Vaccine

Abstract

The invention relates to modified Mycobacterium cells, and their uses as vaccines, and, particularly, modified Bacillus Calmette-Gurin vaccines. The invention extends to the use of the modified vaccines for vaccination applications in a wide range of animals, including cattle and humans. The invention extends to novel antigens, kits and compositions comprising these novel antigens and to their use in diagnosis. The invention also extends to apparatus comprising the modified vaccine and the antigens, and compositions comprising the antigens.

Claims

1. An apparatus for tuberculosis vaccination and diagnosis, the apparatus comprising: (i) a vaccine comprising a mutant Mycobacterium cell, which has been modified compared to a corresponding wild-type cell, such that a plurality of genes, or products thereof, have been functionally deleted and/or inhibited, wherein the genes encode the native antigens esx-1 secretion-associated protein espA (espA), esat-6 like protein esxS (esxS), esx-1 secretion-associated protein espC (espC), major secreted immunogenic protein Mpb70 (MPB70), and cell surface lipoprotein Mpb83 (MPB83), or a homologue, paralogue, orthologue, functional fragment or variant thereof; and (ii) a composition configured to detect a Mycobacterium infection in a subject vaccinated with the vaccine of (i), the composition comprising the antigens of (i).

2. The apparatus of claim 1, wherein the Mycobacterium is selected from a group consisting of: Mycobacterium tuberculosis, Mycobacterium bovis Bacillus Calmette Guerin (BCG), Mycobacterium microtti, Mycobacterium africanum, Mycobacterium smegmatis, Mycobacterium avium, Mycobacterium caprae and Mycobacterium vaccae, optionally preferably wherein the mutant cell is a Mycobacterium bovis cell, or a Mycobacterium tuberculosis cell, more optionally wherein the mutant Mycobacterium cell is a mutant Bacillus Calmette-Gurin (BCG) Mycobacterium bovis cell.

3. The apparatus according to claim 1, wherein the mutant Mycobacterium cell expresses a protein that increases its immunogenicity in a host, and wherein the protein is a mutant Escherichia coli heat-labile toxin LT, or a mutant A subunit thereof.

4. The apparatus according to claim 1, wherein the antigens further comprise ESAT6 and/or CFP-10.

5. The apparatus according to claim 4, wherein (i) espA comprises or consists of an amino acid sequence substantially as set out in SEQ ID NO: 9, or a functional fragment or variant thereof, or is encoded by a nucleic acid sequence comprising or consisting of a nucleotide sequence substantially as set out in SEQ ID NO: 10, or a fragment or variant thereof; (ii) esxS comprises or consists of an amino acid sequence substantially as set out in SEQ ID NO: 1, or a functional fragment or variant thereof, or is encoded by a nucleic acid sequence comprising or consisting of a nucleotide sequence substantially as set out in SEQ ID NO: 2, or a fragment or variant thereof; (iii) espC comprises or consists of an amino acid sequence substantially as set out in SEQ ID NO: 7, or a functional fragment or variant thereof, or is encoded by a nucleic acid sequence comprising or consisting of a nucleotide sequence substantially as set out in SEQ ID NO: 8, or a fragment or variant thereof; (iv) MPB70 comprises or consists of an amino acid sequence substantially as set out in SEQ ID NO: 3, or a functional fragment or variant thereof, or is encoded by a nucleic acid sequence comprising or consisting of a nucleotide sequence substantially as set out in SEQ ID NO: 4, or a fragment or variant thereof; and/or (v) MPB83 comprises or consists of an amino acid sequence substantially as set out in SEQ ID NO: 5, or a functional fragment or variant thereof, or is encoded by a nucleic acid sequence comprising or consisting of a nucleotide sequence substantially as set out in SEQ ID No: 6, or a fragment or variant thereof; and/or (vi) wherein ESAT6 comprises or consists of an amino acid sequence substantially as set out in SEQ ID NO: 11, or a functional fragment or variant thereof, or is encoded by a nucleic acid sequence comprising or consisting of a nucleotide sequence substantially as set out in SEQ ID NO: 12, or a fragment or variant thereof; and/or (vii) wherein CFP10 comprises or consists of an amino acid sequence substantially as set out in SEQ ID NO: 13, or a functional fragment or variant thereof, or is encoded by a nucleic acid sequence comprising or consisting of a nucleotide sequence substantially as set out in SEQ ID NO: 14, or a fragment or variant thereof.

6. A mutant Mycobacterium cell, which has been modified compared to a corresponding wild-type cell, such that a plurality of genes, or products thereof, have been functionally deleted and/or inhibited, wherein the genes encode the antigens esx-1 secretion-associated protein espA (espA), esat-6 like protein esxS (esxS); esx-1 secretion-associated protein espC (espC); major secreted immunogenic protein Mpb70 (MPB70); and cell surface lipoprotein Mpb83 (MPB83) or a homologue, paralogue, orthologue, functional fragment or variant thereof.

7. The mutant Mycobacterium cell according to claim 6, wherein the Mycobacterium is selected from a group consisting of: Mycobacterium tuberculosis, Mycobacterium bovis Bacillus Calmette Guerin (BCG), Mycobacterium microtti, Mycobacterium africanum, Mycobacterium smegmatis, Mycobacterium avium, Mycobacterium caprae and Mycobacterium vaccae, optionally wherein the mutant cell is a Mycobacterium bovis cell, or a Mycobacterium tuberculosis cell, more optionally wherein the mutant Mycobacterium cell is a mutant Bacillus Calmette-Gurin (BCG) Mycobacterium bovis cell.

8. The mutant Mycobacterium cell according to claim 6, wherein the mutant Mycobacterium cell expresses a protein that increases its immunogenicity in a host, optionally wherein the protein is a mutant Escherichia coli heat-labile toxin LT, or a mutant A subunit thereof.

9. The mutant Mycobacterium cell according to claim 6, wherein the antigens further comprise ESAT6 and/or CFP-10.

10. The mutant Mycobacterium cell according to claim 9, wherein (i) espA comprises or consists of an amino acid sequence substantially as set out in SEQ ID NO: 9, or a functional fragment or variant thereof, or is encoded by a nucleic acid sequence comprising or consisting of a nucleotide sequence substantially as set out in SEQ ID NO: 10, or a fragment or variant thereof; (ii) esxS comprises or consists of an amino acid sequence substantially as set out in SEQ ID NO: 1, or a functional fragment or variant thereof, or is encoded by a nucleic acid sequence comprising or consisting of a nucleotide sequence substantially as set out in SEQ ID NO: 2, or a fragment or variant thereof; (iii) espC comprises or consists of an amino acid sequence substantially as set out in SEQ ID NO: 7, or a functional fragment or variant thereof, or is encoded by a nucleic acid sequence comprising or consisting of a nucleotide sequence substantially as set out in SEQ ID NO: 8, or a fragment or variant thereof; (iv) MPB70 comprises or consists of an amino acid sequence substantially as set out in SEQ ID NO: 3, or a functional fragment or variant thereof, or is encoded by a nucleic acid sequence comprising or consisting of a nucleotide sequence substantially as set out in SEQ ID NO: 4, or a fragment or variant thereof; and/or (v) MPB83 comprises or consists of an amino acid sequence substantially as set out in SEQ ID NO: 5, or a functional fragment or variant thereof, or is encoded by a nucleic acid sequence comprising or consisting of a nucleotide sequence substantially as set out in SEQ ID No: 6, or a fragment or variant thereof; and/or (vi) wherein ESAT6 comprises or consists of an amino acid sequence substantially as set out in SEQ ID NO: 11, or a functional fragment or variant thereof, or is encoded by a nucleic acid sequence comprising or consisting of a nucleotide sequence substantially as set out in SEQ ID NO: 12, or a fragment or variant thereof; and/or (vii) wherein CFP10 comprises or consists of an amino acid sequence substantially as set out in SEQ ID NO: 13, or a functional fragment or variant thereof, or is encoded by a nucleic acid sequence comprising or consisting of a nucleotide sequence substantially as set out in SEQ ID NO: 14, or a fragment or variant thereof.

Description

(1) For a better understanding of the invention, and to show how embodiments of the same may be carried into effect, reference will now be made, by way of example, to the accompanying Figures, in which:

(2) FIG. 1A shows bean plot of fold changes during in vivo passage in cattle for selected gene groups and FIG. 1B Schematic representation of creating BCG TK. FIG. 1A Black lines show the medians; white lines represent individual antigenic genes; polygons represent the estimated density of the data. The grey region is a density plot of the data's distribution. Values are normalised to the median value of the All gene group. The plots were created with BoxPlotR (Spitzer, Wildenhain et al. 2014) FIG. 1B BCG TK was created by sequential gene knock out using specialized Transduction method (Bardov et al. 2002). The Phagemid used was Phae159 and the cosmids used were p0004S, pYUB854 and pANEE001 to create BCG 3043, BCG3043/BCG2897/BCG2895 (Double knock out) and BCG3043/2897/2895/3679/3680 (Triple knock out) respectively.

(3) FIGS. 2A-2B show competitive survival of selected mutants in vitro and ex vivo conditions. Competitive in vitro survival of selected mutants in FIG. 2A media and FIG. 2B bovine macrophages. Approximately equal number of WT BCG Danish and BCG knockout were mixed and used to inoculate media, infect PBMC derived bovine macrophages. Inoculants and recovered BCG were enumerated on selective media. Error bars represent standard errors.

(4) FIGS. 3A-3C show comparative analysis of body weight and survival ability of BCG TK vaccinated Guinea pigs after M. bovis challenge. FIG. 3A Schematic representation of study schedule FIG. 3B Group mean body weight profiles recorded for each group of guinea pigs during the vaccination and challenge phase of the study. Solid red vertical bar on x-axis indicates the time point of vaccination and dashed-black vertical bar on x-axis indicates time point of challenge with M. bovis. FIG. 3C Survival data of unvaccinated and vaccinated (WT BCG, BCG TK) guinea pigs up on M. bovis infection.

(5) FIGS. 4A-4B show protective efficacy of BCG TK vaccination in Guinea pigs upon M. bovis challenge. FIG. 4A The bacterial load in the lungs of WT BCG (P=0.0021) and BCG TK (P=0.0006) vaccinated guinea pigs is significantly low compared to the with the unvaccinated control group. FIG. 4B The bacterial load in spleen of WT BCG (P=0.0015) and BCG TK (P=0.0006) vaccinated guinea pigs is significantly low compared to the unvaccinated control group. Values for each individual are shown and the horizontal bar denotes the mean for each group. * P=$0.05, P=0.01, ***P=0.001.

(6) FIGS. 5A-5E show pre and post-challenge skin test reaction in BCG TK vaccinated guinea pigs. FIG. 5A Diagram to show the injection layout on animal. At least 2.5 cm between each inoculation given on the same flank. FIGS. 5B & 5C Pre-challenge skin test: The group mean size of the diameter of erythema at 24 FIG. 5B and at 48 hours FIG. 5C after injection. Post-challenge skin test: the mean size of the diameter of erythema at 24 FIG. 5D and 48 FIG. 5E hours after injection. The dotted line denotes the minimum skin test response (STR) threshold (2 mm) for DIVA antigens to consider it as positive. The x-axis denotes the vaccine group. The error bars indicate standard deviation for each vaccine group.

(7) FIG. 6 shows the cosmid map of pANEE001. The map was generated using Snap gene viewer. In this plasmid, Zeocin antibiotic cassette is flagged with MfeI and NdeI restriction sites at 3 and 5 respectively which enable the user to change the antibiotic cassette as required.

(8) FIGS. 7A-7C show the confirmation of DBCG TK genotype by PCR. FIG. 7APCR products of the expected size were obtained for the mutants with CG3043_LF_CHK_R and BCG3043_LF_F (PCR1), and using BCG3043_RF_CHK_R and CG3043_RF_R (PCR2); no products were obtained with wild type (PCRs 1 & 2). PCR over the BCG3043 gene using BCG3043_LF_F and BCG3043_RF_R further confirms the correct insertion of the Apramycine cassette (PCR3). FIG. 7BPCR products of the expected size were obtained for the mutants with MPB70/83_LF_CHK_R and MPB70/83_LF_F (PCR1), and using MPB70/83_RF_CHK_R and MPB70/83_RF_R (PCR2); no products were obtained with wild type (PCRs 1 & 2). PCR over the BCG2897/95 gene using MPB70/83_LF_F and MPB70/83_RF_R further confirms the correct insertion of the Hygromycin cassette (PCR3). FIG. 7CPCR products of the expected size were obtained for the mutants with BCG3679/80_LF_CHK_R and BCG3679/80_LF_F (PCR1), and using BCG3679/80_RF_CHK_R and BCG3679/80_RF_R (PCR2); no products were obtained with wild type (PCRs 1 & 2). PCR over the BCG3679/80 gene using BCG3679/80_LF_F and BCG3679/80_RF_R further confirms the correct insertion of the Zeocin cassette (PCR3). All PCR products were run on 1% agarose gel and imaged using a UVP gel doc machine. The schematic representations of genes are not to the scale. The empty spaces around the edges of gel images were trimmed for better representation. The untrimmed version of gel images were given below with exact same order as above images in FIG. 8.

(9) FIG. 8 shows the confirmation of DBCG TK genotype by PCR. The untrimmed version of gel images of FIG. 7 representing in the exact same order as FIG. 7.

(10) FIGS. 9A-9E show Pre- and Post-M. bovis challenge skin test at 24 h and 48 h against immunodominant antigens. FIG. 9A, 9B The size of erythema against PPD and Fusion antigens in the vaccinate guinea pigs, pre and post M. bovis challenge. FIG. 9C The size of erythema against PPD and Fusion antigens in the unvaccinated guinea pigs, pre and post M. bovis challenge. The error bars indicate standard deviation for each vaccine group.

(11) FIG. 10 shows Details of the skin test antigens. The table list the antigen components for each skin test group.

(12) FIG. 11 (table 2) shows pre-challenge & post-challenge skin testing study design

(13) (Skin-testing injection Regime). Table shows the injection for each antigen preparations (coded A-E) for each group of animals. Antigen preparation group Key-A: PPD-B, B3: ESAT6-CFP10 fusion+MPB7-83 fusion+EspC-esxS fusion (Triple fusion), C: ESAT6-CFP10 fusion, D: MPB70-83 fusion, E3: EspC-esxS fusion

(14) FIG. 12 shows ANOVA general linear model (Latin square) statistical analysis to determine the effect of skin test flank location. The # symbol denotes the statistical analysis could not generate P value as all responses were 0. NA denotes not done

(15) FIG. 13 shows skin responses induced by the triple fusion protein were also compared with those induced by a cocktail of ESAT-6/CFP10/espC (E6/C10/15c) in a small number of 6 naturally infected cattle.

EXAMPLES

(16) The inventors aimed to generate a synergistic vaccine and diagnostic approach that would permit the vaccination of cattle without interfering with the conventional PPD-based surveillance. The inventors identified genes that were essential and those that were non-essential for persistence in bovine lymph nodes. They then inactivated selected immunogenic, but non-essential genes in BCG Danish to create a diagnostic-compatible triple knock-out BCG TK strain. The protective efficacy of the BCG was tested in guinea pigs experimentally infected with M. bovis by aerosol and found to be equivalent to wild-type BCG. A complementary diagnostic skin test was developed with the antigenic proteins encoded by the deleted genes which did not cross-react in vaccinated or in uninfected guinea pigs. Thus, the inventors have demonstrated the functionality of a new and improved BCG strain which retains its protective efficacy but is diagnostically compatible with a novel DIVA skin test that could be implemented in control programmes.

Materials and Methods

(17) BCG Culture Preparation

(18) M. bovis BCG Danish 1331 (Staten's Serum Institute, batch 111013B) was grown on Middlebrook 7H11 solid media or in Middlebrook 7H9 supplemented with 0.2% glycerol, 0.05% Tween-80 and 10% OADC at 37 C. shaking at 150 rpm in an orbital shaker. When selection was required antibiotics were used at 50 g ml-1 for apramycin, 50 g ml-1 for hygromycin and 25 g ml 1 for zeocin.

(19) Construction of the recombinant cosmids containing allelic exchange substrates (AESs) Cosmid pANE001 zeomycin (FIG. 6) was derived from pYUB854 (Hyg). The original pYUB854 cosmid was modified by replacing the hygromycin resistance cassette with zeomycin cassettes. An inverse PCR of pYUB854 with primers designed to amplify plasmid backbone less the hygromycin cassette and add Nde1 and Mfe1 restriction ends. The zeomycin cassettes were amplified from pNCMTB plasmid and Nde1 and Mfe1 restriction sites added to the ends. The antibiotic cassette was then cloned into pYUB854, and confirmed by Sanger sequencing. The modified a res-MfeI-zeo-NdeI-res gene cassette flanked by multiple cloning sites (MCSs) was thus created.

(20) Construction of BCG Null Mutants

(21) Mutants were generated sequentially using the mycobacteriophage-based method of specialized transduction (Bardarov et al, 2002), and cosmids pANE001 or p0004S. Upstream (LF) and downstream (RF) sequences flanking the genes to be mutated were PCR amplified from BCG Danish genomic DNA using Qiagen High Fidelity Taq polymerase according to manufacturer's instructions, cloned into the appropriate cosmids and confirmed by Sanger sequencing to generate the knock-out plasmids p0004S3043 (Apra), pANE3679/80 (Zeo) and pYUB2897/95 (Hyg). Primer sequences are listed below:

(22) TABLE-US-00017 Zeo_casset_F SEQIDNo:16 GAACTCCAATTGATGGCCAAGTTGACCAGTGC Zeo_casset_R SEQIDNo:17 GAACTCCATATGTCAGTCCTGCTCCTCGGCCAC pYUB_inv_F SEQIDNo:18 GACATCCAATTGTCACAGCGGACCTCTATTC pYUB_inv_R SEQIDNo:19 GATCTCCATATGAACTGGCGCAGTTCCTCTGG BCG3043_RF_F SEQIDNo:20 GATCTCAAGCTTTCCTTCCAATTCGAATC BCG3043_RF_R SEQIDNo:21 GATCTCACTAGTTGGTGGCGACGAATTTC BCG3043_LF_F SEQIDNo:22 GATCTCCTTAAGCCAACCACGCCACATAC BCG3043_LF_R SEQIDNo:23 GATCTCTCTAGATGCTCGGAATGAAAAGG MPB70/83_RF_F SEQIDNo:24 GATCTCAAGCTTATGCCTCCGGCGTAATC MPB70/3_RF_R SEQIDNo:25 GATCTCACTAGTGAGCCCTGACCATTTCC MPB70/83_LF_F SEQIDNo:26 GATCTCCTTAAGGCTCGTCAGCGACGGC MPB70/83_LF_R SEQIDNo:27 GATCTCTCTAGAACCAGTGATTCGGAGTG BCG3679/80_RF_F SEQIDNo:28 GATCTCAAGCTTCCTGACCACGTTTGCTGC BCG3679/80_RF_R SEQIDNo:29 GATCTCACTAGTCGTGCTCTATTAATGCTG BCG3679/80_LF_F SEQIDNo:30 GATCTCCTTAAGTCTATCAGTAGGCGGCTAG BCG3645/46_LF_R SEQIDNo:31 GATCTCTCTAGAAACTGCGCTGCGACAATG BCG3043_RF_CHK_F SEQIDNo:32 GTCGTTGCAGAGTGCGGTGG BCG3043_LF_CHK_R SEQIDNo:33 CCAATAATGTTGAAACCCAGG MPB70/83_RF_CHK_F SEQIDNo:34 CCAGCGATTCCTTGTTG MPB70/83_LF_CHK_R SEQIDNo:35 CAAAACACGAACAAGTGAGG BCG3679/80_RF_CHK_F SEQIDNo:36 AAATCGCGTACGTGG BCG3679/80_RF_CHK_R SEQIDNo:37 GAAGTGCACGCAGTTGCC BCG3679/80_LF_CHK_F SEQIDNo:38 CAAGTTGACCAGTGCCGTTC BCG3679/80_LF_CHK_R SEQIDNo:39 CAATTGAGTCATCCAGCG
Confirmation of Mutant Construction

(23) Knockouts genotypes were confirmed by PCR using primers outside the upstream and downstream flanking regions both alone, and in combination with antibiotic cassette specific primers, such that PCR products would be obtained only if the antibiotic cassette was inserted in the required genomic location.

(24) Growth Analysis of Strains

(25) BCG wild-type and mutant strains were grown to mid-log phase (OD 0.8). The cells were then washed twice with PBS, resuspended in PBS and used to inoculate fresh to a starting OD of 0.05. Growth was analysed by taking OD readings. All analyses were performed in triplicate except where stated.

(26) In Vitro Competition Assays

(27) A mix of strains containing approximately equal amounts of the BCG TK mutant and WT BCG Danish were inoculated into broth and cultured for 14 days. At selected time points the numbers of each mutant were determined by serially diluting onto selective media. Numbers of WT BCG were estimated by subtracting the antibiotic resistant colony numbers from counts from plates without antibiotics. The assays were repeated three times.

(28) Bovine Macrophage Preparations and Infections

(29) Heparin-anticoagulated blood was collected from adult cows and peripheral blood mononuclear cells (PBMCs) isolated using Ficoll-Histopaque density gradient centrifugation from which the monocytes were isolated using CD14 MicroBeads (Miltenyi Biotec). The monocytes were differentiated into macrophages in 24 well plates containing complete RPMI supplemented with 1% sodium pyruvate, 1% penicillin/streptomycin and 20 ng ml-1 macrophage colony-stimulating factor (Miltenyi Biotec). Fresh medium was added at day 3 before being infected on day 6 at an MOI of 1 with a mixed BCG culture containing approximately equal amounts of WT BCG and BCG TK mutant. Control macrophages were incubated with culture medium only. After 4 h, the infected cells were washed three times with PBS. The intracellular bacilli were harvested by lysing the cells with 0.1% Triton X-100 at different time points. The mixed culture used for infection, and harvested intracellular bacilli were enumerated as described for the in vitro competition assay. The assays were repeated three times.

(30) Cloning and Expression of Recombinant Proteins

(31) Coding sequence of ESAT-6 and CFP-10, and of Rv3615c and Rv3020 of M. tuberculosis H37Rv were synthesized as fusion gene construct (GenScript, USA) and cloned into prokaryotic expression vector pET28a (Novagen) and transformed into E. coli BL21 DE3 cells (Invitrogen). The protein expression was induced with 1 mM IPTG over-night at 25 C. The His6 tagged ESAT-6::CFP10 and Rv3615c::Rv3020 fusion proteins were purified from the soluble fraction of the bacterial lysate using Ni-NTA agarose (immobilized metal affinity chromatography). Briefly, a 5 ml Ni-NTA agarose column was equilibrated with 10 column volumes of Tris buffered saline (TBS) and the soluble fraction of the bacterial lysate was passed through the column and the column was washed with 20 column volumes of TBS containing 50 mM imidazole and the recombinant protein was eluted using 500 mM imidazole. The pooled protein fractions were dialyzed against PBS (pH 7.4) and purity of the protein was assessed using SDS-PAGE. The protein was identified in a Western blot using anti-His6 antibody.

(32) LPS Removal from the Purified TB Antigens

(33) LPS from recombinant fusion proteins was removed using Triton X-100 as per the procedure 56. Briefly, Triton X-100 was added to the protein sample to a final concentration of 1% (v/v) and incubated at 4 C. for 1 h with continuous mixing. The sample was centrifuged at 6000 rcf for 10 min at 30 C. and the upper phase was collected without disturbing the LPS rich middle and lower phase. Triton X-100 was added again to the upper phase to a final concentration of 0.5% (v/v) and the remaining steps were repeated as mentioned above. Then, the recombinant protein was analysed in SDS-PAGE and Western blot.

(34) Guinea Pig Experiments

(35) Studies were conducted according to the United Kingdom Home Office Legislation for animal experimentation and approved by a local ethical committee at Public Health England (Porton Down, United Kingdom). Dunkin Hartley guinea pigs free from pathogen-specific infection were randomly assigned to vaccine groups and identified using subcutaneously implanted microchips (Plexx, the Netherlands) to enable blinding of the analyses wherever possible. Group sizes were determined by statistical power calculations (Minitab, version 16) performed using previous data (SD, approximately 0.5) to reliably detect a difference of 1.0 log 10 in the median number of colony-forming units (cfu) per millilitre. The guinea pigs were housed in groups of up to eight during vaccination and in pairs post-challenge. Animals were monitored daily for behavioural changes. Behaviour was evaluated for contra-indicators including body condition, lethargy and hunching.

(36) The 32 animals were divided into 4 groups (n=8). Groups 1 and 2 were vaccinated subcutaneously on the nape with 5104 cfu of either BCG TK (Group 1) or wild type BCG (Group 2) at day 0. Groups 3 and 4 remained unvaccinated. All groups received the pre-challenge skin tests at 34 days post-vaccination. Skin test responses (STR) were measured at 24 and 48 hours following inoculation with the antigens. Groups 1, 2 and 3 were challenged with M. bovis (AF2122/97) at 42 days (6 weeks) post-vaccination and received a post-challenge skin test before the scheduled cull and necropsy at 70 days (4 weeks post-challenge). Group 4 was not challenged as this was a control group to test for non-specific skin test responses. Guinea pigs in groups 1-3 were challenged by the aerosol route with a target estimated dose of 10-20 cfu of M. bovis using a contained Henderson apparatus in conjunction with an AeroMP control unit 57-59. Fine particle aerosols of M. bovis, with a mean diameter of 2 m, were generated in a Collison nebulizer and delivered directly to the snout of each animal. The AeroMP is a platform system designed to manage the aerosol generation, characterization and sampling processes via a dashboard software laptop system. Throughout the study, the body weight of each animal was measured and recorded at least weekly. The frequency of checks was increased on appearance of any clinical signs or weight loss. The humane endpoint was reached when 20% loss of maximal body weight was recorded and/or observation of defined clinical signs such as laboured breathing.

(37) The determination of bacterial load was scheduled at 4 weeks post-challenge. Guinea pigs from each group were killed and the lungs and spleens were aseptically removed and stored at 20 C. on the day of necropsy until they were processed in a single batch. On the day of tissue processing, each tissue was homogenized in 10 ml (lung) or 5 ml (spleen) sterile phosphate buffered saline (PBS). Each tissue homogenate was serially diluted in sterile PBS and 100 l of each dilution plated, in duplicate onto Middlebrook 7H11+OADC+pyruvate selective agar. Following incubation, colonies were enumerated to determine the colony forming units (cfu).

(38) Skin Testing

(39) The skin testing was performed 34 days post-vaccination prior to M. bovis challenge (pre-challenge skin test) and at 62 days post-vaccination around 4 weeks after M. bovis challenge (post-challenge skin tests). All guinea pigs, regardless of vaccination and challenge status were given PPD-B (Group A) and four specific DIVA skin test antigen preparations (Group B-E) at six separate injection sites in a Latin square formation. A diagram of the six sites for each animal (three sites on each flank) is shown in FIG. 5A. The details of the group and skin test antigen are given in FIG. 10.

(40) Each antigen cocktail was prepared prior to delivery. 100 l of each antigen preparation (2 g of PPD-B or 1 g of antigen cocktail preparation) was given to the appropriate site by the intradermal route. Each guinea pig received each of the five types of antigen preparation and a repeat of one other (on opposite flank) as described in FIG. 11. The rationale to test one preparation on both flanks of each animal was to determine whether the flank side (left or right) influenced the magnitude of the inflammatory response. The inventors didn't observe any significant difference in the magnitude of the skin test response when the same test was given in different locations or on either flank which nullify the influence of the position or flank of the skin test location on the magnitude of the inflammatory response (FIG. 12).

(41) Skin test responses were measured at 24 h and 48 h following antigen inoculation. However overall reactions were observed with the recombinant proteins. As the inventors expected that reaction sizes to recombinant proteins were lower than to PPD, based on the observations in cattle by 32 the inventors defined cut-off values for positivity for the recombinant proteins at both time points at >2 mm, and >4 mm for PPD. The size of the individual erythema reactions (if present) was measured in millimetres (mm) and the average of these values was used for analysis. Skin test data were initially analysed using an ANOVA general linear model (Latin square) statistical analysis. Group comparisons of the magnitude of skin test were performed using the non-parametric Mann-Whitney test (Minitab software version 16). A test for normality was applied to the bacterial load data and the data from each vaccine group were compared and ranked using the non-parametric Mann-Whitney test (Minitab software version 16).

Results

(42) The starting point for the inventor's experiments was the identification of genes that influence survival of BCG in the bovine lymph node. The details of these experiments are fully described elsewhere.sup.60, with the method based on the original BCG lymph node challenge model.sup.36. Briefly, a BCG Danish transposon (Tn) library was constructed and inoculated into the left and the right prescapular lymph nodes of three calves. The library was recovered from lymph nodes after 3 weeks and the input and output library pools were compared by Tn-seq to identify genes that, when inactivated by the transposon, influenced persistence in bovine lymph nodes.sup.60. Genes that did not influence persistence were thereby dispensable and therefore candidate targets for deletion to construct a BCG strain. These were identified using the TRANSIT's Resampling method analysis.sup.37. Genes in this list that encoded antigens were identified by cross-checking against a list of 500 proteins whose immunoreactivity in TB-infected cows has been already characterized.sup.38,39 to identify dispensable antigenic proteins.

(43) Five genes encoding antigens were identified as Tn mutants in the library whose fold changes during in vivo passage in cattle was between 0.5 to 2 fold (FIG. 1A), indicating that they were not essential for persistence in the bovine lymph condition, and which could be eliminated from the genome via three genome deletions. The genes were BCG3043, BCG2897, BCG2895, BCG3679 and BCG3680 which are orthologs of M. tb genes Rv3020c, MPT70, MPT83, Rv3615c and Rv3616c, respectively. Rv3020c is a member of the ESX family of virulence factors known to induce a potent cellular immune responses.sup.40. Rv3615c [Esx-1 substrate protein C (EspC)], encoded outside of RD1, is an antigen that is already part of the DIVA skin test prototyope described by Whelan et al., 201032. The MPB70 and MPB83 antigens were reported to be highly specific and sensitive for the detection of M. bovis infection in animals without any cross-reaction with Mycobacterium spp. found in the environment.sup.41-43. Lastly, Rv3616c is a CD8 antigen in mice with characteristics of the Esx family of bacterial proteins.sup.44. It is also strongly recognised by T cells from infected cattle.sup.45. The inventors therefore chose to delete these genes from BCG Danish.

(44) Construction of Modified BCG TK Vaccine

(45) All 5 antigen genes were removed using specialized transduction method.sup.46 by three sequential deletion steps each using vectors with different antibiotic cassettes for the selection of mutants at each stage (FIG. 1B) to make a triple knockout, BCG TK mutant. PCR analysis of the genetic constructs.sup.47 constructed to make the deletion mutants were all of the expected size (FIG. 11).

(46) Growth Analysis of BCG TK Mutants in Standard Growth Medium and in Bovine Macrophages

(47) To confirm that the deletion of the genes did not have any growth defect, the inventors first tested the in vitro growth kinetics of the mutant strain compared to WT BCG in a competition assay. When co-cultured with wild type BCG in 7H9 media the TK mutant did not show any loss of fitness when compared to WT (FIG. 2A). The inventors next sought to determine whether the deletion of BCG antigenic genes influenced the survival of BCG in bovine macrophages. PBMC-derived bovine macrophages were infected with the mixture (1:1) of WT BCG and the BCG TK mutant. The BCG triple mutant survived in the macrophages as well as WT BCG (FIG. 2B). This confirms that the removal of antigens does not alter the in vitro or ex vivo growth characteristics of the BCG TK strain.

(48) Protective Efficacy of BCG TK in Guinea Pigs

(49) The aerosol-infection guinea pig model of human TB and bovine TB is commonly used as a screening tool to assess the protective efficacy of vaccines.sup.48,49. M. bovis challenge of guinea pigs has also proven useful to test the potency of vaccines against bovine TB50. Groups of Dunkin Hartley guinea pigs were thereby immunised subcutaneously on the nape with either BCG TK (5104 cfu), or the wild-type BCG. Controls were unvaccinated. Protective immunity was assessed as the ability to reduce disease progression following challenge at 42 days post-vaccination (FIG. 3A) with virulent M. bovis (10-20 cfu by the aerosol route). Disease progression was assessed by weight loss, a sensitive indicator of TB in the guinea pig model. Disease burden was quantified by measurement of viable M. bovis in lungs and spleens.

(50) The uninfected controls together with all animals immunized with either BCG TK or wild-type BCG gained weight normally after challenge (FIG. 3B). Indeed, there were no significant differences in weight gain between these two groups. After 21 days post-infection, however, non-immunized, infected animals exhibited a substantial weight loss and were euthanised at a pre-defined humane end-point; whilst the weight of vaccinated guinea pigs continued to increase steadily (FIG. 3B).

(51) Although this study was not powered to measure survival, the notable difference between disease progression in vaccinated and unvaccinated animals permitted an analysis of survival (based upon time to humane end-point). The Kaplan Meier plot (FIG. 3C) shows that the vaccinated and challenged guinea pigs all survived until the end of the 4 week post-infection observation period, whereas all of the unvaccinated-challenged group had been euthanised by this time. In addition none of the animals vaccinated with either wild-type or BCG strains showed any pathological signs of clinical disease thus confirming the protective efficacies of the strain.

(52) To assess the capacity of the recombinant vaccine BCG TK to restrict the growth of M. bovis in tissues of challenged guinea pigs, the number of viable bacteria (colony forming units, cfu) in the lung, the primary site of infection, and spleen, a major site of bacterial dissemination was quantified at necropsy. The cfu data from lungs (FIG. 4A) and spleens (FIG. 4B) of challenged animals showed statistically significantly lower cfu burden in the lungs (p<0.001) and spleens (p=0.0004) of animals vaccinated with either vaccine compared to unvaccinated controls. The reductions in bacterial burden in either organ imparted by vaccination with wild-type BCG and BCG TK was indistinguishable (FIGS. 4A-4B). Together with the data demonstrating prevention of disease progression, these data on reduced bacterial burden in lungs and spleens following vaccination with either vaccine demonstrates that the deletion of the target genes from BCG TK has not reduced its protective efficacy.

(53) Skin Test Immune Response Against Extended DIVA Antigens in Guinea Pigs

(54) To test whether the antigens deleted from BCG TK could induce skin test responses in M. bovis-infected guinea pigs, but not in vaccinated animals prior to infection, orthologs of the genes deleted from BCG TK:esxS (BCG3043), MPB70 (BCG2897), MPB83 (BCG2895), espC were prepared as three different fusion proteins (ESAT-6-CFP-10, MPB70-MPB83, espC-esxS). These were tested alone, or in combination, as synthetic antigen cocktails.

(55) Groups of guinea pigs were vaccinated as above with WT BCG, and BCG TK, or left as unvaccinated controls, and subsequently challenged with M. bovis. Skin tests were performed on all animals post-vaccination to determine specificities, and also performed post-infection to determine sensitivities of the test reagents. The following antigen preparations were injected in a Latin Square arrangement 51 in the sites shown in FIG. 5A: PPD-B, fusion proteins of ESAT6-CFP10, MPB70 and MPB83, espC and esxS. A cocktail of all of these three fusion proteins (Triple antigen cocktail) was also tested.

(56) The groups of animals vaccinated with WT BCG or BCG TK gave no skin reactions (measured at 24 h and 48 h post inoculation) pre-challenge to any of the DIVA antigen cocktails. As expected, injection of the standard PPD-B skin test reagent gave rise to reactions in both groups of vaccinated guinea pigs. Unvaccinated animals did not respond either to the DIVA cocktails or to PPD-B (FIG. 5B & FIG. 5C).

(57) Following M. bovis challenge of these animals, both vaccine groups, as well as the unvaccinated control group, showed consistently positive responses to PPD-B with no significant difference in response between the vaccinated and unvaccinated animals (FIGS. 5D & 5E). Challenged animals also reacted to the DIVA antigen cocktails, particularly against the triple fusion protein cocktail injection (MPB70-MPB83, ESAT-6-CFP10 and espC-esxS) at the 24 h and 48 h measuring time point (FIGS. 5D & 5E). Unvaccinated animals showed response to PPD-B and the antigen cocktails only after M. bovis challenge. Only 24h skin-test reactions are shown for animals in this group as they had reached the humane end point. Importantly, the antigen cocktails distinguished between BCG and M. bovis exposure with skin test reactions occurring only in challenged animals irrespective of their immunization status (FIG. 12).

(58) Skin Test Immune Response Against Extended DIVA Antigens in Naturally-Infected Cattle Skin responses induced by the triple fusion protein were also compared with those induced by a cocktail of ESAT-6/CFP10/Rv3615c (E6/C10/15c) in a small number of 6 naturally infected cattle. As FIG. 13 shows, the triple fusion induced stronger responses (Mean=5.7 mm), compared to E6/C10/150 DIVA skin test reagent [Srinivasan S, Jones G, Veerasami M, Steinbach S, Holder T, Zewude A, Fromsa A, Ameni G, Easterling L, Bakker D, Juleff N. A defined antigen skin test for the diagnosis of bovine tuberculosis. Science advances. 2019 Jul. 1; 5(7): eaax4899] that generated a mean reaction size of 4 mm. Whilst reactions to the fusion protein were comparable to those of the SIT (i.e. bvobin PPD only, mean=6.5 mm), reactions to E6/C10/15c were comparable to SICCT responses (i.e. bovine PPD minus avian PPD reaction sizes, mean=3.1 mm). Thus, without being bound to any particular theory, the inventors believe that the results of this pilot experiment suggest that the performance of the status quo DIVA antigens ESAT-6, CFP-10 and espC can be enhanced by the addition of the additional ADIP proteins in the target species, cattle.
Discussion

(59) This study is the first step in a novel strategy to engineer a diagnostically compatible BCG vaccine that has similar protective efficacy to the current commercially available BCG vaccines. The inventors constructed a BCG TK strain that gave indistinguishable protection against BTB challenge as WT BCG. The inventors developed a compatible extended DIVA skin test that proved to be specific in not provoking skin reactions in vaccinated guinea pigs before challenge, but provoking reactions post-challenge. Adding additional antigens in a cocktail of 6 antigens, including the prototype DIVA antigens ESAT-6, CFP-10 and espC, alongside the triple antigen proteins (MPB70, MPB83 and esxS) led to significant increases in skin responses in all groups post-challenge whilst retaining the absence of skin test responses post-BCG vaccination prior to challenge. Similar tests in naturally-infected cattle demonstrated high sensitivity of the triple antigen protein skin test that was comparable to the standard SIT skin test and more sensitive to the state-of-the art DIVA skin test (Srinivasan S, Jones G, Veerasami M, Steinbach S, Holder T, Zewude A, Fromsa A, Ameni G, Easterling L, Bakker D, Juleff N. A defined antigen skin test for the diagnosis of bovine tuberculosis. Science advances. 2019 Jul. 1; 5(7): eaax4899.)

(60) In summary, in this study the inventors demonstrate, for the first time, a new strategy for engineering a live bacterial vaccine that has been rationally-designed to optimize both protection and diagnostic compatibility. The DIVA cocktail described here is specific and is not affected by vaccination. The development of a combination of effective vaccine and skin test reagents could transform bovine TB control programmes worldwide. Similar strategies will also be of value for control of human TB, and perhaps other infectious diseases, because the guinea pig model described herein is as good a model for human TB as it is for bovine TB.

REFERENCES

(61) 1 Brown, C. Emerging zoonoses and pathogens of public health significancean overview. Revue scientifique et technique-office international des epizooties 23, 435-442 (2004). 2 Perry, B. D. Investing in animal health research to alleviate poverty. (ILRI (aka ILCA and ILRAD), 2002). 3 Olea-Popelka, F. et al. Zoonotic tuberculosis in human beings caused by Mycobacterium bovisa call for action. The Lancet Infectious Diseases 17, e21-e25 (2017). 4 Organization, W. H. Global Tuberculosis Report 2017. (World Health Organization, 2017). 5 Organization, W. H. Roadmap for zoonotic tuberculosis. (2017). 6 Pritchard, D. A century of bovine tuberculosis 1888-1988: conquest and controversy. Journal of comparative pathology 99, 357-399 (1988). 7 Borsuk, S., Newcombe, J., Mendum, T. A., Dellagostin, O. A. & McFadden, J. Identification of proteins from tuberculin purified protein derivative (PPD) by LC-MS/MS. Tuberculosis 89, 423-430 (2009). 8 Donnelly, C. A. et al. Impact of localized badger culling on tuberculosis incidence in British cattle. Nature 426, 834 (2003). 9 Calmette, A. (SAGE Publications, 1931). 10 Horwitz, M. A new TB vaccine. Immunologist 5, 15-20 (1997). 11 Zhu, B., Dockrell, H. M., Ottenhoff, T. H., Evans, T. G. & Zhang, Y. Tuberculosis vaccines: Opportunities and challenges. Respirology 23, 359-368 (2018). 12 Horwitz, M. A., Harth, G., Dillon, B. J. & Maslea-Gali, S. A novel live recombinant mycobacterial vaccine against bovine tuberculosis more potent than BCG. Vaccine 24, 1593-1600 (2006). 13 Larsen, M. H. et al. Efficacy and safety of live attenuated persistent and rapidly cleared Mycobacterium tuberculosis vaccine candidates in non-human primates. Vaccine 27, 4709-4717 (2009). 14 Martin, C. et al. The live Mycobacterium tuberculosis phoP mutant strain is more attenuated than BCG and confers protective immunity against tuberculosis in mice and guinea pigs. Vaccine 24, 3408-3419 (2006). 15 Sayes, F. et al. CD4+ T cells recognizing PE/PPE antigens directly or via cross reactivity are protective against pulmonary Mycobacterium tuberculosis infection. PLOS pathogens 12, e1005770 (2016). 16 Arbues, A. et al. Construction, characterization and preclinical evaluation of MTBVAC, the first live-attenuated M. tuberculosis-based vaccine to enter clinical trials. Vaccine 31, 4867-4873 (2013). 17 Kaufmann, S. H. et al. Progress in tuberculosis vaccine development and host-directed therapies-a state of the art review. The Lancet Respiratory Medicine 2, 301-320 (2014). 18 Sander, P. et al. Deletion of zmp1 improves Mycobacterium bovis BCG-mediated protection in a guinea pig model of tuberculosis. Vaccine 33, 1353-1359 (2015). 19 Suazo, F. M., Escalera, A. M. a. A. & Torres, R. M. G. A review of M. bovis BCG protection against TB in cattle and other animals species. Preventive veterinary medicine 58, 1-13 (2003). 20 Chambers, M. et al. Vaccination against tuberculosis in badgers and cattle: an overview of the challenges, developments and current research priorities in Great Britain. Veterinary Record 175, 90-96 (2014). 21 Wilson, G. J., Carter, S. P. & Delahay, R. J. Advances and prospects for management of TB transmission between badgers and cattle. Veterinary microbiology 151, 43-50 (2011). 22 Vordermeier, H. M. et al. Correlation of ESAT-6-specific gamma interferon production with pathology in cattle following Mycobacterium bovis BCG vaccination against experimental bovine tuberculosis. Infection and immunity 70, 3026-3032 (2002). 23 Chaparas, S. D., Maloney, C. J. & Hedrick, S. R. Specificity of tuberculins and antigens from various species of mycobacteria. American Review of Respiratory Disease 101, 74-83 (1970). 24 Mahairas, G. G., Sabo, P. J., Hickey, M. J., Singh, D. C. & Stover, C. K. Molecular analysis of genetic differences between Mycobacterium bovis BCG and virulent M. bovis. Journal of bacteriology 178, 1274-1282 (1996). 25 Fogan, L. PPD antigens and the diagnosis of mycobacterial diseases: a study of atypical mycobacterial disease in Oklahoma. Archives of internal medicine 124, 49-54 (1969). 26 Frothingham, R., Hills, H. G. & Wilson, K. H. Extensive DNA sequence conservation throughout the Mycobacterium tuberculosis complex. Journal of Clinical Microbiology 32, 1639-1643 (1994). 27 Imaeda, T. Deoxyribonucleic acid relatedness among selected strains of Mycobacterium tuberculosis, Mycobacterium bovis, Mycobacterium bovis BCG, Mycobacterium microti, and Mycobacterium africanum. International Journal of Systematic and Evolutionary Microbiology 35, 147-150 (1985). 28 Sester, M. et al. Interferon-y release assays for the diagnosis of active tuberculosis: a systematic review and meta-analysis. European Respiratory Journal 37, 100-111 (2011). 29 Monaghan, M., Doherty, M., Collins, J., Kazda, J. & Quinn, P. The tuberculin test. Veterinary microbiology 40, 111-124 (1994). 30 Vordermeier, M., Jones, G. J. & Whelan, A. O. DIVA reagents for bovine tuberculosis vaccines in cattle. Expert review of vaccines 10, 1083-1091 (2011). 31 Vordermeier, H. M., Jones, G. J., Buddle, B. M., Hewinson, R. G. & Villarreal-Ramos, B. Bovine tuberculosis in cattle: vaccines, DIVA tests, and host biomarker discovery. Annual review of animal biosciences 4, 87-109 (2016). 32 Whelan, A. O. et al. Development of a skin test for bovine tuberculosis for differentiating infected from vaccinated animals. Journal of clinical microbiology 48, 3176-3181 (2010). 33 Vordermeier, H. et al. Development of diagnostic reagents to differentiate between Mycobacterium bovis BCG vaccination and M. bovis infection in cattle. Clinical and diagnostic laboratory immunology 6, 675-682 (1999). 34 Vordermeier, H. M., Sidders, B., Stoker, N. G. & Ewer, K. (Google Patents, 2014). 35 Weir, R. E. et al. Persistence of the immune response induced by BCG vaccination. BMC infectious diseases 8, 9 (2008). 36 Villarreal-Ramos, B. et al. Development of a BCG challenge model for the testing of vaccine candidates against tuberculosis in cattle. Vaccine 32, 5645-5649 (2014). 37 DeJesus, M. A., Ambadipudi, C., Baker, R., Sassetti, C. & Ioerger, T. R. TRANSIT-a software tool for Himari TnSeq analysis. PLOS computational biology 11, e1004401 (2015). 38 Flower, D. R. & Perrie, Y. in Immunomic Discovery of Adjuvants and Candidate Subunit Vaccines (eds Darren R. Flower & Yvonne Perrie) 1-11 (Springer New York, 2013). 39 Vordermeier, M., Jones, G. J., Sampson, S. & Gordon, S. V. in Immunomic Discovery of Adjuvants and Candidate Subunit Vaccines (eds Darren R. Flower & Yvonne Perrie) 73-90 (Springer New York, 2013). 40 Mahmood, A. & Arora, A. G. Characterization of RD1 related secretory protein(s) from Mycobacterium tuberculosis H37Rv, (2015). 41 Harboe, M. & Nagai, S. MPB70, a unique antigen of Mycobacterium bovis BCG. American review of respiratory disease 129, 444-452 (1984). 42 Surujballi, O. et al. Sensitive diagnosis of bovine tuberculosis in a farmed cervid herd with use of an MPB70 protein fluorescence polarization assay. Canadian Journal of Veterinary Research 73, 161 (2009). 43 Harrington, N. P. Immune Responses of Deer (Cervus elaphus) to Mycobacterium Bovis Infection: Potential for Immunodiagnostics. (ProQuest, 2006). 44 Nayak, K. et al. Identification of novel Mycobacterium tuberculosis CD4 T-cell antigens via high throughput proteome screening. Tuberculosis 95, 275-287 (2015). 45 Mustafa, A. et al. Immunogenicity of Mycobacterium tuberculosis antigens in Mycobacterium bovis BCG-vaccinated and M. bovis-infected cattle. Infection and immunity 74, 4566-4572 (2006). 46 Bardarov, S. et al. Specialized transduction: an efficient method for generating marked and unmarked targeted gene disruptions in Mycobacterium tuberculosis, M. bovis BCG and M. smegmatis. Microbiology 148, 3007-3017 (2002). 47 Williams, K. J. et al. The Mycobacterium tuberculosis-oxidation genes echA5 and fadB3 are dispensable for growth in vitro and in vivo. Tuberculosis 91, 549-555 (2011). 48 Clark, S., Hall, Y. & Williams, A. Animal models of tuberculosis: guinea pigs. Cold Spring Harbor perspectives in medicine 5, a018572 (2015). 49 McMurray, D. N. in Tuberculosis 135-147 (American Society of Microbiology, 1994). 50 Clark, S. et al. Assessment of different formulations of oral Mycobacterium bovis Bacille Calmette-Gurin (BCG) vaccine in rodent models for immunogenicity and protection against aerosol challenge with M. bovis. Vaccine 26, 5791-5797 (2008). 51 Bradley, J. V. Complete counterbalancing of immediate sequential effects in a Latin square design. Journal of the American Statistical Association 53, 525-528 (1958). 52 Waters, W. R., Palmer, M. V., Buddle, B. M. & Vordermeier, H. M. Bovine tuberculosis vaccine research: historical perspectives and recent advances. Vaccine 30, 2611-2622 (2012). 53 Berggren, S. Field experiment with BCG vaccine in Malawi. British Veterinary Journal 137, 88-94 (1981). 54 Francis, J. Bovine Tuberculosis Including A Contras With Human Tuberculisis. (Staples Press Limited Cavendish Place, London W, 1947). 55 Rodrigues, L. C. & Smith, P. G. Tuberculosis in developing countries and methods for its control. Transactions of the Royal Society of Tropical Medicine and Hygiene 84, 739-744 (1990). 56 Veerasami, M. et al. Multi-antigen print immunoassay for seroepidemiological surveillance of bovine tuberculosis on Indian cattle farms. Veterinaria italiana 48, 253-267 (2012). 57 Clark, S., Hall, Y., Kelly, D., Hatch, G. & Williams, A. Survival of Mycobacterium tuberculosis during experimental aerosolization and implications for aerosol challenge models. Journal of applied microbiology 111, 350-359 (2011). 58 Hartings, J. M. & Roy, C. J. The automated bioaerosol exposure system: preclinical platform development and a respiratory dosimetry application with nonhuman primates. Journal of pharmacological and toxicological methods 49, 39-55 (2004). 59 Williams, A., Davies, A., Marsh, P. D., Chambers, M. A. & Hewinson, R. G. Comparison of the protective efficacy of bacille calmette-Guerin vaccination against aerosol challenge with Mycobacterium tuberculosis and Mycobacterium bovis. Clinical infectious diseases 30, S299-S301 (2000). 59 Mendum, T., Chandran, A. et al. Transposon libraries identify novel Mycobacterium bovis BCG genes involved in the dynamic interactions required for BCG to persist during in vivo passage in cattle. BMC Genomics (Accepted)