COMPOSITION USING NOVEL LACTOBACILLUS PLANTARUM KC3 STRAIN FOR PREVENTION OR TREATMENT OF IMMUNE IMPAIRMENT, RESPIRATORY INFLAMMATORY DISEASE, ALLERGY, AND ASTHMA AND USE THEREOF

Abstract

The present disclosure relates to a composition for ameliorating immune disorders and preventing or treating respiratory inflammatory diseases, the composition including, as an active ingredient, new lactic acid bacteria from Lactobacillus plantarum KC3 (also referred to as “CKDB-KC3”). It is confirmed that the composition is useful as a pharmaceutical composition or a health functional food for ameliorating immune disorders and preventing and treating a respiratory inflammatory diseases by confirming that the new strain of the present disclosure exhibits excellent activities of ameliorating immune disorders and inhibiting respiratory inflammatory diseases through the following animal experiments: an experiment on the characteristics of the new lactic acid bacteria from the Lactobacillus plantarum KC3 (see Experimental Example 1); an experiment on the inhibitory effect of probiotics on the expression of inflammatory cytokines in the intestines (see Experimental Example 2); an experiment on the anti-inflammatory effect on ear edema (see Experimental Example 3); and an experiment on the defense effect against respiratory damage caused by air pollutants such as fine dust (see Experimental Example 4 and FIG. 1). That is, the new strain disclosed herein may be usefully utilized as a pharmaceutical composition, health functional food, or health supplement food for the amelioration of immune disorders and the prevention or treatment of respiratory inflammatory diseases.

Claims

1. A pharmaceutical composition for ameliorating immune disorders and preventing or treating respiratory inflammatory diseases, the pharmaceutical composition comprising, as an active ingredient, one or more selected from the group consisting of a Lactobacillus plantarum KC3 strain (also referred to as “CKDB-KC3”, Accession number: KCTC13375BP), a culture thereof, a concentrate of the culture, and a dried material of the culture.

2. The pharmaceutical composition of claim 1, wherein the immune disorders are selected from diseases caused by a decrease in immune function due to anticancer therapy such as chemotherapy and radiation therapy, diseases caused by decreased immunity after bone marrow transplantation, AIDS due to damage to an immune system, and cancer diseases caused by a decrease in immune function.

3. The pharmaceutical composition of claim 1, wherein the respiratory inflammatory diseases are selected from the group consisting of rhinitis, otitis media, sore throat, tonsillitis, pneumonia, asthma, and chronic obstructive pulmonary disease (COPD).

4. A health functional food for ameliorating immune disorders and preventing or treating respiratory inflammatory diseases, the health functional food comprising, as an active ingredient, one or more selected from the group consisting of a Lactobacillus plantarum KC3 strain (also referred to as “CKDB-KC3”, Accession number: KCTC13375BP), a culture thereof, a concentrate of the culture, and a dried material of the culture.

5. The health functional food of claim 4, wherein the health functional food is in the form of powder, granules, tablets, capsules, pills, suspensions, emulsions, syrups, tea bags, leached teas, or health beverages.

6. A health supplement food for ameliorating immune disorders and preventing or treating respiratory inflammatory diseases, the health supplement food comprising, as an active ingredient, one or more selected from the group consisting of a Lactobacillus plantarum KC3 strain (also referred to as “CKDB-KC3”, Accession number: KCTC13375BP), a culture thereof, a concentrate of the culture, and a dried material of the culture.

7. A food for ameliorating immune disorders and preventing or treating respiratory inflammatory diseases, the food comprising, as an active ingredient, one or more selected from the group consisting of a Lactobacillus plantarum KC3 strain (also referred to as “CKDB-KC3”, Accession number: KCTC13375BP), a culture thereof, a concentrate of the culture, and a dried material of the culture.

8. A food additive for ameliorating immune disorders and preventing or treating respiratory inflammatory diseases, the food additive comprising, as an active ingredient, one or more selected from the group consisting of a Lactobacillus plantarum KC3 strain (also referred to as “CKDB-KC3”, Accession number: KCTC13375BP), a culture thereof, a concentrate of the culture, and a dried material of the culture.

9. A method of ameliorating immune disorders and treating a patient having a respiratory inflammatory disease, the method comprising administering one or more selected from the group consisting of a Lactobacillus plantarum KC3 strain (also referred to as “CKDB-KC3”, Accession number: KCTC13375BP), a culture thereof, a concentrate of the culture, and a dried material of the culture, to a patient having an immune disorder and a respiratory inflammatory disease.

10. Use of one or more selected from the group consisting of a Lactobacillus plantarum KC3 strain (also referred to as “CKDB-KC3”, Accession number: KCTC13375BP), a culture thereof, a concentrate of the culture, and a dried material of the culture, for preparation of a drug for amelioration of immune disorders and treatment of respiratory inflammatory diseases.

Description

BRIEF DESCRIPTION OF DRAWINGS

[0110] FIG. 1 shows results of an experiment on the effects on a ratio of neutrophils to the total number of cells in bronchoalveolar lavage (BAL) fluid;

[0111] FIG. 2 shows a deposit certificate of Lactobacillus plantarum KC3;

[0112] FIG. 3 shows results of an experiment on bile tolerance against the Lactobacillus plantarum KC3 strain of the present disclosure (wherein all numerical values (or data) are the mean±standard deviation of 3 repetitions, and * represents a case of p<0.05 between with oxgall and without oxgall); and

[0113] FIG. 4 shows results of an experiment on pH resistance against the L Lactobacillus plantarum KC3 strain of the present disclosure.

BEST MODE

[0114] It would be obvious to one of ordinary skill in the art that various modifications and variations may be made for compositions, use, and preparation of the present disclosure without departing from the spirit or scope of the present disclosure.

[0115] One or more embodiments of the present disclosure are described in detail, but it should be understood that the present disclosure is not limited to those embodiments in any manner.

[0116] However, embodiments and experimental examples below are merely examples without limiting the scope of the present disclosure, and the present disclosure is not limited to those embodiments and experimental examples.

Example 1. Isolation of New Lactic Acid Bacteria from Lactobacillus plantarum KC3

[0117] 1-1. Preparation of Raw Materials of Kimchi

[0118] For use as cabbage kimchi which is a raw material of the present disclosure, kimchi for family use in North Jeolla Province was prepared according to the following process using materials all purchased from a local mart (Hanaro Mart, Wansan-gu, Jeonju-si).

[0119] (1) Step 1: Five Chinese cabbages (about 1 kg each) were prepared and cut into two pieces after getting rid of inedible portions. 500 g of salt was dissolved in water in a container for salting. The divided Chinese cabbage pieces were soaked in salted water, and after being taken out of the salted water, salt was sprinkled in layers between cabbage leaves. The Chinese cabbages were then salted for 5 to 6 hours, washed with clean water 3 to 4 times, and placed on a large colander for dehydration.

[0120] (2) Step 2: Two Chinese radishes (about 1.2 kg each) were prepared, trimmed and washed after getting rid of radish leaves, and then cut into thin strips in 4-5 cm long. Half bundle of great green onions (about 0.5 kg), half bundle of chives (about 0.5 kg), and half bundle of mustard leaves (about 0.5 kg) were also trimmed and washed, and cut into the same length as the radish strips.

[0121] (3) Step 3: 50 g of garlic, 10 g of ginger, and 200 g of salted shrimp were finely minced, and 300 ml (about 200 g) of anchovy sauce was prepared. Rice porridge was cooked with 150 g of glutinous rice soaked in water. After cooling the rice porridge, the prepared anchovy sauce and the minced salted shrimp, garlic, and ginger were added thereto with 500 g of red pepper powder, and all the seasonings were mixed evenly.

[0122] (4) Step 4: After putting and mixing all the radish strips, great green onion, chives, and mustard leaves that were all cut to the similar length as in Step 2, kimchi seasoning was made by seasoning with salt (about 0.5 kg) and sugar (about 0.5 kg).

[0123] (5) Step 5: After spreading the kimchi seasoning evenly between the Chinese cabbage leaves, the Chinese cabbage was rolled by the outermost leaf. Then, the Chinese cabbage was placed one by one in a container in a way that the cross section of the Chinese cabbage faced up, and the container was stored in a low-temperature storage (0° C. to −2° C.) so as to ripen the kimchi for 1 year, thereby producing raw materials for the Chinese cabbage kimchi.

[0124] 1-2. Isolation of New Microorganism

[0125] Regarding isolation and identification processes for the Lactobacillus plantarum KC3 strain of the present disclosure, the raw materials for the Chinese cabbage kimchi of Section 1-1 were inoculated by 0.1 ml each onto an MRS sodium medium (supplemented with MRS medium (DF0881-17-5, Difco) and 1.5% agar (214010, Difco)) to which bromocresol purple (114375, Sigma) and sodium azide (S2002, sigma) were diluted with a peptone diluent (MB-B2220, MB cell) and added, by a streak-plate method. After culturing in an anaerobic condition at 37° C. for 48 hours, colonies that turned yellow in the medium were selected as tentative lactic acid bacteria.

[0126] As a result of identifying the isolated strain, it was confirmed that the strain was a gram-positive facultative anaerobic Bacillus was negative for the catalase and motility.

[0127] It was also confirmed that the strain did not grow at 15° C. and 45° C., and based on that no gas from glucose and no ammonia from arginine were produced, the strain was confirmed to belong to the genus Lactobacillus.

[0128] 1-3. Identification of Microorganism (Based on Analysis of Glucose Utilization and 16s rRNA Identification)

[0129] 1-3-1. Analysis of Glucose Utilization

[0130] The glucose utilization of the selected lactic acid bacteria was analyzed using an API CHL50 kit (50300, bioMerieux). As a result of the analysis, it was confirmed that, as shown in Table 1 below, glucose from D-ribose, D-galactose, D-glucose, D-fructose, D-mannose, D-mannitol, D-sorbitol, methyl-αD-mannopyranoside, amyglandine, albutine, esculin ferric citrate, D-cellobiose, D-maltose, D-lactose, D-melibiose, D-saccharose, D-trehalose, D-melezitose, and D-raffinose was utilized.

TABLE-US-00001 TABLE 1 Glucose Utilization Glucose Utilization Control − Esculin ferric + citrate Glycerol − Salicin ± Erythritol − D-Celiobiose + D-Arabinose − D-Maltose + L-Arabinose − D-Lactose + D-Ribose + D-Melibiose + D-Xylose − D-Saccharose + L-Xylose − D-Trehalose + D-Adonitol − Inulin − Methyl-βD- − D-Melezitose + Xylopyranoside D-Galactose + D-Raffinose + D-Glucose + Amidon − D-Fructose + Glycogen − D-Mannose + Xylitol − L-Sorbose − Gentiobiose ± L-Rhamnose − D-Turanose − Dulcitol − D-Lyxose − Inositol − D-Tagatose − D-Mannitol + D-Fucose − D-Sorbitol + L-Fucose − Methyl-αD- + D-Arabitol − Mannopyranoside Methyl-αD- − L-Arabitol − Glucopyranoside N-AcetylGlucosamine ± potassium Gluconate − Amygdalin + potassium − 2-KetoGluconate Arbutin + potassium − 5-KetoGluconate

[0131] 1-3-2. 16s rRNA Identification

[0132] The colonies grown on the MRS solid medium (supplemented with MRS medium (DF0881-17-5, Difco) and 1.5% agar (214010, Difco)) were collected and subjected to double-stranded DNA sequencing (Solgent, Korea). As a result of identifying the strain by BLAST, the obtained nucleic acid sequence (SEQ ID NO: 1 in Table 2) showed a homology of 99% to the Lactobacillus plantarum, confirming that the new microorganism of the present disclosure was the strain (hereinafter also referred to as “new lactic acid bacteria from KC3” or “CKDB-KC3”).

TABLE-US-00002 TABLE 2 16s rRNA nucleic sequence of Lactobacillus plantarum KC3 SEQ 16s rRNA nucleic sequence of ID Lactobacillus plantarum KC3 NO. TATGGCTCAGGACGAACGCTGGCGGCGTGC 1 CTAATACATGCAAGTCGAACGAACTCTGGT ATTGATTGGTGCTTGCATCATGATTTACAT TTGAGTGAGTGGCGAACTGGTGAGTAACAC GTGGGAAACCTGCCCAGAAGCGGGGGATAA CACCTGGAAACAGATGCTAATACCGCATAA CAACTTGGACCGCATGGTCCGAGTTTGAAA GATGGCTTCGGCTATCACTTTTGGATGGTC CCGCGGCGTATTAGCTAGATGG TGGGGTAACGGCTCACCATGGCAATGATAC GTAGCCGACCTGAGAGGGTAATCGGCCACA TTGGGACTGAGACACGGCCCAAACTCCTAC GGGAGGCAGCAGTAGGGAATCTTCCACAAT GGACGAAAGTCTGATGGAGCAACGCCGCGT GAGTGAAGAAGGGTTTCGGCTCGTAAAACT CTGTTGTTAAAGAAGAACATATCTGAGAGT AACTGTTCAGGTATTGACGGTATTTAACCA GAAAGCCACGGCTAACTACGTGCCAGCAGC CGCGGTAATACGTAGGTGGCAAGCGTTGTC CGGATTTATTGGGCGTAAAGCGAGCGCAGG CGGTTTTTTAAGTCTGATGTGAAAGCCTTC GGCTCAACCGAAGAAGTGCATCGGAAACTG GGAAACTTGAGTGCAGAAGAGGACAGTGGA ACTCCATGTGTAGCGGTGAAATGCGTAGAT ATATGGAAGAACACCAGTGGCGAAGGCGGC TGTCTGGTCTGTAACTGACGCTGAGGCTCG AAAGTAT GGGTAGCAAACAGGATTAGATACCCTGGTA 1 GTCCATACCGTAAACGATGAATGCTAAGTG TTGGAGGGTTTCCGCCCTTCAGTGCTGCAG CTAACGCATTAAGCATTCCGCCTGGGGAGT ACGGCCGCAAGGCTGAAACTCAAAGGAATT GACGGGGGCCCGCACAAGCGGTGGAGCATG TGGTTTAATTCGAAGCTACGCGAAGAACCT TACCAGGTCTTGACATACTATGCAAATCTA AGAGATTAGACGTTCCCTTCGGGGACATGG ATACAGGTGGTGCATGGTTGTCGTCAGCTC GTGTCGTGAGATGTTGGGTTAAGTCCCGCA ACGAGCGCAACCCTTATTATCAGTTGCCAG CATTAAGTTGGGCACTCTGGTGAGACTGCC GGTGACAAACCGGAGGAAGGTGGGGATGAC GTCAAATCATCATGCCCCTTATGACCTGGG CTACACACGTGCTACAATGGATGGTACAAC GAGTTGCGAACTCGCGAGAGTAAGCTAATC TCTTAAAGCCATTCTCAGTTCGGATTGTAG GCTGCAACTCGCCTACATGAAGTCGGAATC GCTAGTAATCGCGGATCAGCATGCCGCGGT GAATACGTTCCCGGGCCTTGTACACACCGC CCGTCACACCATGAGAGTTTGTAACACCCA AAGTCGGTGGGGTAACCTTTTAGGAACCAG CCGCCTAAGGTGGGACAGATGATTAGGGTG AAGTCGTACA

[0133] 1-3-3. Characteristics of Microorganism

[0134] The characteristics of the new Lactobacillus plantarum KC3 according to the present disclosure are as follows:

[0135] (1) Form of bacteria [0136] Form of bacteria when cultured in MRS agar plate medium at 37° C. for 48 hours [0137] {circle around (1)} Cell type: Bacillus [0138] {circle around (2)} Mobility: None [0139] {circle around (3)} Spore-forming ability: None [0140] {circle around (4)} Gram staining: Positive

[0141] (2) Shape of colony [0142] Form of colonies when cultured in MRS agar plate medium at 37° C. for 48 hours [0143] {circle around (1)} Shape: Round [0144] {circle around (2)} Bulge: Convex [0145] {circle around (3)} Surface: Smooth [0146] {circle around (4)} Color: Milky-white

[0147] (3) Physiological properties [0148] {circle around (1)} Temperature for growth and development [0149] Temperature enable growth and development: 15° C. to 40° C. [0150] Optimal temperature for growth and development: 36° C. to 38° C. [0151] {circle around (2)} pH for growth and development [0152] pH enable growth and development: 4.6 to 7.5 [0153] Optimal pH: 6.0 to 7.0 [0154] {circle around (3)} Effect on oxygen: Facultative anaerobic

[0155] (4) Catalase: Negative

[0156] (5) Gas generation: Negative

[0157] (6) Indole production: Negative

[0158] (7) Lactic acid production: Positive

[0159] (8) Biogenic amine production: Negative [0160] Based on the results of the microorganism identification and the bacteria characteristics above, a new strain isolated from kimchi was named Lactobacillus plantarum KC3 and deposited at the Korea Research Institute of Bioscience and Biotechnology (Accession No: KCTC13375BP) on Oct. 20, 2017 (see FIG. 2).

Experimental Example 1. Characteristics of New Lactic Acid Bacteria from Lactobacillus plantarum KC3

[0161] 1-1. Tolerance Experiment of Stomach Acid and Bile Acid

[0162] Gastric acid secretion in gastric fluids and bile acid secreted from the pancreas are significantly important factors affecting the survival of microorganisms. Thus, in order to confirm gastric acid-resistance and bile acid-resistance of the new lactic acid bacteria from the Lactobacillus plantarum KC3 of the present disclosure, an experiment was performed as follows by applying the method described in the document. (Kararli, T T, Comparison of the gastrointestinal anatomy, physiology, and biochemistry of humans and commonly used laboratory animals. Biopharm Drug Dispos 1995 16(5):351-380. doi: 10.1002/bdd.2510160502)

[0163] It was a process of examining the resistance to artificial gastric fluids and bile to explore the possibility for use as probiotics, and then selecting and identifying strains having excellent activity and strong resistance.

[0164] FIG. 3 is a diagram showing the results of the bile-resistance test against the L. plantarum KC3 strain of the present disclosure.

[0165] More specifically, the Lactobacillus plantarum KC3 strain was grown in an MRS medium (with oxgall) containing 0.03% of bile (oxgall) and 0.05% of L-cysteine and an MRS medium (without oxgall) containing 0.05% of L-cysteine. All values (or data) are the mean±standard deviation for triplicate experiments, and * indicates a case where p<0.05 between with oxgall and without oxgall.

[0166] FIG. 4 is a diagram showing the results of pH resistance test against the Lactobacillus plantarum KC3 strain of the present disclosure.

[0167] More specifically, the figure shows the survival rate of the Lactobacillus plantarum KC3 strain after 3 hours in hydrochloric acid solution having a pH of 2.0, 3.0, 4.0 and 6.4, and as compared with the start point (or start time), * indicates a case of p<0.05, ** indicates a case of p<0.01, and *** indicates a case of p<0.001.

[0168] 1-2. Antibacterial Activity Experiment

[0169] In order to confirm antibacterial activity of the new lactic acid bacteria from the Lactobacillus plantarum KC3, an antibacterial activity experiment was performed.

[0170] The antibacterial activity experiment was to confirm the inhibitory activity against Escherichia coli, Salmonella typhimurium, Staphylococcus aureus, and Listeria monocytogenes. The antibacterial activity was considered better when having stronger inhibitory activity against harmful bacterial.

[0171] Table 3 shows the experimental results about the antibacterial activity of the Lactobacillus plantarum KC3 strain, wherein the initial number of bacteria of the Lactobacillus plantarum KC3 strain was about 2.10±0.17×10.sup.6 CFU/mL, and the results were obtained after 6 hours of the experiments at 37° C. Here, all values (or data) are the mean±standard deviation for triplicate experiments.

TABLE-US-00003 TABLE 3 Antibacterial activity of Lactobacillus plantarum KC3 Growth Pathogens KC3 + pathogens.sup.a Inhibi- Pathogens CFU/mL pH CFU/mL pH tion (%) Escherichia 3.23 ± 0.25 × 5.98 8.50 ± 0.05 × 4.84 73.98% coli 10.sup.6 10.sup.5 Salmonella 6.46 ± 0.35 × 6.10 4.00 ± 0.26 × 5.25 38.14% Typhimurium 10.sup.6 10.sup.6 Listeria 1.57 ± 0.20 × 6.06 1.13 ± 0.06 × 4.94 27.97% monocytogenes 10.sup.5 10.sup.5 Staphyloccous 3.46 ± 0.87 × 6.08 2.83 ± 0.61 × 4.9 18.27% aureus 10.sup.6 10.sup.6

[0172] 1-3. Antibiotics Resistance Experiment

[0173] In order to confirm antibiotics resistance level of the new lactic acid bacteria from the of the Lactobacillus plantarum KC3 the present disclosure, an experiment was performed as follows by applying the method described in the document ([1] Mathur, S. and R. Singh, Antibiotic resistance in food lactic acid bacteria—A review. Int. J. Food Microbiol 2005 105: 281-295); [2] European Food Safety Authority, Guidance on the assessment of bacterial susceptibility to antimicrobials of human and veterinary importance: EFSA Panel on Additives and Products or Substances used in Animal Feed (FEEDAP). The EFSA Journal 2012 2740:1-10. doi:10.2903/j.efsa.2012.2740).

[0174] To measure the antibiotics resistance level of the strain, an MIC test was carried out. Lactic acid bacteria that were inoculated into an MRS medium (DF0881-17-5, Difco) and cultured at 37° C. for 18 hours were spread on an LSM solid medium (90% iso-sensitest broth (CM0473, Oxoid), 10% MRS medium (DF0881-17-5, Difco), and 1.5% agar (214010, Difco)). Strips for each type of antibiotics, such as Amikacin (92018, Liofilchem srl), Gentamycin (92009, Liofilchem srl), Kanamycin (92034, Liofilchem srl), Streptomycin (92112, Liofilchem srl), Penicillin-G (92102, Liofilchem srl), Oxacillin (92015, Liofilchem srl), Ampicillin (920030, Liofilchem srl), Bacitracin (92019, Liofilchem srl), Rifampicin (92001, Liofilchem srl), Polymyxin B (92004, Liofilchem srl), Chloramphenico I (92075, Liofilchem srl), Vancomycin (92057, Liofilchem srl), and the like, were put on the medium, and the bacteria were grown at 37° C. for 24 hours. Then, a section where a clear zone disappeared was observed with the naked eyes, and an MIC was measured therefrom.

[0175] Table 4 shows the results of the antibiotics resistance of the Lactobacillus plantarum KC3 strain. In Table 4, R indicates resistance and represents that the size of an inhibition zone is about 0 mm; IS indicates medium resistance and represents that the size of an inhibition zone is in a range of about 1 mm to about 5 mm; and S indicates resistance and represents that the size of an inhibition zone is greater than about 5 mm.

TABLE-US-00004 TABLE 4 Antibiotics resistance of Lactobacillus plantarum KC3 Anti-microbial Antibiotic Anti-microbial Antibiotic agents resistance agents resistance Aminoglycosides Gram-positive- IS (4 mm) spectrum Amikacin IS (1 mm) Bacitracin S (7 mm) Gentamycin IS (3 mm) Rifampicin S (7 mm) Kanamycin R (0 mm) Novabiocin S (7 mm) Neomycin IS (3 mm) Lincomycin S (10 mm) Streptomycin R (0 mm) Gram-negative spectrum β-lactams Polymyxin B R (0 mm) Penicillin-G IS (5 mm) Broad spectrum Oxacillin IS (2 mm) Chloramphenicol S (10 mm) Ampicillin S (14 mm) Vancomycin R (0 mm)

[0176] 1-4. Biogenic Amine Producibility Experiment

[0177] To confirm biogenic amine producibility of the new lactic acid bacteria from the Lactobacillus plantarum KC3 of the present disclosure, an experiment was performed as follows by applying the method described in the document (Bover-Cid S, Holzapfel W H, Improved screening procedure for biogenic amine production by lactic acid bacteria. Int J Food Microbiol 1999 53:33-41. doi:10.1016/S0168-1605(99)00152-X).

[0178] Biogenic amines are produced by fermentation of food and may vary depending on a type of microorganisms or chemical and physical conditions. Since biogenic amines produced in fermented food can cause food poisoning or allergic reactions, the biogenic amines are considered as important criteria for selecting a safe strain for food engineering ([1] Ladero V et al., Toxicological effects of dietary biogenic amines. Curr Nutr Food Sci. 2010 6:145-156. 10.2174/157340110791233256; [2] European Food Safety Authority, Scientific Opinion on risk-based control of biogenic amine formation in fermented foods: EFSA Panel on Biological Hazards. The EFSA Journal 2011 9:1-93. doi:10.2903/j.efsa.2011.2393).

[0179] In this regard, to confirm whether the strain of the present disclosure has formed the biogenic amines, the strain grown in an MRS liquid medium (DF0881-17-5, Difco) at 37° C. for 6 hours was transferred to a specialized medium as described in the document (Bover-Cid S, Holzapfel W H, Improved screening procedure for biogenic amine production by lactic acid bacteria. Int J Food Microbiol 1999 53:33-41. doi:10.1016/S0168-1605(99)00152-X), and then, cultured at 37° C. for 48 hours.

[0180] An MRS liquid medium (DF0881-17-5, Difco) to which an amino acid precursor for each of tyrosine (SIGMA, T1145), histidine (SIGMA, H5659), ornithine (SIGMA, O2375), and lysine (DAEJUNG, 5093-4105) was added was prepared. In each medium, it was confirmed whether the biogenic amines, i.e., tyramine, histamine, putrescine, and cadaverine, were produced by the strain. In detail, into an MRS liquid medium (DF0881-17-5, Difco) to which 0.1% of the amino acid precursor was added, 1% of the isolated Lactobacillus plantarum strain was, and then sub-cultured 5 times to 10 times.

[0181] The resulting strain was then spread on a biogenic amine identification medium [prepared by mixing 0.5% of tryptone, 0.5% of yeast extract, 0.5% of cocoon extract, 0.5% of sodium chloride, 0.25% of glucose, 0.05% of tween-80, 0.02% of magnesium sulfate, 0.005% of manganese sulfate, 0.004% of iron sulfate, 0.2% of citric acid salt, 0.001% of thiamine, 0.2% of K.sub.2PO.sub.4, 0.01% of calcium carbonate, 0.005% of pyridoxal-5-phosphate, 1% of amino acid, 0.006% of bromocresol purple, and 2% of agar with distilled water and adjusting the pH to 5.3 for use], and cultured at 37° C. for 24 hours to 48 hours. Then, by checking whether the color changes to purple, the biogenic amine producibility of the strain was determined.

[0182] Bromocresol purple contained in a decarboxylase medium is yellow at pH 5.2, but turns purple as the pH increases to 6.8. Thus, based on the color that turns purple as the pH increases by the production of the biogenic amines, the production of the biogenic amines was confirmed.

[0183] Table 5 below shows the results of analyzing the biogenic amine producibility of the Lactobacillus plantarum KC3 strain. As shown in Table 4, it was confirmed that the strain was negative for all of putrescine, tyramine, histamine, and cadaverine. Accordingly, it was confirmed that the strain of the present invention had no ability to produce the biogenic amines that can induce hypersensitive immune responses.

TABLE-US-00005 TABLE 5 Biogenic amine producibility of Lactobacillus plantarum KC3 Biogenic amines Strain Putrescine Tyramine Histamine Cadaverine KC3 — — — —

Experimental Example 2: Inhibitory Effect of Probiotics on Expression of Intestinal Inflammatory Cytokines

[0184] In order to confirm whether the probiotics Lactobacillus plantarum KC3 (KC3) inhibits mRNA expression of an inflammatory cytokine induced by LPS, RT-PCR was performed as follows by applying the method described in the document. (Verma N et al., Profiling of ABC transporters during active ulcerative colitis and in vitro effect of inflammatory modulators. Dig Dis Sci. 2013 August; 58(8):2282-92. doi: 10.1007/s10620-013-2636-7; [2] Bhattacharyya S et al., Lipopolysaccharide activates NF-kappaB by TLR4-Bcl10-dependent and independent pathways in colonic epithelial cells. Am J Physiol Gastrointest Liver Physiol. 2008 October; 295(4):G784-90. doi: 10.1152/ajpgi.90434.2008.])

[0185] 2-1. Experimental Method

[0186] HT-29 cells (KCBL No. 30038, large intestinal epithelial cell line, Human) were purchased from the Korean Cell Line Bank (KCLB, Seoul, Korea), and inoculated into a 6-well cell plate at a concentration of 1×10.sup.5 cell/mL and cultured in a cell incubator (Panasonic MCO-18AC-PK; under conditions of 37° C., 5% CO.sub.2) until a monolayer was formed.

[0187] Samples for Example spread on an MRS solid medium (containing MRS medium (DF0881-17-5, Difco) and 1.5% agar (214010, Difco)) which is a freezing stock. After culturing 37° C. for 24 hours, colonies that were confirmed to be purely isolated were collected with a platinum loop and cultured in an MRS liquid medium (DF0881-17-5, Difco) at 37° C. for 18 hours to 24 hours.

[0188] The culture medium that has been completely cultured was subjected to centrifugation to remove the supernatant, and then, was washed with PBS twice to obtain bacterial cells only. The bacterial cells were diluted at a concentration of 1×10.sup.8 CFU/mL in an antibiotics-free and FBS-free DMEM cell culture medium (GenDEPOT, CM003-050). When the cells reached confluency, 20 μl of each bacterial suspension was dispensed into the cells and cultured in a cell incubator (Panasonic MCO-18AC-PK; under conditions of 37° C. and 5% CO.sub.2). Afterwards, a washing process was performed thereon twice, each using PBS, and an LPS-containing cell medium was dispensed thereinto and allowed for a reaction for 16 hours.

[0189] After completion of the reaction, cells were detached by treatment with trypsin-EDTA (Gibco, 25200056). Then, RNA was extracted from the cells by using a commercially available kit (Promega, Z6010), and cDNA was synthesized.

[0190] Next, mRNA expression levels of inflammatory cytokines were confirmed through RT-PCR. The genomic nucleic sequences used for PCR analysis are listed in Table 6.

TABLE-US-00006 TABLE 6 Genomic nucleic sequence for PCR analysis Se- Target quence gene Primer Sequences I.D. β-actin Forward 5′-AGGTGAAGGTCGGAGTCAACG-3′ 2 Reverse 5′-GCTCCTGGAAGATGGTGATGG-3′ 3 IL-1β Forward 5′-ACAGATGAAGTGCTCCTTCCA-3′ 4 Reverse 5′-GTCGGAGATTCGTAGCTGGAT-3′ 5 TNFa Forward 5′-GAAAGCATGATCCGGGACGTG-3′ 6 Reverse 5′-GATGGCAGAGAGGAGGTTGAC-3′ 7 See, Jinsil Choo. (2016) A study on the role of high-fat diet inducec Fabp6 in colon cancer cell growth, (Masters dissertation). Sookmyung Women's University, Seoul, Republic of Korea; Li J et al., Regulation of IL-8 and IL-1β expression in Crohn's disease associated NOD2/CARD15 mutations. Hum Mol Genet. 2004 Aug. 15; 13(16): 1715-25; Hossen MJ et al., Thymoquinone: An IRAKI inhibitor with in vivo and in vitro anti-inflammatory activities. Sci Rep. 2017 Feb. 20; 7:42995. doi: 10.1038/srep42995.

[0191] 2-2. Experiment Results

[0192] As a result of the experiment above, it was confirmed as shown that the probiotics Lactobacillus plantarum KC3 (KC3) as in the example of the present disclosure exhibited effects of significantly inhibiting the expression of inflammatory cytokines (IL-1β and TNFα) that were increased by LPS using the HT-29 cell line (see Table 7)

TABLE-US-00007 TABLE 7 Inhibitory effect on expression of cytokines IL-1β TNFα Control 0.068 ± 0.006 0.033 ± 0.005 LPS 1.015 ± 0.248 1.000 ± 0.032 LGG 0.758 ± 0.147 1.223 ± 0.052 KC3 0.438 ± 0.005 0.216 ± 0.124 LGG: Lactobacillus rhamnosus GG (positive control group)

Experimental Example 3: Anti-Inflammatory Effect Test on Ear Edema

[0193] To confirm anti-inflammatory effect of the probiotic lactic acid bacteria (Lactobacillus plantarum KC3, KC3) on ear edema, an experiment was performed according to the croton oil-induced mouse ear edema method by applying the method described in the document (Dong Wook Kim, Kun Ho Son, Hyeun Wook Chang, KiHwan Bae and Sam Sik Kang, Arch Pharm Res., 2003, 3, pp 232-236).

[0194] 3-1. Experimental Method

[0195] To evaluate anti-inflammatory activity of the samples of the Example above, a croton oil-induced mouse ear edema test was carried out, and results thereof were obtained by measuring the ear thickness of the samples as shown in Table 8. Croton oil causes inflammation generating rubefaction, swelling, and blisters when applied to the skin (Dong Wook Kim, Kun Ho Son, Hyeun Wook Chang, KiHwan Bae and Sam Sik Kang, Arch Pharm Res., 2003, 3, pp 232-236).

[0196] 6-week-old male ICR mice weighing between 25 g and 28 g (Orient Bio Inc., Korea) were separated for each experimental group. Lactic acid bacteria of Lactobacillus plantarum KC3 (KC3) of Comparative Examples and Examples were diluted in distilled water, and were orally administered at a dose of 300 μl per day for 5 days. In the same way, the administration was performed for a negative administration control group (distilled water administration group) and a positive control material, i.e., cyclooxygenase (COX) inhibitor Indomethacin (10 mg/kg, Sigma).

[0197] About 1 hour after administration, 2.5% croton oil (C0421 available from TCI Company, 25 mL) dissolved in acetone was applied evenly to the inside and outside of the right ear of each mice to induce ear edema. After about 4 hours of the induction of edema, the mice were anesthetized with CO.sub.2 and sacrificed. Then, the degree of edema in the ears of the mice was measured according to variations in speed by measuring the thickness of both ears using a thickness gauge (Digimatic thickness gauge, 547-301, Mitutoyo, Japan). Here, based on the degree of and the inhibition rate (%) was calculated based on the degree of edema of the mice in the negative control group (0.5% sodium carboxymethyl cellulose (CMC), Sigma-Aldrich 419273), inhibition rates (%) were calculated, and results thereof are shown in Table 8 below.

[0198] 3-2 Experiment Results

[0199] As a result of the experiment above, it was confirmed that the probiotic lactic acid bacteria from the Lactobacillus plantarum KC3 (KC3) prepared in the Examples of the present disclosure had a significant anti-edema effect in an animal model, i.e., the mice having croton oil-induced inflammation of the ear edema.

TABLE-US-00008 TABLE 8 Anti-inflammatory inhibition effect on ear edema Inhibition rate Dosage for oral of ear edema administration Thickness (% of control) Normal control Distilled water 0.329 ± 0.032 — group Control group Induction of ear edema 0.806 ± 0.068 — Positive control 10 mg/kg BW 0.684 ± 0.054 25.6 ± 2.2 group (Indomethacin) Example 1 1 × 10.sup.9 CFU/mouse 0.751 ± 0.057 11.5 ± 1.0 2 × 10.sup.9 CFU/mouse 0.693 ± 0.051 23.7 ± 2.4

Experimental Example 4: Protective Effect Against Respiratory Damage Caused by Air Pollutants Such as Fine Dust

[0200] To confirm protective effects of the probiotic lactic acid bacteria (Lactobacillus plantarum KC3, KC3) against respiratory damage caused by air pollutants such as fine dust, an experiment was carried out as follows by applying the method described in the existing document.

[0201] 4-1. Experimental Method in Mouse Model Having Respiratory Damage

[0202] BALb/c male mice (Orient Bio Inc., 8-week-old) were divided into groups of 6 mice, and for all groups except for the normal group, components of air pollutants, i.e., 10 mg/ml of coal combustible materials, 10 mg/ml of fly ash, and 5 mg/ml of diesel exhaust particle (DEP) were diluted so that a final concentration of Alum was 1%, and so that a final concentration of each component was 1.5 mg/ml for coal combustible material/fly ash and 5 mg/ml for DEP in a mixture. Then, on each of the 4.sup.th, 7.sup.th, and 10.sup.th days from the start of the experiment, 50 μl of the mixture was directly injected into the airway and nose of the experimental animals according to the Intra-Nazal-Trachea (INT) injection method described in the document (Lim et al., Free Radic Biol Med. 25(6), 635-644. (1998), Shin et al., Korean J. Medicinal Crop Sci 27(3), 218-231. (2019)).

[0203] For a positive control group (dexamethasone, Sigma D2915), lactic acid bacteria (Lactobacillus plantarum KC3, KC3) was diluted at a concentration of 1×10.sup.9 CFU/mouse in a solution containing 0.5% sodium carboxymethyl cellulose (CMC, 419273, Sigma-Aldrich), and then orally administered at a dosage of 3 mg per kg of body weight (BW) per day (for 11 days). On the 12.sup.th day after the start of the experiment, an autopsy was performed on the mice, and bronchoalveolar lavage (BAL) fluid was collected.

[0204] 4-2. Measurement of Total Number of Cells in BAL Fluid

[0205] 4-2-1. Experiment Method

[0206] To confirm effects of the samples in Examples above on the total number of cells in BAL fluid, an experiment was carried out as follows by applying the method described in the document (Schins et al., Toxicol Appl Pharmacol. 195(1), 1-11 (2004) and Smith et al., Toxicol Sci, 93(2), 390-399 (2006)).

[0207] 4-2-2. Experiment Results

[0208] The results of measuring the effects of the samples on the total number of cells in the BAL fluid are shown in Table 9 below. Compared to the bronchial damage-induced group by air pollutants, the total number of cells in the BAL fluid was significantly reduced by administration of the probiotic lactic acid bacteria from the Lactobacillus plantarum KC3 (KC3), thereby confirming that the sample had inhibitory activity on the bronchial inflammation.

TABLE-US-00009 TABLE 9 Experiment results of effects on the total number of cells in total bronchoalveolar lavage (BAL) fluid Inhibition rate Total BAL cell (based on Division (×10.sup.4 cells/ml) induction group) Normal control group 16.7 ± 0.93 Induction group 81.2 ± 19.8 Positive control group 72.6 ± 9.5  11% Lactobacillus plantarum 63.6 ± 8.9  22% KC3

[0209] 4-3. Measurement of Ratio of Number of Neutrophils to Total Number of Cells in BAL Fluid

[0210] 4-3-1. Experiment Method

[0211] To confirm effects of the samples in Examples above on a ratio of the number of neutrophils to the total number of cells in BAL fluid, an experiment was carried out as follows by applying the method described in the document (Schins et al., Toxicol Appl Pharmacol. 195(1), 1-11 (2004) and Smith et al., Toxicol Sci, 93(2), 390-399 (2006)).

[0212] The experiment was carried out in the same manner as in Experimental Examples 4-1 and 4-2. From the collected BAL fluid, the neutrophils were observed after staining according to a Diff-Qick staining method (Takano et al., Am J Respir Crit Care Med, 156(1), 36-42(1997), Hemacolor Rapid staining of blood smear, 1.11661.0001, Merck).

[0213] 4-3-2. Experiment Results

[0214] The results of measuring the effects of the samples on the ratio of the number of neutrophils, which are inflammatory immune cells, to the total number of cells in the BAL fluid are shown in Table 10 below. The total number of neutrophils that have increased by air pollutants was significantly reduced by administration of the probiotic lactic acid bacteria from Lactobacillus plantarum KC3 (KC3), thereby confirming that the sample had inhibitory activity on the bronchial inflammation (see Table 10 and FIG. 1).

TABLE-US-00010 TABLE 10 Experiment results of effects on number of neutrophils to total number of cells in BAL fluid Neutrophile No of Inhibition rate (based on Division BAL cel (400X) induced group) Normal control group  0.1 ± 0.1 Induction group 119 ± 13 Positive control group 108 ± 9  10% Lactobacillus plantarum 68 ± 7 43% KC3

[0215] 4-4. Measurement of Expression Levels of Inflammation Factors in BAL Fluid

[0216] 4-4-1. Experiment Method

[0217] To confirm effects of the samples in Examples above on expression levels of inflammation factors in the BAL fluid, an experiment was carried out as follows by applying the method described in the document (Brandt E B et al., J. Allergy Clin. Immunol., 132(5):1194-1204, (2013)).

[0218] An evaluation test was performed using ELISA to measure the expression levels of inflammation factors, such as IL-17A, TNF-α MIP2, and CXCL-1, in the BAL fluid.

[0219] The experiment was carried out in the same manner as in Experimental Examples 4-2 and 4-3, except that the number of cells in the BAL fluid was measured.

[0220] The expression levels of IL-17A, TNF-α MIP2, and CXCL-1 in the BAL fluid were measured using ELISA. IL-17A antibodies (M1700, R&D Systems, Minneapolis, USA), TNF-α antibodies (MTA00B, R&D Systems, Minneapolis, USA), MIP2 antibodies (MM200, R&D Systems, Minneapolis, USA), and CXCL-1 antibodies (MKC00B, R&D Systems, Minneapolis, USA) were diluted with a buffer solution and coated micro-wells, and then cultured at 4° C. for 16 hours. Each well was washed with a washing buffer solution three times, and 10-fold diluted serum was dispensed at 100 μl per well.

[0221] After being left at room temperature for one hour, the wells were washed twice. Then, 100 μl of Avidin-HRP-conjugated antibodies (DY007, R&D Systems, Minneapolis, USA) was treated thereon, and the wells were left again at room temperature for one hour, followed by washing again. A TMB substrate solution (DY007, R&D Systems, Minneapolis, USA) was dispensed at 100 μl per well, and the well plate was left in shadow for 30 minutes. Then, 50 μl of a stopping solution (DY007, R&D Systems, Minneapolis, USA) was treated thereon, and absorbance of the cells was measured at 450 nm.

[0222] 4-4-2. Experiment Results

[0223] The results of measuring the levels of inflammation biomarkers, such as IL-17A, TNF-α, MIP2, and CXCL-1, in the BAL fluid are shown in Table 11 below. The levels of the inflammation biomarkers (i.e., IL-17A, TNF-α, MIP2, and CXCL-1) that have increased by air pollutants were significantly reduced by the administration of the probiotic lactic acid bacteria from Lactobacillus plantarum KC3 (KC3), thereby confirming that the sample significantly defended against bronchial inflammation and damage.

TABLE-US-00011 TABLE 11 Experiment results of effects on expression of inflammation factors in BAL fluid Concentration (pg/ml)/inhibition rate (%) based on induced group Division IL-17A TNF-α MIP2 CXCL-1 Normal control 6.3 ± 0.9 79 ± 6 49 ± 4 87 ± 4 group Induction group 13.4 ± 1.5  366 ± 45 68 ± 7 327 ± 41 Positive control 7.0 ± 0.8 121 ± 14 55 ± 9 174 ± 15 group (47%) (66%) (19%) (46%) Lactobacillus 6.9 ± 0.7 134 ± 13 59 ± 7 121 ± 16 plantarum (48%) (63%) (13%) (63%) KC3

Mode of Disclosure

[0224] Hereinafter, a formulation method and kinds of carriers will be described, but the present disclosure is not limited thereto. The representative preparation examples will be described.

[0225] Preparation examples of a composition including a sample of the present disclosure are described, but the present disclosure is not limited thereto. These preparation examples are merely described in detail.

Formulation Example 1. Preparation of Powder

[0226]

TABLE-US-00012 New lactic acid bacteria from KC3  20 mg Lactose 100 mg Talc  10 mg

[0227] The components above were mixed and filled in an airtight bag to prepare a powder.

Formulation Example 2. Preparation of Tablet

[0228]

TABLE-US-00013 New lactic acid bacteria from KC3  10 mg Corn starch 100 mg Lactose 100 mg Magnesium stearate  2 mg

[0229] The tablet was prepared by mixing the above components and en-tableting the same, according to an existing tablet formation method.

Formulation Example 3. Preparation of Capsule

[0230]

TABLE-US-00014 New lactic acid bacteria from KC3 10 mg Crystalline cellulose 3 mg Lactose 14.8 mg Magnesium stearate 2 mg

[0231] A capsule was prepared by mixing the components above and filling a gelatin capsule with the mixture, according to an existing capsule formation method.

Formulation Example 4. Preparation of Injection

[0232]

TABLE-US-00015 New lactic acid bacteria from KC3 10 mg Mannitol 180 mg Sterile distilled water for injection 2,974 mg Na.sub.2HPO.sub.4, 12H2O 26 mg

[0233] According to an existing injection formation method, an injection was prepared based on the component contents above per 1 ampoule (2 ml).

Formulation Example 5. Preparation of Liquid Formulation

[0234]

TABLE-US-00016 New lactic acid bacteria from KC3 20 mg Isomerized glucose syrup 10 g Mannitol 5 g Purified water optimum amount

[0235] According to an existing preparation method for a liquid formulation, each component was added to purified water and dissolved therein, and an optimum amount of lemon flavor was added and mixed with the components above. Then, purified water was added thereto so that the total volume was adjusted to 100 ml, and the resultant solution filled in a brown bottle and sterilized, thereby preparing a liquid formulation.

Formulation Example 6. Preparation of Health Food

[0236]

TABLE-US-00017 New lactic acid bacteria from KC3 1,000 mg Vitamin mixture optimum amount Vitamin A acetate 70 μg Vitamin E 1.0 mg Vitamin B1 0.13 mg Vitamin B2 0.15 mg Vitamin B6 0.5 mg Vitamin B12 0.2 μg Vitamin C 10 mg Biotin 10 μg nicotinic acid amide 1.7 mg Folic acid 50 μg calcium pantothenate 0.5 mg Mineral mixture optimum amount Ferrous sulfate 1.75 mg Zinc oxide 0.82 mg Magnesium carbonate 25.3 mg Monopotassium phosphate 15 mg Dicalcium phosphate 55 mg Potassium citrate 90 mg Calcium carbonate 100 mg Magnesium chloride 24.8 mg

[0237] A compositional ratio of vitamins and minerals in the mixture was provided as a preferable example using components relatively suitable for health food. However, such a mixture ratio may be arbitrarily modified considered without departing from the spirit and scope of the present disclosure.

Formation Example 7. Preparation of Health Beverage

[0238] New lactic acid bacteria from KC3 - - - 1,000 mg

[0239] Citric acid - - - 1,000 mg

[0240] Oligosaccharide - - - 100 g

[0241] Plum concentrate - - - 2 g

[0242] Taurine - - - 1 g

[0243] By addition of purified water - - - 900 ml in total

[0244] According to an existing method of preparing a health beverage, the components above were mixed and heated at 85° C. for about one hour while stirring. The prepared solution was filtered and collected in a sterilized 2 L container. The container was sealed, sterilized, and stored in a refrigerator to be used for the preparation of a health beverage composition.

[0245] The compositional ratio above was provided as a preferable example using components relatively suitable for beverages. However, depending on regional and ethnic preferences in terms of a demand class, a country of demand, and a purpose of use, such a mixing ratio may be arbitrarily modified.

[0246] As described above, the present disclosure may be varied in many ways, and such variations are not construed as a departure from the spirit and scope of the present disclosure. It would be apparent for those skilled in the art to understand that all such modifications intended to be included within the scope of the following claims of the present disclosure.

INDUSTRIAL APPLICABILITY

[0247] As described above, it was confirmed that the composition is useful as a pharmaceutical composition or a health functional food for ameliorating an immune disorder and preventing and treating a respiratory inflammatory disease by confirming that the lactic acid bacteria from the Lactobacillus plantarum KC3 strain exhibit excellent activities of ameliorating an immune disorder and inhibiting a respiratory inflammatory disease through animal experiments, such as an experiment on the characteristics of the new lactic acid bacteria from the Lactobacillus plantarum KC3 (Experimental Example 1); an experiment on the inhibitory effects of probiotics on the expression of inflammatory cytokines in the intestines (Experimental Example 2); an experiment on the anti-inflammatory effect on ear edema (Experimental Example 3); and an experiment on the defense effects against respiratory damage caused by air pollutants such as fine dust (Experimental Example 4). Accordingly, the composition may be useful as a pharmaceutical composition, a health functional food, or a health supplement food for ameliorating immune disorders and preventing and treating respiratory inflammatory diseases.