WHEAT HAPLOID INDUCER PLANT AND USES

Abstract

The invention relates to a wheat haploid inducer plant comprising at least one cell which presents inhibition of the expression of the three NLD genes of genome A, B and D, and at least one dominant or semi-dominant genetic marker, wherein said genetic marker produces, a detectable phenotype, as well as methods of uses.

Claims

1. A wheat haploid inducer plant comprising at least one cell which presents inhibition of expression of three NLD genes of genomes A, B and D, wherein the NLD genes of genomes A, B and D present at least 95% identity with SEQ ID NO: 3, 4 and 9 respectively, and at least one dominant or semi-dominant genetic marker, wherein the genetic marker produces, by itself or in complementation with another gene, a phenotype that can be detected.

2. The wheat haploid inducer plant of claim 1, wherein the plant comprises at least two different genetic markers from two different marker systems.

3. The wheat haploid inducer plant of claim 1, wherein the genetic marker is selected from a dominant or semi-dominant visual genetic marker, a gene modifying morphology of the plant, a genetic marker producing a phenotype when combined with another genetic marker, and an inducible genetic marker.

4. The wheat haploid inducer plant of claim 1 comprising at least a mutation in one of the NLD genes of genomes A, B and D that results in a frameshift in a coding sequence.

5. The wheat haploid inducer plant of claim 4, wherein the frameshift is in exon 4 of the NLD gene.

6. The wheat haploid inducer plant of claim 1, wherein inhibition of the expression of the NLD genes has been is obtained by site directed mutagenesis, chemical mutagenesis, physical mutagenesis of the genes, and/or introduction of a RNAi construct against the NLD genes in the genome of the plant.

7. A method for identifying the wheat haploid inducer plant of claim 1 comprising detecting mutations of the NLD genes, and/or presence of a vector inhibiting expression of the NLD genes, and the presence of the dominant or semi-dominant genetic marker, which is able to produce by itself or in complementation with another gene, a phenotype that can be detected, in the A, B or D genomes of a wheat plant.

8. A method for quality control of seed lots comprising wheat haploid inducer lines according to claim 1 comprising: (a) taking a sample of seeds from a seed lot comprising wheat haploid inducer lines; (b) conducting molecular analyses to identify and quantify a presence of haploid inducer or non-inducer alleles, and of the genetic marker; (c) deducing from (b) a genetic purity value of the lot for haploid inducer character.

9. A method for obtaining the plant of claim 1 comprising (a) introducing into a genome of at least one cell of a wheat plant at least one mutation in one NLD gene of one of the A, B or D genomes and/or a genetic construct inhibiting expression of one NLD gene leading to a plant having a modified genome, and presenting inhibition of the NLD genes on the A, B and D genomes, and (b) introducing at least one genetic marker system in the genome of a cell of the wheat plant if the marker is not already present, and (c) obtaining a wheat plant comprising at least one cell which presents inhibition of the expression of the three NLD genes of its genomes and the genetic marker system.

10. A method for inducing haploid progeny comprising pollinating a female wheat plant with the wheat plant of claim 1.

11. The wheat haploid inducer plant of claim 1, further comprising in its genome one or more expression cassettes comprising at least one gene encoding for a nuclease capable of modifying the genome.

12. The wheat haploid inducer plant of claim 11, wherein the nuclease is a CRISPR-Cas, and wherein the plant further comprises an expression cassette comprising a polynucleotide targeting one or several specific loci of interest in the wheat plant's genome to induce a CRISPR-Cas-mediated genome modification.

13. A method for genetically modifying a genome of a wheat plant comprising pollinating a second plant with pollen of the wheat haploid inducer plant of claim 11.

14. A method for identifying a haploid wheat plant within a wheat plant population comprising selecting a plant from the wheat plant population which does not present a phenotype associated with the genetic marker, wherein the wheat plant population consists of plants obtained after cross of the wheat haploid inducer plant of claim 1 as a pollen provider and of another wheat plant as a female plant.

15. The wheat haploid inducer plant of claim 3 comprising at least a mutation in one of the NLD genes of genomes A, B and D that results in a frameshift in a coding sequence.

16. The wheat haploid inducer plant of claim 15, wherein the frameshift is in exon 4 of the NLD gene.

17. The wheat haploid inducer plant of claim 16, wherein inhibition of the expression of the NLD genes is obtained by site directed mutagenesis, chemical mutagenesis, physical mutagenesis of the genes, and/or introduction of a RNAi construct against the NLD genes in the genome of the plant.

18. The wheat haploid inducer plant of claim 17, further comprising in its genome one or more expression cassettes comprising at least one gene encoding for a nuclease capable of modifying the genome.

19. The wheat haploid inducer plant of claim 18, wherein the nuclease is a CRISPR-Cas, and wherein the plant further comprises an expression cassette comprising a polynucleotide targeting one or several specific loci of interest in a genome of the wheat plant to induce a CRISPR-Cas-mediated genome modification.

20. The wheat haploid inducer plant of claim 1, wherein the genetic marker is selected from a gene involved in anthocyanin biosynthesis, a component of a system inducing hybrid necrosis when combined and a gene inducing pre-harvest sprouting in specific conditions.

Description

BRIEF DESCRIPTION OF THE FIGURES

[0159] FIG. 1 shows the alignment of maize Not Like Dad (NLD) protein (ZmNLD_GRMZM2G471240, SEQ ID NO: 2) with Wheat putative orthologs. TaNLD-like 4AS (SEQ ID NO: 6), TaNLD-like 4DL (SEQ ID NO: 7), TaNLD-like_4BL 3′ (SEQ ID NO: 8), TaNLD-like_BL_Cadenza (SEQ ID NO: 10) with the consensus sequence (SEQ ID NO: 83)

[0160] FIG. 2 shows the expression pattern of Wheat NLD-like genes. RNAseq data was obtained from the IWGSC. Most expression is seen in spikes at the Zadock 65 stage. All 3 NLD orthologs appear to be expressed.

[0161] FIG. 3 shows the C-terminal protein alignments of ZmNLD and TaNLDs with the haploid inducer mutated protein ZmNLD-PK6 from maize inducer line PK6. The sequences are parts of the following sequences from the sequence listing: TaNLD-like 4AS (SEQ ID NO: 6), TaNLD-like 4DL (SEQ ID NO: 7), TaNLD-like_BL_Cadenza (SEQ ID NO: 10), ZmNLD_GRMZM2G471240 (SEQ ID NO: 2), ZmNLD-PK6 (SEQ ID NO: 33)

[0162] FIG. 4 shows the position of the target sequence of the designed LbCpf1 RNA guides. The crRNA PAM TTTA lies on the reverse strand 13 bp downstream of the A residue (in bold) which is the equivalent position in the ZmNLD-PK6 gene where the frameshift occurs. A 23 bp sequence is used as a target. TaNLD_4AS_Fielder_exon4 (SEQ ID NO: 84), TaNLD_4BL_Fielder_exon4 (SEQ ID NO: 85), TaNLD_4DL_Fielder_exon4 (SEQ ID NO: 86), Consensus (SEQ ID NO: 87), target TTTN_AS+DL (SEQ ID NO: 88), target TTTN_BL (SEQ ID NO: 89).

[0163] FIG. 5 shows the construct pBIOS11170 T-DNA region for editing of the NLD gene with LbCpf1

[0164] FIG. 6 shows the summary of the number of mutations found in T0 plantlets

[0165] FIG. 7 shows the alignment of wildtype and mutant TaNLD nucleotide sequences around the targeted region in exon4. The sequences are parts of the following sequences from the sequence listing: TaNLD_4AS_Fielder_exon4 (SEQ ID NO: 11), TaNLD_4AS_Fielder_exon4_del8bp (SEQ ID NO: 21), TaNLD_4BL_Fielder_exon4 (SEQ ID NO: 13), TaNLD_4BL_Fielder_exon4_del11 bp (SEQ ID NO: 23), TaNLD_4BL_Fielder_exon4_del26 bp (SEQ ID NO: 25), TaNLD_4DL_Fielder_exon4 (SEQ ID NO: 12), TaNLD_4DL_exon4_del7 bp (SEQ ID NO: 27), TaNLD_4DL_exon4_del8bp (SEQ ID NO: 29), TaNLD_4DL_exon4_del20 bp (SEQ ID NO: 31).

[0166] FIG. 8 shows the alignment of wildtype and mutant TaNLD exon 4 protein sequences. The sequences are parts of the following sequences from the sequence listing: TaNLD_4AS_exon4 (SEQ ID NO: 14), TaNLD_4AS_exon4_del8bp (SEQ ID NO: 22), TaNLD_4BL_exon4 (SEQ ID NO: 16), TaNLD_4BL_exon4_del11 bp (SEQ ID NO: 24), TaNLD_4BL_exon4_del26 bp (SEQ ID NO: 26), TaNLD_4DL_exon4 (SEQ ID NO: 15), TaNLD_4DL_exon4_del7 bp (SEQ ID NO: 28), TaNLD_4DL_exon4_del8bp (SEQ ID NO: 30), TaNLD_4DL_exon4_del20 bp (SEQ ID NO: 32)

[0167] FIG. 9 shows the alignment of wildtype and mutant Genome D TaNLD nucleotide sequences around the targeted region in exon4. The sequences are parts of the following sequences from the sequence listing: TaNLD_4DL_Fielder_exon4 (SEQ ID NO: 12), TaNLD_4DL_Fielder_N1del_exon4 (SEQ ID NO: 34), TaNLD_4DL_Fielder_N2del_exon4 (SEQ ID NO: 35), TaNLD_4DL_Fielder_N4del_exon4 (SEQ ID NO: 36), TaNLD_4DL_Fielder_N5del_exon4 (SEQ ID NO: 37), TaNLD_4DL_Fielder_N6del_exon4 (SEQ ID NO: 38), TaNLD_4DL_Fielder_N7del_exon4 (SEQ ID NO: 39), TaNLD_4DL_Fielder_N9*del_exon4 (SEQ ID NO: 40)

[0168] FIG. 10 shows the alignment of wildtype and mutant genome D TaNLD exon 4 protein sequences. The sequences are parts of the following sequences from the sequence listing: TaNLD_4DL_exon4 (SEQ ID NO: 15), TaNLD_4DL_Fielder_N1del_exon4 (SEQ ID NO: 41), TaNLD_4DL_Fielder_N2del_exon4 (SEQ ID NO: 42), TaNLD_4DL_Fielder_N4del_exon4 (SEQ ID NO: 43), TaNLD_4DL_Fielder_N5del_exon4 (SEQ ID NO: 44), TaNLD_4DL_Fielder_N6del_exon4 (SEQ ID NO: 45), TaNLD_4DL_Fielder_N7del_exon4 (SEQ ID NO: 46), TaNLD_4DL_Fielder_N9*del_exon4 (SEQ ID NO: 47)

[0169] FIG. 11 shows the construct pBIOS11489 T-DNA region for editing of the NLD gene with SpCas9

[0170] FIG. 12 shows the alignment of wildtype and mutant TaNLD exon 4 sequences from Cas9-derived plant B0183691. The sequences are parts of the following sequences from the sequence listing: TaNLD_4AS_exon4 (SEQ ID NO: 14), TaNLD_4AS_Fielder_exon4_+1_B0183691 (SEQ ID NO: 58), TaNLD_4BL_exon4 (SEQ ID NO: 16), TaNLD_4BL_Fielder_exon4_+1_B0183691 (SEQ ID NO: 59), TaNLD_4DL_exon4 (SEQ ID NO: 15), TaNLD_4DL_Fielder_exon4_+1_B0183691 (SEQ ID NO: 60).

[0171] FIG. 13 shows alignment of wildtype and mutant TaNLD exon 4 sequences from Cas9-derived plant B0183700. The sequences are parts of the following sequences from the sequence listing: TaNLD_4AS_exon4 (SEQ ID NO: 14), TaNLD_4AS_Fielder_exon4_del1_B0183700 (SEQ ID NO: 62), TaNLD_4AS_Fielder_exon4_del4_B0183700 (SEQ ID NO: 63), TaNLD_4BL_exon4 (SEQ ID NO: 16), TaNLD_4BL_Fielder_exon4_del4_B0183700 (SEQ ID NO: 64), TaNLD_4DL_exon4 (SEQ ID NO: 15), TaNLD_4DL_Fielder_exon4_CtoA_B0183700 (SEQ ID NO: 61), TaNLD_4DL_Fielder_exon4_del4_B0183700 (SEQ ID NO: 65)

[0172] An embodiment of the invention will be described in detail in the following examples. All genes, constructs, plants described in these examples are part of the invention.

EXAMPLES

Example 1: Identification of Wheat Orthologs of Maize not Like Dad (NDL)

[0173] Putative orthologs of the maize B73 NLD gene (GRMZM2G471240) SEQ ID NO: 1 (WO_2016_177887, Gilles et al. (2017)) were identified by TBLASTN analysis of the Chinese Spring wheat genome sequence using the maize line B73 ZmNLD protein (SEQ ID NO: 2) as the query sequence. The best matching sequences were on chromosomes 4AS, 4DL and 4BL (SEQ ID NO: 3, SEQ ID NO: 4 and SEQ ID NO: 5). The predicted protein sequences are respectively SEQ ID NO: 6, SEQ ID NO: 7 and SEQ ID NO: 8. The 4BL genomic sequence is incomplete lacking the 5′ region of the coding sequence such that it starts in exon 2. A complete genomic sequence for the 4BL homolog was identified from a genomic sequence of the variety Cadenza (SEQ ID NO: 9) and the predicted protein sequence is SEQ ID NO: 10. An alignment of the predicted wheat sequences with ZmNLD is shown in FIG. 1. TaNLD-like 4AS has 75.2% identity with ZmNLD, TaNLD-like_4DL, 74.8% identity and TaNLD-like_4BL Cadenza, 74.8% identity.

[0174] The ZmNLD gene is known to be expressed specifically in reproductive tissues; in the pollen from the bicellular stage with expression continuing in the pollen tube. It is expected that true wheat orthologs of NLD would have a similar pattern of expression. Wheat RNAseq data showed that indeed all three potential orthologs were expressed almost exclusively in reproductive tissues (late developing spike) (FIG. 2).

[0175] RNAseq data was obtained from the IWGSC (International Wheat Genome Sequencing Consortium). Most expression is seen in spikes at the Zadock 65 stage. All 3 NLD orthologs appear to be expressed.

Example 2: Creation of Maize NLD-PK6-Like Mutations in Wheat NLD-Like Genes of the Variety Fielder Using CRISPR

[0176] From the expression data in FIG. 2 it appears that all of the 3 identified genome copies of TaNLD are expressed. Thus, in order to phenocopy the maize NLD haploid inducer phenotype it may be necessary to mutate all 3 genes. In this example the objective is to create wheat mutations that are very similar to the NLD maize mutation which is the result of a frameshift at the 3′ end of the gene (WO_2016_177887, Gilles et al. (2017)). The site of the frameshift appears to remove a C-terminal part in the truncated NLD-PK6 protein, from maize haploid inducer line PK6, such that the protein is no longer attached to the plasma membrane (Gilles et al. (2017)). The frameshift is after the G 379 residue of the ZmNLD protein. This sequence is conserved in the TaNLD sequences and lies in exon 4 (FIG. 3). In order to design guide RNA sequences in the Fielder wheat variety to be used, exon 4 was amplified and sequenced from each of the three TaNLD genomic copies in Fielder using primers designed to the Chinese Spring sequences (Table 1). Primer pair A010430+A010435 (SEQ ID NO: 66-67) amplified the Fielder 4AS NLD gene and the primers pairs A010433 and A010423 (SEQ ID NO: 68-69) amplified both the Fielder 4BL and 4DL genes. The sequencing of cloned amplicons allowed the identification of the 4BL and 4DL gene sequences. Genome-specific NLD primers are shown in Table 1 (SEQ ID NO: 70-75). The exon 4 TaNLD-4AS, 4DL and 4BL Fielder sequences are shown respectively in SEQ ID NO:11, SEQ ID NO: 12 and SEQ ID NO: 13.

[0177] The CRISPR system Cpf1 was used to introduce mutations into the TaNLD genes. A conserved PAM sequence (TTTA) was found on the reverse strand of the TaNLD sequences 13 bp downstream of the A residue which is the equivalent position in the ZmNLD-PK6 gene where the frameshift occurs (FIG. 4). Two 23 bp sequences were used as a target, one sequence is identical to the NLD 4AS and 4DL genes (SEQ ID NO: 80 5′ CCTCCTCGTACCTCCCGGTCTCG 3′) and the other identical to the 4BL sequence (SEQ ID NO: 81 5′ TCTCCTCGTACCTCCCGGTCTCC 3′). The two sequences differ by 2 bp. A binary plant transformation construct (pBIOS11170 FIG. 5) was made that contained a Lachnospiraceae bacterium ND2006 Cpf1 gene with a C-terminal NLS and HA epitope TAG (Zetsche et al., 2015) encoding the protein SEQ ID NO: 17, expressed from the constitutive maize Ubiquitin promoter plus 5′UTR (SEQ ID NO: 18). The construct also contained a wheat U6 promoter (SEQ ID NO: 19) driving the expression of a crRNA containing the TaNLD-4AS or TaNLD-4DL target sequence (SEQ ID NO: 80) and a wheat U6 promoter (SEQ ID NO: 19) driving the expression of a crRNA containing the TaNLD-4BL target sequence (SEQ ID NO: 81). In addition, the construct contained a selectable marker gene (BAR) for plant transformation and a visual marker gene (ZsGreen) to aid the detection of transgenic events. FIG. 5 shows a schematic diagram of the T-DNA region of pBIOS11170 (SEQ ID NO: 20).

[0178] pBIOS11170 was transferred to the agrobacterial strain EHA105 giving the strain T10932 and transformed into Fielder using a protocol based on immature embryo transformation (Ishida et al.; 2015). The DNA sequence of the region targeted in Exon4 in transformed plantlets was amplified using primers that amplified all 3 NLD genome copies (Table 1, SEQ ID NO: 76-77). The amplicons obtained were sequenced using Next Generation Sequencing (NGS) and the sequences assigned to genomes based on NLD genome-specific SNPs in the amplicon. In primary transformants mutations were observed at the targeted sites in all targeted genes (FIG. 6) but no plant contained in-frame deletions in all three targeted genes. Selected plants with mutations were analyzed in the T1 generation.

[0179] T0 plant B0142293 contained a heterozygous 8bp deletion mutation in TaNLD_4AS after the position 425 bp in SEQ ID NO: 21. The predicted Exon4 protein sequence of this mutation is shown in SEQ ID NO: 22. Plant B0142293 also contained 2 different mutant 4BL sequences, a deletion of 11 bp after the position 421 bp in SEQ ID NO: 23, giving the predicted exon 4 protein sequence in SEQ ID NO: 24 and a deletion of 26 bp after the position 409 bp in SEQ ID NO: 25, giving the predicted exon 4 protein sequence in SEQ ID26. In the T1 generation plants were identified that were homozygous for the 4AS_8bp deletion (genotype represented as a8a8BBDD), homozygote for each of the 4BL mutations (AAb11b11DD and AAb26b26DD) and homozygote for the two double genome mutations (a8a8b11b11DD and a8a8b26b26DD). The mutations were inherited from the T0 in a mendelian fashion without any apparent segregation distortion.

[0180] T0 plant B0148740 contained a heterozygous 7 bp deletion mutation in TaNLD_4DL after the position 423 bp in SEQ ID NO: 27. The predicted Exon4 protein sequence of this mutation is shown in SEQ ID NO: 28.

[0181] T0 plant B0148773 contained a heterozygous 8bp deletion mutation in TaNLD_4DL after the position 423 bp in SEQ ID NO: 29. The predicted Exon4 protein sequence of this mutation is shown in SEQ ID NO: 30.

[0182] T0 plant B0164336 contained a homozygous 20 bp deletion mutation in TaNLD_4DL after the position 423 bp in SEQ ID NO: 31. The predicted Exon4 protein sequence of this mutation is shown in SEQ ID NO: 32.

[0183] Alignments of wildtype and mutant nucleotide sequences from exon4 are shown in FIG. 7 and those of protein sequences in FIG. 8. It can be seen that the altered protein C-terminal sequences are highly different to the wild-type sequences. All but one of the mutant proteins have a similar length to the wildtype sequences and the new C-terminal sequences have significant homology. Mutant TaNDL_4DL_del7 bp is very different in that its new C-terminal protein sequence is very short (5 amino acids compared to 46 in the TaNDL_4DL protein.

[0184] To generate all possible mutant combinations the two aabbDD lines were crossed to the three AABBdd lines. The F1 plants were selfed and the F2 plants genotyped by TaNLD genome specific PCR and sequencing. Plants that are homozygous for single, double and triple TaNLD genome mutations were retained that also can lack the Cpf1 transgene construct.

[0185] In addition to the above aabbDD×AABBdd crossing strategy aabbDD plants containing the Cpf1 transgene construct were screened for the appearance of D genome NLD mutations. 7 different D mutations were obtained (FIG. 9, DNA sequences SEQ ID NO: 34-40, and FIG. 10; predicted amino-acid sequences SEQ ID NO: 41-47), the plants selfed and triple homozygote mutant aabbdd lines identified.

TABLE-US-00001 TABLE 1 List of primers FORWARD PRIMER REVERSE PRIMER NAME DESCRIPTION SEQUENCES 5′-3′ NAME DESCRIPTION SEQUENCES 5′-3′ AMPLIFIES SIZE A_010430 FOR_4AS GACTTCACTTACGCTTCGTCAT A_010435 REV_EXON_4AS GCTTGCCGAAATAGGTA Fielder 2235 bp GAGCG GGAGG NLD 4AS A_010433 FOR_4BL GAATTAAGATCTGCCTCCTAC A_010423 REV_EXON4 GAAGCTTTCTCTACCTA Fielder 2052 bp CACAGTCG TCCCAG NLD 4BL and 4DL PP_02247_ FOR_4AS cttctccacatacgacgtatatatgc PP_02247_ RREV_4AS atgttcccagtgttctgttgtataggt Fielder 1300 bp F R NLD_4AS PP_02248_ FOR_4BL cgacgtatgctaattttatacgagg PP_02248_ REV_4BL gctagccaaagtagggatgctg Fielder 1211 bp F R NLD_4BL PP_02249_ FOR_4DL cgacgtatgccaattttatatgtataag PP_02249_ REV_4DL gatgatcgtttaaccgatgttgg Fielder 1309 bp  F R NLD_4DL PP_02255_ NGS Forw ATCCAGGACAACTCGCTCC PP_02255_ NGS Rev crRNA AGCCTTGTCCTCCTCTC Fielder 221 bp F1 cRNA R1 GTC NLD 4AS/ 4BL/4DL PP_03021_ NGS Forw gactgcggcaagttcctg PP_03021_ NGS Rev gRNA7 caccctggacaccctctg Fielder  418 bp F gRNA7 R NLD 4 AS/ 4BL/4DL

Example 3: Phenotype of TaNLD-PK6-Like Mutants

[0186] Double homozygote aabbDD and single homozygote mutant AABBdd plants when selfed had a normal seed set, however aabbdD and aabbdd mutants had a noticeable reduction seed set as measured by a fertility index (Table 2 and Table 3). The aabbdd mutants had a lower fertility index than the aabbdD mutants. It is known that the maize inducer lines have a reduction of set on selfing, this is thought to be due to endosperm genome imbalances where in some fertilization products, the endosperm lacks a paternal genome (Lin, (1984)). Such a 2n:0p endosperm has arrested development leading to kernel abortion. It is thus anticipated that wheat haploid inducer NLD mutant lines could also have reduced seed set. If so the aabbdd triple mutants but not the double aabbDD and single AABBdd mutants are likely to be inducers of haploidy. In addition, the selfed progeny of the aabbDd lines contained a significant proportion of plants in the triple homozygote progeny that were completely sterile (Table 3). This sterility might be due to the production of haploid plants which would be sterile. It is noticeable that the progeny of the aabbd8dN9* line had a higher level of sterility that the other lines. The d8 mutation is a frame shift whereas the dN9* mutation is an in-frame mutation of 4 amino acids. The low fertility index of the aabbdN9*dN9* progeny suggests that the dN9* mutation has an NLD loss of function. Thus, the aabbd8dN9* parental plant is a triple NLD homozygote mutant.

TABLE-US-00002 TABLE 2 Fertility of the aabbDd parental lines. The Fertility Index is the number of seeds per spikelet. Fertility Genotype parent Seed Spikelets Index AABB DD 329 167 2 aabb DD 620 347 1.8 aabb dN1D 209 274 0.8 aabb dN2D 247 208 1.2 aabb dN4D 90 64 1.4 aabb dN5D 115 88 1.3 aabb dN6D 111 71 1.6 aabb dN7D 76 48 1.6 aabb d8dN9* 61 123 0.5

TABLE-US-00003 TABLE 3 Fertility of the aabbDd and aabbdd progeny plants. fertility Genotype progeny Sterile fertile Total % sterile index aabb DD 0 8 8 0% 1,9 aabb dN1D 0 5 5 0% 1,1 aabb dN2D 0 5 5 0% 1,1 aabb dN4D 0 10 10 0% 1,5 aabb dN6D 0 5 5 0% 0,9 aabb dN7D 0 5 5 0% 1,1 aabb dN1dN1 1 15 16 6% 0,4 aabb dN2dN2 4 10 14 29%  0,5 aabb dN4dN4 0 3 3 0% 0,9 aabb dN5dN5 6 24 30 20%  0,7 aabb dN6dN6 3 8 11 27%  0,7 aabb dN7dN7 0 3 3 0% 0,8 aabb d8d8 5 7 12 42%  0,6 aabb dN9*dN9* 5 4 9 56%  0,6

[0187] The fertility index is calculated according to the formula:

fertility index=(number of kernels/number of spikelets) per plant

Example 4: Haploid Induction of TaNLD-PK6-Like Mutants

[0188] In order to determine if aabbDD lines are haploid inducers, pollen from the aab11b11DD and aab26b26DD lines were used to pollinate a Cytoplasmic Male Sterility (CMS) line. The CMS line used was seed from a cross of CMS line Arturnick to a fertile-non restorer spring cultivar. 114 plantlets from this CMS×NLD aabbDD cross (45 from aab11b11DD and 69 from the aab26b26DD cross) were genotyped for the NLD genome A and genome B mutations. All the plantlets were heterozygous for the NLD locus (mutant and WT alleles). Thus, the aabbDD lines used did not induce haploid production to a significant extent.

[0189] Pollen from the triple mutant lines was also used to pollinate a CMS line. In this case the CMS used was a BC1 between the CMS line Arturnick and the fertile non-restorer Fielder line. Out of 40 plantlets genotyped from this cross, 6 were wild-type for all 3 NLD mutant alleles. A set of 29 SNP markers that differentiate Arturnick from Fielder were then used to genotype the parental plants (Fielder and each CMS parent used in the cross) and the plantlets from the cross. The 6 plants that only contained wild-type alleles were homozygous for all 29 markers which strongly suggested that these plants are indeed haploid. Final confirmation was obtained by genome-wide genotyping using an 18K SNP Affymetrix array. No significant heterozygosity was observed in any of the 6 plants confirming that they are indeed haploid (Table 4). The haploid induction rate using these triple NLD mutant lines was thus 15% in this experiment (Table 4).

TABLE-US-00004 TABLE 4 Summary of Genotyping data from 18K affymetrix chip for progeny of cross of NLD triple mutant aabbdd lines to a CMS line. Progeny Haploid GENOTYPE NLD Male Parent Tested plants a8a8b26b26dN1dN1 1 0 a8a8b26b26dN2dN2 2 0 a8a8b26b26dN9dN9 2 1 a8a8b26b26d8d8 1 0 a8a8b26b26dN6dN6 14 1 a8a8b26b26dN7dN7 15 3 a8a8b26b26dN5dN5 5 1 Total 40 6

Example 5: Creation of Knockout TaNLD Mutant Lines

[0190] Instead of creating mutations in TaNLD that resemble the ZmNLD-PK6 mutation it is possible to create mutations that eliminate or mutate a larger part or all of the TaNLD genes. These mutations are likely to completely eliminate TaNLD function. A construct was designed to mutate around 134aa of the C-terminus of the TaNLD genes using the Cas9 nuclease from Streptococcus pyogenes. The target site was in a conserved sequence in exon 4. A binary plant transformation construct was made that contains the Cas9 gene with N and C-terminal NLS sequences encoding the protein SEQ ID NO: 48, expressed from the constitutive maize Ubiquitin promoter (SEQ ID NO: 18). The construct also contained a wheat U6 promoter (SEQ ID NO: 19) driving the expression of a gRNA containing the TaNLD-4AS, TaNLD-4BL and TaNLD-4DL target sequence (5′ GGCGAAGCAGTGCTCCCAGT 3′, SEQ ID NO: 82)). In addition, the construct contained a selectable marker gene (BAR) for plant transformation and a visual marker gene (ZsGreen) to aid the detection of transgenic events. FIG. 11 shows a schematic diagram of the T-DNA region (SEQ ID NO: 49). This construct was transferred to the agrobacterial strain EHA105 and transformed into Fielder using a protocol based on immature embryo transformation (Ishida et al.; 2015). The DNA sequence of the regions targeted in Exon4 in transformed plantlets was amplified using primers that amplified all 3 NLD genome copies (Table 1; SEQ ID NO: 78-79). The amplicons obtained were sequenced using Next Generation Sequencing (NGS) and the sequences assigned to genomes based on NLD genome-specific SNPs in the amplicon. Sequence analysis then identified TaNLD mutant T0 plants. Two T0 plants were retained for further analysis. Transformant B0183691 was heterozygous for mutations in each TaNLD-like gene (aAbBdD, SEQ ID NO: 50-52). A protein alignment of TaNLD exon 4 (SEQ ID NO: 58-60) is shown in FIG. 12. Plant B0183700 was heterozygous for mutations in TaNLD-like in genomes A and D and homozygous for a mutation in genome B (aAbbdD, SEQ ID NO: 53-57). A protein sequence alignment of TaNLD exon 4 (SEQ ID NO: 61-65) is shown in FIG. 13. Progeny from these selfed plants are screened to identify combinations of A, B and D genome TaNLD-like mutant T1 plants.

Example 6: Phenotype of TaNLD-Like Deletion Mutants Obtained with SpCas9

[0191] Pollen from homozygote single, double and triple Cas9-derived TaNLD mutants is used to pollinate a CMS wheat line. This wheat line is genetically different to Fielder. Seeds from these crosses are germinated and plantlets genotyped using a panel of markers. Plantlets with a genotype identical to that of the CMS female parent are derived from a haploid induction event. Table 5 shows results from genotyping F1 seed derived from a cross between the T2 progeny of line B0183700 (aabbDD, aabbdD or aabbdd), used as the male parent, and the CMS line Arturnick. The percentage of haploid plants was greatest when the male parent was triple homozygous mutant for TaNLD.

TABLE-US-00005 TABLE 5 Summary of Genotyping data from 18K affymetrix chip for progeny of cross of NLD mutant lines derived from transformant B0183700 to a CMS line. NLD Genotype Plants Haploids % Hapoids aabbDD 6 0 0% aabbdD 315 5 2% aabbdd 87 4 5%

Example 7: Delivery of Genome Editing Tools Via Wheat Nld Haploid Inducer Lines

[0192] The wheat nld haploid inducer lines can be used as a vehicle to deliver genome editing (GE) tools into a second genetic background to produce genome-edited mutants directly in that background. In this system (HILAGE or HiEDIT (WO2017004375A1)) GE tools are introduced into the HI line by crossing to a line with the GE tools and selecting for progeny that contain the GE tool and are mutant in the genome A, B and D NLD genes. Alternatively, a HI line can be retransformed with the GE tools. To demonstrate GE delivery from a wheat nld GE line, triple homozygote nld plants identified in example 5 are crossed to the CMS line Arturnick as described in example 6. These plants contain the Cas9 transgene and guide that was used to create the nld mutations in Fielder. The exon4 region from TaNLD4AS SEQ ID NO: 90, TaNLD4BL SEQ ID NO: 91 and TaNLD4DL SEQ ID NO: 92 contains the target sequence (5′ GGCGAAGCAGTGCTCCCAGT 3′, SEQ ID NO: 82). Haploid plants from the progeny of the cross between the Fielder HI line and Arturnick are identified by genotyping as described in example 4. The exon 4 region of the 3 NLD genome copies are amplified from haploids and sequenced. Arturnick haploid plants that have mutations in the NLD genes can then be identified.

Example 8: Conversion of a Colored Coleoptile Wheat Line to a Haploid Inducer Line

[0193] Wheat lines having a colored coleoptile are selected. The selection of these lines is made according to the color of the coleoptile that has to be visible and dominant. To determine if a wheat line has a colored coleoptile, a germination test is made in a growth chamber, ideally a vernalization chamber. The growth conditions are standard conditions for wheat. The coleoptile of the tested wheat line is compared to the coleoptile of a control line having a white/green coleoptile like Apache. Wheat lines having a red coleoptile are easily identified by direct observation. Six such lines, BGA-0664, BGA-0665, BGA-0666, BGA-0667, BGA-0668 and BGA-0669 were identified. BGA-0664, BGA-0665 and BGA-0668 are spring wheats, the others are winter wheats. TaNLD exon4 from the A, B and D genomes were amplified from these lines and sequenced. (SEQ ID NO: 93-110)

TABLE-US-00006 TABLE 6 Sequences of NLD genes in different wheat lines TaNLD_4AS_Exon4 TaNLD_4BL_Exon4 TaNLD_4DL_Exon4 BGA-0664 SEQ ID NO: 93 SEQ ID NO: 99 SEQ ID NO: 105 BGA-0665 SEQ ID NO: 94 SEQ ID NO: 100 SEQ ID NO: 106 BGA-0666 SEQ ID NO: 95 SEQ ID NO: 101 SEQ ID NO: 107 BGA-0667 SEQ ID NO: 96 SEQ ID NO: 102 SEQ ID NO: 108 BGA-0668 SEQ ID NO: 97 SEQ ID NO: 103 SEQ ID NO: 109 BGA-0669 SEQ ID NO: 98 SEQ ID NO: 104 SEQ ID NO: 110

[0194] In all 6 lines the target site for the Cas9 gRNA from example 5 was conserved (5′ GGCGAAGCAGTGCTCCCAGT 3′, SEQ ID NO: 82).

[0195] The shoot apical meristem is exposed from colored coleoptile line seeds and bombarded with Cas9 ribonucleoprotein (Cas9 protein and Cas9 gRNA RNA (target SEQ ID NO: 82)) according to the method described by Imai et al. 2020. Plantlets with out of frame mutations in TaNLD genome copies are identified and crossed and/or selfed to obtain progeny that are homozygous for TaNLD knockout mutations in the A, B and D genomes. These aabbdd lines (which are also homozygous for the Rc gene) are used in pollinations as males to females that have green coleoptiles. Progeny of these crosses that possess green rather than colored coleoptiles can be easily visually identified upon germination. These green coleoptile plants are haploids and are treated to double the genome according to well-known procedures (Sood et al; 2003, Niu et al; 2014, Vanous et al. 2017, Hantzschel et al. 2010, Melchinger et al. 2016, Ren 2018, Chaikam et al. 2020) to obtain fertile plants.

Example 9: Conversion of a Colored Coleoptile Wheat Line to a Haploid Inducer and a Low Palmitic Acid Seed Line

[0196] Mutations in the maize FatB Chr6 or FatB chr9 genes reduce the palmitic acid content of maize embryos (Li et al 2011, Zheng et al 2014). Palmitic acid content can thus be used as a marker to identify seeds that contain haploid embryos (or sort isolated embryos into F1 and haploid embryos) if the haploid inducer line contains a FatB loss of function mutation or mutations. F1 embryos will have a reduced Palmitic acid content compared to a haploid embryo. This early haploid marker can be also combined with the coleoptile color marker of example 8 in order to confirm haploids identified on the basis of palmitic acid content.

[0197] The maize FatB Chr6 (SEQ ID NO: 111) and Chr9 (SEQ ID NO: 112) protein sequences were used in BLASTP homology searches to identify the wheat homologs in the variety Chinese Spring. Homologs were identified on chromosome 4A (TraesCS4A02G387700) (SEQ ID NO: 113 encoded by SEQ ID NO: 114), 7A (TraesCS7A02G089000) (SEQ ID NO: 115 encoded by SEQ ID NO: 116) and 7D (TraesCS7D02G084400). (SEQ ID NO: 117 encoded by SEQ ID NO: 118). These wheat FatB protein sequences are between 80% to 82% identical to the maize FatB proteins. Primers based on the Wheat FatB Chinese Spring 4A, 7A and 7D genes were used to amplify FatB exon2 genomic sequences (containing the start ATG codon) from the wheat variety Fielder and the 6 colored coleoptile lines in example 8 ((SEQ ID NO: 119 to 139). Exon 2 sequences of TaFatB4A from lines BGA-0664, BGA-0666 and BGA-668 appear to lack 1 nucleotide compared to other sequences which may indicate that in these lines the TaFatB4A copy is inactive.

[0198] Two Cas9 gRNAs, g220r and g283r were designed to target 2 regions of TaFatB4A, 7A and 7D exon2 in all the 6 colored coleoptile lines and also in Fielder and Chinese Spring. The targeted sequence for g220r is 5′ TGTCTGAGCCTGTAGTCTTG 3′ SEQ ID NO: 140 and for g283r 5′ GCAAGAAGCATGCTCCAGTC 3′ SEQ ID NO: 141.

[0199] The shoot apical meristem is exposed from colored coleoptile line seeds and bombarded with Cas9 ribonucleoprotein (Cas9 protein, Cas9 NLD gRNA (target SEQ ID NO: 82) and Cas9 FATB gRNA RNA (SEQ ID NO: 140, SEQ ID NO: 141)) according to the method described by Imai et al. 2020. Plantlets with out of frame mutations in TaNLD and/or TaFATB genome copies are identified and crossed and/or selfed to obtain progeny that are homozygous for TaNLD knockout mutations in the A, B and D genomes and contain in addition homozygous TaFATB knockout mutations in 1, 2 or 3 genomic loci. These lines are used in pollinations as males to female lines. Seeds with high palmitic acid content in embryos, or isolated embryos with high palmitic acid levels, can be identified with a non-destructive technique such as Near Infra-Red Spectroscopy (NIRS). These high palmitic acid content seeds or isolated embryos are haploids. If the female line has a non-colored coleoptile confirmation of haploidy can be obtained by visualization of the coleoptile color of germinated seeds. Plantlets with green coleoptiles are haploids. Identified haploid embryos or plantlets are treated to double the genome according to well-known procedures (Sood et al; 2003, Niu et al; 2014, Vanous et al. 2017, Hantzschel et al. 2010, Melchinger et al. 2016, Ren 2018, Chaikam et al. 2020) to obtain fertile plants.

REFERENCES

[0200] Alsahlany M, Zarka D, Coombs J and David S. Douches D S (2019) Comparison of Methods to Distinguish Diploid and Tetraploid Potato. Applied Diploid Breeding. American Journal of Potato Research 96, pp 244-254. [0201] Amato F D, Scarascia G T, Monti L M and Bozzini, A (1962) Types and frequencies of chlorophyll mutations in Durum wheat induced by radiations and chemicals. Radiation Botany Volume 2, Issues 3-4, December 1962, Pages 217-239. [0202] Anzalone, A. V., Randolph, P. B., Davis, J. R. et al. Search-and-replace genome editing without double-strand breaks or donor DNA. Nature 576, 149-157 (2019) doi:10.1038/s41586-019-1711-4 [0203] Borrino E M and Powell W (1988) Stomatal guard cell length as an indicator of ploidy in microspore-derived plants of barley. Genome, 30(2): 158-160. [0204] Chaikam, V. et al. Analysis of effectiveness of R1-nj anthocyanin marker for in vivo haploid identification in maize and molecular markers for predicting the inhibition of R1-nj expression. Theor. Appl. Genet. 128, 159-171 (2015). [0205] Chaikam V, Martinez L, Melchinger A E, Schipprack W and Boddupalli P M (2016) Development and Validation of Red Root Marker-Based Haploid Inducers in Maize. Crop Sci. DOI: 10.2135/cropsci2015.10.0653 [0206] Chaikam, V., Molenaar, W., Melchinger, A. E. & Boddupalli, P. M. Doubled haploid technology for line development in maize: technical advances and prospects. Theor Appl Genet (2019) doi:10.1007/s00122-019-03433-x. [0207] Chaikam, V. et al. Improving the Efficiency of Colchicine-Based Chromosomal Doubling of Maize Haploids. Plants 9, 459 (2020). [0208] Chu C G, Faris J D, Friesen T L, Xu S S. (2006) Molecular mapping of hybrid necrosis genes Ne1 and Ne2 in hexaploid wheat using microsatellite markers. Theor Appl Genet. 112(7):1374-81 [0209] Coe E H (1959) A line of maize with high haploid frequency. Am Nat 93: 381-382 El-Hannawy et al, 2011. Production of doubled haploid wheat lines (Triticum aestivum L.) using anther culture technique. Annals of Agricultural Sciences. 56. 63-72. [0210] Faris J D, Zhang Z, Lu H, Lu S, Reddy L, Cloutier S, Fellers J P, Meinhardt S W, Rasmussen J B, Xu S S, Oliver R P, Simons K J, Friesen T L (2010) Proc Natl Acad Sci USA.; 107:13544-9. doi: 10.1073/pnas.1004090107 [0211] Ge, W. et al. Maize haploid recognition study based on nuclear magnetic resonance spectrum and manifold learning. Computers and Electronics in Agriculture 170, 105219 (2020). [0212] Geiger et al., Doubled haploids in hybrid maize breeding, Maydica 54(4):485-499 Gilles L M, Khaled A, Laffaire J B, Chaignon S, Gendrot G, Laplaige J, Berges H, Beydon G, Bayle V, Barret P, Comadran J, Martinant J P, Rogowsky P M, Widiez T. (2017) Loss of pollen-specific phospholipase NOT LIKE DAD triggers gynogenesis in maize. EMBO J. 36(6):707-717. doi: 10.15252/embj.201796603. [0213] Gilles et al. Haploid induction in plants, Current Biology 27, R1095-1097, 2017 Hamilton, D. A., Roy, M., Rueda, J. et al. Plant Mol Biol (1992) 18: 211-218 [0214] Ho, I Y. Wan Y, Widholm J M and Rayburn A L (1990) The Use of Stomatal Chloroplast Number for Rapid Determination of Ploidy Level in Maize. Plant Breeding 105, pp 203-210. doi.org/10.1111/j.1439-0523.1990.tb01197.x [0215] Häntzschel, K. R. & Weber, G. Blockage of mitosis in maize root tips using colchicine-alternatives. Protoplasma 241, 99-104 (2010). [0216] Hussain et al, 2012. Double Haploid Production in Wheat through Microspore Culture and Wheat×Maize Crossing System: An Overview. ijavms. 6. 10.5455/ijavms.168. [0217] Ishida Y, Tsunashima M, Hiei Y, Komari T (2015) Wheat (Triticum aestivum L.) transformation using immature embryos. Methods Mol Biol. 1223:189-98. doi: 10.1007/978-1-4939-1695-5_15 [0218] Kandala et al 2012. Analysis of Moisture Content, Total Oil and Fatty Acid Composition by NIR Reflectance Spectroscopy: A Review. Lecture Notes in Electrical Engineering. 146. 59-80. 10.1007/978-3-642-27638-5_4. [0219] Kelliher et al., 2017; MATRILINEAL, a sperm-specific phospholipase, triggers maize haploid induction. Nature 542: 105-109 [0220] Le TDQ, Alvarado C, Girousse C, Legland D, Chateigner-Boutin A L. (2019). Use of X-ray micro computed tomography imaging to analyze the morphology of wheat grain through its development. Plant Methods. 31; 15:84. doi: 10.1186/s13007 0468-y. [0221] Li L, Li H, Li Q, et al. An 11-bp insertion in Zea mays fatb reduces the palmitic acid content of fatty acids in maize grain. PLoS One. 2011; 6(9):e24699. doi:10.1371/journal.pone.0024699 [0222] Lin B Y. (1984) Ploidy barrier to endosperm development in maize. Genetics. 107(1):103-15. [0223] Liu, Zhixin & Wang, Yanbo & Ren, Jiaojiao & Mei, Mei & Frei, Ursula & Trampe, Benjamin & Lübberstedt, Thomas & Goldman, I. & Ortiz, Rodomiro. (2016). Maize Doubled Haploids. 10.1002/9781119279723.ch3. [0224] Liu et al., 2017 A 4 bp insertion at ZmPLA1 encoding a putative phospholipase A generates haploid induction in maize, Mol Plant 10: 520-522 [0225] Liu et al (2019) Extension of the in vivo haploid induction system from diploid maize to hexaploid wheat. Plant Biotechnol J. 2019 Jul. 25. doi: 10.1111/pbi.13218. [0226] Liu et al. 2019 Efficient induction of haploid plants in wheat by editing of TaMTL using an optimized Agrobacterium-mediated CRISPR system, Journal of Experimental Botany erz529, https://doi.org/10.1093/jxb/erz529 [0227] Melchinger, A. E., W. Schipprack, T. Würschum, S. Chen, and F. Technow. (2013). Rapid and accurate identification of in vivo induced haploid seeds based on oil content in maize. Sci. Rep. 3:2129. doi:10.1038/srep02129 [0228] Melchinger, A. E., W. Schipprack, H. F. Utz, and V. Mirdita (2014). In vivo haploid induction in maize: Identification of haploid seeds by their oil content. Crop Sci. 54:1497-1504. doi:10.2135/cropsci2013.12.0851 [0229] Melchinger, A. E., Molenaar, W. S., Mirdita, V. & Schipprack, W. Colchicine Alternatives for Chromosome Doubling in Maize Haploids for Doubled-Haploid Production. Crop Science 56, 559-569 (2016). [0230] Miao, J, Guo D S, Zhang J Z, Huang Q P, Qin G J, Zhang X, Wan J M, Gu H Y and Qu L J (2013). Targeted mutagenesis in rice using CRISPR-Cas system Cell Res, 23 (10) (2013), pp. 1233-1236 [0231] Molenaar, W. S., Oliveira Couto, E. G., Piepho, H. & Melchinger, A. E. Early diagnosis of ploidy status in doubled haploid production of maize by stomata length and flow cytometry measurements. Plant Breed 138, 266-276 (2019). [0232] Nakamura S (2018) Grain dormancy genes responsible for preventing pre-harvest sprouting in barley and wheat. Breeding Science 68: 295-304. doi:10.1270/jsbbs.17138 [0233] Niu, Z. et al. Review of doubled haploid production in durum and common wheat through wheat×maize hybridization. Plant Breed 133, 313-320 (2014).) [0234] Pukhal′skĩĩ V A, Martynov S P, Bilinskaia E N. (2010) Dynamics of hybrid necrosis genes in Russian cultivars of common wheat (Triticum aestivum L.). Genetika. 46(11):1516-24. [0235] Ren, X. Doubling Effect of Anti-microtubule Herbicides on the Maize Haploid. Emir J Food Agric 903 (2018) doi:10.9755/ejfa.2018.v30.i10.1828. [0236] Röber et al., In vivo haploid induction in maize—Performance of new inducers and significance of doubled haploid lines in hybrid breeding Maydica, 50(3-4): 275-283, 2005 [0237] Rousseau D, Widiez T, Di Tommaso S, Rositi H, Adrien J, Maire E, Langer M, Olivier C, Peyrin F, Rogowsky P (2015). Fast virtual histology using X-ray in-line phase tomography: application to the 3D anatomy of maize developing seeds. Plant Methods. 18; 11:55. doi: 10.1186/s13007-015-0098-y. [0238] Sari N, Abak K and Pitrat M (1999) Comparison of ploidy level screening methods in watermelon: Citrullus lanatus (Thunb.) Matsum. and Nakai. Scientia Horticulturae 82, 3-4, pp 265-277. https://doi.org/10.1016/S0304-4238(99)00077-1. [0239] See P T, lagallo E M, Oliver R P, Moffat C S. (2019) Heterologous Expression of the Pyrenophora tritici-repentis Effector Proteins ToxA and ToxB, and the Prevalence of Effector Sensitivity in Australian Cereal Crops. Front Microbiol. 10:182. doi: 10.3389/fmicb.2019.00182. [0240] Shi G, Zhang Z, Friesen T L, Raats D, Fahima T, Brueggeman R S, Lu S, Trick H N, Liu Z, Chao W, Frenkel Z, Xu S S, Rasmussen J B, Faris J D. (2016) The hijacking of a receptor kinase-driven pathway by a wheat fungal pathogen leads to disease. Sci Adv. 2(10):e1600822. [0241] Shoeva O Y and Khlestkina E K (2015). The specific features of anthocyanin biosynthesis regulation in wheat. In Y. Ogihara et al. (eds.), Advances in Wheat Genetics: From Genome to Field, DOI 10.1007/978-4-431-55675-6_16 [0242] Sood, S., Dhawan, R., Singh, K. & Bains, N. S. Development of novel chromosome doubling strategies for wheat×maize system of wheat haploid production. Plant Breeding 122, 493-496 (2003). [0243] W. Tadesse, S. Tawkaz, M. N. Inagaki, E. Picard, and M. Baum. 2013. Methods and Applications of Doubled Haploid Technology in Wheat Breeding. ICARDA, Aleppo, Syria. 36 pp. [0244] Twell, D., Patel, S., Sorensen, A. et al. Sexual Plant Reprod (1993) 6: 217-224 [0245] Vanous, K., Vanous, A., Frei, U. K. & Lübberstedt, T. Generation of Maize (Zea mays) Doubled Haploids via Traditional Methods: Generation of Maize Doubled Haploids. in Current Protocols in Plant Biology (eds. Stacey, G. et al.) 147-157 (John Wiley & Sons, Inc., 2017). doi:10.1002/cppb.20050. [0246] Vikas V K, Tomar SMS, Sivasamy M, Kumar J, Jayaprakash P, Kumar A, Peter J, Nisha R, Punniakotti E (2013) Hybrid necrosis in wheat: evolutionary significance or potential barrier for gene flow? Euphytica 194, Issue 2, pp 261-275. [0247] Würschum T, Langer S M, Longin C F. (2015) Genetic control of plant height in European winter wheat cultivars. Theor Appl Genet. 2015 May; 128(5):865-74. doi: 10.1007/s00122-015-2476-2. [0248] Yao et al, 2018 Nat Plants. 2018 August; 4(8):530-533. [0249] Ye G J, Wei L, Chen W J, Zhang B, Liu B L and Zhang H G (2017) Frame-shift Mutation Causes the Function Loss of TaMYB-A1 Regulating Anthocyanin Biosynthesis in Triticum aestivum. Cereal Research Communications 45(1), pp. 35-46 (2017) DOI: 10.1556/0806.44.2016.042 [0250] Zetsche B, Gootenberg J S, Abudayyeh 00, Slaymaker I M, Makarova K S, Essletzbichler P, Volz S E, Joung J, van der Oost J, Regev A, Koonin E V, Zhang F (2015). Cpf1 is a single RNA-guided endonuclease of a class 2 CRISPR-Cas system. Cell. 163(3):759-71. doi: 10.1016/j.cell.2015.09.038. [0251] Zhang P, Hiebert C W, McIntosh R A, McCallum B D, Thomas J B, Hoxha S, Singh D, Bansal U. (2016) The relationship of leaf rust resistance gene Lr13 and hybrid necrosis gene Ne2m on wheat chromosome 2B S. Theor Appl Genet. 129(3):485-93. doi: 10.1007/s00122-015-2642-6 [0252] Zheng et al 2014, Theor Appl Genet. 2014 July; 127(7):1537-47 [0253] Zhong et al. Mutation of ZmDMP enhances haploid induction in maize, Nature Plants, Vol. 5, 2019