NOVEL YhhS VARIANT AND METHOD FOR PRODUCING O-PHOSPHOSERINE, CYSTEINE, AND DERIVATE OF CYSTEINE USING SAME

Abstract

The present disclosure relates to a novel YhhS variant and a method for producing O-phosphoserine, cysteine and a derivative of cysteine using the same.

Claims

1. A YhhS variant, wherein the amino acid corresponding to a 129th position in the an amino acid sequence of SEQ ID NO: 1 is substituted with another amino acid.

2. The YhhS variant according to claim 1, wherein the amino acid corresponding to the 129th position in the amino acid sequence of SEQ ID NO: 1 is a polar amino acid.

3. The YhhS variant according to claim 2, wherein the polar amino acid is serine.

4. The YhhS variant according to claim 1, wherein the another amino acid is a non-polar amino acid.

5. The YhhS variant according to claim 4, wherein the non-polar amino acid is glycine or alanine.

6. A YhhS variant, wherein isoleucine, an amino acid corresponding to a 241st position in the amino acid sequence of SEQ ID NO: 1, is substituted with glutamine.

7. The YhhS variant according to claim 1, wherein isoleucine, an amino acid corresponding to a 241st position in the amino acid sequence of SEQ ID NO: 1, is substituted with glutamine or threonine.

8. The YhhS variant according to claim 1, wherein aspartic acid, an amino acid corresponding to a 246th position in the amino acid sequence of SEQ ID NO: 1, is further substituted with valine and/or valine, an amino acid corresponding to a 330th position in the amino acid sequence of SEQ ID NO: 1, is further substituted with isoleucine.

9. The YhhS variant according to claim 1, wherein the variant has 90% or more sequence identity to an amino acid sequence selected from among SEQ ID NOs: 2 to 5, 34 and 36.

10. A polynucleotide encoding the variant according to claim 1.

11. A microorganism of the genus Escherichia comprising the variant according to claim 1 or a polynucleotide encoding the variant.

12. The microorganism according to claim 11, wherein the microorganism further exhibits activity of phosphoserine phosphatase (SerB) weakened compared to intrinsic activity.

13. A method for producing O-phosphoserine, the method comprising culturing a microorganism containing the variant according to claim 1 or a polynucleotide encoding the variant in a medium.

14. A method for producing cysteine or a derivative of cysteine, the method comprising: a) culturing an O-phosphoserine-producing microorganism containing the variant according to claim 1 or a polynucleotide encoding the variant in a medium to produce O-phosphoserine or an O-phosphoserine-containing medium; and b) bringing O-phosphoserine sulfhydrylase (OPSS) or a microorganism expressing O-phosphoserine sulfhydrylase, the O-phosphoserine or O-phosphoserine-containing medium produced in the step a), and a sulfide into contact with one another.

15. A composition for producing O-phosphoserine comprising the variant according to claim 1; a polynucleotide encoding the variant; a microorganism containing the variant or a polynucleotide encoding the variant; or a combination of two or more thereof.

16. Use of the variant according to claim 1; a polynucleotide encoding the variant; a vector comprising the polynucleotide; or a microorganism comprising the variant or a polynucleotide encoding the variant for producing O-phosphoserine, cysteine, or a derivative of cysteine.

17. Use of exporting O-phosphoserine from a microorganism using the variant according to claim 1.

Description

DETAILED DESCRIPTION OF THE INVENTION

[0149] Hereinafter, the present disclosure will be described in more detail with reference to Examples. However, the following Examples are merely preferred embodiments for illustrating the present disclosure, and therefore, the scope of the present disclosure is not intended to be limited thereto. Meanwhile, technical matters not described in this specification can be sufficiently understood and easily implemented by those skilled in the art of the present disclosure or similar technical fields.

Example 1: Selection of YhhS Variant

[0150] In order to select a YhhS variant exhibiting increased OPS exporting activity, a YhhS gene variant plasmid library was constructed. The specific process is as follows.

[0151] Random mutagenesis PCR was performed using the genomic DNA of Escherichia coli (E.coli) K12 W3110 as a template and the primer pair having the nucleotide sequences of SEQ ID NOs: 13 and 14 presented in Table 1 below. Diversity PCR Random Mutagenesis Kit (Takara) was used. For PCR, after denaturation at 94 C. for 5 minutes, denaturation at 94 C. for 30 seconds, annealing at 55 C. for 30 seconds, and polymerization at 72 C. for 1 minute were repeated 20 times, followed by polymerization at 72 C. for 5 minutes.

[0152] In order to put the mutant gene fragments constructed through such a process into the pCL1920 vector having the rhtB promoter, pCL_PrhtB was first constructed.

[0153] In order to secure the rhtB promoter fragment, PCR was performed using the genomic DNA of E. coli K12 W3110 as a template and SEQ ID NOs: 15 and 16. For PCR, after denaturation at 94 C. for 5 minutes, denaturation at 94 C. for 30 seconds, annealing at 55 C. for 30 seconds, and polymerization at 72 C. for 1 minute were repeated 30 times, followed by polymerization at 72 C. for 5 minutes. The rhtB promoter fragment was cloned into the pCL1920 vector (GeneBank No. AB236930) digested with EcoRI and SalI using an infusion cloning kit, and pCL_PrhtB was secured. After the secured pCL_PrhtB vector was digested with Scal, the mutant gene fragments obtained through the PCR were cloned using an infusion cloning kit. Cloning was performed by conducting the reaction at 50 C. for 60 minutes, a pCL_PrhtB-yhhS gene mutant plasmid library was thus constructed. Thereafter, the obtained plasmid was transformed into CA07-0012 (KCCM 11121P, Korean Patent No. 10-1381048 and US Patent Application Publication No. 10-2012-0190081) by electroporation.

[0154] Among others, three strains containing variants were selected, plasmids were obtained from these, and the nucleotide sequences were analyzed through sequencing technique. As a result of sequencing, it was confirmed that the selected variants were a variant in which serine of the 129th amino acid residue in the amino acid sequence of wild-type YhhS was substituted with glycine, a variant in which isoleucine of the 241th amino acid residue was substituted with glutamine, and a variant in which isoleucine of the 241 amino acid residue was substituted with threonine, aspartic acid of the 246th amino acid residue was substituted with valine, and valine of the 330th amino acid residue was substituted with isoleucine. The three strains were named CA07-0012/pCL_PrhtB-yhhS (S129G), CA07-0012/pCL_PrhtB-yhhS (I241Q) and CA07-0012/pCL_PrhtB-yhhS (I241T/D246V/V3301), respectively. The CA07-0012/pCL_PrhtB-yhhS (I241T/D246V/V3301) strain is also commonly referred to as Escherichia coli CA07-0352, and was deposited with the Korean Culture Center of Microorganisms (KCCM) on May 14, 2020 under the Budapest Treaty and was given an accession number KCCM 12720P.

TABLE-US-00001 TABLE1 SEQIDNO: Sequence(5.fwdarw.3) 13 GGAGTTCATCagtATGCCCGAACCCGTAGCC 14 CTGCAGGTCGAagtTTAAGATGATGAGGCGGC 15 CGACGGCCAGTGAATTCGATGGTCGATGATTA AGACATC 16 ATGCCTGCAGGTCGAAGTACTGATGAACTCCC GGTGTGTCT

Example 2: Construction of Vector for Expression of Additional YhhS Variant

2-1. Construction of YhhS (S129A) Variant Expressing Vector and Expression Strain

[0155] In order to secure the YhhS (S129A) fragment, an upstream fragment of the YhhS (S129A) was secured through PCR using E. coli K12 W3110 genomic DNA as a template and SEQ ID NOs: 13 and 18, a downstream fragment of the YhhS (S129A) was secured through PCR using E. coli K12 W3110 genomic DNA as a template in the same manner and SEQ ID NOs: 19 and 14 presented in Table 2 below. For PCR, after denaturation at 94 C. for 5 minutes, denaturation at 94 C. for 30 seconds, annealing at 55 C. for 30 seconds, and polymerization at 72 C. for 1 minute were repeated 30 times, followed by polymerization at 72 C. for 5 minutes.

[0156] After the pCL_PrhtB vector was digested with Scal, the secured upstream fragment of YhhS (S129A) and downstream fragment of YhhS (S129A) were cloned using an infusion cloning kit (Clontech Laboratories, Inc.). Cloning was performed by conducting the reaction at 50 C. for 60 minutes, and pCL_PrhtB-yhhS (S129A) was thus secured. The secured plasmid was transformed into CA07-0012 by electroporation to secure a strain CA07-0012/pCL_PrhtB-yhhS (S129A).

TABLE-US-00002 TABLE2 SEQIDNO: Sequence(5.fwdarw.3) 18 TCCCGTTCCGGCAAAcgc TTGCCCAATCCCAAGGA 19 CTTGGGATTGGGCAAgcg TTTGCCGGAACGGGATC

2-2. Construction of YhhS (I241Q) Variant Expressing Vector, YhhS (I241T) Variant Expressing Vector and Variant Expressing Strain

[0157] In order to confirm the OPS producing ability when isoleucine of the 241th amino acid residue of YhhS secured through the library was substituted with threonine other than glutamine, a strain was constructed and evaluation was conducted.

[0158] To insert the 241th amino acid mutation of YhhS into the CA07-0012 chromosome, trc was used as a promoter and the mgsA gene position was used as the insertion site.

[0159] Specifically, pSKH130 vector (US Patent Application Publication No. 2020-0048619, SEQ ID NO: 38) was used for insertion into a chromosome. The vector includes R6K replicon, SacB (Levansucrase) gene, and kanamycin resistant gene being dependent on PI protein (pir gene), the desired strain was secured using R6K and kanamycin in the first crossover using the vector, and then the antibiotic was removed from the medium with sucrose, thereby constructing a strain.

[0160] In order to introduce a form in which the 241th amino acid residue of YhhS was substituted with other amino acids into the mgsA gene position of the strain CA07-0012, it was attempted to secure the pSKH130mgsA plasmid. pSKH130AmgsA is a vector for deleting the mgsA ORF (open reading frame), and is a plasmid containing 5 and 3 nucleotide sequences on both sides of the ORF of mgsA.

[0161] Using the primer pairs presented in Table 3 below, 5 fragments and 3 fragments were secured, respectively. The pSKH130 vector was digested with BamHI, and then a plasmid was secured using an infusion cloning kit.

TABLE-US-00003 TABLE3 SEQ ID NO: Sequence(5.fwdarw.3) Primerpairof 20 CCTGCCATCGGATCCGGT upstream ATCCGTTTTTGCCACCA fragmentof 21 ACCTGTGCAATAAGTACT mgsA AATGTACATCCGTAGTT Primerpairof 22 CGGATGTACATTAGTACT downstream TATTGCACAGGTGGCAA fragment 23 TGATATCGAATTCCTTCG ofmgsA CTGTTGGTGATGACTGG

[0162] In order to secure the trc promoter fragment, PCR was performed using SEQ ID NOs: 24 and 25 presented in Table 4 below. In order to secure two types of variant YhhS ORFs, two types of upstream and downstream fragments of variants were secured using the primer pairs presented in Table 5, respectively. The secured two types of upstream and downstream fragments, the trc promoter fragment, and a vector in which pSKH130mgsA were digested with Scal, and an infusion cloning kit were used together to secure two types of plasmids.

[0163] In order to secure a strain in which wild-type YhhS was introduced into the mgsA position as a control, a pSKH130mgsA::Ptrc-yhhS plasmid was constructed. PCR was performed using an oligonucleotide pair having SEQ ID NOs: 26 and 27 to secure the YhhS ORF, and an infusion cloning kit was used together with the trc promoter fragment and a vector in which pSKH130mgsA were digested with Scal to secure a plasmid.

TABLE-US-00004 TABLE4 SEQ ID NO: Sequence(5.fwdarw.3) 24 CGGATGTACATTAGTCGC TTGCTGCAACTCTCTCA 25 GATAGCTCTCCTGTGTGA AATTGTTATCCGCTCAC

TABLE-US-00005 TABLE5 SEQIDNO: Sequence(5.fwdarw.3) Primerpair 26 CACAGGAAAGATATCA ofupstream TGCCCGAACCCGTAGC fragmentof CGA 1241Q 28 GCCGGATTTGGCGTCA TCGCCACCTTTcagAC GCTGTTTTATGACGCT Primerpair 29 CCAACCTTTAGCGTCA of TAAAACAGCGTctgAA downstream AGGTGGCGATGACGCC fragmentof 27 ACCTGTGCAATAAGTT 1241Q TAAGATGATGAGGCGG CCT Primerpair 26 CACAGGAAAGATATCA ofupstream TGCCCGAACCCGTAGC fragmentof CGA 1241T 30 TCATAAAACAGCGTGG TAAAGGTGGCGATGAC GCC Primerpair 31 TCATCGCCACCTTTAC of CACGCTGTTTTATGAC downstream GCT fragmentof 27 ACCTGTGCAATAAGTT 1241T TAAGATGATGAGGCGG CCT

[0164] The secured plasmid was transformed into the strain CA07-0012 by electroporation. The strain in which the mutation was inserted into the chromosome by recombination (crossover) was selected from LB solid medium with kanamycin, and then subjected to the secondary recombination (replacement) in a medium with sucrose so that excision of the plasmid site from the chromosome occurred. The strain undergone the secondary recombination was subjected to PCR using SEQ ID NOs: 20 and 27 and sequencing to secure two types of strains (CA07-0012mgsA::Ptrc-yhhS (I241T) and CA07-0012mgsA::Ptrc-yhhS (I241Q)) in which the YhhS variant was inserted into the mgsA position of the chromosome. The strain (CA07-0012mgsA::Ptrc-yhhS) into which the control was introduced was also secured by the same method.

2-3. Construction of YhhS (S129G/I241Q) Variant Expressing Vector and Expression Strain

[0165] Based on the YhhS (I241Q) variant, a strain in which serine of the 129th amino acid residue was replaced with glycine was constructed. In this case, the rhtB promoter was used as a promoter.

[0166] Specifically, PCR was performed using pCL_PrhtB-yhhS (I241Q) as a template and SEQ ID NOs: 32 and 33 (PCR_129G time-point in the entire plasmid) presented in Table 6 below. The secured PCR fragment was cloned using an infusion cloning kit.

[0167] The secured plasmid was transformed into CA07-0012 by electroporation to secure strain CA07-0012/pCL_PrhtB-yhhS (S129G/I241Q).

TABLE-US-00006 TABLE6 SEQIDNO: Sequence5.fwdarw.3 32 ATTGGGCAAgGTTTTGCCGG 33 CCGGCAAAACcTTGCCCAAT

2-4. Construction of YhhS (S129G/I241T/D246V/V330I) Variant Expressing Vector and Expression Strain

[0168] The trc promoter was used, the mgsA gene was deleted, and S129G/I241T/D246V/V330I mutation was inserted thereinto.

[0169] Specifically, in order to introduce 1241T, D246V and V330I mutations into the mgsA gene position of the strain CA07-0012, the pSKH130mgsA plasmid constructed in Example 2-2 was used.

[0170] In order to construct pSKH130mgsA::Ptrc-yhhS (I241T/D246V/V330I), the trc promoter fragment secured in Example 2-2 was used in the same manner. PCR was performed using SEQ ID NOs: 26 and 27 and the pCL_Ptrc-yhhS (I241T/D246V/V330I) plasmid as a template to secure the ORF fragment of the YhhS (I241T/D246V/V330I). The trc promoter fragment, yhhS453 fragment, a vector in which pSKH130mgsA was digested with Scal, and an infusion cloning kit were used together to secure a plasmid pSKH130mgsA::Ptrc-yhhS (I241T/D246V/V330I).

[0171] Thereafter, PCR was performed using the pSKH130mgsA::Ptrc-yhhS (I241T/D246V/V330I) as a template and SEQ ID NOs: 32 and 33 (PCR_129G time-point in the entire plasmid). For PCR, after denaturation at 94 C. for 5 minutes, denaturation at 94 C. for 30 seconds, annealing at 55 C. for 30 seconds, and polymerization at 72 C. for 7 minutes were repeated 30 times, followed by polymerization at 72 C. for 5 minutes. The secured fragment and an infusion cloning kit were used to secure a plasmid pSKH130mgsA::Ptrc-yhhS (129G/I241T/D246V/V330I).

[0172] The secured plasmid was transformed into the strain CA07-0012 by electroporation. For the transformed strain, the strain introduced into the chromosome in LB solid medium with kanamycin by recombination (crossover) was selected, and then excision of the plasmid site from the chromosome occurred through secondary recombination (replacement) in medium with sucrose.

[0173] The strain undergone the secondary recombination was subjected to PCR using SEQ ID NOs: 20 and 27 and sequencing to secure two types of strains (CA07-0012/pSKH130mgsA:: Ptrc-yhhS (I241T/D246V/V330I) and CA07-0012/pSKH130mgsA::Ptrc-yhhS (129G/I241T/D246V/V330I)) in which YhhS (I241T/D246V/V330I) or YhhS (129G/I241T/D246V/V330I) was inserted into the mgsA position of the chromosome.

Example 3: Evaluation of OPS Producing Ability of YhhS Variant-Introduced Strain

[0174] The O-phosphoserine producing ability of the YhhS variant-introduced strain was evaluated using the following medium (Table 7).

[0175] Specifically, in culturing, each strain was plated on LB solid medium, and then cultured overnight in an incubator at 33 C. The strain cultured overnight in LB solid medium was inoculated into the 25 mL titer medium of Table 7 below, and then cultured for 48 hours in an incubator at 33 C. at 200 rpm, and the results are presented in Tables 8 to 11.

TABLE-US-00007 TABLE 7 Component of medium Amount prepared Glucose 40 g KH.sub.2PO.sub.4(KP1) 6 g (NH.sub.4).sub.2SO.sub.4 17 g MgSO.sub.47H.sub.2O 1 g MnSO.sub.44H.sub.2O 5 mg FeSO.sub.47H.sub.2O 10 mg L-glycine 2.5 g/L Yeast extract 3 g/L CaCO.sub.3 30 g/L pH 6.8

3-1: Evaluation of OPS Producing Ability of Strain Into Which 129th Amino Acid-Substituted Variant of YhhS is Introduced

[0176] It has been confirmed that the rate of increase in OPS producing ability is about 252% in the case of CA07-0012/pCL_PrhtB-yhhS (S129G), a strain into which YhhS (S129G) variant is introduced and the rate of increase in OPS producing ability is about 29% in the case of CA07-0012/pCL_PrhtB-yhhS (S129A), a strain into which YhhS (S129A) variant is introduced (Table 8).

TABLE-US-00008 TABLE 8 Name of strain OPS concentration (g/L) CA07-0012/pCL_PrhtB-yhhS 2.1 CA07-0012/pCL_PrhtB-yhhS(S129A) 2.7 CA07-0012/pCL_PrhtB-yhhS(S129G) 5.3

3-2: Evaluation of OPS Producing Ability of Strain Into Which 241st Amino Acid Residue-Substituted Variant of YhhS is Introduced

[0177] The rate of increase in OPS exporting ability compared to that of CA07-0012mgsA::Ptrc-yhhS, a strain into which wild-type YhhS was introduced, was examined, and as a result, it has been confirmed that the rate of increase in OPS exporting ability is about 425% in the case of CA07-0012mgsA::Ptrc-yhhS (I241Q), a strain into which YhhS (I241Q) variant is introduced, the rate of increase in OPS exporting ability is about 233% in the case of CA07-0012mgsA::Ptrc-yhhS (I241T), a strain into which YhhS (I241T) variant is introduced, and the rate of increase in OPS exporting ability is about 267% in the case of CA07-0012mgsA::Ptrc-yhhS (I241T/D246V/V330I), a strain into which YhhS (I241T/D246V/V330I) variant is introduced (Table 9).

TABLE-US-00009 TABLE 9 Name of strain OPS concentration (g/L) CA07-0012mgsA::Ptrc-yhhS 1.2 CA07-0012mgsA::Ptrc-yhhS(I241T) 2.8 CA07-0012mgsA::Ptrc-yhhS(I241Q) 5.1 CA07-0012mgsA::Ptrc- 3.2 yhhS(I241T/D246V/V330I)

3-3: Evaluation of OPS Producing Ability of Strain Into Which 129th Amino Acid Residue-Substituted and 241st Amino Acid Residue-Substituted Variant of YhhS is Introduced

[0178] The rate of increase in OPS exporting ability compared to that of CA07-0012/pCL_PrhtB-yhhS, a strain into which wild-type YhhS was introduced, was examined, and as a result, it has been confirmed that the rate of increase in OPS exporting ability is about 338% in the case of CA07-0012/pCL_PrhtB-yhhS (S129G/I241Q), a strain into which a YhhS (S129G/1241Q) variant is introduced (Table 10).

TABLE-US-00010 TABLE 10 Name of strain OPS concentration (g/L) CA07-0012/pCL_PrhtB-yhhS 2.1 CA07-0012/pCL_PrhtB- 7.1 yhhS(S129G/I241Q)

[0179] In addition, the rate of increase in OPS exporting ability compared to that of CA07-0012mgsA::Ptrc-yhhS (I241T/D246V/V330I) was examined, and as a result, it has been confirmed that the rate of increase in OPS exporting ability is about 144% in the case of CA07-0012mgsA::Ptrc-yhhS (S129G/I241T/D246V/V330I), a strain into which the YhhS (S129G/I241T/D246V/V330I) variant is introduced (Table 11).

TABLE-US-00011 TABLE 11 Name of strain OPS concentration (g/L) CA07-0012mgsA::Ptrc- 3.2 yhhS(I241T/D246V/V330I) CA07-0012mgsA::Ptrc- 4.6 yhhS(S129G/I241T/D246V/V330I)

[0180] Based on the above description, those skilled in the art to which the present disclosure pertains will understand that the present disclosure may be implemented in other specific forms without changing the technical spirit or essential characteristics thereof. In this regard, it should be understood that the embodiments described above are illustrative in all respects and not restrictive. With regard to the scope of the present disclosure, it should be construed that all changes and modifications derived from the meaning and scope of the claims described below and their equivalents rather than the above detailed description are included in the scope of the present disclosure.