LEUKEMIA TREATMENT

20250346890 ยท 2025-11-13

    Inventors

    Cpc classification

    International classification

    Abstract

    The present invention relates to an inhibitor of R-spondin 2 and/or R-spondin 3 mediated bone morphogenetic protein (BMP) receptor inhibition for use in treating and/or preventing leukemia in a subject; and to methods, kits, combined preparations, and uses related thereto.

    Claims

    1. A method for treating and/or preventing leukemia in a subject in need thereof, said method comprising administering an inhibitor of R-spondin 2 and/or R-spondin 3 mediated bone morphogenetic protein (BMP) receptor inhibition to said subject.

    2. The method of claim 1, wherein said inhibitor is selected from the list consisting of an immunoglobulin or binding fragment thereof, a polypeptide comprising an isolated domain of said R-spondin, a polypeptide comprising an extracellular domain of a BMP receptor, an RNAi agent, a gRNA, a peptide aptamer, a polynucleotide aptamer, an anticalin, and a Designed Ankyrin Repeat Protein.

    3. The method of claim 1, wherein said inhibitor is selected from (i) an immunoglobulin or fragment thereof specifically binding to said R-spondin 2 or R-spondin 3, preferably to said R-spondin 2; (ii) an immunoglobulin or fragment thereof specifically binding to the extracellular domain of a BMP receptor, preferably BMP receptor 1A; (iii) a polypeptide comprising either the thrombospondin type-1 (TSP1) domain or the first furin-like (FU1) domain of said R-spondin, or a fragment thereof; (iv) a polypeptide comprising an extracellular domain of a BMP receptor, preferably of BMP receptor 1A; (v) any combination of (i) to (iv).

    4. The method of claim 3, wherein said immunoglobulin or fragment thereof specifically binding to said R-spondin 2 or R-spondin 3 specifically binds the TSP1 domain and/or the FU1 domain of said R-spondin, preferably specifically binds the TSP1 domain of said R-spondin.

    5. The method of claim 3, wherein said TSP1 domain corresponds to amino acids 147 to 204 of a human R-spondin 2, and/or wherein said FU1 domain corresponds to amino acids 37 to 84 of a human R-spondin 2.

    6. The method of claim 3, wherein said immunoglobulin or subdomain thereof specifically binding to the extracellular domain of a BMP receptor specifically binds the activin receptor domain of said BMP receptor, preferably binds an epitope comprised in a peptide corresponding to amino acids 1 to 152 of the human BMP receptor 1A.

    7. The method of claim 1, wherein said subject was identified as benefiting from treatment with an inhibitor of R-spondin 2 or R-spondin 3; and/or wherein said subject is suffering from a leukemia in which leukemia cells comprise a decreased activity of said BMP receptor, preferably caused by R-spondin 2 or R-spondin 3 overproduction.

    8. The method of claim 7, wherein said inhibitor is retinoic acid, preferably all-trans retinoic acid.

    9. A method for identifying a subject benefiting from leukemia treatment with an inhibitor of R-spondin 2 and/or R-spondin 3 mediated BMP receptor inhibition comprising (a) contacting a sample comprising leukemia cells of said subject with an inhibitor of R-spondin 2 and/or R-spondin 3 mediated BMP receptor inhibition; (b) determining the amount of BMP receptor, phospho-mothers against decapentaplegic homolog 1 (pSMAD1), DNA-binding protein inhibitor ID-1 (ID1), CD14, and/or integrin alpha-M (CD11B) in the leukemia cells of step (a), (c) comparing the amount determined in step (b) to a reference, preferably from control treated leukemia cells of said subject, and (d) based on the result of step (c), identifying a subject benefiting from treatment with an inhibitor of R-spondin 2 and/or R-spondin 3 mediated BMP receptor inhibition.

    10. The method of claim 9, wherein said reference is derived from a population of apparently healthy subjects or from a population of subjects known not to benefit from treatment with an inhibitor of R-spondin 2 and/or R-spondin 3 mediated BMP receptor inhibition; and wherein a subject benefiting from treatment with an inhibitor of R-spondin 2 and/or R-spondin 3 mediated BMP receptor inhibition is identified if the amount determined in step (b) is higher than the reference; and/or wherein said reference is derived from a population of subjects known to benefit from treatment with an inhibitor of R-spondin 2 and/or R-spondin 3 mediated BMP receptor inhibition; and wherein a subject benefiting from treatment with an inhibitor of R-spondin 2 or R-spondin 3 mediated BMP receptor inhibition is identified if the amount determined in step (a) is equal to or higher than the reference.

    11. (canceled)

    12. (canceled)

    13. A method for identifying a compound for treating and/or preventing leukemia, preferably acute myeloid leukemia (AML), comprising (A) contacting leukemia cells, preferably AML cells, with a compound suspected to be a compound for treating leukemia, (B) determining an amount of a BMP receptor, phospho-mothers against decapentaplegic homolog 1 (SMAD1), DNA-binding protein inhibitor ID-1 (ID1), CD14, integrin alpha-M (CD11B), R-spondin 2, and/or R-spondin 3 in said leukemia cells, and (C) based on the result of step (B), identifying a compound for treating and/or preventing leukemia.

    14. (canceled)

    15. The method of claim 1, wherein said R-spondin is R-spondin 2 and/or wherein said leukemia is acute myeloid leukemia (AML).

    16. The method of claim 1, further comprising administration of an antiproliferative agent to said subject.

    17. (canceled)

    18. A combined preparation comprising an antiproliferative agent and an inhibitor of R-spondin 2 and/or R-spondin 3 mediated bone morphogenetic protein (BMP) receptor inhibition.

    19. (canceled)

    20. (canceled)

    21. The method of claim 1, comprising administration of a combined preparation comprising an antiproliferative agent and an inhibitor of R-spondin 2 and/or R-spondin 3 mediated bone morphogenetic protein (BMP) receptor inhibition to said subject.

    22. The method of claim 9, wherein said R-spondin is R-spondin 2 and/or wherein said leukemia is acute myeloid leukemia (AML).

    Description

    FIGURE LEGENDS

    [0135] FIG. 1: RSPO2 and -3 antagonize BMP4 signaling independently of WNT: a) BRE reporter assay in HEPG2 cells stimulated by BMP4, with or without RSPO1-4 treatment. b,c) Western blot analyses of phosphorylated-(pSmad1) and total Smad1 (tSmad1) in HEPG2 cells upon RSPO2 DNA transfection (b) or treatment with RSPO2 (c). d) qRT-PCR analysis of ID1 in HEPG2 cells upon BMP4, with or without overnight RSPO2 treatment. e) Domain structures of RSPO2 and deletion mutants. sp, signal peptide; FU, furin domain; TSP1, thrombospondin domain 1. f) BRE reporter assay in HEPG2 cells stimulated by BMP4+RSPO2 and deletion mutants.

    [0136] FIG. 2: RSPO2 inhibits BMP4 signaling in Xenopus dorsoventral embryonic patterning: a) BMP-reporter assays with neurulae (St.15) injected as indicated. Data are biological replicates and displayed as meansSD with unpaired t-test. b) Quantification of in situ hybridization of BMP4 target sizzled in gastrula embryos (St.11) injected as indicated.

    [0137] FIG. 3: RSPO2 reduces ALK3 surface levels via ZNRF3/RNF43: a) BRE reporter assay in HEPG2 cells treated with ALK3RD and RSPO1-4. b) In vitro binding assay between RSPO1-3, FGF and ALK3.sup.ECD. c) Scatchard plot of RSPO2 and ALK3.sup.ECD binding. d) Quantification of cell surface binding assay in HEK293T cells transfected with receptor DNAs, followed by RSPO binding as indicated. Data shows a representative from 4 independent experiments. e) Western blot analysis of ALK3 in stage 15 embryos injected as indicated. GFP, loading control. f) Western blot analysis in stage 18 embryos injected as indicated. g) BRE reporter assay in HEPG2 cells transfected with siRNA and treated with BMP4+RSPO2. h) BRE reporter assay in HEPG2 cells treated as indicated. i) In vitro binding assay for ZNRF3 and ALK3.sup.ECD as indicated. j), Model for RSPO2-ZNRF3-ALK3 module (1) to mediate membrane clearance and degradation of ALK3 (2). Data for BRE reporter assays are biological replicates; binding assays are experimental replicates; ns, not significant, *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001 from unpaired t-test. Western blots show representative results from three independent experiments.

    [0138] FIG. 4: RSPO2 blocks macrophage differentiation by antagonizing BMP signaling. [0139] a) qRT-PCR analysis of ID1 in THP-1 cells treated siRNA as indicated. b) Western blot analysis of phosphorylated Smad1 (pSmad1) and total Smad1 (tSmad1) in THP-1 cells treated with siRNA and BMP4 as indicated. c) Western blot analysis of pSmad1 and tSmad1 in siRNA treated THP-1 cells, with or without ALK inhibitor (LDN-193189, LDN) treatment. d) Western blot analyses of pSmad1 and tSmad1 in THP-1 cells treated with siRNA and BMP4 as indicated. e) Quantification of FACS analysis for CD14.sup.+- or CD11B.sup.+ cells upon siRNA transfection of THP-1 cells. f) qRT-PCR analysis of CD14 and CD11B expression in siRNA treated THP-1 cells. g) Quantification of FACS analysis for CD14.sup.+ cells in THP-1 cells following BMP4 stimulation. h-j) Quantification of FACS analysis for CD11.sup.+- or CD14B.sup.+ cells upon antibody treatment of THP-1 cells.

    [0140] FIG. 5: Loss of RSPO2 in THP-1 cells increases BMP signaling and decreases cell growth: a) qRT-PCR analysis of indicated genes in THP-1 clones upon Dox treatment. b) Quantification of FACS analysis for CD11B.sup.+ cells in THP-1 clones treated as indicated. c) Cumulative cell growth curve depicted as the total cell count of THP-1 clones with Dox treatment. d) Representative images of CFC assay in THP-1 clones. e) Experimental scheme of THP-1 xenograft mice. f) Disease free survival (DFS) plot of THP-1 xenograft mice. g) qPCR analysis of the THP-1 burden in mice blood. h) Images show the livers and spleens harvested from THP-1 xenograft mice treated with or without Dox. Scale bar=1 cm. i) Quantification of FACS analysis for CD11B.sup.+ CD45.sup.+ cells in mice bone marrow. Data for FACS analyses are biological replicates and qRT-PCR are experimental replicates, and displayed as meansSD with unpaired t-test or one-way ANOVA test. Data show one representative of multiple independent experiments. ns, not significant; *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001.

    [0141] FIG. 6: High RSPO2 expression is a predictor for poor prognosis in AML: a-i) Kaplan-Meier plot of AML patients stratified by different gene expression levels (low and high according to the median). j) Table showing the number of patients analyzed (n), hazard ratio (HR), median survival ratio and significance of survival differences. ns, not significant; **p<0.01 from log-rank test. k-m) Kaplan-Meier plots of AML patients stratified by RSPO2 expression levels in the following cohorts: k) Beat AML (Tyner et al (2018), Nature 562 (7728): 526), 1) TARGET AML, and m) Leucegene AML.

    [0142] FIG. 7: Loss of RSPO2 increases BMP signaling, induces differentiation and reduces CFU of MOLM14 AML cells; a) pSmad1 and tSmad1 levels shown by western blot with cell lysates from MOLM14 TetOn-shRNA clones; b) qRT-PCR analysis of RSPO2 and ID1 in MOLM14 TetOn-shRNA clones; c) Quantification of FACS analysis for CD11B+ cells in MOLM14 TetOn-shRNA clones; d) CFC assay with MOLM14 TetOn-shRNA clones.

    [0143] FIG. 8: Loss of RSPO2 sensitize AML cells to chemotherapeutic drug cytarabine (AraC) treatment; a) and b) Cumulative cell growth depicted as the total cell count of THP-1 clones with Dox and AraC treatment.; c) AraC IC50 of THP-1 TetOn-shRNA clones upon Dox treatment.

    [0144] The following Examples shall merely illustrate the invention. They shall not be construed, whatsoever, to limit the scope of the invention.

    EXAMPLE 1: MATERIALS AND METHODS

    1.1 Constructs

    [0145] Alkaline phosphatase (AP) fusions with RSPOs (human RSPO1.sup.C-AP-pCDNA3, RSPO2.sup.C-AP-pCDNA3, RSPO2.sup.C-AP-pCS2+, RSPO3.sup.C-AP-pCDNA3, murine RSPO4.sup.C-pCDNA3) were generated by replacing the C-terminal domain (C) by AP and used to produce conditioned media. Human RSPO2 wild-type (RSPO2), Furin1 and Furin2 deletion mutants (RSPO2.sup.FU), and TSP1 domain deletion mutant (RSPO2.sup.TSP) are ORFs lacking the C-terminal domain, C-terminally tagged with a Flag-tag and subcloned into pCS2+. R1-TSP.sup.R2, R1-TSP.sup.R2-AP and R1-TSP.sup.R2-Flag plasmids were generated by fusion PCR and cloned in pCS2+. Conditioned media from all RSPO constructs were adjusted to equal concentration by western blot and AP activity measurement, and further validated by WNT reporter assay using HEK293T cells. The extracellular domain of ALK3 (ALK3.sup.ECD) was subcloned in AP-pCS2+ for generating conditioned medium and used in in vitro binding assays. Constitutively active forms of ALK2,3,6 (ALK.sup.QD) were generated by Gln-Asp mutations as described in Fujii et al. (1999), Mol Biol Cell 10, 3801-3813, doi: 10.1091/mbc.10.11.3801. HA-tagged ALK3 was a gift from Dr. D. Koinuma (Goto et al. (2007), J Biol Chem 282, 20603-20611, doi: 10.1074/jbc.M702100200). For Xenopus mRNA microinjection, Xenopus laevis BMP4-pCS2+, myc-tagged RSPO2.sup.C-myc-pCS2+, RSPO2.sup.FU-myc-pCS2+ and RSPO2.sup.TSP-myc-pCS2+ plasmids, DNALK3-pCS2+, membrane-RFP, EYFP-tagged human ALK3-pCS2+ were used for in vitro transcription. Human ZNRF3 and ZNRF3.sup.RING constructs were gifts from Dr. F. Cong (Novartis; Hao et al. (2012), Nature 485, 195-200, doi: 10.1038/nature11019), and ORFs were subcloned in flag-pCS2+ for in vitro transcription.

    [0146] A list of constructs used is provided in Table 1 below.

    1.2 Cell Culture

    [0147] HEK293T and HEPG2 cells (ATCC) were maintained in DMEM High glucose (Gibco 11960) supplemented with 10% FBS (Capricorn FBS-12A), 1% penicillin-streptomycin (Sigma P0781), and 2 mM L-glutamine (Sigma G7513). H1581 (gift from Dr. R. Thomas) and THP-1 cells (gift from Dr. S. Wiemann) were maintained in RPMI (Gibco 21875) with 10% FBS, 1% penicillin-streptomycin, 2 mM L-glutamine and 1 mM sodium pyruvate (Sigma S8636). Mycoplasma contamination was negative in all cell lines used. siRNAs and plasmids were transfected using DharmaFECT 1 transfection reagent (Dharmacon T-2001) and Lipofectamine 3000 (Invitrogen L3000) respectively, according to manufacturer protocols.

    1.3 Generation of Conditioned Medium

    [0148] HEK293T cells were seeded in 15 cm culture dishes and transiently transfected with RSPOs-AP, RSPOs-flag, ALK3.sup.ECD-AP, DKK1 or WNT surrogate plasmids using X-tremeGENE9 DNA transfection reagent (Roche 06365809001). After 24 hours, media were changed with fresh DMEM, 10% FBS, 1% L-glutamine and 1% penicillin-streptomycin and cultured 6 days at 32 C. Conditioned media were harvested three times every two days, centrifuged and validated by TOPFlash assay or western blot analyses.

    1.4 Luciferase Reporter Assays

    [0149] BRE luciferase assays were executed using 300,000 ml.sup.1 of HEPG2 cells in 24-well plates. PGL3-BRE-Luciferase (500 ng ml.sup.1) and pRL-TK-Renilla plasmids (50 ng ml.sup.1) were transfected using Lipofectamine 3000. After 24 hours, cells were serum starved 2 hours and stimulated 14-16 hours with 80 ng ml.sup.1 recombinant human BMP4 protein (R&D systems 314-BP) along with AP tagged RSPO1-4 or flag tagged RSPO1-3 conditioned medium. Luciferase activity was measured with the Dual luciferase reporter assay system (Promega E1960). Firefly luminescence (BRE) was normalized to Renilla. TOPFlash luciferase assays were carried out as previously described (Berger et al. (2017), EMBO Rep 18, 712-725, doi: 10.15252/embr.201643585). Data are displayed as average of biological replicates with SD. Statistical analyses were made with the PRISM7 software using unpaired t-test or one-way ANOVA test. Not significant (ns) P>0.05, *P<0.05, **P<0.01, ***P<0.001, and ****P<0.0001.

    1.5 Western Blot Analysis

    [0150] Cultured cells were rinsed with cold PBS and lysed in Triton lysis buffer (20 mN Tris-Cl, pH 7.5, 1% Triton X-100, 150 mM NaCl, 1 mM EDTA, 1 mM EGTA, 1 mM -glycerophosphate, 1 mM Na.sub.3 VO.sub.4) or RIPA buffer with complete Protease Inhibitor Cocktail (Roche 11697498001). Lysates were mixed with Laemmli buffer with -mercaptoethanol and boiled at 95 C. for 5 min to prepare SDS-PAGE samples. Western blot images were acquired with SuperSignal West pico ECL (ThermoFisher 34580) or Clarity Western ECL (Biorad 1705061) using LAS-3000 system (FujiFilm). Quantification of blots was done using ImageJ software.

    1.6 Cell Surface Biotinylation Assay

    [0151] H1581 cells were seeded in 6 cm culture dishes and transfected with 50 nM of indicated siRNAs and 2 g of ALK3-HA DNA. Surface proteins were biotinylated with 0.25 mg/ml sulfo-NHS-LC-LC-Biotin (ThermoFisher 21338) at 4 C. for 30 min. The reaction was quenched by 10 mM Monoethanolamine and cells were harvested and lysed with Triton X-100 lysis buffer. 200-300 g of lysate was incubated with 20 l streptavidin agarose (ThermoFisher 20359) to pull-down biotinylated surface proteins and subjected to Western blot.

    1.7 Xenopus laevis and Xenopus tropicalis Experiments

    [0152] All X. laevis and X. tropicalis experiments were approved by the state review board of Baden-Wrttemberg, Germany (permit number G-141-18) and executed according to federal and institutional guidelines and regulations. Developmental stages of the embryos were determined according to Nieuwkoop and Faber. No statistical analysis was done to adjust sample size before the experiments. No randomization of injection order was used during the experiments.

    1.8 Xenopus laevis Whole-Mount In Situ Hybridization

    [0153] Whole-mount in situ hybridizations of Xenopus embryos were performed using digoxigenin (DIG)-labeled probes. Antisense RNA probes against rspo2 and bmp4 were generated by in vitro transcription as previously described (Kazanskaya et al. (2004), Dev Cell 7, 525-534, doi: 10.1016/j.devcel.2004.07.019). Probes against alk3 and znrf3 were prepared using full-size of Xenopus alk3 ORF or znrf3 ORF as a template. Mo and mRNA injected embryos were collected at stage 11 (gastrula) or 32 (tadpole) for in situ hybridization. Images were obtained using AxioCam MRc 5 microscope (Zeiss). Embryos in each image were selected using Magnetic Lasso tool or Magic Wand tool of Adobe Photoshop CS6 software, and pasted into the uniform background color for presentation.

    1.9 Xenopus Microinjection and Phenotype Analysis

    [0154] In vitro fertilization, microinjection and culture of Xenopus embryos were performed as previously described (Gawantka et al. (1995), EMBO J 14, 6268-6279). X. laevis embryos were microinjected with reporter DNAs, in vitro transcribed mRNAs or antisense morpholino oligonucleotide (Mo) using Harvard Apparatus microinjection system. Mos for rspo2 (Kazanskaya et al (2004, loc. cit.), lrp6, chordin, bmp4, znrf3 and standard control were purchased from GeneTools. rspo2.sup.TSP Mo was designed based on rspo2 sequence. X. laevis 4-cell stage embryos were microinjected 5 nl per each blastomere equatorially and cultured until indicated stages. Equal amount of total mRNA or Mo were injected by adjustment with ppl or standard control Mo. Scoring of phenotypes was executed blind, and data are representative images from two independent experiments. Embryos in each image were selected using Magnetic Lasso tool or Magic Wand tool of Adobe Photoshop CS6 software, and pasted into the uniform background color for presentation. Statistical analyses show Chi-square tests.

    1.10 Xenopus tropicalis CRISPR/Cas9-Mediated Mutagenesis

    [0155] The 5 region of genomic sequences from X. tropicalis chordin (NM_001142657.1) and noggin (NM_001171898.1) were searched for synthetic guide RNA (gRNA) targeting sites using an online prediction tool (crispr.cos.uni-heidelberg.de). Primers were designed for PCR-based gRNA template assembly. A primer lacking target sequences was used as control gRNA. PCR reactions were performed with Phusion Hot Start Flex DNA Polymerase (NEB M0535), followed by in vitro transcription using MEGAscript T7 Transcription Kit (Invitrogen AM1334). Embryos were microinjected at one to two-cell stages with a mixture of 50 g of gRNA and 1 ng of recombinant Cas9 protein (Toolgen) per embryo. Injected embryos were cultured until stage 26, fixed with MEMFA and phenotypes were analyzed. Scoring of phenotypes was executed at stage 30 with blinding, and data are representative images from three independent experiments. Defects were categorized by the severity of ventralization. Severe showed small head, enlarged ventral tissues and short body axis. Mild showed one or two of the defects described above. Normal showed no visible differences to the uninjected control. Statistical analyses show Chi-square test.

    1.11 Xenopus tropicalis T7 Endonuclease I Assay

    [0156] To validate CRISPR/Cas9-mediated genome editing, three embryos of each injection set were lysed at stage 30 for genotyping PCR reactions. All target sequences were amplified with Roti-Pol Hot-TaqS Mix (Roth 9248). After denaturation for 3 min at 94 C. and reannealing (ramp 0.1 C. per sec), the PCR products were incubated with 3 U of T7 Endonuclease I for 45 min at 37 C. Cleavage results were visualized on a 2% agarose gel.

    1.12 Xenopus laevis Western Blot Analysis

    [0157] Injected Xenopus embryos were harvested at stage 15 to 18, homogenized in NP-40 lysis buffer (2% NP-40, 20 mM Tris-HCl pH 7.5, 150 mM NaCl, 10 mM NaF, 10 mM Na3VO4, 10 mM sodium pyrophosphate, 5 mM EDTA, 1 mM EGTA, 1 mM PMSF, and complete Protease Inhibitor Cocktail with a volume of 20 l per embryo. Lysates were cleared with CFC-113 (Honeywell 34874), followed by centrifugation (14,000 rpm, 10 min at 4 C.), boiling at 95 C. for 5 min with NuPAGE Sample Buffer. 0.5-1 embryos per lane were loaded for SDS-PAGE analysis.

    1.13 In Vitro Binding Assay

    [0158] High binding 96-well plates (Greiner M5811) were coated with 2 g ml.sup.1 of recombinant human RSPO1 (Peprotech 120-38), RSPO2 (Peprotech 120-43), RSPO3 (Peprotech 120-44) or FGF8b (Peprotech 100-25) recombinant protein reconstituted in bicarbonate coating buffer (50 mM NaHCO.sub.3, pH 9.6) overnight at 4 C. Coated wells were washed three times with TBST (TBS, 0.1% Tween-20) and blocked with 5% BSA in TBST for 1 hour at room temperature. 1.5 U ml.sup.1 of ALK3.sup.ECD-AP or control conditioned medium was incubated overnight at 4 C. Wells were washed six times with TBST and bound AP activity was measured by the chemiluminescent SEAP Reporter Gene Assay kit (Abcam ab 133077). For ZNRF3-ALK3 binding assay, plates were coated with recombinant human ZNRF3 Fc Chimera protein (R&D systems 7994-RF). ALK3.sup.ECD-AP was preincubated with RSPO2-Flag, RSPO2.sup.TSP-Flag conditioned medium or recombinant RSPO protein prior to treatment. Control conditioned medium and vesicles were used as control. Data show average chemiluminescent activities with SD from experimental triplicates. Statistical analyses show unpaired t-tests.

    1.14 Immunofluorescence

    [0159] 150,000 H1581 cells were grown on coverslips in 12-well plates, followed by siRNA and DNA transfection. After 48 hours cells were fixed in 4% PFA for 10 min. Cells were treated with primary antibodies (1:250) overnight at 4 C., and secondary antibodies (1:500) and Hoechst dye (1:500) were applied for 2 hours at room temperature. Tyramide Signal Amplification for detecting RSPO-HRP was carried out as previously described.sup.13,23. Quantification was executed using ImageJ. Dot plots show average and SD from every cells analyzed with unpaired t-test.

    [0160] For X. laevis embryos, alk3-EYFP and membrane-RFP mRNAs were coinjected with the indicated mRNAs or Mos. Embryos were dissected for animal or ventrolateral explants at stage 9 or stage 11.5, respectively. Explants were immediately fixed with 4% PFA for 2 hours and mounted with Fluoromount-G (ThermoFisher 00495802). Images were obtained using LSM 700 (Zeiss). Data are representative images from two independent experiments. For quantification, Pearson's correlation coefficient for EYFP and RFP was analyzed using 16-30 random areas harboring 10 cells chosen from 6-10 embryos per each set. Dot plots show an average and SD from every plane analyzed with unpaired t-test.

    1.15 Cell Surface Binding Assay

    [0161] Cell surface binding assays were carried essentially out as previously described (Dosch et al. (1997), Development 124, 2325-2334). In brief, human ALK3-HA and Xenopus tropicalis LGR4 DNA were transfected in HEK293T cells, and incubated with 1.5 U ml.sup.1 conditioned media for 3 hours on ice. After several washes and crosslinking, cells were treated with 2 mM Levamisole for 20 min to inactivate endogenous AP activities and developed with BM-Purple (Sigma 11442074001). Cells were mounted with Fluoromount G. Images were obtained using LEICA DMIL microscope/Canon DS126311 camera.

    1.16 Quantitative Real-Time PCR

    [0162] Cultured cells were lysed in Macherey-Nagel RAI buffer containing 1% -mercaptoethanol and total RNAs were isolated using NucleoSpin RNA isolation kit (Macherey-Nagel 740955). Reverse transcription and PCR amplification were performed. Primers used in this study are listed in Supplementary Table 1. Graphs show relative gene expressions to GAPDH. Data are displayed as mean with SD from multiple experimental replicates. Statistical analyses were performed using PRISM7 software with unpaired t-test or one-way ANOVA test.

    [0163] 1.17 FACS analysis

    [0164] For analyzing macrophage differentiation of THP-1, cells were harvested, pelleted and resuspended in ice-cold blocking buffer (PBS supplemented with 1% BSA and 0.1% NaN.sub.3). Cells were treated with Fc Receptor Binding Inhibitor as recommended by the manufacturer (eBioscience 14916173) and stained directly with FITC/APC-conjugated antibodies diluted in blocking buffer or with non-conjugated primary antibodies followed by fluorochrome-labeled secondary antibodies. Isotype-matched antibodies were used as controls. Dead cells were excluded by counterstaining with propidium iodide. For analyzing apoptosis of THP-1, cells were fixed in 4% PFA, permeabilized by MeOH and blocked with PBS supplemented with 1% BSA and 0.1% Tween-20. Cells were stained with anti-active Caspase-3 antibody and fluorochrome-labeled secondary antibody. FACS Samples were analyzed with FACSCalibur or FACSCanto (BD Biosciences). 10,000 events per samples were acquired, and results were processed with Cell Quest or FACSDiva software (BD Biosciences). For BMP4 stimulation, cells were treated with 5 and 25 ng ml.sup.1 recombinant human BMP4 protein (R&D systems 314-BP). 100, 300 and 1000 nM LDN 193185 (Tocris 6053) were used for rescue assay. For the THP-1 cell number quantification and differentiation validation in vivo, bone marrow cells were harvested from tibias of NSG mice and red blood cells were removed by ACK Lysing Buffer (Gibco A1049201). Cells were stained and analyzed as above. Here, 50,000 PI-negative events per samples were acquired.

    1.18 RSPO2 Neutralization Assay

    [0165] THP-1 cells were treated with 0.3, 1.0 and 3.0 g ml.sup.1 goat polyclonal anti-RSPO2 antibodies (R&D systems AF3266) or goat polyclonal GFP antibodies (ABIN 100085). After 48 hours, medium was replaced including fresh antibodiesand incubated another 24 hours. Western blot analysis and FACS analyses were performed as discussed above.

    1.19 Generation of Inducible shRNA Expressing Cell Line

    [0166] The sequences of shRSPO2 and shControl (Table 1) were synthesized, inserted into the transfer plasmid Tet-pLKO-puro (Addgene 21915) and validated by sequencing. Lentivirus was produced with the 3.sup.rd generation lentiviral system according to the protocol available at the Trono lab as described (www.epfl.ch/labs/tronolab/). THP-1 cells were infected with lentivirus with 8 g ml.sup.1 Polybrene (Sigma TR-1003) and selected with 0.5 g ml.sup.1 puromycin (Calbiochem 540411). Single cell clones were obtained by limiting dilutions. The shRNA expression of clones was validated by monitoring RSPO2 expression after doxycycline treatment (1.0 g ml.sup.1) for 3 days.

    1.20 Colony Formation Assay

    [0167] 1,000 cells per well of Dox-inducible THP-1 clones were seeded into 24-well plates in RPMI+10% FBS, 1% penicillin-streptomycin, 1 mM sodium pyruvate, 2 mM L-glutamine and 0.5% methylcellulose, with or without Doxycycline (1 g ml.sup.1). After 8 days incubation, microscopic dark field images were taken using LEICA DMIL microscope/Canon DS126311 camera. Quantification was executed with ImageJ, and statistics shows unpaired t-test.

    1.21 In Vivo Experiments with NSG Mouse

    [0168] NOD SCID gamma (NSG) mice were recruited from the Center for Preclinical Research, DKFZ, Heidelberg. Mice were maintained at a 12 h light-dark cycle with unrestricted Kliba 3307 diet and water. Randomized mouse cohorts (n=6-7 mice/group) were treated with Dox or vehicle throughout the study. Treatment started 3 days prior to cell transplantation via drinking water consisting 1 mg/ml Dox and 5% saccharose, or 5% saccharose only. One day prior to transplantation, mice were sub-lethally irradiated on whole body (2 Gy of a 137Cs-source, Type OB. 58/9021; Buchler GmbH, Braunschweig) and treated with Baytril (25 mg/kg bodyweight, i.e. 25 mg/ml drinking water) for 2 weeks. 500,000 cells in 100 l PBS were injected intravenously into the lateral tail vein of 7-8-week-old female mice. Besides regular health checks, mouse body weight was taken twice per week throughout the experiment. Heparinized blood was collected from the tail vein at days 9 and 22 after transplantation. Terminal blood collection was performed under isoflurane anesthesia followed by cervical dislocation. Necropsies were taken as indicated or when mice reached a stop criterion of the German Society of Laboratory Animal Sciences (GV-SOLAS), until here defined as survival. All mouse experiments were in accordance with the approved guidelines of the local Governmental Committee for Animal Experimentation (RP Karlsruhe, Germany, license G140/19).

    1.22 qPCR Analysis for THP-1 Burden in NSG Mouse

    [0169] Genomic DNA was isolated from mouse blood samples using NucleoSpin Tissue kit (Macherey-Nagel 740952). Quantitative PCR was done with human Alu element specific primers and corresponding Taqman probe (Funakoshi et al. (2017), Sci Rep 7, 13202, doi: 10.1038/s41598-017-13402-3). For each reaction, 25 ng genomic DNA was used. A standard curve was generated with genomic DNA extracted from NSG mice blood containing known numbers of THP-1 cells and used for converting qPCR fluorescent signals to actual cell numbers. Normal NSG mice blood and nuclease free water were used as negative controls.

    1.23 Kaplan-Meier Plot of AML Patients

    [0170] Kaplan-Meier plots of AML patients were generated using UCSC Xena database (xena.ucsc.edu) and the GDC TCGA Acute Myeloid Leukemia dataset (portal.gdc.cancer.gov/projects/TCGA-LAML). Expression levels of indicated genes were stratified into two or three groups according to the RNAseq data. Statistical analyses were done with the PRISM7 software using Log-rank test.

    EXAMPLE 2: RESULTS

    2.1 RSPO2 and -3 Antagonize BMP4 Signaling Independently of WNT

    [0171] We tested if RSPO2 could suppress BMP signaling in human cells. To this end, we utilized human hepatocellular carcinoma (HEPG2) cells, which express very low levels of RSPOs. Intriguingly, treatment with RSPO2 and RSPO3 but not RSPO1 and RSPO4 decreased BMP4 signaling, while all RSPOs showed similar ability to amplify Wnt signaling (FIG. 1a). RSPO2 decreased phosphorylation of Smad1 and expression of ID1, which are hallmarks of BMP signaling activation (FIG. 1b-d). Importantly, inhibition of BMP signaling by RSPO2 was independent of both WNT/LRP6 and WNT/PCP signaling since it remained unaffected by siRNA knockdown of -catenin, LGR4/5, LRP5/6, DVL1/2/3 and ROR1/2.

    [0172] To delineate the domains required for BMP inhibition, we analyzed deletion mutants of RSPO2 and found both the TSP1- and FU-domains to be important (FIG. 1e-f). We next investigated RSPO2 deficiency in H1581 cells, a human large cell lung carcinoma cell line that expresses high levels of RSPO2. Knockdown of RSPO2 but not LRP5/6 sensitized H1581 cells to BMP stimulation.

    2.2 RSPO2 Antagonizes BMP Signaling During Xenopus Embryonic Axis Development

    [0173] To analyze if RSPO2 inhibits BMP signaling in vivo, we turned our attention to Xenopus embryos, where BMP signaling plays a crucial role in dorsoventral patterning and rspo2 is required for WNT-mediated myogenesis (Kazanskaya et al. (2004, loc. cit.). Bmp4 overexpression ventralizes Xenopus embryos, resulting in small heads and enlarged ventral structures. Concordantly, injection of wild-type rspo2 mRNA, but not its deletion mutants, rescued these bmp4-induced malformations. Conversely, injection of a previously characterized rspo2 antisense Morpholino (Mo, Kazanskaya et al (2004), loc. cit.) increased endogenous BMP signaling (FIG. 2a). Strikingly, coinjection of bmp4 Mo and rspo2 Mo canceled each other out in BMP signaling reporter assays.

    [0174] To confirm our morpholino data, we used a previously established guide RNA (gRNA, Szenker-Ravi et al. (2018), Nature 557, 564-569, doi: 10.1038/s41586-018-0118-y) to generate Crispr-Cas9-mediated Xenopus rspo2 knockout embryos. In accordance, rspo2 ablation increased BMP target gene expression (FIG. 2b) and yielded mildly ventralized embryos.

    2.3 RSPO2 Bridges ALK3 and ZNRF3 and Triggers BMP Receptor Degradation

    [0175] Given that RSPOs act by promoting receptor endocytosis, we postulated that RSPO2 might regulate BMP signaling through its receptors: ALK2, ALK3 and ALK6. To test this hypothesis, we analyzed the effects of RSPO2 on BMP signaling induced by constitutively active ALKs (ALK.sup.QD). Interestingly, RSPO2 and -3 treatment specifically inhibited ALK3RD but not ALK2.sup.QD or ALK6.sup.QD. while RSPO1 and -4 had no effect (FIG. 3a). Indeed, in vitro binding assay revealed that RSPO2 bound the extracellular domain of ALK3 (FIG. 3b) with high affinity (K.sub.d4.8 nM) (FIG. 3c). ALK3 binding required the TSP1but not the FU domains of RSPO2, while, conversely, LGR binding required the FU domains but not TSP1 (FIG. 3d).

    [0176] To investigate the consequence of this binding, we monitored ALK3 protein levels upon rspo2 overexpression or knockdown in Xenopus embryos, where alk3 is expressed from early stages onwards. rspo2 mRNA decreased protein levels from coinjected alk3-EYFP mRNA (FIG. 3e), while rspo2 MO increased ALK3-EYFP protein levels (FIG. 3f). Similarly, in H1581 cells siRSPO2 treatment increased ALK3 levels, altogether suggesting that RSPO2 destabilizes ALK3.

    [0177] Our results indicate that the specificity for the RSPO-ALK3 interaction resides in the TSP1 domain of RSPOs. Consistently, the RSPO1 TSP1 domain shows only 43% and 50% sequence similarity to RSPO2 and RSPO3 respectively. We next asked whether TSP1-domain swapping could convey BMP inhibition to RSPO1. To this end, we generated an RSPO1 chimera (R1-TSP.sup.R2) possessing the TSP1 domain of RSPO2. R1-TSP.sup.R2 activated WNT signaling and interacted with LGR4, similar to wt RSPO1. However, unlike wt RSPO1, R1-TSP.sup.R2 bound to ALK3 (FIG. 3d) and antagonized BMP signaling, mimicking the effects of RSPO2.

    [0178] We next turned to the role of the FU domains in RSPO2, which are also required for inhibition of BMP signaling. FU1 and FU2 domains confer RSPO binding to ZNRF3/RNF43 and LGRs, respectively.sup.5. Knockdown of ZNRF3/RNF43 or expression of a dominant negative ZNRF3 (ZNRF3.sup.R).sup.15 prevented inhibition of BMP signaling by RSPO2 (FIG. 3g-h), supporting that RSPO2 requires ZNRF3/RNF43 to antagonize BMP signaling. Importantly, ZNRF3 interacted with ALK3 in the presence of RSPO2 but not RSPO2.sup.TSP or RSPO1 (FIG. 3i), indicating that RSPO2 bridges both transmembrane proteins. To test if RSPO2/ZNRF3 target ALK3 for endocytosis and lysosomal degradation, we treated cells with the clathrin inhibitor monodansylcadaverin (MDC), which eliminated inhibition of BMP signaling by RSPO2. Taken together, our results support a model (FIG. 3j) wherein RSPO2 bridges ZNRF3 and ALK3 and routes them towards clathrin-mediated endocytosis and lysosomal degradation, thereby antagonizing BMP signaling. We suggest that, based on our in vitro and in vivo data, a similar mechanism applies to RSPO3.

    2.4 RSPO2 Maintains Cancer Cell Proliferation by Inhibiting BMP Signalling

    [0179] To investigate the role of RSPO2 in macrophage maturation from precursors (monocytes), we utilized human monocytic leukemia THP-1 cells. THP-1 cells are used to model both monocyte to macrophage differentiation and AML (acute myeloid leukemia). In accordance with our observations in human cell lines and Xenopus, RSPO2but not RSPO1 siRNA knockdown enhanced BMP signaling, as shown by induction of ID1 expression (FIG. 4a). Furthermore, RSPO2 knockdown was accompanied by increased Smad1-phosphorylation (FIG. 4b), and treatment with the BMP receptor inhibitor LDN 193189 reverted increased Smad1-phosphorylation (FIG. 4c). Consistently, siZNRF3/RNF43 enhanced Smad1-phosphorylation (FIG. 4d).

    [0180] AML arises from uncontrolled proliferation and impaired differentiation of myeloid precursors (Nowak et al. (2009), Blood 113, 3655-3665, doi: 10.1182/blood-2009-01-198911), raising the possibility that RSPO2, via reducing BMP signaling and thereby inhibiting myeloid differentiation, could act as an endogenous oncogene in THP-1 cells. We therefore asked whether RSPO2 knockdown in THP-1 cells could induce monocyte-macrophage differentiation. Strikingly, siRSPO2 RNA treatment increased expression of the macrophage markers CD14 and CD11B (FIG. 4e-f), similar to BMP4 treatment (FIG. 4g). Attenuating BMP receptor signaling with LDN 193189 impaired monocyte-macrophage differentiation induced by siRSPO2. Neutralizing endogenous RSPO2 protein with an anti-RSPO2 antibody showed similar effects to siRSPO2 treatment (FIG. 4h-j). To test whether adding RSPO2 protein could impair monocyte-macrophage differentiation, we treated THP-1 cells with all-trans-retinoic acid (ATRA), which induces macrophage differentiation in a number of monocytic cell lines, including THP-1 cells. ATRA induced Smad1-phosphorylation as well as ID1 and CD11B expression, while co-treatment with RSPO2 reverted these effects. These results indicate that RSPO2 inhibits BMP signaling in THP-1 cells, thereby preventing macrophage differentiation and promoting self-renewal.

    [0181] To further validate this conclusion, we established two THP-1 clones expressing Dox-inducible shRSPO2 RNA (TetOn-shRSPO2), where Dox-administration induced BMP signaling and robust monocyte-macrophage differentiation (FIG. 5 a). In addition, Dox+ATRA cooperated in inducing macrophage differentiation (FIG. 5 b). Consistent with RSPO2 maintaining a proliferative state, Dox treatment reduced THP-1 cell growth (FIG. 5c) and colony formation (FIG. 5d).

    [0182] Also, loss of RSPO2 was found to increase BMP signaling, induce differentiation and reduce CFU of MOLM14 AML cells (FIG. 7).

    [0183] Moreover, loss of RSPO2 was found to sensitize AML cells to chemotherapeutic drug cytarabine (AraC) treatment (FIG. 8).

    [0184] To explore a putative therapeutic effect of inhibiting RSPO2 to restrict THP-1 growth in an AML xenograft model, we injected TetOn-shRSPO2 or -shControl THP-1 cells into immunodeficient (NSG) mice (FIG. 5e). Mice harboring TetOn-shControl THP-1 cells rapidly developed leukemia and succumbed within 50 days post-injection, with or without Dox treatment. Mice injected with the two TetOn-shRSPO2 THP-1 cell lines (#1, #2) also reached the humane endpoint between 45-62 days without Dox treatment. In contrast, upon Dox induction mice injected with cell line #2 survived almost twice as long and mice injected with line #1 where still alive at reporting time, corresponding to an at least 2.3-fold prolongation of disease-free survival (FIG. 5f). Extended survival was accompanied by reduced tumor burden (FIG. 5g-h) and enhanced macrophage differentiation in both cell lines (FIG. 5i).

    [0185] Intriguingly, analysis of overall survival in AML patients in cancer databases revealed that high RSPO2 expression was a superior predictor for poor prognosis (hazard ratio 2.018; p=0.0014) compared to commonly used markers (HOXA9, hazard ratio 1.899; p=0.0034; PBX3, hazard ratio 2.011; p=0.0014; MEISI, hazard ratio 1.460; p=0.0304).sup.31,32 (FIG. 6).

    [0186] Our study reveals that RSPO2 and RSPO3 function not only to amplify WNTbut also to antagonize BMP signaling, and that ALK3 is a novel RSPO2/3 receptor. Given the importance of RSPOs as growth factors of normal and malignant stem cells this conclusion has important implications for disease beyond AML. For example, WNT activation accompanied by suppression of BMP signalling is a hallmark in colorectal cancer (CRC).sup.33. Hence, the dual function as WNT-activator and BMP suppressor sheds new light on how RSPO2 and RSPO3 gain-of-function mutations act as potent drivers in CRC (Seshagiri et al. (2012) Nature 488, 660-664, doi: 10.1038/nature11282). Our data also imply a function for ZNRF3 and possibly RNF43 in antagonizing BMP signalling, inviting a closer inspection of their loss-of-function phenotypes.

    TABLE-US-00002 TABLE1 ConstructsusedintheExamples a.qRT-PCRprimers Gene PrimerSequence SEQIDNO RSPO1 F:ATCAAGGGGAAAAGGCAGA 12 R:CAGAGCTCACAGCCTTTGG 13 RSPO2 F:TGTCCAACCATTGCTGAATC 14 R:TCCTCTTCTCCTTCGCCTTT 15 RSPO3 F:AAGTGTCAGAAGGGAGAACGAG 16 R:TGCTGTCAGGTATTGCTTCTTT 17 RSPO4 F:TTTGGCCCACCAGAACAC 18 R:CCGCAGGTCTTTCCATTG 19 ID1 F:CCAGAACCGCAAGGTGAG 20 R:GGTCCCTGATGTAGTCGATGA 21 ZNRF3 F:TGTGCCATGTGTCTGGAGAA 22 R:TTCCTGTGAAACCGGTGAGT 23 RNF43 F:GTTTGCTGGTGTTGCTGAAA 24 R:TGGCATTGCACAGGTACAG 25 GAPDH F:AGCCACATCGCTCAGACAC 26 R:GCCCAATACGACCAAATCC 27 CD14 F:GTTCGGAAGACTTATCGACCAT 28 R:ACAAGGTTCTGGCGTGGT 29 CD118 F:AGGAAGCCGGAGAGGTCA 30 R:CACAACACTCTGGATCTGTCCTT 31 b.siRNAs siRNA DharmaconCatalogue# siControl D-001210-01-20 sibcatenin M-003482-00 siLgr4 M-003673-03 siLgr5 M-005577-01 siLrp5 M-003844-02 siLrp6 M-003845-03 siRspo1 M-018179-01 siRspo2 M-017888-01 siZnrf3 M-010747-02 siRnf43 M-007004-02 c.shRNAs Human shRNA Sequence SEQIDNO shControl ATCTCGCTTGGGCGAGAGTAAGctcgagCT 32 TACTCTCGCCCAAGCGAGAT shRSPO2 GACAATGGGTGTAGCCGATctcgagATCGG 10 CTACACCCATTGTC d.Morpholinos Gene Sequences(5-3) SEQIDNO rspo2 GCCGTCCAAATGCAGTTTCAAC 9 chordin 1:ACGTTCTGTCTCGTATAGTGAGCGT 35 2:ACAGCATTTTTGTGGTTGTCCCGAA 36 bmp4 CAGCATTCGGTTACCAGGAATCATG 37 lrp6 CCCCGGCTTCTCCGCTCCGACCCCT 38 znrf3 AACATAATTTCCCAGTCCTCAGTGG 39 rspo2TSP CAGCCATCTGGGAAGGCAACAGAAA 40 e.PrimersforX.tropicalissgRNAs Gene Sequences(5-3) SEQIDNO rspo2 TGACTCCATAGTATCCAGGA 11 noggin CCTGGGACTTAGAATAGACC 33 chordin CTGCTGGTGTCTTAGATTGG 44 f.GenotypingPrimersforX.tropicalis Primer Sequences(5-3) SEQIDNO rspo2(F) GCAGTATAGCATTGAAGTGGGTC 41 rspo2(R) GACAGATTCGTTCATCACTACATAG 42 noggin(F) GATCTCTGGCAAGAAATCGGGA 43 noggin(R) GACAGGACAGAAGGTCTGG 44 chordin(F) CTCAACTCTTTGGACTCACTGAG 45 chordin(R) ATGTGGCATCCTAAGGATTTAGG 46

    LITERATURE

    [0187] Berger et al. (2017), EMBO Rep 18, 712-725, doi: 10.15252/embr.201643585 [0188] Dosch et al. (1997), Development 124, 2325-2334 [0189] Fujii et al. (1999), Mol Biol Cell 10, 3801-3813, doi: 10.1091/mbc.10.11.3801 [0190] Funakoshi et al. (2017), Sci Rep 7, 13202, doi: 10.1038/s41598-017-13402-3 [0191] Gawantka et al. (1995), EMBO J 14, 6268-6279 [0192] Goto et al. (2007), J Biol Chem 282, 20603-20611, doi: 10.1074/jbc.M702100200 [0193] Hao et al. (2012), Nature 485, 195-200, doi: 10.1038/nature11019 [0194] Hao et al. (2016), Cancers (Basel) 8, doi: 10.3390/cancers8060054 [0195] Kazanskaya et al. (2004), Dev Cell 7, 525-534, doi: 10.1016/j.devcel.2004.07.019 [0196] Nowak et al. (2009), Blood 113, 3655-3665, doi: 10.1182/blood-2009-01-198911 [0197] Sato et al. (2009), Nature 459, 262-265, doi: 10.1038/nature07935 [0198] Szenker-Ravi et al. (2018), Nature 557, 564-569, doi: 10.1038/s41586-018-0118-y [0199] Tyner et al (2018), Nature 562 (7728): 526