METHOD FOR PREPARING INDUCED PLURIPOTENT STEM CELL WITHOUT USING HYDROGEL

Abstract

A method of producing induced pluripotent stem cells without using a hydrogel.

Claims

1. A method of producing induced pluripotent stem cells, the method comprising: culturing somatic cells; and reprogramming the cultured somatic cells into induced pluripotent stem cells in a hydrogel-free 3D cell culture plate, wherein the 3D cell culture plate comprises: a well plate comprising a plurality of main wells and a plurality of sub wells formed at lower portions of the main wells to be injected with a cell culture solution and comprising recessed parts on a bottom surface thereof; and a connector for large-capacity and high-speed high content screening (HCS), which supports the well plate, and the connector for high content screening (HCS) comprises a base equipped with a fixing means so as to be attached to and detached from a lower end of the well plate and a cover positioned on an upper portion of the well plate to be coupled to the base, the main well has a step formed so as to be tapered at a predetermined site, and the step has an inclination angle (θ) ranging from 10 to 60° with respect to a wall of the main well.

2. The method of claim 1, wherein the somatic cells are fibroblasts.

3. The method of claim 1, wherein the hydrogel is an extracellular matrix-based hydrogel.

4. The method of claim 3, wherein the extracellular matrix-based hydrogel is a matrigel.

5. The method of claim 1, after the reprogramming step, further comprising: forming a spheroid of the reprogrammed induced pluripotent stem cells.

6. The method of claim 1, wherein the sub well has an inclined surface formed so as to taper toward the recessed part, the sub wells have an upper end diameter ranging from 3.0 to 4.5 mm, the recessed parts have an upper end diameter ranging from 0.45 to 1.5 mm, an inclined surface θ.sub.2 between the sub well and the recessed part ranges from 40 to 50°, and a length ratio of the diameter of the sub wells to the diameter of the recessed parts ranges from 1:0.1 to 0.5.

7. The method of claim 1, wherein the main well has an individual volume ranging from 100 to 300 μl, the recessed part has an individual volume ranging from 20 to 50 μl, and an individual volume ratio of the main well to the recessed part is 1:0.1 to 0.5 on average.

8. The method of claim 1, wherein the main well comprises a space part between the step and the sub well, the space part has a height (a.sub.h) ranging from 2.0 to 3.0 mm on average, the sub well has a height (b.sub.h) ranging from 1.0 to 2.0 mm on average, and a height ratio (a.sub.h:b.sub.h) of the space part to the sub well ranges from 1:0.3 to 1.

9. The method of claim 1, wherein the somatic cells are seeded in the sub wells of the cell culture plate at 100 to 1000 cells/well.

Description

DESCRIPTION OF DRAWINGS

[0082] FIG. 1A is a front view of a cell culture plate according to an exemplary embodiment of the present invention, and FIG. 1B is a cross-sectional view of the cell culture plate according to an exemplary embodiment of the present invention.

[0083] FIG. 2 is a view illustrating, in detail, a main well formed in the cell culture plate according to an exemplary embodiment of the present invention.

[0084] FIG. 3 is a view illustrating a well plate, a base, and a cover of the cell culture plate according to an exemplary embodiment of the present invention ((A) a cover, (B) a base, and (C) a fixing means of a microplate and a base).

[0085] FIG. 4A schematically illustrates processes of producing induced pluripotent stem cells according to an exemplary embodiment of the present invention and a comparative example, and FIG. 4B is a set of images illustrating the occurrence of induced pluripotent stem cells according to an exemplary embodiment of the present invention and a comparative example (In all of the drawings below FIG. 4, for the convenience of description, the 3D cell culture plate of the present invention is not accurately displayed, but is displayed in a U shape for convenience.)

[0086] FIG. 5 is a set of images of an exemplary embodiment (3D iPSC) of the present invention and a comparative example (2D iPSC).

[0087] FIG. 6 is an alkaline phosphatase (AP) stained image of an exemplary embodiment (3D sph-iPSC) of the present invention and a comparative example (2D Matrigel).

[0088] FIG. 7A is an AP image (D4, D9, D15, D21) over time, FIG. 7B compares the number of colonies, FIG. 7C is an E-cadherin expression result, and FIG. 7D illustrates the process of forming a spheroid of iPSCs.

[0089] FIG. 8A is a result of showing the size distribution of spheroids (colonies) as a result of 3D culture in the related art and culture according to an exemplary embodiment of the present invention, and FIG. 8B is the expression result of a reprogramming factor (pluripotency marker)

[0090] FIG. 9 illustrates the expression results of pluripotency markers of iPSCs according to an exemplary embodiment of the present invention.

MODES OF THE INVENTION

[0091] Since the present invention may be modified into various forms and include various exemplary embodiments, specific exemplary embodiments will be illustrated in the drawings and described in detail in the Detailed Description. However, the description is not intended to limit the present invention to the specific exemplary embodiments, and it is to be understood that all the changes, equivalents, and substitutions belonging to the spirit and technical scope of the present invention are included in the present invention. When it is determined that the detailed description of the related publicly known art in describing the present invention may obscure the gist of the present invention, the detailed description thereof will be omitted.

EXAMPLES

Example 1. Experimental Methods

[0092] 1-1: Culture of Fibroblasts and Production of Induced Pluripotent Stem Cells

[0093] The German federal authorities/RKI: AZ 1710-79-1-4-41 E01 (F134), which is a human fibroblast line, was cultured in a DMEM containing 10% FBS (fetal bovine serum, Invitrogen, USA) and 1 mM L-glutamine (Invitrogen, USA) in a 35 mm or 100 mm Petri dish. The cultured fibroblasts were reprogrammed by being transfected (Neon™ transfection system) with an episomal iPSC reprogramming vector (EP5™ kit: Cat. No. A16960. Invitrogen, Carlsbad, Calif., USA) by electroporation. The electroporation was performed under the conditions of 1,650 V, 10 ms, and 3 pulses.

[0094] As illustrated in FIG. 4A, the transfected fibroblasts were inoculated in a 3D cell culture plate of the present invention (without Matrigel, the Example), a 2D 12-well plate (coated with Matrigel, Comparative Example 1) and a commercialized product Addgene (Comparative Example 2, coated with Matrigel, not illustrated in FIG. 4A), and cultured in an N2B27 medium (containing bFGF). After the fibroblasts were cultured for 15 days, the medium was replaced with an Essential 8™ medium. After 15 days, the number of colonies in the Example and the Comparative Examples were confirmed by plating 3D iPSC of the Example (3D cell culture plate) on a 12-well plate which is a 2D plate.

[0095] 1-2: Reprogramming Efficiency Analysis of Fibroblasts

[0096] According to the alkaline phosphatase staining kit manual (System Biosciences, USA), reprogrammed cells were washed twice with PBS, fixed with 4% paraformaldehyde, then stained with Blue-color AP solution, washed twice with PBS, and then it was observed under an optical microscope whether the colonies were stained. The number of stained colonies was counted and quantified.

[0097] Images of the cultured cells in the Example and the Comparative Examples were captured, and the sizes of cell spheres were compared. Spheroids were subjected to imaging by an automated plate device, and in this case, the device was allowed to perform imaging by automatically focusing. Image size analysis was performed using a macro program of a program called ImageJ (related to FIGS. 5, 6 and 7).

[0098] 1-3: Optimization of 3D Culture Method of Induced Pluripotent Stem Cells

[0099] Images of the 3D induced pluripotent stem cells cultured in the Example and the Comparative Examples were captured, and accordingly, the sizes of the cell spheres were compared and measured (FIG. 8A). An external inspection company (Cell Bio CEFO, Korea) was commissioned to test the results of the images, and this test was performed as a blind test.

[0100] 1-4: Immunostaining

[0101] Reprogrammed cells were fixed with 4% paraformaldehyde at room temperature for 20 minutes. After the fixed cells were reacted with PBS containing 1% BSA and 0.5% Triton X-100 at room temperature for 1 hour, the cells were treated with each of primary antibodies Oct4 (1:100, Santa Cruz, Calif., USA), Sox2 (1:100, Cell Signaling, Danvers, Mass., USA), Nanog (1:200, Cosmo Bio, Koto-Ku, Japan), and E-cadherin (1:200, abcam), and reacted with FITC-conjugated goat anti-rabbit IgG or anti-mouse IgG (1:100, Invitrogen, Carlsbad, Calif.) as a secondary antibody. Fluorescent images were analyzed under a fluorescence microscope (Olympus, Shinjuku, Tokyo, Japan). DAPI was used as a nuclear staining solution.

[0102] 1-5: qPCR

[0103] Total RNA was extracted from fibroblasts and reprogrammed cells using an RNA minikit (Qiagen, Inc.), and then converted to cDNA using the Accupower RT mix reagent (Bioneer Corp., Seoul, Korea). qPCR was performed using Real-time PCR FastStart Essential DNA Green Master Mix (Roche, Indianapolis, Ind., USA). The primer sequences used in the present invention are as follows in Table 1.

TABLE-US-00001 TABLE 1 Genes Primer sequences (5′-3′) hCOL1A1 forward ATGACTATGAGTATGGGGAAGCA reverse TGGGTCCCTCTGTTACACTTT hOCT4 forward AATTTGTTCCTGCAGTGCCC reverse AGACCCAGCAGCCTCAAAAT hNANOG forward GGATCCAGCTTGTCCCCAAA reverse TGCGACACTCTTCTCTGCAG hSOX2 forward CGGAAAACCAAGACGCTCAT reverse GTTCATGTGCGCGTAACTGT hLIN28 forward TTCGGCTTCCTGTCCATGAC reverse CCGCCTCTCACTCCCAATAC

Example 2. Confirmation of Reprogramming Efficiency

[0104] Referring to FIG. 4B, it can be seen that in the case of 2D culture, a small amount of colonies begin to be formed only at D15. After iPSC reprogramming was induced up to D15, 3D iPSCs were plated on a 2D plate, and the number of colonies in Comparative Example 1 and Example 1 was compared by plating 3D iPSCs on a 2D plate, and as a result, the difference in the number of colonies formed was large. It can be seen that the iPSC reprogramming yield of the Example is high because the cells that are well differentiated into iPSCs forming a colony. Referring to FIGS. 5 and 7B, it can be seen that the difference in the number of colonies is very large between the 2D culture (Comparative Example 1) and the 3D culture (the Example). Referring to FIG. 6, it can be seen that as a result of alkaline phosphatase (AP) staining, the reprogramming efficiency is very high in 3D iPSC spheroids (the Example, 3D sph-iPCSs). Further, referring to FIGS. 6 and 7A, when 2D Matrigel (Comparative Example 1) and 3D iPSC spheroids (the Example, 3D sph-iPCSs) are compared with each other, the images appear uniform and clear, showing that the 3D cell culture plate of the present invention is capable of large-scale image analysis.

[0105] Referring to FIG. 7C, it can be seen that the reprogramming efficiency in the 3D cell culture plate is very good. In addition, referring to FIG. 7D, it can be seen that since the present invention does not use Matrigel, a large number of single cells reprogrammed into iPCSs gather to form a spheroid, which is a spherical cell aggregate, and these spheroids can be easily separated from the 3D cell culture plate and replated. That is, reprogramming efficiency is very high.

[0106] FIG. 8 compares the 3D culture in the related art of Comparative Example 2 with the 3D culture of the Example of the present invention (SpheroidFilm in FIG. 8B). The 3D culture in the related art is not uniform in size and has a relatively low expression level of oct4. However, the present invention is very uniform in size (99.45%) and has a very high reprogramming factor expression level. That is, the present invention is effective in stem cell culture even when compared to the 3D culture in the related art, and can increase the efficiency of reprogramming somatic cells into induced pluripotent stem cells. Furthermore, a uniform size means that standardized induced pluripotent stem cells and stem cells can be three-dimensionally mass-produced in the form of a spheroid.

Example 3. Analysis of Characteristics of Induced Pluripotent Stem Cells

[0107] Referring to FIG. 9, it can be seen that the iPSCs produced according to the present invention have very high expression of pluripotency markers.

[0108] Although the specific part of the present invention has been described in detail, it will be obvious to those skilled in the art that such a specific description is just a preferred embodiment and the scope of the present invention is not limited thereby. Accordingly, the substantial scope of the present invention will be defined by the appended claims and equivalents thereof.

DESCRIPTION OF REFERENCE NUMERALS AND SYMBOLS

[0109] 100: Well plate [0110] 101: Step [0111] 110: Main well [0112] 120: Sub well [0113] 121: Recessed part [0114] 130: Space part [0115] 140: Concave part [0116] 200: Connector for large-capacity and high-speed HCS [0117] 210: Base [0118] 220: Cover [0119] 240: Convex part