MICROORGANISM COMPRISING VARIANT LYSE AND METHOD OF L-AMINO ACID PRODUCTION USING SAME

20230072150 · 2023-03-09

    Inventors

    Cpc classification

    International classification

    Abstract

    Provided are a microorganism comprising variant LysE, and an L-amino acid producing method using same. The variant LysE may improve L-amino acid excretion and/or production capacity compared to a wild type.

    Claims

    1. A polypeptide, wherein the 65.sup.th amino acid from the N-terminus of the amino acid sequence of SEQ ID NO: 1, asparagine, is substituted with other amino acid.

    2. The polypeptide of claim 1, wherein the 65.sup.th amino acid, asparagine, is substituted with glutamic acid, arginine, valine, lysine, histidine, leucine, alanine, phenylalanine, aspartic acid, isoleucine, tryptophan, proline, cysteine, tyrosine, serine, threonine, methionine, glutamine, or glycine.

    3. The polypeptide of claim 1, having activity of L-amino acid L-amino acid exporter.

    4. A polynucleotide encoding the polypeptide of claim 1.

    5. The polynucleotide of claim 4, represented by the nucleic acid sequence of SEQ ID NO: 4.

    6. A recombinant vector comprising the polynucleotide of claim 4.

    7. An L-amino acid producing microorganism, comprising the polypeptide of claim 1, a polynucleotide encoding the polypeptide, or a recombinant vector comprising the polynucleotide.

    8. The L-amino acid producing microorganism of claim 7, wherein the polypeptide has activity of L-amino acid exporter.

    9. The L-amino acid producing microorganism of claim 7, wherein the polypeptide or the polynucleotide is derived from a microorganism belongs to the same species of the L-amino acid producing microorganism.

    10. The L-amino acid producing microorganism of claim 7, wherein the microorganism belongs to the genus of Corynebacterium or Escherichia.

    11. The L-amino acid producing microorganism of claim 7, wherein the microorganism is Corynebacterium glutamicum or Escherichia coli.

    12. The L-amino acid producing microorganism of claim 7, having an improved exporting ability or production potential of L-amino acid, compared to an unmodified microorganism.

    13. The L-amino acid producing microorganism of claim 8, wherein the L-amino acid is L-lysine, L-arginine, or a combination thereof.

    14. A method of producing an L-amino acid, the method comprising: culturing the L-amino acid producing microorganism claim 7 in a medium.

    15. The method of producing an L-amino acid of claim 14, further comprising, after the step of culturing, recovering the L-amino acid from the cultured microorganism, the medium, or both of them.

    16. The method of producing an L-amino acid of claim 14, wherein the L-amino acid is L-lysine, L-arginine, or a combination thereof.

    Description

    MODE FOR INVENTION

    [0061] Hereinafter, the present disclosure will be described in more detail with examples, but these examples are only for illustrative purpose and are not intended to limit the scope of the disclosure. It is obvious to a person skilled in the art that the examples described below may be modified without departing from the spirit of the disclosure.

    EXAMPLE 1

    Construction of Vector Library for Introduction of Mutation into ORF of lysE gene

    [0062] To find enzymes having improved L-lysine exporting ability, a vector library for obtaining mutated lysE genes were constructed as follows.

    [0063] Using Genemorphll Random Mutagenesis Kit (Stratagene), mutations were introduced into DNA fragments including lysE gene (711 bp; SEQ ID NO: 2), wherein 0 to 4.5 mutations/kb of the DNA fragment were introduced. Error-prone PCR was performed using a genomic DNA of Corynebacterium glutamicum ATCC 13032 (WT) as a template and using primers of SEQ ID NOS: 5 and 6 in Table 1. A PCR were performed for a reaction solution comprising genomic DNA (500 ng) of WT strain, primers (each 125 ng), Mutazyme II reaction buffer (1×), dNTP mix (40 mM), and Mutazyme II DNA polymerase (2.5 U) by 30 cycles of denaturing at 94° C. for 2 minutes, denaturing at 94° C. for 1 minute, annealing at 56° C. for 1 minute, and polymerizing at 72° C. for 30 seconds, and followed by polymerizing at 72° C. for 10 minutes. The DNA fragments obtained as above were reacted with restriction enzyme BamHI-HF (NEB) at 37° C. for 1 hour, ligated with pECCG117 vector (KR patent no. 10-0057684) which is treated with CIP (NEB) enzyme at 37° C. for 30 minutes, transformed into E. coli DH5α, and then, plated on LB solid medium supplemented with kanamycin (25 mg/l).

    [0064] After selecting 20 colonies of transformants, plasmids were obtained and subject to nucleic acid sequence analysis, to confirm that mutations were introduced into various loci with frequency of 0.5 mutations/kb. Finally, about 10,000 colonies of the transformed E. coli were collected, and plasmids were extracted therefrom using plasmid prep kit (QIAGEN) and named as p117-lysE(mt) library. In addition, a vector wherein a wild-type lysE is introduced into pECCG117 vector was prepared as a control for screening. Wild-type lysE gene fragments were obtained by PCR using primers of SEQ ID NOS: 5 and 6, to prepare p117-lysE(WT) vector as described as above. The PCR was performed as follows; denaturation at 94° C. for 2 minutes; 30 cycles of denaturation at 94° C. for 1 minute, annealing at 56° C. for 1 minute, and polymerization at 72° C. for 30 seconds, and followed by polymerization at 72° C. for 10 minutes.

    [0065] The nucleic acid sequences of the used primers are summarized in Table 1:

    TABLE-US-00001 TABLE 11 primer Nucleic acid sequence (5′ .fwdarw.′‘) SEQ ID NO: 5 CGGGATCCATGGTGATCATGGAAATCTTCATTAC SEQ ID NO: 6 AAGGATCCCTAACCCATCAACATCAGTTTG

    EXAMPLE 2

    Generation and Screening of Strain Introduced with Vector Library

    [0066] For generating strains wherein lysE gene was deleted from wild-type Corynebacterium glutamicum ATCC13032, a vector for lysE gene deletion was prepared. Specifically, a recombinant vector was prepared by ligating DNA fragments (each 600 bp) located at 5′ and 3′ ends of lysE gene with pDZ vector (U.S. Pat. No. 9,109,242 B2). Primers of SEQ ID NOS: 7 and 8 were synthesized based on the nucleic acid sequence (SEQ ID NO: 2) of lysE gene, and primers of SEQ ID NOS: 9 and 10 were synthesized corresponding to positions 600 bp away from them, respectively (Table 2).

    [0067] PCR was performed using a genomic DNA of Corynebacterium glutamicum ATCC13032 as a template and using primers of SEQ ID NOS: 7 and 9, to prepare DNA fragments of 5′ end of lysE gene. Similarly, PCR was performed using primers of SEQ ID NOS: 8 and 10, to prepare DNA fragments of 3′ end of lysE gene. The PCR were performed as follows; denaturation at 94° C. for 2 minutes; 30 cycles of denaturation at 94° C. for 1 minute, annealing at 56° C for 1 minute, and polymerization at 72° C. for 30 seconds, and followed by polymerization at 72° C. for 10 minutes. The amplified DNA fragments were purified using a PCR Purification kit (QIAGEN), and then, used as insertion DNA fragments for vector preparation.

    [0068] The insertion DNA fragment amplified by PCR as above and pDZ vector (U.S. Pat. No. 9,109,242 B2) which was treated with restriction enzyme Xbal and heated at 65° C. for 20 minutes were ligated using Infusion Cloning Kit, transformed into E. coli DH5α, and then, smeared on LB solid medium supplemented with kanamycin (25 mg/l). After selecting a colony transformed with a vector in which the target gene was inserted, by PCR using primers of SEQ ID NOS: 7 and 8, a plasmid was obtained therefrom by a conventional method for plasmid extraction, and named pDZ-ΔlysE.

    [0069] The nucleic acid sequences of the used primers are summarized in Table 2:

    TABLE-US-00002 TABLE 2 Primer Nucleic acid sequence (5′ -> 3′) SEQ ID NO: 7 GTACCCGGGGATCCTCTAGAGTCTGGAAAGGCT CTTTACG SEQ ID NO: 8 GCCTGCAGGTCGACTCTAGATCTAGTTTCCCAT CAACCATGT SEQ ID NO: 9 AAGTACTTCCATAGGTCACGTTTTCGCGGGTTT TGGAATC SEQ ID NO: 10 GATTCCAAAACCCGCGAAAACGTGACCTATGGA AGTACTT

    [0070] The prepared vector pDZ-ΔlysE was transformed into Corynebacterium glutamicum ATCC13032 by electric pulse method (Van der Rest et al., Appl. Microbiol. Biotecnol. 52:541-545, 1999), to prepare a mutated strain wherein lysE gene was deletion by homologous chromosome recombination. The obtained strain in which wherein lysE gene was deletion was named as Corynebacterium glutamicum 13032::ΔlysE.

    [0071] The 13032::ΔlysE strain was transformed with p117-lysE(mt) library prepared in Example 1 by electric pulse method, and smeared on complex plate medium supplemented with kanamycin (25 mg/l), to obtain about 1,000 colonies. To prepare control, 13032::ΔlysE strain was transformed with p117-lysE(WT) vector as described above.

    [0072] <Complex plate medium (pH 7.0)>

    [0073] Glucose 10 g, Peptone 10 g, Beef extract 5 g, Yeast extract 5 g, Brain Heart Infusion 18.5 g, NaCl 2.5 g, Urea 2 g, Sorbitol 91 g, agar 20 g (per liter of distilled water)

    [0074] The obtained 13032::ΔlysE p117(lysE(WT)) (control) and 13032:: ΔlysE_p117(lysE(mt)) libraries were respectively inoculated on 96-Deep Well Plate-Dome (Bioneer) including 400 ul1 of seed medium, and cultured in plate shaking incubator (TAITEC) under the conditions of 32° C and 12000 rpm for about 12 hours.

    [0075] <Seed medium (pH 7.0)>

    [0076] Glucose 20 g, Peptone 10 g, Yeast extract 5 g, Urea 1.5 g, KH.sub.2PO.sub.4 4 g, K.sub.2HPO.sub.4 8 g, MgSO.sub.4 7H.sub.2O 0.5 g, Biotin 100 μg, Thiamine HCl 1,000 μg, Calcium-pantothenate 2,000 μg, Nicotinamide 2,000 μg (per liter of distilled water)

    [0077] 1000 colonies incubated above were serially diluted with complex plate medium supplemented with 100 g/L of L-lysine hydrochloride, and subjected to MIC (minimum inhibitory concentration) test, thereby obtaining 9 colonies having significantly increased MIC compared to the control strain. Each colony was subjected to secondary screening. Each colony was cultured on 96-Deep Well Plate-Dome (Bioneer) including 400 ul of seed medium, and cultured in plate shaking incubator (TAITEC) under the conditions of 32° C and 12000 rpm for about 12 hours. The secondary screening was performed by adjusting the initial optical density (OD) of the finally cultured colonies as a same value, serial dilution with complex plate medium supplemented with 100 g/L of L-lysine hydrochloride, and MIC test. As a result, one colony having significantly increased MIC compared to the control strain, in which wild-type lysE gene was introduced, was selected and named as 13032::lysE(mt), which was used in the examples below.

    EXAMPLE 3

    Sequencing of Mutated lysE gene

    [0078] To analyze the nucleic acid sequences of genes inserted into strain 13032::lysE(mt) selected in Example 2, a gene fragment was amplified by PCR using primers of SEQ ID NOS: 11 and 12. The PCR was performed under the same conditions of Example 1, and the amplified DNA fragment was obtained using GeneAll Expin GEL SV kit (Seoul, KOREA) and subjected to nucleic acid sequence analysis.

    [0079] The nucleic acid sequences of the used primers are summarized in Table 3:

    TABLE-US-00003 TABLE 3 Primer Nucleic acid sequence (5' -> 3') SEQ ID NO: 11 CCTTCGAAGCTGCCTTCATC SEQ ID NO: 12 CTGGACAACAGCCTTGATTC

    [0080] The nucleic acid sequence analysis result of the amplified gene indicates that 13032::lysE(mt) strain includes mutated lysE gene in which the nucleic acid sequence of positions 193˜195 from the start codon of lysE gene ORF, “AAT”(WT), is substituted with “GAA”, thereby coding a L-lysine exporter mutant in which the amino acid residue at 65.sup.th position from N-terminus of wild-type sequence (SEQ ID NO: 1), asparagine(N), is substituted with glutamic acid(E).

    EXAMPLE 4

    Preparation of Vector for Introducing Mutated lysE gene and Strain in Which the Mutated lysE gene Introduced

    [0081] In order to introduce N65E mutation which was confirmed in Example 3, recombinant vectors were prepared as follows. Using genomic DNA extracted from WT strain (ATCC13032) as a template, primers of SEQ ID NOS: 13 and 14 shown in Table 4 were synthesized, wherein the restriction site of restriction enzyme Xbal was inserted into 5′ fragment and 3′ fragment which are about 600 bp away from the region of positions 193˜195 of lysE gene (SEQ ID NO: 2) in direction of upstream and downstream, respectively. In addition, primers of SEQ ID NOS: 15 and 16 for introducing nucleotide substitution mutations at positions 600 bp away from both end of the region.

    [0082] The nucleic acid sequences of the used primers are summarized in Table 4:

    TABLE-US-00004 TABLE 4 Primer Nucleic acid sequence (5′ -> 3′) SEQ ID NO: 13 GTACCCGGGGATCCTCTAGAGCTCCACCCCAAG AAGCT SEQ ID NO: 14 GCCTGCAGGTCGACTCTAGACGAGTTGGAGGCG ATCG SEQ ID NO: 15 AGCACGATCGGCGCGGCTTCGGACAAAAGATCA ACGCCC SEQ ID NO: 16 GCGTTGATCTTTTGTCCGAAGCCGCGCCGATCG TG

    [0083] Specifically, recombinant vectors were prepared by ligating DNA fragments (each 600 bp) located at 5′ and 3′ ends of lysE gene with pDZ vector (U.S. Pat. No. 9,109,242 B2). A PCR was performed using a genomic DNA of WT(wild-type) strain as a template, and using primers of SEQ ID NOS: 13 and 15, to prepare 5′ end gene fragment of lysE gene (positioned at 5′ end of lysE gene). The PCR was performed as follows; denaturation at 94° C. for 2 minutes; 30 cycles of denaturation at 94° C. for 1 minute, annealing at 56° C for 1 minute, and polymerization at 72° C. for 30 seconds, and followed by polymerization at 72° C. for 10 minutes. In the same manner, a PCR was performed using primers of SEQ ID NOS: 14 and 16, to prepare 3′ end fragment of lysE gene (positioned at 3′ end of lysE gene). The amplified DNA fragments were purified using a PCR Purification kit (QIAGEN), and then, used as insertion DNA fragments for vector preparation.

    [0084] The insertion DNA fragment amplified by PCR as above and pDZ vector which was treated with restriction enzyme Xbal and heated at 65° C. for 20 minutes were ligated using Infusion Cloning Kit, and transformed into E. coli DH5α. Then, the transformed strains were smeared on LB solid medium supplemented with kanamycin (25 mg/L). After selecting a colony transformed with a vector in which the target gene was inserted through PCR using primers of SEQ ID NOS: 13 and 14, a plasmid was obtained therefrom by a conventional method for plasmid extraction, and named pDZ-lysE(N65E).

    [0085] The prepared vector pDZ-lysE(N65E) was transformed into Corynebacterium glutamicum KCCM11016P strain (KR Patent No. 10-0159812) having lysine producing potential by electric pulse method. Such obtained strain, wherein a heterologous nucleotide substitution mutation (N65E) is introduced into lysE gene, was named as KCCM11016P::lysE(N65E).

    EXAMPLE 5

    Assay for L-lysine Production Potential of lysE(N65E) Mutant Strains

    [0086] The KCCM11016P::lysE(N65E) strain prepared in Example 4 and parent strain KCCM11016P(N65) were cultured in the following manner so as to measure optical density (OD) values, L-lysine production yields, and sugar consumption rates. First, each strain was inoculated into a 250 ml corner-baffle flask containing 25 ml of a seed medium and then cultured at 30° C. for 20 hours with shaking at 200 rpm. Thereafter, 1 ml of the seed culture solution was inoculated into a 250 ml corner-baffle flask containing 24 ml of a production medium and then cultured at 32° C. for 72 hours with shaking at 200 rpm. Compositions of the seed medium and the production medium were as follow, and the culture results are given in Table 4, below.

    [0087] <Seed medium (pH 7.0)>

    [0088] Glucose 20 g, Peptone 10 g, Yeast extract 5 g, Urea 1.5 g, KH.sub.2PO.sub.4 4 g, K.sub.2HPO.sub.4 8 g, MgSO.sub.4 7H.sub.2O 0.5 g, Biotin 100 μg , Thiamine HCl 1,000 μg, Calcium-pantothenate 2,000 μg, Nicotinamide 2,000 μg (per liter of distilled water)

    [0089] <Production medium (pH 7.0)>

    [0090] Glucose 90 g, (NH.sub.4).sub.2SO.sub.4 30 g, Soy protein 20 g, Sugar beet-derived molasses 10 g, KH.sub.2PO.sub.4 1.1 g, MgSO.sub.4 7H.sub.2O 1.2 g, Biotin 2 mg, Thiamine HCl 10 mg, Calcium-pantothenate 10 mg, Nicotinamide 30 mg, MnSO.sub.4 20 mg, FeSO.sub.4 20mg, ZnSO.sub.4 1 mg, CuSO.sub.4 1 mg, CaCO.sub.3 30 g (per liter of distilled water)

    TABLE-US-00005 TABLE 5 OD values (562 nm), L-lysine productivities, and sugar consumption rates of parent strain and lysE(N65E) mutant strain Lys Sugar 24 hr Final production consumption Strain OD OD yield (%) rate (g/hr) KCCM11016P 36.7 96.5 19.9 1.99 KCCM11016P::lysE(N65E) 31.0 87.9 22.3 1.96

    [0091] Compared to parent strain KCCM11016P, KCCM11016P::lysE(N65E) mutant in which lysE gene mutation is introduced shows slightly decreased OD value and increased L-lysine production yield by about 12.1% maintaining similar sugar consumption rate. These results evidence that lysE(N65E) mutation which was selected in Example 2 is a mutation of enhancing exporting ability of L-lysine exporter. The strain KCCM11016P::lysE(N65E) (called as ‘Corynebacterium glutamicum CM03-1012’), which has an enhanced lysine production potential, was deposited in the Korean Culture Center of Microorganisms located in Hongje-dong, Seodaemun-Gu, Seoul, Korea on Dec. 13, 2019 and given the accession number KCCM12641P.

    EXAMPLE 6

    Preparation of Strains Including Mutated lysE gene Encoding Amino Acid Sequences Comprising an Amino Acid Other Than Asparagine at 65.SUP.th .Position

    [0092] In the amino acid sequence of SEQ ID NO: 1, the 65.sup.th amino acid was substituted by each of other amino acids (18 amino acids) than both of asparagine (wild-type) and glutamic acid of which activity was verified in Example 5. In order to introduce nucleotide substitution mutation for encoding each of such 18 heterologous amino acid substitution mutants, each recombinant vectors was prepared in the following manner.

    [0093] Using genomic DNA extracted from WT strain (ATCC13032) as a template, primers of SEQ ID NOS: 17 to 52 (shown in Table 6) for introducing nucleotide substitution mutations into 5′ fragment and 3′ fragment which are about 600 bp away from the region of positions 193-195 of lysE gene in direction of upstream and downstream, were synthesized. Specifically, recombinant vectors were prepared by ligating DNA fragments (each 600 bp) located at 5′ and 3′ ends of lysE gene with pDZ vector (U.S. Pat. No. 9,109,242 B2). A PCR was performed using a genomic DNA of WT(wild-type) strain as a template, and using primers of SEQ ID NOS: 13 and 17, to prepare 5′ end gene fragment of lysE gene (positioned at 5′ end of lysE gene). The PCR was performed as follows; denaturation at 94° C. for 2 minutes; 30 cycles of denaturation at 94° C. for 1 minute, annealing at 56° C for 1 minute, and polymerization at 72° C. for 30 seconds, and followed by polymerization at 72° C. for 10 minutes. In the same manner, a PCR was performed using primers of SEQ ID NOS: 14 and 18, to prepare 3′ end fragment of lysE gene (positioned at 3′ end of lysE gene). The amplified DNA fragments were purified using a PCR Purification kit (QIAGEN), and then, used as insertion DNA fragments for vector preparation.

    [0094] The insertion DNA fragment amplified by PCR as above and pDZ vector which was treated with restriction enzyme Xbal and heated at 65° C. for 20 minutes were ligated using Infusion Cloning Kit, and transformed into E. coli DH5α. Then, the transformed strains were smeared on LB solid medium supplemented with kanamycin (25 mg/l). After selecting a colony transformed with a vector in which the target gene was inserted through PCR using primers of SEQ ID NOS: 13 and 14, a plasmid was obtained therefrom by a conventional method for plasmid extraction, and named pDZ-lysE(N65G).

    [0095] In the same manner,

    [0096] pDZ-lysE(N65A) was prepared using primers SEQ ID NOS: 13 and 19, and SEQ ID NOS: 14 and 20;

    [0097] pDZ-lysE(N65V) was prepared using primers SEQ ID NOS: 13 and 21, and SEQ ID NOS: 14 and 22;

    [0098] pDZ-lysE(N65L) was prepared using primers SEQ ID NOS: 13 and 23, and SEQ ID NOS: 14 and 24;

    [0099] pDZ-lysE(N651) was prepared using primers SEQ ID NOS: 13 and 25, and SEQ ID NOS: 14 and 26;

    [0100] pDZ-lysE(N65F) was prepared using primers SEQ ID NOS: 13 and 27, and SEQ ID NOS: 14 and 28;

    [0101] pDZ-lysE(N65P) was prepared using primers SEQ ID NOS: 13 and 29, and SEQ ID NOS: 14 and 30;

    [0102] pDZ-lysE(N65M) was prepared using primers SEQ ID NOS: 13 and 31, and SEQ ID NOS: 14 and 32;

    [0103] pDZ-lysE(N65W) was prepared using primers SEQ ID NOS: 13 and 33, and SEQ ID NOS: 14 and 34;

    [0104] pDZ-lysE(N65S) was prepared using primers SEQ ID NOS: 13 and 35, and SEQ ID NOS: 14 and 36;

    [0105] pDZ-lysE(N65T) was prepared using primers SEQ ID NOS: 13 and 37, and SEQ ID NOS: 14 and 38;

    [0106] pDZ-lysE(N65Q) was prepared using primers SEQ ID NOS: 13 and 39, and SEQ ID NOS: 14 and 40;

    [0107] pDZ-lysE(N65Y) was prepared using primers SEQ ID NOS: 13 and 41, and SEQ ID NOS: 14 and 42;

    [0108] pDZ-lysE(N65C) was prepared using primers SEQ ID NOS: 13 and 43, and SEQ ID NOS: 14 and 44;

    [0109] pDZ-lysE(N65D) was prepared using primers SEQ ID NOS: 13 and 45, and SEQ ID NOS: 14 and 46;

    [0110] pDZ-lysE(N65H) was prepared using primers SEQ ID NOS: 13 and 47, and SEQ ID NOS: 14 and 48;

    [0111] pDZ-lysE(N65K) was prepared using primers SEQ ID NOS: 13 and 49, and SEQ ID NOS: 14 and 50; and

    [0112] pDZ-lysE(N65R) was prepared using primers SEQ ID NOS: 13 and 51, and SEQ ID NOS: 14 and 52.

    [0113] The nucleic acid sequences of the used primers are summarized in Table 6:

    TABLE-US-00006 TABLE 6 Primer Nucleic acid sequence (5′ -> 3′) SEQ ID NO: 17 AGCACGATCGGCGCGGCGCCGGACAAAAGATCAAC GCCC SEQ ID NO: 18 GCGTTGATCTTTTGTCCGGCGCCGCGCCGATCGTG SEQ ID NO: 19 AGCACGATCGGCGCGGCAGCGGACAAAAGATCAAC GCCC SEQ ID NO: 20 GCGTTGATCTTTTGTCCGCTGCCGCGCCGATCGTG SEQ ID NO: 21 AGCACGATCGGCGCGGCGACGGACAAAAGATCAAC GCCC SEQ ID NO: 22 GCGTTGATCTTTTGTCCGTCGCCGCGCCGATCGTG SEQ ID NO: 23 AGCACGATCGGCGCGGCCAGGGACAAAAGATCAAC GCCC SEQ ID NO: 24 GCGTTGATCTTTTGTCCCTGGCCGCGCCGATCGTG SEQ ID NO: 25 AGCACGATCGGCGCGGCGATGGACAAAAGATCAAC GCCC SEQ ID NO: 26 GCGTTGATCTTTTGTCCATCGCCGCGCCGATCGTG SEQ ID NO: 27 AGCACGATCGGCGCGGCGAAGGACAAAAGATCAAC GCCC SEQ ID NO: 28 GCGTTGATCTTTTGTCCTTCGCCGCGCCGATCGTG SEQ ID NO: 29 AGCACGATCGGCGCGGCTGGGGACAAAAGATCAAC GCCC SEQ ID NO: 30 GCGTTGATCTTTTGTCCCCAGCCGCGCCGATCGTG SEQ ID NO: 31 AGCACGATCGGCGCGGCCATGGACAAAAGATCAAC GCCC SEQ ID NO: 32 GCGTTGATCTTTTGTCCATGGCCGCGCCGATCGTG SEQ ID NO: 33 AGCACGATCGGCGCGGCCCAGGACAAAAGATCAACG CCC SEQ ID NO: 34 GCGTTGATCTTTTGTCCTGGGCCGCGCCGATCGTG SEQ ID NO: 35 AGCACGATCGGCGCGGCGGAGGACAAAAGATCAAC GCCC SEQ ID NO: 36 GCGTTGATCTTTTGTCCTCCGCCGCGCCGATCGTG SEQ ID NO: 37 AGCACGATCGGCGCGGCGGTGGACAAAAGATCAAC GCCC SEQ ID NO: 38 GCGTTGATCTTTTGTCCACCGCCGCGCCGATCGTG SEQ ID NO: 39 AGCACGATCGGCGCGGCCTGGGACAAAAGATCAAC GCCC SEQ ID NO: 40 GCGTTGATCTTTTGTCCCAGGCCGCGCCGATCGTG SEQ ID NO: 41 AGCACGATCGGCGCGGCGTAGGACAAAAGATCAAC GCCC SEQ ID NO: 42 GCGTTGATCTTTTGTCCTACGCCGCGCCGATCGTG SEQ ID NO: 43 AGCACGATCGGCGCGGCGCAGGACAAAAGATCAAC GCCC SEQ ID NO: 44 GCGTTGATCTTTTGTCCTGCGCCGCGCCGATCGTG SEQ ID NO: 45 AGCACGATCGGCGCGGCGTCGGACAAAAGATCAAC GCCC SEQ ID NO: 46 GCGTTGATCTTTTGTCCGACGCCGCGCCGATCGTG SEQ ID NO: 47 AGCACGATCGGCGCGGCGTGGGACAAAAGATCAAC GCCC SEQ ID NO: 48 GCGTTGATCTTTTGTCCCACGCCGCGCCGATCGTG SEQ ID NO: 49 AGCACGATCGGCGCGGCCTTGGACAAAAGATCAAC GCCC SEQ ID NO: 50 GCGTTGATCTTTTGTCCAAGGCCGCGCCGATCGTG SEQ ID NO: 51 AGCACGATCGGCGCGGCGCGGGACAAAAGATCAAC GCCC SEQ ID NO: 52 GCGTTGATCTTTTGTCCCGCGCCGCGCCGATCGTG

    [0114] Each prepared vector was transformed into Corynebacterium glutamicum KCCM11016P strain (KR Patent No. 10-0159812) having lysine producing potential by electric pulse method. The 18 strains obtained above, wherein heterologous nucleotide substitution mutations are introduced into lysE gene, were named as KCCM11016P::lysE(N65G), KCCM11016P::lysE(N65A), KCCM11016P::lysE(N65V), KCCM11016P::lysE(N65L), KCCM11016P::lysE(N651), KCCM11016P::lysE(N65F), KCCM11016P::lysE(N65VP), KCCM11016P::lysE(N65M), KCCM11016P::lysE(N65W), KCCM11016P::lysE(N65S), KCCM11016P::lysE(N65T), KCCM11016P::lysE(N65Q), KCCM11016P::lysE(N65Y), KCCM11016P::lysE(N65C), KCCM11016P::lysE(N65D), KCCM11016P::lysE(N65H), KCCM11016P::lysE(N65K), and KCCM11016P::lysE(N65R), respectively.

    EXAMPLE 7

    Assay for L-lysine Production Potential of lysE Mutant Strains

    [0115] The parent strain KCCM11016P(N65), KCCM11016P::lysE(N65E) strain prepared in Example 4, and 18 strains prepared in Example 6 were cultured in the same manner with Example 5 so as to measure OD values, L-lysine production yields, and sugar consumption rates. The obtained results are shown in Table 7:

    TABLE-US-00007 TABLE 7 OD values (562 nm), L-lysine productivities, and sugar consumption rates of parent strain and lysE mutant strains Lys Sugar 24 hr Final production consumption Strain OD OD yield (%) rate (g/hr) KCCM11016P 36.5 96.8 19.8 2.00 KCCM11016P::lysE(N65E) 29.8 88.0 22.9 1.97 KCCM11016P::lysE(N65G) 31.0 82.2 21.8 2.04 KCCM11016P::lysE(N65A) 30.3 88.4 23.3 2.04 KCCM11016P::lysE(N65V) 29.5 84.2 23.9 2.08 KCCM11016P::lysE(N65L) 30.3 85.2 23.3 1.90 KCCM11016P::lysE(N65I) 31.1 83.9 22.8 2.01 KCCM11016P::lysE(N65F) 30.8 84.5 23.1 2.05 KCCM11016P::lysE(N65P) 29.9 84.6 22.4 2.01 KCCM11016P::lysE(N65M) 31.0 87.0 21.3 2.07 KCCM11016P::lysE(N65W) 30.8 86.1 22.5 2.00 KCCM11016P::lysE(N65S) 35.3 93.6 21.7 1.99 KCCM11016P::lysE(N65T) 34.9 92.4 21.4 1.96 KCCM11016P::lysE(N65Q) 32.8 97.0 21.2 2.08 KCCM11016P::lysE(N65Y) 31.5 96.5 21.8 2.01 KCCM11016P::lysE(N65C) 32.0 95.8 22.0 1.99 KCCM11016P::lysE(N65D) 31.2 90.4 22.9 2.05 KCCM11016P::lysE(N65H) 32.1 83.8 23.6 1.95 KCCM11016P::lysE(N65K) 29.4 86.4 23.7 2.06 KCCM11016P::lysE(N65R) 31.8 86.0 24.1 2.02

    [0116] Compared to parent strain KCCM11016P, KCCM11016P::lysE(N65E) mutant selected in Example 5 shows slightly decreased OD value and increased L-lysine production yield by about 15.7% maintaining similar sugar consumption rate, and all 18 strains prepared in Example 6 also show equal or slightly decreased OD value and increased L-lysine production yield by maximum about 21.7% maintaining similar sugar consumption rate, These results evidence that the position corresponding to 65.sup.th amino acid asparagine in lysE is important in enhancing L-lysine exporting ability.

    EXAMPLE 8

    Assay for L-lysine Production Potential of Selected lysE Mutant Strains

    [0117] In order to assay effects of the lysE gene mutations on other parent strain having L-lysine production potential, another L-lysine producing strain Corynebacterium glutamicum KCCM10770P(N65) (U.S. Pat. No. 9,109,242 B2) was used as a parent strain for introducing each of 4 mutations including lysE(N65E) mutation selected in Example 3 and 3 mutations selected from mutations of Example 7. Each of 4 vectors, pDZ-lysE(N65E) prepared in Example 4, and pDZ-lysE(N65K), pDZ-lysE(N65Q), and pDZ-lysE(N65L) prepared in Example 6 was transformed into Corynebacterium glutamicum KCCM10770P strain by electric pulse method, to prepare 4 mutant strains, KCCM10770P::lysE(N65E), KCCM10770P::lysE(N65K), KCCM10770P::lysE(N65Q), and KCCM10770P::lysE(N65L). The parent strain KCCM10770P, and the 4 mutant strains were cultured in the same manner with Example 5 so as to measure OD values, L-lysine production yields, and sugar consumption rates. The obtained results are shown in Table 8:

    TABLE-US-00008 TABLE 8 OD values (562 nm), L-lysine productivities, and sugar consumption rates of parent strain and lysE mutant strains Sugar Lys consumption 24 hr Final production rate custom-character OD OD yield (%) (g/hr) KCCM10770P 68.6 58.6 7.8 3.27 KCCM10770P::lysE(N65E) 99.3 116.8 20.3 3.24 KCCM10770P::lysE(N65K) 87.0 69.0 9.2 3.26 KCCM10770P::lysE(N65Q) 82.4 69.2 8.4 3.39 KCCM10770P::lysE(N65L) 79.2 67.1 8.1 3.38

    [0118] As shown in Table 8, the mutant strain prepared by introducing the mutation selected in Example 5, i.e., the amino acid substitution of 65.sup.th amino acid of SEQ ID NO: 1 with glutamic acid into lysine producing strain KCCM10770P (parent strain), shows similar sugar consumption rate, increased OD value, and increased L-lysine production yield by about 160.3%, compared to those of the parent strain. In addition, the additional 3 mutant strains also show similar sugar consumption rate, increased OD value, and increased L-lysine production yield by about 3.8% to 17.9%, compared to those of the parent strain. These results suggest that, although the amount of change in OD and increase in L-lysine production yield are different depending on parent strains, the position of the 65.sup.th amino acid of IysE, asparagine, plays an important role in improving L-lysine exporting ability, which is consistent with the results in Example 7.

    EXAMPLE 9

    Assay for L-arginine Production Potential of Selected lysE Mutant Strain

    [0119] In order to assay the effect of the mutated L-lysine exporter on L-arginine exporting ability, the pDZ-lysE(N65E) vector prepared in Example 4 was transformed into L-arginine producing strain, Corynebacterium glutamicum KCCM10741P(N65) strain (U.S. Pat. No. 8,034,602 B2), by electric pulse method. Such prepared mutant strain, wherein the heterologous nucleotide substitution mutation was introduced into lysE gene, was named as KCCM10741P::lysE(N65E). The parent strain KCCM10741P and the prepared KCCM10741P::lysE(N65E) strain were cultured in the following manner so as to measure OD values, L-arginine production yields, and sugar consumption rates. First, each strain was inoculated into a 250 ml corner-baffle flask containing 25 ml of a seed medium and then cultured at 30° C. for 20 hours with shaking at 200 rpm. Thereafter, 1 ml of the seed culture solution was inoculated into a 250 ml corner-baffle flask containing 24 ml of a production medium and then cultured at 32° C. for 72 hours with shaking at 200 rpm. Compositions of the seed medium and the production medium were as follow, and the culture results are given in Table 9, below.

    [0120] <Seed medium (pH 7.0)>

    [0121] Glucose 20 g, Peptone 10 g, Yeast extract 5 g, Urea 1.5 g, KH.sub.2PO.sub.4 4 g, K.sub.2HPO.sub.4 8 g, MgSO.sub.4 7H.sub.2O 0.5 g, Biotin 100 μg, Thiamine HCl 1 mg, Calcium-pantothenate 2 mg, Nicotinamide 2 mg (per liter of distilled water)

    [0122] <Production medium (pH 7.0)>

    [0123] Glucose 60 g, Ammonium sulfate 30 g, KH.sub.2PO.sub.4 1 g, MgSO.sub.4 7H.sub.2O 2 g, CSL(corn steep liquor) 15 g, NaCl 10 g, Yeast extract 5 g, Biotin 100 mg (per liter of distilled water).

    TABLE-US-00009 TABLE 9 OD values (562 nm), lysine productivities, and sugar consumption rates of parent strain and lysE(N65E) mutant strain Arg Sugar 24 hr Final production consumption Strain OD OD yield (%) rate (g/hr) KCCM10741P 32.2 76.5 5.1% 0.89 KCCM10741P::lysE(N65E) 31.8 77.8 5.7% 0.88

    [0124] As shown in Table 9, compared to parent strain KCCM10741P, lysE mutation introduced KCCM10741P::lysE(N65E) strain shows similar OD value and sugar consumption rate, and increased L-arginine production yield by about 11.8%. These results suggest that lysE(N65E) mutation is a mutation capable of enhancing L-arginine exporting ability as well as L-lysine exporting ability.

    [0125] From the above description, it will be understood by those skilled in the art that the present disclosure may be embodied in other specific forms without departing from the spirit or essential characteristics thereof. In this regard, it should be understood that the embodiments described above are illustrative in all aspects and not restrictive. The scope of the present application is to be interpreted as being within the scope of the present application, all changes or modifications derived from the meaning and scope of the appended claim s and from their equivalents rather than the detailed description.