construction of a Recombinant Baculovirus Vector Including an Expression Cassette I of a Rep Gene of AAV Serotype 2

(59) (1) Construction of the expression cassette I of the rep gene: see FIG. 5, the expression cassette I of the rep gene sequentially includes a polh promoter, an intron, a nucleotide sequence encoding a T2A peptide, and a nucleotide sequence encoding a Rep protein of AAV serotype 2 lacking only a translation start codon ATG of a Rep78 protein from 5 to 3. The nucleotide sequence of the polh promoter is shown in SEQ ID No.12. The nucleotide sequence of the intron in the expression cassette of the rep gene of the example is shown in SEQ ID No. 5, and the intron includes the translation start codon ATG. The nucleotide sequence encoding the T2A peptide is shown in SEQ ID No.6. The nucleotide sequence encoding the Rep protein of AAV serotype 2 is shown in SEQ ID No. 13 and includes multiple nucleotide mutations between the Rep78 translation start codon and the Rep52 translation start codon to eliminate possible translation start sites within the region. The sequences were connected through artificial direct synthesis or overlap extension PCR amplification to obtain a construct 2R-1 whose nucleotide sequence is shown in SEQ ID No.14.

(60) (2) Construction of a recombinant baculovirus vector: the same as Step (2) in Example 1, a recombinant baculovirus vector Ac5 including 2R-1 was obtained.

Example 3 Construction of a Recombinant Baculovirus Vector Including an Expression Cassette II of a Cap Gene of AAV Serotype 9

(61) (1) Construction of the expression cassette II of the cap gene: see FIG. 3, the expression cassette II of the cap gene sequentially includes a p10 promoter, an artificially constructed sequence, and a nucleotide sequence encoding a VP protein of AAV serotype 9 lacking only a translation start codon ATG of a VP1 protein from 5 to 3. The nucleotide sequence of the p10 promoter is shown in SEQ ID No.1. In the expression cassette II of the cap gene, the example specifically provides 2 artificially constructed sequences whose nucleotide sequences are respectively shown in SEQ ID No. 15 and SEQ ID No. 16, and the artificially constructed sequences both include the translation start codon ATG and two intron splicing sites. The nucleotide sequence encoding the VP protein of AAV serotype 9 is shown in SEQ ID No. 7 whose amino-terminal has at least one nucleotide mutation, which is used to eliminate possible cleavage sites in the encoding sequence. The sequences were connected through artificial direct synthesis or overlap extension PCR amplification to respectively obtain constructs 9K-5 and 9K-6 whose nucleotide sequences are respectively shown in SEQ ID No. 17 and SEQ ID No. 18.

(62) (2) Construction of a recombinant baculovirus vector: the same as Step (2) in Example 1, a recombinant baculovirus vector Ac6 including 9K-5 and a recombinant baculovirus vector Ac7 including 9K-6 were respectively obtained.

Example 4 Construction of a Recombinant Baculovirus Vector Including an Expression Cassette II of a Rep Gene of AAV Serotype 2

(63) (1) Construction of the expression cassette II of the rep gene: see FIG. 6, the expression cassette II of the rep gene includes a polh promoter, an artificially constructed sequence, and a nucleotide sequence encoding a Rep protein of AAV serotype 2 lacking only a translation start codon ATG of a Rep78 protein from 5 to 3. The nucleotide sequence of the polh promoter is shown in SEQ ID No.12. The nucleotide sequence of the artificially constructed sequence in the expression cassette II of the rep gene of the example is shown in SEQ ID No. 16, and the artificially constructed sequence includes the translation start codon ATG and two intron splicing sites. The nucleotide sequence encoding the Rep protein of AAV serotype 2 is shown in SEQ ID No. 13 and includes multiple nucleotide mutations between the Rep78 translation start codon and the Rep52 translation start codon to eliminate possible translation start sites within the region. The sequences were connected through artificial direct synthesis or overlap extension PCR amplification to obtain a construct 2R-2 whose nucleotide sequence is shown in SEQ ID No.19.

(64) (2) Construction of a recombinant baculovirus vector: the same as Step (2) in Example 1, a recombinant baculovirus vector Ac8 including 2R-2 was obtained.

Example 5 Construction of a Recombinant Baculovirus Vector Including an Expression Cassette III of a Cap Gene of AAV Serotype 9

(65) (1) Construction of the expression cassette III of the cap gene: see FIG. 4, the expression cassette III of the cap gene includes a p10 promoter, an adenine nucleotide (A), an intron, a thymine nucleotide (T), a guanine nucleotide (G), and a nucleotide sequence encoding a VP protein of AAV serotype 9 lacking only a translation start codon ATG of a VP1 protein. The nucleotide sequence of the p10 promoter is shown in SEQ ID No.1. In the expression cassette III of the cap gene, the example specifically provides 2 introns whose nucleotide sequences are respectively shown in SEQ ID No. 20 and SEQ ID No. 21. The nucleotide sequence encoding the VP protein of AAV serotype 9 is shown in SEQ ID No. 7 whose amino-terminal has at least one nucleotide mutation, which is used to eliminate possible cleavage sites in the encoding sequence. The sequences were connected through artificial direct synthesis or overlap extension PCR amplification to respectively obtain constructs 9K-7 and 9K-8 whose nucleotide sequences are respectively shown in SEQ ID No. 22 and SEQ ID No. 23.

(66) (2) Construction of a recombinant baculovirus vector: the same as Step (2) in Example 1, a recombinant baculovirus vector Ac9 including 9K-7 and a recombinant baculovirus vector Ac10 including 9K-8 were respectively obtained.

Example 6 Construction of a Recombinant Baculovirus Vector Including an Expression Cassette III of a Rep Gene of AAV Serotype 2

(67) (1) Construction of the expression cassette III of the rep gene: see FIG. 7, the expression cassette III of the rep gene includes a polh promoter, A, an intron, TG, and a nucleotide sequence encoding a Rep protein of AAV serotype 2 lacking only a translation start codon ATG of a Rep78 protein from 5 to 3. The nucleotide sequence of the polh promoter is shown in SEQ ID No.12. The nucleotide sequence of the intron in the expression cassette III of the rep gene of the example is shown in SEQ ID No.21. The nucleotide sequence encoding the Rep protein of AAV serotype 2 is shown in SEQ ID No. 13 and includes multiple nucleotide mutations between the Rep78 translation start codon and the Rep52 translation start codon to eliminate possible translation start sites within the region. The sequences were connected through artificial direct synthesis or overlap extension PCR amplification to obtain a construct 2R-3 whose nucleotide sequence is shown in SEQ ID No.24.

(68) (2) Construction of a recombinant baculovirus vector: the same as Step (2) in Example 1, a recombinant baculovirus vector Ac11 including 2R-3 was obtained.

Comparative Example Construction of a Recombinant Baculovirus Vector Ac0 and an Expression Cassette of a Rep Gene

(69) (1) Construction of an expression cassette of a cap gene: in Comparative Example, the expression cassette of the cap gene was constructed with reference to the method of Urabe et al. (Urabe et al., 2002, Hum Gene Ther, 13: 1935-1943). A promoter of the expression cassette of the cap gene adopts a p10 promoter, the cap gene in the expression cassette encodes a VP protein of AAV serotype 9, and a translation start codon ATG of VP1 in the encoding sequence is mutated to a suboptimal codon ACG. The expression cassette of the cap gene is numbered 9K-0 whose nucleotide sequence is shown in SEQ ID No.25.

(70) (2) Construction of a recombinant baculovirus vector: the same as Step (2) in Example 1, a recombinant baculovirus vector Ac0 including 9K-0 was obtained.

(71) (3) Construction of the expression cassette of the rep gene: the expression cassette of the rep gene was constructed with reference to the method of Chinese patent CN 103849629 A. A promoter of the expression cassette of the rep gene adopts a polh promoter. The rep gene in the expression cassette encodes a Rep protein of AAV serotype 2, and an original translation start codon ATG of a Rep78 protein of AAV was replaced with ACG. The expression cassette of the rep gene is numbered 2R-0.

Example 7 Detection of Expression of VP Proteins (VP1, VP2, VP3) and Rep Proteins (Rep78, Rep52)

(72) The recombinant baculovirus vectors Ac0, Ac1, Ac2, Ac3, Ac4, Ac5, Ac6, Ac7, Ac8, Ac9, Ac10, and Ac11 prepared in Examples 1-6 and Comparative Example were respectively transfected into a host cell line and cultured to obtain a recombinant baculovirus, and the expression of the VP proteins (VP1, VP2, VP3) and the Rep proteins (Rep78, Rep52) were detected. The specific operation steps are as follows:

(73) DNA of the recombinant baculovirus vector was extracted and transfected into a Sf9 insect cell to prepare a recombinant baculovirus BEV. The transfected Sf9 insect cell successfully produced BEV, and further infection of massively replicated BEV resulted in obvious cytopathic effect (CPE) in the Sf9 cells. Culture supernatant of the Sf9 cells with CPE was collected, which included a large amount of BEV, which was the 0th generation BEV (P0). At the same time, the Sf9 cells including a large amount of rAAV were collected. The obtained BEV-P0 infected the Sf9 cells in suspension culture at a multiplicity of infection (MOI=1). After infection for 72 hours, the cell activity dropped to less than 50%. The cell culture medium was centrifuged at 1000 g for 5 min. The culture supernatant and the cell pellet were respectively collected. The supernatant was labeled as the 1st generation BEV-P1. Continue to expand the culture, and the obtained BEV-P1 infected the Sf9 cells in suspension culture at a multiplicity of infection (MOI=1). After infection for 72 hours, the cell activity dropped to less than 50%. The cell culture medium was centrifuged at 1000 g for 5 min. The cell pellet was collected for western blot to examine the expression of the VP proteins (VP1, VP2, VP3) and the Rep proteins (Rep78, Rep52).

(74) FIG. 8 is a western blot detection diagram of the VP proteins (VP1, VP2, and VP3) of the recombinant baculovirus vectors Ac1, Ac2, Ac3, and Ac4 including the expression cassette I of the cap gene and the control recombinant baculovirus vector Ac0. It can be seen from the drawing that the recombinant baculovirus vectors can produce VP1, VP2, and VP3 in a relatively appropriate ratio; Ac4 has higher VP1 production than Ac1 to Ac3, and high VP1 incorporation often leads to higher infectious activity. The reason for the higher VP1 production is that the intron included in Ac4 has lower splicing activity than other vectors.

(75) FIG. 9 is a western blot detection diagram of the Rep proteins (Rep78 and Rep52) of the recombinant baculovirus vector Ac5 including the expression cassette I of the rep gene. It can be seen from the drawing that the recombinant baculovirus vector Ac5 can produce the Rep78 and Rep52 proteins, and the expression level of the Rep78 protein is lower than the Rep52 protein.

(76) FIG. 10 is a western blot detection diagram of the VP proteins (VP1, VP2, and VP3) of the recombinant baculovirus vectors Ac6 and Ac7 including the expression cassette II of the cap gene and the control recombinant baculovirus vector Ac0. It can be seen from the drawing that Ac0, Ac6, and Ac7 can produce VP1, VP2, and VP3 in a relatively appropriate ratio; Ac7 has higher VP1 production than Ac6, and high VP1 incorporation often leads to higher infectious activity. The reason for the higher VP1 production is that the splicing donor of the second intron and the splicing acceptor of the intron included in Ac7 have higher alternative splicing activity.

(77) FIG. 11 is a western blot detection diagram of the Rep proteins (Rep78 and Rep52) of the recombinant baculovirus vector Ac8 including the expression cassette II of the rep gene. It can be seen from the drawing that the recombinant baculovirus vector Ac8 can produce the Rep78 and Rep52 proteins.

(78) FIG. 12 is a western blot detection diagram of the VP proteins (VP1, VP2, and VP3) of the recombinant baculovirus vectors Ac9 and Ac10 including the expression cassette III of the cap gene and the control recombinant bacmid Ac0. It can be seen from the drawing that Ac0, Ac9, and Ac10 can produce VP1, VP2, and VP3 in a relatively appropriate ratio; Ac10 has higher VP1 production than Ac9, and high VP1 incorporation often leads to higher infectious activity. The reason for the higher VP1 production is that the splicing activity of the intron included in Ac10 is higher than Ac9.

(79) FIG. 13 is a western blot detection diagram of the Rep proteins (Rep78 and Rep52) of the recombinant baculovirus vector Ac11 including the expression cassette III of the rep gene. It can be seen from the drawing that the recombinant baculovirus vector Ac11 can produce the appropriate Rep78 and Rep52 proteins.

Example 8 Construction of a Recombinant AAV Bacmid for Producing an AAV Virus in an Insect Cell

(80) With reference to Example 1 in the previous patent application CN 112553257 A of our company, the method for constructing the recombinant AAV bacmid for producing the AAV virus in the insect cell in the example includes the following steps:

(81) (1) Construction of a homologous recombination vector including AAV essential functional elements, expression cassettes of cap and rep genes. Then, the essential functional elements in the homologous recombination vector were inserted into a C-terminus of an essential gene Ac135 (116492 . . . 117391) in a baculovirus genome through Red homologous recombination in Escherichia coli to obtain the recombinant baculovirus vector including the expression cassettes of the cap and rep genes, and numbered Bac-Cap-Rep.

(82) (2) Construction of a shuttle vector including an ITR core element (ITR-GOI). The ITR core element is numbered IG-1 whose nucleotide sequence is shown in SEQ ID No.26. In the example, GOI in the ITR core element adopts an expression cassette of a red fluorescent protein mcherry gene, that is, the expression of mcherry is controlled by a miniEf1a promoter, which is convenient for detecting the activity of rAAV. ITR and the expression cassette of the red fluorescent protein were constructed on the shuttle vector pFastDual.

(83) (3) A competent cell including the Bac-Cap-Rep recombinant bacmid was transformed using the shuttle vector constructed in Step (2) above. ITR-GOI was inserted into a Tn7 site in the Bac-Cap-Rep recombinant bacmid using Tn7 recombination. Finally, a recombinant bacmid of a recombinant baculovirus genome including the functional protein components essential for producing rAAV and the ITR core element was obtained and numbered Bac-Cap-Rep-ITR-GOI.

(84) The 9 different recombinant AAV bacmids constructed in the example both include the expression cassette of the cap gene, the expression cassette of the rep gene, and the ITR core element, as shown in Table 1.

(85) TABLE-US-00001 TABLE 1 List of constituent elements of 9 different recombinant AAV bacmids constructed in Example 8 Recombinant Functional protein components essential AAV bacmid for producing rAAV and ITR core element (Bac-Cap- Expression Expression ITR core Rep-ITR-GOI) cassette cassette of element numbering of cap gene rep gene (ITR-GOI) CRI-0 9K-0 2R-0 I-G-1 CRI-1 9K-1 2R-1 I-G-1 CRI-2 9K-2 2R-1 I-G-1 CRI-3 9K-3 2R-1 I-G-1 CRI-4 9K-4 2R-1 I-G-1 CRI-5 9K-5 2R-2 I-G-1 CRI-6 9K-6 2R-2 I-G-1 CRI-7 9K-7 2R-3 I-G-1 CRI-8 9K-8 2R-3 I-G-1

Example 9 Preparation of an AAV Recombinant Baculovirus

(86) The recombinant AAV bacmids CRI-0, CRI-1, CRI-2, CRI-3, CRI-4, CRI-5, CRI-6, CRI-7, and CRI-8 prepared in Example 8 were respectively transfected into a host cell line culture to obtain the AAV recombinant baculovirus.

(87) DNA of the recombinant bacmid was extracted and transfected into a Sf9 insect cell to prepare a recombinant baculovirus BEV and rAAV. The transfected Sf9 insect cell successfully produced BEV, and further infection of massively replicated and proliferated BEV resulted in obvious cytopathic effect (CPE) in the Sf9 cells. Culture supernatant of the Sf9 cells with CPE was collected, which included a large amount of BEV, which was the 0th generation BEV (P0). At the same time, the Sf9 cells including a large amount of rAAV were collected. The obtained BEV-P0 infected the Sf9 cells in suspension culture at a multiplicity of infection (MOI=1). After infection for 72 hours, the cell activity dropped to less than 50%. The cell culture medium was centrifuged at 1000 g for 5 min. The culture supernatant and the cell pellet were respectively collected. The supernatant was labeled as the 1st generation BEV-P1, and the cells were labeled as rAAV packaged with BEV-P0.

Example 10 Purification of a Recombinant AAV Virion and Detection of Packaging Efficiency and Virus Titer Thereof

(88) Continue to expand the culture according to the operation of Example 9 until the Sf9 cells in suspension culture are infected with BEV-P2 seed virus according to a multiplicity of infection (MOI=1) for rAAV packaging, and the packaging volume is 300 mL to 400 mL. After infection for 3 days, the cell activity was monitored, and if the activity was less than 50%, the cell pellet and the supernatant were respectively harvested by centrifugation. The harvested cell pellet and supernatant were respectively purified. Nuclease (Benzonase) was added to the supernatant, treated in a water bath at 37 C. for 60 min, and centrifuged at 5000 rpm for 10 min after treatment. The collected cell lysate and the collected supernatant were PEG precipitated, resuspended, and purified by iodixanol density gradient centrifugation (see Aslanidi et al., 2009, Proc. Natl Acad. Sci. USA, 206: 5059-5064 for the method). Finally, the purified virus was resuspended in 80 L to 190 L PBS, and 10 L of the purified virus was run on SDS-PAGE gel for silver staining.

(89) FIGS. 14A, 14B, 14C provide detection of a purified recombinant AAV virion subjected to SDS-PAGE silver staining after transfecting a host cell with the recombinant AAV bacmids CRI-0, CRI-1, CRI-2, CRI-3, CRI-4, CRI-5, CRI-6, CRI-7, and CRI-8. It can be seen from the results that the recombinant AAV bacmid constructed by the disclosure can express the VP1, VP2, and VP3 proteins in a relatively appropriate ratio in the insect cell through the regulating function of intron splicing, thereby packaging into the virions. The CRI-4, CRI-6 and CRI-7 virions respectively have higher VP1 protein incorporation amounts than CRI-3, CRI-5, and CRI-8. The reason for the phenomenon is that the expression level of the VP1 protein is higher. The splicing efficiency of the intron determines the relative expression level of the VP1 protein. Through adjusting the sequence of the intron, we can change the splicing efficiency of the intron, thereby obtaining the virions with different VP1 incorporation amounts.

(90) In the example, Q-PCR was also adopted to detect the packaging rate of the harvested rAAV virus, and the detection of the rAAV packaging rate used a pair of primers (Q-ITR-F: GGAACCCCTAGTGATGGAGTT and Q-ITR-R: CGGCCTCAGTGAGCGA) targeting an ITR sequence. The detection of rAAV infection titer was performed by adopting the detection method in the previous patent application CN 112280801 A of our company. For the specific operation method, reference may be made to the method for plasmid-assisted rAAV infection titer detection in the patent. The detection result is shown in Table 2.

(91) TABLE-US-00002 TABLE 2 Detection result table of packaging rate and infection titer of rAAV virions produced using 9 different recombinant AAV bacmids Recombinant AAV bacmid Cell packaging Virus infection numbering rate (VG/cell) titer (VG/mL) CRI-0 3.62E+05 5.26E+07 CRI-1 2.66E+05 1.58E+08 CRI-2 5.46E+05 2.02E+08 CRI-3 7.44E+05 6.10E+07 CRI-4 5.30E+05 8.28E+07 CRI-5 7.02E+05 4.21E+07 CRI-6 2.28E+05 1.92E+08 CRI-7 3.82E+05 2.85E+08 CRI-8 5.69E+05 7.34E+07

(92) It can be seen from Table 2 and FIG. 15 that the recombinant AAV bacmids CRI-1 to CRI-8 prepared by the disclosure can be used to transfect the insect cell to package into the recombinant baculovirus, the packaging rate and the virus infection titer are higher, and the same are comparable to or higher than the virion produced by the recombinant AAV bacmid CRI-0 including the control expression cassette of the cap gene. CRI-4, CRI-6, and CRI-7 respectively have higher virus infection titers than CRI-3, CRI-5, and CRI-8, and VP1 incorporation amounts thereof are also higher.

Example 11 Validation of Intron Regulation Function in Different AAV Serotypes

(93) In order to verify that the above intron regulation manner can work in different AAV serotypes, with reference to the method in Example 1, an expression cassette 2K-1 of a cap gene of AAV serotype 2, an expression cassette 5K-1 of a cap gene of AAV serotype 5, and an expression cassette 8K-1 of a cap gene of AAV serotype 8 were respectively constructed; with reference to the method in Example 3, an expression cassette 2K-2 of a cap gene of AAV serotype 2, an expression cassette 5K-2 of a cap gene of AAV serotype 5, and an expression cassette 8K-2 of a cap gene of AAV serotype 8 were respectively constructed; with reference to the method in Example 5, an expression cassette 2K-3 of a cap gene of AAV serotype 2, an expression cassette 5K-3 of a cap gene of AAV serotype 5, and an expression cassette 8K-3 of a cap gene of AAV serotype 8 were constructed. Nucleotide sequences of the constructs 2K-1, 2K-2, 2K-3, 5K-1, 5K-2, 5K-3, 8K-1, 8K-2, and 8K-3 are respectively shown in SEQ ID No.27 to SEQ ID No.35. An expression cassette of a rep gene in the example still adopts AAV serotype 2, because the Rep protein of AAV serotype 2 is suitable for the preparation of rAAV of various serotypes.

(94) Referring to Example 8, 9 different recombinant AAV bacmids were constructed in the example, all of which included the expression cassette of the cap gene, the expression cassette of the rep gene, and the ITR core element, as shown in Table 3.

(95) TABLE-US-00003 TABLE 3 List of constituent elements of 9 different recombinant AAV bacmids constructed in Example 11 Recombinant Functional protein components essential AAV bacmid for producing rAAV and ITR core element (Bac-Cap- Expression Expression ITR core Rep-ITR-GOI) cassette cassette element numbering of cap gene of rep gene (ITR-GOI) CRI-9 2K-1 2R-1 I-G-1 CRI-10 2K-2 2R-2 I-G-1 CRI-11 2K-3 2R-3 I-G-1 CRI-12 5K-1 2R-1 I-G-1 CRI-13 5K-2 2R-2 I-G-1 CRI-14 5K-3 2R-3 I-G-1 CRI-15 8K-1 2R-1 I-G-1 CRI-16 8K-2 2R-2 I-G-1 CRI-17 8K-3 2R-3 I-G-1

(96) Referring to Example 9 and Example 10, in the example, the recombinant AAV bacmid was transfected into a host cell, and the purified recombinant AAV virion was detected by SDS-PAGE silver staining. The experimental results are shown in FIGS. 16A, 16B, and 16C. The cell packaging rate and the virus infection titer of rAAV produced by the recombinant AAV bacmids of different serotypes were detected, and the detection result is shown in Table 4.

(97) TABLE-US-00004 TABLE 4 Detection result table of packaging rate and infection titer of rAAV virions produced using 9 different recombinant AAV bacmids in Example 11 Recombinant AAV bacmid Cell packaging Virus infection numbering rate (VG/cell) titer (VG/mL) CRI-9 2.26E+06 7.86E+07 CRI-10 6.53E+05 3.25E+08 CRI-11 8.54E+05 1.75E+08 CRI-12 8.72E+05 2.56E+08 CRI-13 5.43E+05 1.32E+08 CRI-14 1.62E+06 8.56E+07 CRI-15 8.94E+05 9.12E+07 CRI-16 6.24E+05 2.45E+08 CRI-17 2.95E+05 4.21E+08

(98) Combining the results of Table 4 and FIG. 17, it is shown that the disclosure regulates the expression of the VP1, VP2, and VP3 proteins in the insect cell in a relatively appropriate ratio through the intron splicing function, which is suitable for various AAV serotypes and can produce the rAAV virion on a large scale.

(99) Persons skilled in the art can easily understand that the above are only preferred embodiments of the disclosure and are not intended to limit the disclosure. Any modifications, equivalent replacements, improvements, etc. made within the spirit and principle of the disclosure should be included within the protection scope of the disclosure.