Nucleic Acid Detection Kit For Novel Coronavirus 2019-nCoV
20230070496 · 2023-03-09
Inventors
- Xiwen JIANG (Guangzhou, Guangdong, CN)
- Jian FAN (Guangzhou, Guangdong, CN)
- Hailong PENG (Guangzhou, Guangdong, CN)
Cpc classification
C12Q1/6876
CHEMISTRY; METALLURGY
C12Q2600/166
CHEMISTRY; METALLURGY
Y02A50/30
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
C12Q1/6883
CHEMISTRY; METALLURGY
International classification
C12Q1/6876
CHEMISTRY; METALLURGY
Abstract
Provided is a nucleic acid detection kit for novel coronavirus 2019-nCoV, and in particular, provided are a kit and a method for multiple detection of the nucleic acid of the novel coronavirus 2019-nCoV. Three nucleic acid targets of the novel coronavirus 2019-nCoV can be detected at the same time. False positives can be prevented by means of mutual authentication among different targets, and detection omissions, which may be caused by mutations, are confirmed, such that the accuracy of virus identification is significantly improved.
Claims
1-10. (canceled)
11. A kit for multiplex detection of novel coronavirus 2019-nCoV nucleic acid, which comprises a primer pair set for detecting the novel coronavirus 2019-nCoV nucleic acid, and the primer pair set comprises: a first primer pair group, wherein the first primer pair group comprises: a forward primer as shown in SEQ ID NO.1; and a reverse primer as shown in SEQ ID NO.2
12. The kit of claim 11, wherein the primer pair set further comprises: a second primer pair group, wherein the second primer pair group comprises: a forward primer as shown in SEQ ID NO. 4; and a reverse primer as shown in SEQ ID NO. 5.
13. The kit of claim 12, wherein the primer pair set further comprises: a third primer pair group, wherein the third primer pair group comprises: a forward primer as shown in SEQ ID NO. 7; and a reverse primer as shown inSEQ ID NO.8.
14. The kit of claim 13, wherein the primer pair set further comprises: an internal standard primer pair group, wherein the internal standard primer pair group comprises: a forward primer as shown in SEQ ID NO. 10; and a reverse primer as shown in SEQ ID NO.11.
15. The kit of claim 11, wherein the kit further comprises a probe set, and the probe set includes a first probe whose nucleotide sequence is shown in SEQ ID NO. 3; and the 5′ end of the first probe is labeled with a fluorescent reporter group, and the 3′ end of the first probe is labeled with a fluorescence quenching group.
16. The kit of claim 15, wherein the probe set further includes: a second probe whose nucleotide sequence is shown in SEQ ID NO.6; and the 5′ end of the second probe is labeled with a fluorescent reporter group, and the 3′ end of the second probe is labeled with a fluorescence quenching group.
17. The kit of claim 16, wherein the probe set further includes: a third probe whose nucleotide sequence is shown in SEQ ID NO.9; and the 5′ end of the third probe is labeled with a fluorescent reporter group, and the 3′ end of the third probe is labeled with a fluorescence quenching group.
18. The kit of claim 17, wherein the probe set further includes: an internal control probe whose nucleotide sequence is shown in SEQ ID NO.12; and the 5′ end of the internal control probe is labeled with a fluorescent reporter group, and the 3′ end of the internal control probe is labeled with a fluorescence quenching group.
19. The kit of claim 11, wherein the kit comprises a first container, and the first container contains a primer and probe mix, and the primer and probe mix contains polynucleotides having sequences shown in SEQ ID NOs. 1 to 9.
20. The kit of claim 19, wherein the primer and probe mix further contains polynucleotides having sequences shown in SEQ ID NOs. 10 to 12.
21. The kit of claim 19, wherein the kit further includes a second container, and the second container contains a PCR enzyme system including a hot-start enzyme and a reverse transcriptase M-MMLV.
22. The kit of claim 21, wherein the kit further includes a third container, and the third container contains a positive control.
23. The kit of claim 22, wherein the kit further includes a fourth container, and the fourth container contains a negative control.
24. A method for multiplex detection of novel coronavirus 2019-nCoV nucleic acid, which includes the steps of: (1) providing a nucleic acid sample of a subject to be tested; (2) preparing a PCR reaction system for the PCR detection: wherein the PCR reaction system includes: the nucleic acid sample provided in step (1) and a primer and probe mix, and the primer and probe mix contains polynucleotides having sequences shown in SEQ ID NOs. 1 to 9.
25. The method of claim 25, wherein the primer and probe mix further contains polynucleotides having sequences shown in SEQ ID NOs. 10 to 12.
Description
DESCRIPTION OF DRAWINGS
[0043]
[0044]
[0045]
[0046]
[0047]
[0048]
[0049]
[0050]
[0051]
[0052]
[0053]
[0054]
[0055]
[0056]
[0057]
DETAILED DESCRIPTION OF INVENTION
[0058] Through extensive and intensive research, the present inventor has obtained a kit and method for multiplex detection of the novel coronavirus 2019-nCoV nucleic acid, which can simultaneously detect the three nucleic acid targets of novel coronavirus 2019-nCoV and mutual verification between different targets can be used to prevent false positives and to confirm missed detections that may be caused by mutations, which significantly improves the accuracy of virus identification.
[0059] Before describing the present invention, it should be understood that the present invention is not limited to the specific methods and experimental conditions as described, due to such methods and conditions may vary. It should also be understood that the terminology used herein is for the purpose of describing specific embodiments only and is not intended to be limiting, and the scope of the present invention will be limited only by the appended claims.
[0060] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art to which this invention belongs. As used herein, when used in reference to specifically recited values, the term “about” means that the value may vary from the recited value by no more than 1%. For example, as used herein, the expression “about 100” includes all values between 99 and 101 and (e.g., 99.1, 99.2, 99.3, 99.4, etc.).
[0061] Although any methods and materials similar or equivalent to those described in the present invention can be used in the practice or testing of the present invention, the preferred methods and materials are exemplified herein.
[0062] Multiplex PCR
[0063] Multiplex PCR, also known as multiple primers PCR or complex PCR, is a PCR reaction in which two or more pairs of primers are added to the same PCR reaction system to simultaneously amplify multiple nucleic acid fragments. The reaction principle, reaction reagents and operation process are the same as general PCR.
[0064] There are many factors that affect multiplex PCR reactions, such as:
[0065] (1) The imbalance of the reaction system. The imbalance of the reaction system leads to the rapid amplification of certain dominant primers and their templates in the previous rounds of reactions, and a large number of amplification products are obtained, and these amplification products are also good inhibitors of DNA polymerase. Therefore, as a large number of amplification products appear, the polymerization ability of the polymerase is more and more strongly inhibited. Therefore, the primers and their templates that are at a disadvantage in the early stage are more difficult to react, resulting in a very small amount of amplification product that cannot be detected.
[0066] (2) Primer specificity. If the primer has stronger binding ability with other non-target gene fragments in the system, the ability of the target gene to bind to the primer will be contested, resulting in a decrease in amplification efficiency.
[0067] (3) The optimal annealing temperature is inconsistent. Multiple pairs of primers are put into one system for amplification. Since the annealing temperature for PCR reaction is the same, the optimal annealing temperature of each pair of primers is required to be close.
[0068] (4) Primer dimers, including the dimers between primers and the hairpin structure formed by the primers themselves, and there is also a third-party DNA-mediated polymer. Like non-specific primers, these dimers will interfere with the competition between the primer and the target binding site, affecting the amplification efficiency.
[0069] Although several factors affecting the efficiency of amplification are mentioned as above, more factors are unclear. So far, there is no effective method that can clearly predict the amplification efficiency.
[0070] The present invention provides an oligonucleotide sequence combination for specifically detecting the N, ORF1ab and E gene of novel coronavirus 2019-nCoV in a sample and a kit containing the oligonucleotide sequence combination, wherein the primer sequences for the N gene amplification are:
TABLE-US-00001 SEQ ID NO. 1: AAGAAATTCAACTCCAGGCAGC and SEQ ID NO. 2: GCTGGTTCAATCTGTCAAGCAG,
[0071] the corresponding detection probe sequence is SEQ ID NO.3:
TABLE-US-00002 TCACCGCCATTGCCAGCCA;
[0072] the primer sequences for the ORF1ab gene amplification are:
TABLE-US-00003 SEQ ID NO. 4: TTATCACCCGCGAAGAAG and SEQ ID NO. 5: TCTAGTAGCATGACACCCCT,
[0073] the corresponding detection probe sequence is SEQ ID NO.6:
TABLE-US-00004 TAAGACATGTACGTGCATGGATTGGC;
[0074] the primer sequences for the E gene amplification are:
TABLE-US-00005 SEQ ID NO. 7: CTTTCGTGGTATTCTTGCTAGTT and SEQ ID NO. 8: CACGTTAACAATATTGCAGCA,
[0075] the corresponding detection probe sequence is SEQ ID NO.9:
TABLE-US-00006 TAGCCATCCTTACTGCGCTTCGATTG.
[0076] The probe labels of each gene of the present invention are not limited to the single labels listed at the same wavelength, and include multiplex detection reagents in different combinations of different labels.
[0077] In one embodiment, the kit further includes internal standard quality control and amplification primers and detection probes;
[0078] the internal standard quality control contains the target gene fragment whose sequence is shown inSEQ ID NO.13;
[0079] the sequences of the internal standard quality control amplification primers are respectively SEQ ID NO.10: CTAACACTGGCTCGTGTG and SEQ ID NO.11: TGGGATGGGGAGTCTGT,
[0080] the corresponding detection probe sequence is SEQ ID NO.12:
TABLE-US-00007 AGGCTGGTGTAAAGCGGCCTT.
[0081] The target gene fragment sequence shown in SEQ ID NO.13 is as follows:
TABLE-US-00008 CTAACACTGGCTCGTGTGACAAGGCCATGAGGCTGGTGTAAAGCGG CCTTGGAGTGTGTATTAAGTAGGCGCACAGTAGGTCTGAACAGACT CCCCATCCCA.
[0082] Selecting the target gene fragment as the internal standard can monitor the sample collection and the sample extraction process to prevent false negatives due to the failure of sample nucleic acid extraction.
[0083] In one embodiment, the kit comprises MS2 pseudovirus containing N/ORF1ab/E gene fragment as a positive control and sterile saline as a negative control.
[0084] For the gene sequence of novel coronavirus 2019-nCoV in the present invention, please refers to GISAID: BetaCov/Wuhan/WH01/2019|EPI_ISL_406798; for the oligonucleotide sequence information of its N, ORF1ab and E genes, please refer to the Reference Roujian Lu, Xiang Zhao, Juan Li, et. al, Genomic characterisation and epidemiology of 2019 novel coronavirus: implications for virus origins and receptor binding. Lancet. 2020 Jan. 30.
[0085] In one embodiment, the kit includes PCR reaction solution containing primers and probes targeting N/ORF1ab/E gene and internal standard, dNTPs, PCR buffer and PCR enzyme system containing hot-start Hot.Taq enzyme, reverse transcriptase M-MMLV and RNA enzyme inhibitor, in which the concentration of primers and probes are 0.1-1 μM, the concentration of dNTPs is 0.2-0.4 mM, the concentration of MgCl.sub.2 is 2-5 mM, and the concentration of hot-start Hot.taq is 2.5-10 U, the concentration of reverse transcriptase M-MMLV is 40-100 U and the concentration of RNA enzyme inhibitors is 8-20 U.
[0086] A method for using the novel coronavirus 2019-nCoV nucleic acid detection kit, includes the following steps: extracting a sample to be tested (extraction reagent using nucleic acid extraction or purification reagent produced by Daan Gene Co., Ltd. of Sun Yat-sen University (Yuehuixiebei No. 20150348)) to obtain nucleic acid samples (positive control and negative control participate in the extraction at the same time); taking 5 μL into the above PCR reaction solution (17 μL) and enzyme mixture (3 μL), and the amplification reaction was carried out in a real-time fluorescent PCR instrument, and the fluorescence channels were selected in turn by FAM, VIC/HEX, Texas red, and Cy5. The PCR amplification procedure is as follows;
[0087] 50° C., 15 min, 95° C., 15 min; 1 cycle;
[0088] 94° C., 15 sec, 55° C., 45 sec (collecting fluorescence); 45 cycles.
[0089] After PCR is completed, different fluorescent channel curves and Ct values are used to determine the negative or positive of the corresponding pathogen DNA. The test results can be used for the auxiliary diagnosis of novel coronavirus 2019-nCoV infection, providing a reliable basis for virus identification and prevention and control.
[0090] The composition of the kit is detailed in Table 1 and Table 2. It can detect three target genes of novel coronavirus 2019-nCoV at the same time, and can verify each other through different targets to prevent false positives and to confirm the missed detection that may be caused by mutation, which can significantly improve the accuracy of virus identification.
TABLE-US-00009 TABLE 1 Kit composition Composition Main component PCR reaction Specific primers and fluorescent probes solution (SEQ ID NOs. 1 to 12), dNTPs, PCR buffer PCR enzyme Hot start Hot.Taq enzyme, reverse system transcriptase M-MMLV and RNase inhibitors Positive control MS2 Pseudovirus containing N/ORF1ab/E gene fragment, Negative control Sterile Saline
[0091] The primer and probe sequences required by the kit are shown in Table 2:
TABLE-US-00010 TABLE 2 Primers, probes and sequence numbers Primer and Primer/ SEQ probe probe ID name sequence NO. N-F1 AAGAAATTCAACTCCAGGCAGC 1 N-R1 GCTGGTTCAATCTGTCAAGCAG 2 N-P 5’FAM- TCACCGCCATTGCCAGCCA- BHQ1 3 ORF1ab-F1 TTATCACCCGCGAAGAAG 4 ORF1ab-R1 TCTAGTAGCATGACACCCCT 5 ORF1ab-P 5’HEX- 6 ACGTGCATGGATTGGCTTCGATGT BHQ1-3′ E-F1 CTTTCGTGGTATTCTTGCTAGTT 7 E-R1 CACGTTAACAATATTGCAGCA 8 E-P 5’Texas red- 9 TAGCCATCCTTACTGCGCTTCGATTG -BHQ2-3′ Internal CTAACACTGGCTCGTGTG 10 standard- F1 Internal TGGGATGGGGAGTCTGT 11 standard- R1 Internal 5′Cy5- 12 standard- AGGCTGGTGTAAAGCGGCCTT- BHQ2-3′ P
[0092] Preferably, the fluorescent group is selected from the group consisting of FAM, HEX, NED, ROX, TET, JOE, TAMRA, CY3, and CY5.
[0093] Preferably, the quenching group is selected from the group consisting of MGB, BHQ-1, BHQ-2, and BHQ-3.
[0094] In the primer design of the present invention, multiple primer-probe combinations that will not interfere with each other, have high amplification efficiency, and have good specificity are finally screened through a large number of tests, and combined, optimized, and verified.
[0095] The criteria used by the kit of the present invention to determine the effectiveness of the detection are:
[0096] Negative control and positive control are simultaneously detected in each test. When the test result of the positive control is positive and the test result of the negative control is negative, the test result is valid.
[0097] The method for using the kit of the present invention includes the following steps:
[0098] (1) Extracting the total nucleic acid in the test sample to obtain a nucleic acid sample.
[0099] (2) Mixing the nucleic acid sample with the PCR reaction solution and PCR enzyme system to prepare a PCR reaction system.
[0100] (3) Performing Real-time fluorescence PCR reaction, and the procedure is as follows:
[0101] the first stage: 50° C. 2-15 min, 95° C. 10-15 min, 1 cycle;
[0102] the second stage: 94° C. 10-15 s, 55-60° C. 45 s, 45 cycles.
[0103] After PCR, different fluorescence channel curves and Ct values were used to judge the negative and positive of the corresponding pathogen nucleic acid, and the detection result was given.
[0104] The Beneficial Effects of the Present Invention Include:
[0105] Most of the current detection reagents are single-target detection reagents. RNA virus mutates rapidly, and it is easy to miss detection of mutant viruses, which is not conducive to the timely detection and prevention of viruses. The three targets of novel coronavirus 2019-nCoV are tested at the same time in the invention, so they can be mutually verified between different targets to prevent false positives, confirm the miss detection that may be caused by mutation, and significantly improve the accuracy of virus identification. At the same time, the system contains an endogenous internal standard quality control system, which can monitor the entire process of sampling, sample storage, nucleic acid extraction and PCR amplification to prevent the occurrence of false negatives.
[0106] The present invention is suitable for the detection of novel coronavirus 2019-nCoV nucleic acid, and can provide a reliable basis for virus identification and prevention and control, and is worthy of popularization and application. In addition, the method of the present invention is also suitable for non-diagnostic purposes. For example, in the epidemic prevention and control process, the detection method of the present invention can be used to detect viral nucleic acids in the environment, and these viral nucleic acid information can be used for public health management.
[0107] The present invention will be further described in detail below in conjunction with specific embodiments. It should be understood that these examples are only used to illustrate the present invention and not to limit the scope of the present invention. The experimental methods without detailed conditions in the following examples are generally in accordance with the conditions described in the conventional conditions such as Sambrook. J et al. “Guide to Molecular Cloning Laboratory” (translation by Huang Peitang et al., Beijing: Science Press, 2002), Or as recommended by the manufacturer. Unless otherwise stated, percentages and parts are calculated by weight. Unless otherwise specified, the experimental materials and reagents used in the following examples can be obtained from commercially available channels.
Example 1 Detection Limit Test of Novel Coronavirus 2019-ncCov Nucleic Acid Detection Kit
[0108] The quantified pseudoviruses were used as the initial samples and were diluted to a concentration of 10.sup.5 copies/ml, and then sequentially diluted to 10.sup.4, 10.sup.3, 500, 250 copies/ml. And the pseudoviruses containing the internal standard amplified fragments were added into each sample to a final concentration of 10.sup.4 copies/ml as the samples to be tested to test the sensitivity of the triple detection reagent. The PCR reaction system includes the primer and probe combinations shown in SEQ ID NOs. 1 to 12 of the present invention.
[0109] Refer to
[0110]
[0111]
[0112]
[0113]
[0114] The test results showed that the lowest concentration that can be detected for the positive control at different concentrations was 500 copies/ml.
Example 2 Specificity Test of Novel Coronavirus 2019-nCoV Nucleic Acid Detection Kit
[0115] Other pathogens that are similar to Novel Coronavirus 2019-nCoV species or cause similar symptoms (such as Seasonal influenza A H1N1 virus, Novel Influenza A H1N1 (2009) virus, Influenza A H3N2, H5N1, H7N9, Influenza B Yamagata, Influenza B Victoria, Respiratory syncytial virus type A, Respiratory syncytial virus type B, Parainfluenza virus, Adenovirus, Enterovirus, Human interstitial lung Viruses (human metapneumovirus), Epstein-Barr virus, Measles virus, Human cytomegalovirus, Rotavirus, Norovirus, Mumps virus, Varicella-zoster virus, Mycoplasma pneumoniae, Chlamydia pneumoniae, Legionella, Bacillus pertussis, Haemophilus influenzae, Staphylococcus aureus, Streptococcus pneumoniae, Streptococcus pyogenes, Klebsiella pneumoniae, Mycobacterium tuberculosis, Aspergillus fumigatus, Candida albicans, Candida glabrata, Cryptococcus neoformans, Coronavirus (HKU1, OC43, NL63, 229E) and human genomic DNA were used as specificity references to test the specificity of the novel coronavirus 2019-nCoV nucleic acid detection kit.
[0116] Refer to
[0117]
[0118]
[0119] The specificity references were tested and the test results were all negative, and the test results of the internal standard quality control were all positive. It was shown that the kit of the present invention has excellent specificity.
Example 3: Precision Test of Novel Coronavirus 2019-nCoV Nucleic Acid Detection Kit
[0120] Pseudovirus containing N/ORF1ab/E gene was diluted into 10.sup.5 and 10.sup.3 copies/ml as precision references. Test was repeated 10 times to calculate the variable coefficient of each concentration of precision reference.
[0121] Refer to
[0122]
[0123]
[0124]
[0125] After testing, the variable coefficient of the precision reference with high concentration and low concentration of novel coronavirus 2019-nCoV were 1.16% and 1.54% for the N gene, 1.16% and 1.54% for the ORF1ab gene, and 1.16% and 1.54% for the E gene. The variable coefficients of the precision reference with different concentrations of the three gene were all less than 5%.
Example 4. Interfering Substance Test of Novel Coronavirus 2019-nCoV Nucleic Acid Detection Kit
[0126] Respiratory pathogen therapeutic agents such as phenylephrine, oxymetazoline, sodium chloride, beclomethasone, dexamethasone, flunisolide, triamcinolone acetonide, budesonide, mometasone, fluticasone, histamine hydrochloride, interferon, zanamivir, ribavirin, oseltamivir, peramivir, lopinavir, mupirocin, levofloxacin, azithromycin, tobramycin, ritonavir, meropenem, ceftriaxone, ritonavir, tobramycin, meropenem and arbidol were separately added into 10.sup.3 copies/ml of pseudovirus cultures as interfering substance in the test, and samples without interfering substances were used as controls to test the effect of interfering substances on the amplification of primer and probes.
[0127] Refer to
[0128]
[0129]
[0130]
[0131] Phenylephrine, oxymetazoline, chlorine sodium chloride, beclomethasone, dexamethasone, flunisolide, triamcinolone acetonide, budesonide, mometasone, fluticasone, histamine hydrochloride, interferon, zanamivir, ribavirin, oseltamivir, peramivir, lopinavir, mupirocin, levofloxacin, azithromycin, tobramycin, ritonavir, meropenem, ceftriaxone, ritonavir, tobramycin, meropenem and arbidol were added to the sample to be tested. The results showed that there was no obvious interference to the test results, and the interpretation of the results were not affected.
Example 5. Clinical Samples Testing
[0132] Extraction of Nucleic Acid from Test Samples:
[0133] (1) Extraction of Nucleic Acid Template of Clinical Samples
[0134] Collect clinical samples of throat swabs from 22 suspected patients, and the nucleic acid samples were obtained using the nucleic acid extraction or purification reagent (Yuehuixiebei No. 20150348) from Daan Gene Co., Ltd. of Sun Yat-sen University (the positive control and the negative control were involved in the extraction simultaneously). 5 μL of nucleic acid samples was added to the above PCR reaction solution (17 μL) and the enzyme mixture (3 μL), and the amplification reaction was performed in the real-time fluorescent PCR instrument, and the fluorescent channels were selected in order of FAM, VIC/HEX, Texas red and Cy5. The PCR amplification procedure was as follows:
[0135] 50° C., 15 min, 95° C., 15 min; 1 cycle
[0136] 94° C., 15 sec, 55° C., 45 sec (collecting fluorescence); 45 cycles.
[0137] After the PCR was completed, the negative and positive of the corresponding pathogen DNA were determined by different fluorescence channel curves and Ct values.
[0138] In the tested 22 suspected clinical samples, a total of 17 novel coronavirus 2019-nCoV nucleic acid positive clinical samples were detected. Typical test results were shown in
[0139] Sequencing verification results showed that the detection accuracy of the detection system of the present invention reached 100%, which further proved the accuracy of clinical detection of the system of the present invention.
Comparative Example 1
[0140] In the research process, the present inventor screened dozens of PCR primers and probes for the novel coronavirus 2019-nCoV target nucleic acid sequence. After extensive testing, a combination of primers and probes with sensitivity and specificity that can meet the needs of clinical testing and can perform multiple tests was finally obtained.
[0141] For the detection target of the N, ORF1ab and E gene of novel coronavirus 2019-nCoV, the present inventor had undergone a lot of screening and combination. For example, for the ORF1ab gene, some typical primer sequences designed were as follows:
TABLE-US-00011 ORF1ab gene control upstream primer ORF1ab-F2: (SEQ ID NO. 14) ATCAAGTTAATGGTTACCCTAACATG ORF1ab gene control downstream primer ORF1ab-R2: (SEQ ID NO. 15) CAACAGCTTCTCTAGTAGCATGACA ORF1ab gene control upstream primer ORF1ab-F3: (SEQ ID NO. 16) TGGGTTTTAAAATGAATTATCAAGTT ORF1ab gene control downstream primer ORF1ab-R3: (SEQ ID NO. 17) AACCTAGCTGTAAAGGTAAATTGG
[0142] The specific detection steps, detection conditions, and probe sequences were same as the above embodiments, and PCR detection tests are performed.
[0143] The detection results using ORF1ab-F2 and ORF1ab-R2 were shown in
[0144] All literatures mentioned in the present application are incorporated herein by reference, as though each one is individually incorporated by reference. In addition, it should also be understood that, after reading the above teachings of the present invention, those skilled in the art can make various changes or modifications, equivalents of which falls in the scope of claims as defined in the appended claims.