Modified microorganism of genus <i>Corynebacterium</i> producing L-glutamic acid and method for producing L-glutamic acid using same

12492417 ยท 2025-12-09

Assignee

Inventors

Cpc classification

International classification

Abstract

The present invention relates to a Corynebacterium sp. mutant microorganism producing L-glutamic acid and a method of producing L-glutamic acid using the same, and more specifically, to a novel biotin-protein ligase variant involved in the L-glutamic acid biosynthetic pathway, a polynucleotide, and a transformant, as well as a method of producing L-glutamic acid using the same. The biotin-protein ligase variant according to the present invention is obtained by substituting one or more amino acids in the amino acid sequence constituting biotin-protein ligase to change the enzymatic activity of the biotin-protein ligase, and a recombinant microorganism comprising the biotin-protein ligase variant is capable of efficiently producing L-glutamic acid.

Claims

1. A Corynebacterium sp. microorganism transformant, having increased ability to produce L-glutamic acid compared to that of the parent microorganism, comprising a biotin-protein ligase variant consisting of the amino acid sequence of SEQ ID NO: 2 or a polynucleotide encoding the variant.

2. The transformant of claim 1, wherein the polynucleotide comprises the nucleotide sequence of SEQ ID NO: 1.

3. A method for producing L-glutamic acid, comprising steps of: culturing the transformant of claim 1 in a medium; and recovering L-glutamic acid from the transformant or the medium in which the transformant has been cultured.

Description

BRIEF DESCRIPTION OF DRAWINGS

(1) FIG. 1 shows the structure of plasmid pK19msb according to one embodiment of the present invention.

MODE FOR INVENTION

(2) Hereinafter, the present invention will be described in more detail. However, this description is merely presented by way of example to facilitate the understanding of the present invention, and the scope of the present invention is not limited by this exemplary description.

Example 1. Construction of Vector for Expression of Biotin-Protein Ligase Variant

(3) A vector for expression of a variant having a substitution of methionine (M) for valine (V) at position 140 in the amino acid sequence of biotin-protein ligase (SEQ ID NO: 4) was constructed.

(4) Using the gDNA of wild-type Corynebacterium glutamicum ATCC13869 as a template, PCR reactions were performed using a primer pair of primer 1 and primer 2 and a primer pair of primer 3 and primer 4, respectively. Thereafter, using a mixture of the two PCR products as a template, overlapping PCR was performed using primer 1 and primer 4 to obtain a fragment. Here, Takara PrimeSTAR Max DNA polymerase was used as polymerase, and PCR amplification was performed under the following conditions: denaturation at 95 C. for 5 min, and then 30 cycles, each consisting of 95 C. for 30 sec, 58 C. for 30 sec, and 72 C. for 1 min and 30 sec, followed by reaction at 72 C. for 5 min. A pK19msb vector was treated with smaI and ligated with the PCR product (fragment) obtained above, and the resulting plasmid was named pK_birA (V140M).

(5) The primer sequences used for vector construction are as shown in Table 1 below.

(6) TABLE-US-00001 TABLE1 Primer SEQID name NO. Primersequence(5.fwdarw.3) Primer1 6 CGATGAAGGAGCCCTCATCG Primer2 7 GTGGCTTCCATCAGGATGCC Primer3 8 GGCATCCTGATGGAAGCCAC Primer4 9 CCTAAGACCAGGGTGTTTCGCC

Example 2. Construction of Mutant Strain into which Biotin-Protein Ligase Variant has been Introduced

(7) Corynebacterium glutamicum U3 (KCCM13218P) was used as a parent strain into which the biotin-protein ligase variant was to be introduced, and an electrocompetent cell preparation method, a modification of the method of van der Rest et al., was used as a method for transformation of the U3 strain.

(8) First, the U3 strain was primarily cultured in 100 mL of 2YT medium (containing 16 g/l of tryptone, 10 g/l of yeast extract, and 5 g/l of sodium chloride) supplemented with 2% glucose, thus preparing a seed culture. Thereafter, isonicotinic acid hydrazine at a concentration of 1 mg/ml and 2.5% glycine were added to 100 ml of 2YT medium free of glucose, and the seed culture was inoculated into the 2YT medium to reach an OD.sub.610 value of 0.3, and then cultured at 18 C. and 180 rpm for 12 to 16 hours so that the OD.sub.610 value reached 1.2 to 1.4. The culture was kept on ice for 30 minutes, and then centrifuged at 4,000 rpm at 4 C. for 15 minutes. Thereafter, the supernatant was discarded and the precipitated U3 strain was washed 4 times with a 10% glycerol solution and finally re-suspended in 0.5 ml of a 10% glycerol solution, thereby preparing competent cells. Electroporation was performed using a Bio-Rad electroporator. The prepared competent cells and the pK_birA (V140M) vector were placed in an electroporation cuvette (0.2 mm), and then subjected to electroporation under conditions of 2.5 kV, 200 and 12.5 F. Immediately after completion of the electroporation, 1 ml of a regeneration medium (containing 18.5 g/l brain heart infusion and 0.5 M sorbitol) was added to the cells which were then heat-treated at 46 C. for 6 minutes. Next, the cells were cooled at room temperature, transferred into a 15-ml cap tube, incubated at 30 C. for 2 hours, and plated on a selection medium (containing 5 g/l tryptone, 5 g/l NaCl, 2.5 g/l yeast extract, 18.5 g/l brain heart infusion powder, 15 g/l agar, 91 g/l sorbitol, and 20 g/l kanamycin). The cells were cultured at 30 C. for 72 hours, and the generated colonies were cultured in BHI medium until the to induce secondary stationary phase recombination. Then, the cells were diluted to 10.sup.5 to 10.sup.7, and plated on an antibiotic-free 2YT plate medium (containing 10% sucrose), and a strain having no kanamycin resistance and grown on the medium containing 10% sucrose was selected and named BRA1.

Experimental Example 1. Evaluation of L-Glutamic Acid Productivity of Mutant Strain into which Biotin-Protein Ligase Variant has been Introduced

(9) L-glutamic acid productivity was compared between the parent strain U3 and the mutant strain BRA1 into which the biotin-protein ligase variant has been introduced.

(10) Each strain (parent strain or mutant strain) was inoculated at 18 by volume into a 100-mL flask containing 10 mL of the medium for glutamic acid production shown in Table 2 below, and cultured with shaking at 200 rpm at 30 C. for 48 hours. After completion of the culturing, the concentration of L-glutamic acid in the medium was measured using HPLC (Agilent), and the results are shown in Table 3 below.

(11) TABLE-US-00002 TABLE 2 Component Content Glucose 70 g/L (NH.sub.4).sub.2SO.sub.4 5 g/L MgSO.sub.4 0.4 g/L Urea 2 g/L Soybean hydrolyzate 1.5% v/v KH.sub.2PO.sub.4 1.0 g/L FeSO.sub.4 10 mg/L MnSO.sub.4 10 mg/L Thiamine_HCl 200 ug/L biotin 2 ug/L CaCO.sub.3 5%

(12) TABLE-US-00003 TABLE 3 L-glutamic acid production Strain (g/L) U3 10.5 BRA1 11.8

(13) As shown in Table 3 above, it was confirmed that the amount of L-glutamic acid produced by the mutant strain into which the biotin-protein ligase variant has been introduced increased by about 12.48 compared to that produced by the parent strain. These results suggest that the carbon source flux in the glutamic acid biosynthetic pathway is increased by the biotin-protein ligase variant, thereby increasing L-glutamic acid productivity.

(14) So far, the present invention has been described with reference to the preferred embodiments. Those of ordinary skill in the art to which the present invention pertains will appreciate that the present invention may be embodied in modified forms without departing from the essential characteristics of the present invention. Therefore, the disclosed embodiments should be considered from an illustrative point of view, not from a restrictive point of view. The scope of the present invention is defined by the claims rather than the foregoing description, and all differences within the scope equivalent thereto should be construed as being included in the present invention.

Accession Number

(15) Depository Authority: Korean Culture Center of Microorganisms (KCCM) Accession Number: KCCM13218P Deposit Date: Jun. 29, 2022