1. Patent Search
  2. Details

REDUCED HEIGHT MAIZE

20250382626 · 2025-12-18

    Inventors

    Cpc classification

    International classification

    Abstract

    Modifications of maize genes Zm1d31079 and Zm1d44812 which provide maize plants with reduced height are disclosed. Maize plants comprising a modified Zm1d31079 or Zm1d44812 with a heterologous enhancing element are described. Also disclosed are seed obtained from such plants as well as use of the seed and plants to produce commodity productions and in maize breeding.

    Claims

    1. A maize plant comprising a modified Zm1d31079 gene wherein a heterologous expression enhancing element is located in the modified gene, and wherein the unmodified Zm1d31079 gene comprises the DNA molecule of SEQ ID NO: 1 or an allelic variant thereof.

    2. The maize plant of claim 1, wherein the modified Zm1d31079 gene and/or the unmodified Zm1d31079 gene encode the Zm1d31079 protein of SEQ ID NO: 2 or an allelic variant thereof.

    3. The maize plant of claim 1, wherein the modified Zm1d31079 gene is located in the native chromosomal location of the unmodified Zm1d31079 gene.

    4. The maize plant of claim 1, wherein the modified Zm1d31079 gene comprises a transgene located in a chromosomal location other than in the native chromosomal location of the unmodified Zm1d31079 gene.

    5. The maize plant of claim 1, wherein the heterologous expression enhancing element comprises: (i) a heterologous transcription enhancer, a heterologous translational enhancing element, and/or a heterologous intron; or (ii) a heterologous promoter, heterologous 5 UTR, and/or heterologous intron.

    6. The maize plant of claim 5, wherein the heterologous transcription enhancer is located in the promoter, the 5 untranslated region (5 UTR), an intron, a 3 untranslated region (3 UTR), or a 3 flanking region of the modified Zm1d31079 gene.

    7. The maize plant of claim 5, wherein the heterologous transcription enhancer comprises a DNA molecule set forth in SEQ ID NO: 16, 17, 19-124, and/or 125.

    8. The maize plant of claim 5, wherein the transcription enhancer is located about 10, 20, 30, 40, 100, or 150 base pairs (bp) to about 200, 240, 300, 350, 400, 500, or 1000 bp 5 of the transcriptional start site (TSS) of the Zm1d31079.

    9. The maize plant of claim 5, wherein the transcription enhancer comprises SEQ ID NO: 16 or 17 and the insertion is located: (i) about 116 to about 96 base pairs or about 106 base pairs 5 to the TSS of the Zm1d31079 gene; (ii) about 119 to about 99 base pairs or about 109 base pairs 5 to the TSS of the Zm1d31079 gene; (iii) about 170 to about 150 base pairs or about 160 base pairs 5 to the TSS of the Zm1d31079 gene; (iv) about 252 to about 232 base pairs or about 242 base pairs 5 to the TSS of the Zm1d31079 gene; (v) about 261 to about 241 base pairs or about 251 base pairs 5 to the TSS of the Zm1d31079 gene; (vi) in a double stranded break introduced in the Zm1d31079 promoter with a Cas9 nuclease and a guide RNA encoded by SEQ ID NO: 4, 5, or 6; or (vii) in a double stranded break introduced in the Zm1d31079 promoter with a Cas12 nuclease and a guide RNA encoded by SEQ ID NO: 3 or 7.

    10.-14. (canceled)

    15. The maize plant of claim 1, wherein height of the maize plant is reduced in comparison to a control maize plant lacking the lacking the modified Zm1d31079 gene, optionally wherein the height is reduced by about 5% or 10% to about 15%, 20%, 30%, or 50% in comparison to a control maize plant lacking the modified Zm1d31079 gene.

    16. The maize plant of claim 1, wherein the maize plant is a hybrid maize plant which is heterozygous for the modified Zm1d31079.

    17. (canceled)

    18. The maize plant of claim 1, wherein expression of a Zm1d31079 gene product in a plant having the modified Zm1d31079 gene is increased by about 1.2-fold or 1.5-fold to about 2-fold, 3-fold, or 5-fold or by about 20% to 80% in at least one maize tissue in the maize plant in comparison to a control maize plant lacking the modified Zm1d31079 gene.

    19. A maize plant part comprising the modified Zm1d31079 gene of claim 1.

    20.-23. (canceled)

    24. A method of producing hybrid maize seed comprising crossing a maize plant homozygous for the modified Zm1d31079 gene set forth in claim 1 to another maize plant homozygous for the modified Zm1d31079 gene and harvesting seed from a pollen recipient of the cross.

    25. (canceled)

    26. A method of producing a commodity maize plant product, said method comprising: (i) processing a maize plant of claim 1 or a maize seed obtained therefrom; and (ii) recovering the commodity maize plant product from the processed maize plant or maize seed, wherein the commodity maize plant product comprises a detectable amount of a DNA molecule comprising the heterologous transcription enhancer, the heterologous translational enhancing element, and/or the heterologous intron located in a DNA fragment of the modified Zm1d31079 gene.

    27.-28. (canceled)

    29. A biological sample comprising a detectable amount of a DNA molecule comprising a heterologous transcription enhancer, located in a DNA fragment of a modified Zm1d31079 gene.

    30.-32. (canceled)

    33. A method of making the maize plant of claim 1, comprising: (a) contacting a maize plant genome with gene editing molecules comprising a first site-specific nuclease which introduces a double stranded DNA break in a promoter region, a 5 UTR, a coding region, a 3 UTR, or a 3 flanking region in an unmodified Zm1d31079 gene comprising the DNA molecule of SEQ ID NO: 1 or an allelic variant thereof; and a donor DNA template or other DNA template comprising a heterologous expression enhancing element; and (b) selecting a maize plant comprising a modified Zm1d31079 gene, wherein the modified Zm1d31079 gene comprises an insertion of the heterologous expression enhancing element in the promoter region, the 5 UTR, the coding region, the 3 UTR, or the 3 flanking region of the gene, wherein expression of the modified Zm1d31079 gene is increased in at least one tissue, and wherein height of the maize plant comprising the modified Zm1d31079 gene is decreased in comparison to a control maize plant lacking the modified Zm1d31079 gene.

    34. (canceled)

    35. The method of claim 33, wherein the double stranded break is introduced in the promoter, the 5 untranslated region (5 UTR), an intron, a 3 untranslated region (3 UTR), or a 3 flanking region of the unmodified Zm1d31079 gene and the donor DNA template or other DNA template comprises the heterologous transcription enhancer.

    36. The method of claim 35, wherein the transcription enhancer comprises a DNA molecule set forth in SEQ ID NO: 16, 17, 19-124, and/or 125.

    37. (canceled)

    38. The method of claim 36, wherein the transcription enhancer comprises SEQ ID NO: 16 or 17 and the double stranded break is introduced: (i) about 116 to about 96 base pairs or about 106 base pairs 5 to the TSS of the Zm1d31079 gene; (ii) about 119 to about 99 base pairs or about 109 base pairs 5 to the TSS of the Zm1d31079 gene; (iii) about 170 to about 150 base pairs or about 160 base pairs 5 to the TSS of the Zm1d31079 gene; (iv) about 252 to about 142 base pairs or about 242 base pairs 5 to the TSS of the Zm1d31079 gene; (v) about 261 to about 241 base pairs or about 251 base pairs 5 to the TSS of the Zm1d31079 gene; (vi) in the Zm1d31079 promoter with a Cas9 nuclease and a guide RNA encoded by SEQ ID NO: 4, 5, or 6; or (vii) in the Zm1d31079 promoter with a Cas12 nuclease and a guide RNA encoded by SEQ ID NO: 3 or 7.

    39.-45. (canceled)

    Description

    BRIEF DESCRIPTION OF THE DRAWINGS/FIGURES

    [0013] FIG. 1 depicts an unmodified maize Zm1d31079 gene sequence (SEQ ID NO: 1). The location of guide RNA recognition sites in the promoter are shown in bold, the 5 untranslated region (5UTR) is underlined, the coding region is in upper case, and the 3UTR and 3 flanking region are italicized.

    [0014] FIGS. 2A and 2B depict an unmodified maize Zm1d44812 gene sequence (SEQ ID NO: 8). The location of guide RNA recognition sites in the promoter are shown in bold, the 5 untranslated region (5UTR) is underlined, the ATG translation initiation codon is in upper case.

    [0015] FIG. 3 shows two T Zero (T0) ZM187 genetically edited maize plants comprising a transcription enhancer inserted in the Zm1d44812 gene promoter and a T0 ZM190 control plant lacking the transcription enhancer insertion. The T0 ZM187 genetically edited maize plants were generated with a Cas nuclease, a Zm1d44812_Pro-75 gRNA comprising an RNA encoded by SEQ ID NO: 10, and a triplicated ZmOCS enhancer element donor DNA (SEQ ID NO: 18).

    [0016] FIG. 4 shows two T Zero (T0) ZM200 genetically edited maize plants comprising a transcription enhancer inserted in the Zm1d31709 gene promoter and a T0 ZM194 control plant lacking the transcription enhancer insertion. The T0 ZM200 genetically edited maize plants were generated with a Cas nuclease, a Zm1d31709_Pro-242 gRNA comprising an RNA encoded by SEQ ID NO: 6, and a triplicated ZmOCS enhancer element donor DNA (SEQ ID NO: 18).

    [0017] FIG. 5 shows a T Zero (T0) ZM202 genetically edited maize plants comprising a transcription enhancer inserted in the Zm1d31709 gene promoter, a T Zero (T0) ZM203 genetically edited maize plants comprising a transcription enhancer inserted in the Zm1d44812 gene promoter, and a T0 ZM194 control plant lacking any transcription enhancer insertion. The T0 ZM202 genetically edited maize plants were generated with a Cas nuclease, a ZM1d31709_Pro-242 gRNA comprising an RNA encoded by SEQ ID NO: 6, and a triplicated ZmOCS enhancer element donor DNA (SEQ ID NO: 16). The T0 ZM203 genetically edited maize plants were generated with a Cas nuclease, a Zm1d44812_Pro-259 gRNA comprising an RNA encoded by SEQ ID NO: 15, and a triplicated ZmOCS enhancer element donor DNA (SEQ ID NO: 18).

    [0018] FIG. 6 shows two T Zero (T0) ZM185 genetically edited maize plants comprising a transcription enhancer inserted in the Zm1d31709 gene promoter, two T Zero (T0) ZM186 genetically edited maize plant comprising a transcription enhancer inserted in the Zm1d31709 gene promoter, and T0 ZM184 and Zm182 control plants lacking any transcription enhancer insertion. The T0 ZM185 and ZM186 genetically edited maize plants were generated with a Cas nuclease, a ZM1D31709_Pro-109 gRNA comprising an RNA encoded by SEQ ID NO: 4, and a triplicated ZmOCS enhancer element donor DNA (SEQ ID NO: 18).

    [0019] FIG. 7 shows two T Zero (T0) ZM185 genetically edited maize plants comprising a transcription enhancer inserted in the Zm1d31709 gene promoter and a T0 Zm182 control plant lacking any transcription enhancer insertion. The T0 ZM185 genetically edited maize plants were generated with a Cas nuclease, a ZM1d31709_Pro-109 gRNA comprising an RNA encoded by SEQ ID NO: 4, and a triplicated ZmOCS enhancer element donor DNA (SEQ ID NO: 18).

    [0020] FIG. 8 shows five T Zero (T0) ZM187 genetically edited maize plants comprising a transcription enhancer inserted in the Zm1d44812 gene promoter and a T0 ZM190 control plant lacking the transcription enhancer insertion. The T0 ZM187 genetically edited maize plants were generated with a Cas nuclease, a Zm1d44812_Pro-75 gRNA comprising an RNA encoded by SEQ ID NO: 10, and a triplicated ZmOCS enhancer element donor DNA (SEQ ID NO: 18).

    [0021] FIG. 9 shows expression of Zm1d31079 (SEQ ID NO:1) relative to a ZmAct1 (actin) control in young shoot apices in two populations segregating an enhancer insertion allele, comparing plants that do not contain an enhancer allele (C) to siblings that are heterozygous (HeZ) or homozygous (HoZ) for the triplicated ZmOCS enhancer allele at the indicated position (109 or 242 relative to the TSS). Each data point represents the average of two technical replicates for one individual plant.

    [0022] FIG. 10 shows plant height over time for segregating control plants to plants homozygous for the triplicated ZmOCS enhancer element inserted at the indicated position in the Zm1d31079 (SEQ ID NO:1) promoter. Average heightstandard error is shown, with N=5-8 per group; triplicated ZmOCS enhancer element insertion homozygotes are in black (lower curve) and segregating controls which lack the enhancer insertion are in grey (upper curve).

    DETAILED DESCRIPTION

    [0023] The phrase allelic variant as used herein refers to a polynucleotide or polypeptide sequence variant that occurs in a particular gene at particular locus in a different strain, variety, or isolate of a given organism.

    [0024] The term and/or where used herein is to be taken as specific disclosure of each of the two specified features or components with or without the other. Thus, the term and/or as used in a phrase such as A and/or B herein is intended to include A and B, A or B, A (alone), and B (alone). Likewise, the term and/or as used in a phrase such as A, B, and/or C is intended to encompass each of the following embodiments: A, B, and C; A, B, or C; A or C; A or B; B or C; A and C; A and B; B and C; A (alone); B (alone); and C (alone).

    [0025] As used herein, the phrase biological sample refers to either intact or non-intact (e.g., milled maize seed or maize plant tissue, chopped maize plant tissue, lyophilized tissue) maize plant tissue. It may also be an extract comprising intact or non-intact seed or maize plant tissue. The biological sample can comprise flour, meal, syrup, oil, starch, and cereals manufactured in whole or in part to contain maize plant products or by-products. In certain embodiments, the biological sample is non-regenerable (i.e., incapable of being regenerated into a maize plant or maize plant part).

    [0026] As used herein, the terms correspond, corresponding, and the like, when used in the context of an nucleotide position, mutation, and/or substitution in any given polynucleotide (e.g., an allelic variant of SEQ ID NO: 1 or SEQ ID NO: 8) with respect to the reference polynucleotide sequence (e.g., SEQ ID NO: 1 or SEQ ID NO: 8) all refer to the position of the polynucleotide residue in the given sequence that has identity to the residue in the reference nucleotide sequence when the given polynucleotide is aligned to the reference polynucleotide sequence using a pairwise alignment algorithm (e.g., CLUSTAL O 1.2.4 with default parameters).

    [0027] As used herein, the terms Cpf1 and Cas12a are used interchangeably to refer to the same RNA dependent DNA endonuclease (RdDe).

    [0028] As used herein, the phrases endogenous promoter, endogenous gene, endogenous plant transcription unit and the like refer to the native form of a promoter, gene, or plant transcription unit in its natural location in the organism or in the genome of an organism.

    [0029] As used herein, the term exemplary refers to an example, an instance, or an illustration, and does not indicate a preferred embodiment unless otherwise stated.

    [0030] The term heterologous as used herein with regards to a DNA molecule, nucleotides, or polynucleotides inserted into a plant genome refer to any DNA molecule, nucleotide, or polynucleotide that is synthetic or that has been removed from its native location and that has been inserted into a new genomic location.

    [0031] As used herein, the terms include, includes, and including are to be construed as at least having the features to which they refer while not excluding any additional unspecified features.

    [0032] As used herein, the phrase operably linked refers to a juxtaposition wherein the components so described are in a relationship permitting them to function in their intended manner. For instance, a promoter is operably linked to a coding sequence if the promoter affects its transcription or expression. In another non-limiting example, an expression enhancing element (e.g., a transcription enhancer element) is operably linked to a promoter if the expression increasing element increases activity of the promoter (e.g., as measured by promoter-driven accumulation of a transcript or protein encoded by the transcript). In certain embodiments provided herein, a heterologous expression enhancing element (e.g., a transcription enhancer element) is operably linked to an endogenous plant promoter (e.g., a maize Zm1d31079 or Zm1d44812 gene promoter associated with the endogenous maize gene) which is located in a plant chromosome.

    [0033] As used herein, the term plant includes a whole plant and any descendant, cell, tissue, or part of a plant. The term plant parts include any part(s) of a plant, including, for example and without limitation: seed (including mature seed and immature seed); a plant cutting; a plant cell; a plant cell culture; or a plant organ (e.g., pollen, embryos, flowers, fruits, shoots, leaves, roots, stems, and explants). A plant tissue or plant organ may be a seed, protoplast, callus, or any other group of plant cells that is organized into a structural or functional unit. A plant cell or tissue culture may be capable of regenerating a plant having the physiological and morphological characteristics of the plant from which the cell or tissue was obtained, and of regenerating a plant having substantially the same genotype as the plant. Regenerable cells in a plant cell or tissue culture may be embryos, protoplasts, meristematic cells, callus, pollen, leaves, anthers, roots, root tips, flowers, or stalks. In contrast, some plant cells are not capable of being regenerated to produce plants and are referred to herein as non-regenerable plant cells.

    [0034] As used herein, the terms unmodified Zm1d31079 gene and Zm1d31079 protein respectfully refer to either the gene of SEQ ID NO: 1 and allelic variants thereof or the protein of SEQ ID NO: 2 and allelic variants thereof.

    [0035] As used herein, the terms unmodified Zm1d44812 gene and Zm1d44812 protein respectfully refer to either the gene of SEQ ID NO: 8 and allelic variants thereof or the protein of SEQ ID NO: 9 and allelic variants thereof.

    [0036] To the extent to which any of the preceding definitions is inconsistent with definitions provided in any patent or non-patent reference incorporated herein by reference, any patent or non-patent reference cited herein, or in any patent or non-patent reference found elsewhere, it is understood that the preceding definition will be used herein.

    [0037] Maize plants comprising a modified Zm1d31079 gene or a modified Zm1d44812 gene wherein a heterologous expression enhancing element is located in the modified gene and provides for increased expression of a Zm1d31079 or a Zm1d44812 gene product (e.g., a Zm1d31079 or a Zm1d44812 protein or RNA transcript encoding the protein) are disclosed. An endogenous and unmodified Zm1d31079 gene allele (SEQ ID NO: 1) is set forth in the MaizeGDB (maize genome database world wide web internet site maizegdb.org) under accession number Zm00001d031079 and encodes the Zm1d31079 protein (SEQ ID NO: 2). An endogenous and unmodified Zm1d44812 gene (SEQ ID NO: 8) is set forth in the MaizeGDB (maize genome database world wide web internet site maizegdb.org) under accession number Zm00001d044812 and encodes the Zm1d44812 protein (SEQ ID NO: 9). The Zm1d44812 protein (SEQ ID NO: 9) has also been identified as the ZmPIN1a protein (Li, Z X et al. Plant Biotechnology Journal (2018) 16, pp. 86-99; doi: 10.1111/pbi.12751).

    [0038] Allelic variants of an endogenous Zm1d31079 gene (SEQ ID NO: 1) and an endogenous Zm1d44812 gene (SEQ ID NO: 8) include sequence variants of both non-coding regions (e.g., promoter, 5 UTR, and 3 UTR set forth in SEQ ID NO: 1 and SEQ ID NO: 8) and coding regions (regions of the genes encoding the proteins of SEQ ID NO: 2 and SEQ ID NO: 9). Allelic variants of an endogenous Zm1d31079 gene include variants which encode Zm1d31079 proteins having at least 95%, 96%, 98%, 99%, or 99.5% sequence identity to SEQ ID NO: 2. Allelic variants of an endogenous Zm1d31079 gene also include variants having at least 95%, 96%, 98%, 99%, or 99.5% sequence identity to SEQ ID NO: 1. Allelic variants of an endogenous Zm1d44812 gene include variants which encode Zm1d44812 proteins having at least 95%, 96%, 98%, 99%, or 99.5% sequence identity to SEQ ID NO: 9. Allelic variants of an endogenous Zm1d44812 gene also include variants having at least 95%, 96%, 98%, 99%, or 99.5% sequence identity to SEQ ID NO: 8.

    [0039] To obtain maize plants with reduced height and improved performance as both inbred parents and as a hybrids, it is desirable in certain embodiments to obtain an allelic series of maize plants comprising different modified Zm1d31079 genes or different modified Zm1d44812 genes. In the allelic series, distinct expression levels of the different modified Zm1d31079 gene or the different modified Zm1d44812 genes are obtained to produce plants with distinct reductions in height ranging from about 5% or 10% to about 15%, 20%, 30%, or 50% in comparison to control plants lacking the modified Zm1d31079 gene or the modified Zm1d44812 gene. In certain contexts, maize plants having a given Zm1d31079 gene or a modified Zm1d44812 gene results in lower reductions in height (e.g., from about 5% to about 15% in comparison to control plants) are selected from the allelic series in order to obtain plants having a desired height reduction. In certain contexts, maize plants having a given Zm1d31079 gene or a modified Zm1d44812 gene with results in lower reductions in height (e.g., from about 15% to about 20%, 30%, or 50% in comparison to control plants) are selected from the allelic series in order to obtain plants having a desired height reduction. In certain embodiments, maize plants having a given modified Zm1d31079 gene or a modified Zm1d44812 gene exhibit increases in expression of the Zm1d31079 gene or the Zm1d44812 gene in one or more maize tissues of about 10%, 15%, or 20% to about 30%, 40%, 50%, 60%, 70%, 80%, or 100% in comparison to a control maize plant lacking the modified Zm1d31079 gene or the modified Zm1d44812 gene are obtained in the allelic series. In certain embodiments, maize plants having a given modified Zm1d31079 gene or a modified Zm1d44812 gene exhibit in increases of expression of a Zm1d31079 gene product or a Zm1d44812 gene of about 1.2-fold or 1.5-fold to about 2-fold, 3-fold, or 5-fold in at least one maize tissue in the maize plant in comparison to a control maize plant lacking the modified Zm1d31079 gene or the modified Zm1d44812 gene. In certain embodiments, the desired height reduction and/or expression level can be selected based on performance characteristics (e.g., inbred and/or hybrid seed yield) for particular germplasms and/or for use in certain target geographies.

    [0040] In certain embodiments, an allelic series of different modified Zm1d31079 genes or different modified Zm1d44812 genes can be obtained by insertion or formation of a transcription enhancer in the unmodified Zm1d31079 gene or unmodified Zm1d44812 gene such that the transcription enhancer is operably linked to the promoter of the gene but placed at different positions relative to the transcriptional start site (TSS). In certain embodiments, the allelic series can be obtained by locating the transcription enhancer at different positions from about 10, 20, 30, 40, 100, or 150 base pairs (bp) to about 200, 240, 300, 350, 400, 500, or 1000 bp 5 of the transcriptional start site (TSS) of the Zm1d31079 or Zm1d44812 gene. In certain embodiments, operable linkage to the endogenous promoter is achieved by insertion or formation of an enhancer in one or more of an endogenous promoter, 5 untranslated region (5UTR), intron, and/or 3 untranslated region of an endogenous Zm1d31079 gene or endogenous Zm1d44812 gene located at its native chromosomal location (e.g., by CRISPR, TALEN, or artificial Zinc Finger mediated gene editing). Transcriptional enhancer elements that can be inserted or formed in the Zm1d31079 gene or Zm1d44812 gene promoter, 5 UTR, intron, or 3 UTR can comprise one or more DNA molecules set forth in SEQ ID NO:16, SEQ ID NO: 17, SEQ ID NO: 19-SEQ ID NO: 124, and/or SEQ ID NO: 125. In certain embodiments, two distinct enhancers independently selected from SEQ ID NO:16, SEQ ID NO: 17, SEQ ID NO: 19-SEQ ID NO: 124, and/or SEQ ID NO: 125 are inserted or formed in the gene promoter, 5 UTR, intron, or 3 UTR. In certain embodiments, a distinct enhancer independently selected from SEQ ID NO:16, SEQ ID NO: 17, SEQ ID NO: 19-SEQ ID NO: 124, and/or SEQ ID NO: 125 are inserted or formed in the Zm1d31079 gene or Zm1d44812 gene promoter, 5 UTR, intron, or 3 UTR. In certain embodiments, members of a modified Zm1d31079 gene allelic series can comprise insertions of a transcription enhancer (e.g., one or more DNA molecules set forth in SEQ ID NO:16, SEQ ID NO: 17, SEQ ID NO: 19-SEQ ID NO: 124, and/or SEQ ID NO: 125) at: (i) about 116 to about 96 base pairs or about 114, 112, 110, 108, 106, 104, 102, 100, or 98 base pairs 5 to the TSS of the Zm1d31079 gene; (ii) about 119 to about 99 base pairs or about 117, 115, 113, 111, or 109 base pairs 5 to the TSS of the Zm1d31079 gene; (iii) about 170 or 164 to about 150 base pairs or about 168, 166, 164, 162, 160, 158, 156, 154, or 152 base pairs 5 to the TSS of the Zm1d31079 gene; (iv) about 252 to about 242 base pairs or about 250, 248, 246, 244, 242, 240, 238 base pairs 5 to the TSS of the Zm1d31079 gene; (v) about 261 to about 241 base pairs or about 259, 257, 256, 253, 251, 249, 247, 245, or 243 base pairs 5 to the TSS of the Zm1d31079 gene; (v) in a double stranded break introduced in the Zm1d31079 promoter with a Cas9 nuclease and a guide RNA encoded by SEQ ID NO: 4, 5, or 6; or (vi) in a double stranded break introduced in the Zm1d31079 promoter with a Cas12 nuclease and a guide RNA encoded by SEQ ID NO: 3 or 7. In certain embodiments, insertions of the transcription enhancer at any of the aforementioned positions in the Zm1d31079 promoter is accompanied by the deletion of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more base pairs of DNA in the Zm1d31079 promoter either 5 and/or 3 to the transcription enhancer insertion in the corresponding DNA of SEQ ID NO: 1 or an allelic variant thereof. In certain embodiments, members of a modified Zm1d44812 gene allelic series can comprise insertions of a transcription enhancer (e.g., one or more DNA molecules set forth in SEQ ID NO:16, SEQ ID NO: 17, SEQ ID NO: 19-SEQ ID NO: 124, and/or SEQ ID NO: 125) at: (i) about 85 to about 65 base pairs or about 83, 81, 79, 77, 75, 73, 71, 69, or 67 base pairs 5 to the TSS of the Zm1d44812 gene; (ii) about 93 to about 73 base pairs or about 91, 89, 87, 85, 83, 81, 79, 77, or 75 base pairs 5 to the TSS of the Zm1d44812 gene; (iii) about 183 to about 163 base pairs or about 181, 179, 177, 175, 173, 171, 169, 167, or 165 base pairs 5 to the TSS of the Zm1d44812 gene; (iv) about 188 to about 168 base pairs or about 186, 184, 182, 180, 178, 176, 174, 172, or 170 base pairs 5 to the TSS of the Zm1d44812 gene; (v) about 269 to about 249 base pairs or about 267, 265, 263, 261, 259, 257, 255, 253, or 251 base pairs 5 to the TSS of the Zm1d44812 gene; (v) in a double stranded break introduced in the Zm1d44812 promoter with a Cas9 nuclease and a guide RNA encoded by SEQ ID NO: 10, 12, or 15; or (vi) in a double stranded break introduced in the Zm1d44812 promoter with a Cas12 nuclease and a guide RNA encoded by SEQ ID NO: 11, 13, or 14. In certain embodiments, insertions of the transcription enhancer at any of the aforementioned positions in the Zm1d44812 promoter is accompanied by the deletion of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more base pairs of DNA in the Zm1d44812 promoter either 5 and/or 3 to the transcription enhancer insertion in the corresponding DNA of SEQ ID NO: 1 or an allelic variant thereof. In certain embodiments, any of the aforementioned transcription enhancer insertions can be combined with an insertion of a heterologous translational enhancing element and/or a heterologous intron in the Zm1d31079 gene or Zm1d44812 gene. A list of useful transcriptional enhancer elements that can be used to obtain an allelic series of different modified Zm1d31079 genes or different modified Zm1d44812 genes is provided in Table 1.

    TABLE-US-00001 TABLE1 Transcriptionalenhancerelements. SEQID Typeofregulation Nameofelement Sequence.sup.1 NO: up(constitutive) 36bpenhancer GTAAGCGCTTACGTAAGCG 16 CTTACGTAAGCGCTTAC up(auxin 12-ntocsorthologue GTAAGCGCTTAC 17 responsive; (Zeamays) constitutive) regulatorycontrol ABFsbindingsitemotif CACGTGGC 19 byTF regulatorycontrol ABREbindingsite YACGTGGC 20 byTF motif regulatorycontrol ABRE-likebindingsite BACGTGKM 21 byTF motif regulatorycontrol ACEpromotermotif GACACGTAGA 22 byTF regulatorycontrol AGbindingsitemotif TTDCCWWWWWWGGH 23 byTF regulatorycontrol AGbindingsiteinAP3 CCATTTTTAGT 24 byTF regulatorycontrol AGbindingsiteinSUP CCATTTTTGG 25 byTF regulatorycontrol AGLIbindingsitemotif NTTDCCWWWWNNGGWAA 26 byTF N regulatorycontrol AGL2bindingsitemotif NNWNCCAWWWWTRGWW 27 byTF AN regulatorycontrol AGL3bindingsitemotif TTWCYAWWWWTRGWAA 28 byTF regulatorycontrol AP1bindingsiteinAP3 CCATTTTTAG 29 byTF regulatorycontrol ARFbindingsitemotif TGTCTC 30 byTF regulatorycontrol ATHB1bindingsite CAATWATTG 31 byTF motif regulatorycontrol ATHB2bindingsite CAATSATTG 32 byTF motif regulatorycontrol ATHB5bindingsite CAATNATTG 33 byTF motif regulatorycontrol ATHB6bindingsite CAATTATTA 34 byTF motif regulatorycontrol AtMYB2bindingsitein CTAACCA 35 byTF RD22 regulatorycontrol AtMYC2bindingsitein CACATG 36 byTF RD22 regulatorycontrol BoxIIpromotermotif GGTTAA 37 byTF regulatorycontrol CArGpromotermotif CCWWWWWWGG 38 byTF regulatorycontrol CArG1motifinAP3 GTTTACATAAATGGAAAA 39 byTF regulatorycontrol CArG2motifinAP3 CTTACCTTTCATGGATTA 40 byTF regulatorycontrol CArG3motifinAP3 CTTTCCATTTTTAGTAAC 41 byTF regulatorycontrol CBF1bindingsitein TGGCCGAC 42 byTF cor15a regulatorycontrol CBF2bindingsitemotif CCACGTGG 43 byTF regulatorycontrol CCA1bindingsitemotif AAMAATCT 44 byTF regulatorycontrol CCA1motif1binding AAACAATCTA 45 byTF siteinCAB1 regulatorycontrol CCA1motif2binding AAAAAAAATCTATGA 46 byTF siteinCAB1 regulatorycontrol DPBF1&2bindingsite ACACNNG 47 byTF motif regulatorycontrol DREpromotermotif TACCGACAT 48 byTF regulatorycontrol DRE-likepromoter DRCCGACNW 49 byTF motif regulatorycontrol E2Fbindingsitemotif TTTCCCGC 50 byTF regulatorycontrol E2F-varientbindingsite TCTCCCGCC 51 byTF motif regulatorycontrol EIL1bindingsitein TTCAAGGGGGCATGTATCT 52 byTF ERF1 TGAA regulatorycontrol EIN3bindingsitein GGATTCAAGGGGGCATGTA 53 byTF ERF1 TCTTGAATCC regulatorycontrol EREpromotermotif TAAGAGCCGCC 54 byTF regulatorycontrol ERF1bindingsitein GCCGCC 55 byTF AtCHI-B regulatorycontrol EveningElement AAAATATCT 56 byTF promotermotif regulatorycontrol GATApromotermotif WGATAR 57 byTF regulatorycontrol GBF1/2/3bindingsitein CCACGTGG 58 byTF ADH1 regulatorycontrol G-boxpromotermotif CACGTG 59 byTF regulatorycontrol GCC-boxpromoter GCCGCC 60 byTF motif regulatorycontrol GTpromotermotif TGTGTGGTTAATATG 61 byTF regulatorycontrol Hexamerpromoter CCGTCG 62 byTF motif regulatorycontrol HSEsbindingsitemotif AGAANNTTCT 63 byTF regulatorycontrol Iboxpromotermotif GATAAG 64 byTF regulatorycontrol JASE1motifinOPR1 CGTCAATGAA 65 byTF regulatorycontrol JASE2motifinOPR2 CATACGTCGTCAA 66 byTF regulatorycontrol L1-boxpromotermotif TAAATGYA 67 byTF regulatorycontrol LS5promotermotif ACGTCATAGA 68 byTF regulatorycontrol LS7promotermotif TCTACGTCAC 69 byTF regulatorycontrol LTREpromotermotif ACCGACA 70 byTF regulatorycontrol MREmotifinCHS TCTAACCTACCA 71 byTF regulatorycontrol MYBbindingsite MACCWAMC 72 byTF promoter regulatorycontrol MYB1bindingsite MTCCWACC 73 byTF motif regulatorycontrol MYB2bindingsite TAACTSGTT 74 byTF motif regulatorycontrol MYB3bindingsite TAACTAAC 75 byTF motif regulatorycontrol MYB4bindingsite AMCWAMC 76 byTF motif regulatorycontrol Nonamerpromoter AGATCGACG 77 byTF motif regulatorycontrol OBF4,5bindingsitein ATCTTATGTCATTGATGAC 78 byTF GST6 GACCTCC regulatorycontrol OBP-1,4,5bindingsite TACACTTTTGG 79 byTF inGST6 regulatorycontrol OCSpromotermotif TGACGYAAGSRMTKACGY 80 byTF MM regulatorycontrol octamerpromotermotif CGCGGATC 81 byTF regulatorycontrol PIpromotermotif GTGATCAC 82 byTF regulatorycontrol PIIpromotermotif TTGGTTTTGATCAAAACCA 83 byTF A regulatorycontrol PRHAbindingsitein TAATTGACTCAATTA 84 byTF PAL1 regulatorycontrol RAV1-Abindingsite CAACA 85 byTF motif regulatorycontrol RAV1-Bbindingsite CACCTG 86 byTF motif regulatorycontrol RY-repeatpromoter CATGCATG 87 byTF motif regulatorycontrol SBP-boxpromotermotif TNCGTACAA 88 byTF regulatorycontrol T-boxpromotermotif ACTTTG 89 byTF regulatorycontrol TEF-boxpromotermotif AGGGGCATAATGGTAA 90 byTF regulatorycontrol TELO-boxpromoter AAACCCTAA 91 byTF motif regulatorycontrol TGA1bindingsitemotif TGACGTGG 92 byTF regulatorycontrol W-boxpromotermotif TTGAC 93 byTF regulatorycontrol Z-boxpromotermotif ATACGTGT 94 byTF regulatorycontrol AGbindingsitein AAAACAGAATAGGAAA 95 byTF SPL/NOZ regulatorycontrol Bellringer/replumless/ AAATTAAA 96 byTF pennywisebindingsite INAG regulatorycontrol Bellringer/replumless/ AAATTAGT 97 byTF pennywisebindingsite2 inAG regulatorycontrol Bellringer/replumless/ ACTAATTT 98 byTF pennywisebindingsite3 inAG regulatorycontrol AGL15bindingsitein CCAATTTAATGG 99 byTF AtGA2ox6 regulatorycontrol ATB2/AtbZIP53/AtbZIP44/ ACTCAT 100 byTF GBF5bindingsite inProDH regulatorycontrol LFYbindingsiteinAP3 CTTAAACCCTAGGGGTAAT 101 byTF regulatorycontrol SORLREP1 TTWTACTAGT 102 byTF regulatorycontrol SORLREP2 ATAAAACGT 103 byTF regulatorycontrol SORLREP3 TGTATATAT 104 byTF regulatorycontrol SORLREP4 CTCCTAATT 105 byTF regulatorycontrol SORLREP5 TTGCATGACT 106 byTF regulatorycontrol SORLIP1 AGCCAC 107 byTF regulatorycontrol SORLIP2 GGGCC 108 byTF regulatorycontrol SORLIP3 CTCAAGTGA 109 byTF regulatorycontrol SORLIP4 GTATGATGG 110 byTF regulatorycontrol SORLIP5 GAGTGAG 111 byTF regulatorycontrol ABFsbindingsitemotif CACGTGGC 112 byTF up(auxin 3xDR5auxin-response CCGACAAAAGGCCGACAA 113 responsive) element AAGGCCGACAAAAGGT up(auxin 3xDR5auxin-response ACCTTTTGTCGGCCTTTTGT 114 responsive) element CGGCCTTTTGTCGG up(auxin 6xDR5auxin-responsive GCCGACAAAAGGCCGACA 115 responsive) element AAAGGCCGACAAAAGGCC GACAAAAGGCCGACAAAA GGCCGACAAAAGGT up(auxin 6xDR5auxin-responsive ACCTTTTGTCGGCCTTTTGT 116 responsive) element CGGCCTTTTGTCGGCCTTTT GTCGGCCTTTTGTCGGCCTT TTGTCGGC up(auxin 9xDR5auxin-responsive CCGACAAAAGGCCGACAA 117 responsive) element AAGGCCGACAAAAGGCCG ACAAAAGGCCGACAAAAG GCCGACAAAAGGCCGACA AAAGGCCGACAAAAGGCC GACAAAAGGT up(auxin 9xDR5auxin-responsive ACCTTTTGTCGGCCTTTTGT 118 responsive) element CGGCCTTTTGTCGGCCTTTT GTCGGCCTTTTGTCGGCCTT TTGTCGGCCTTTTGTCGGCC TTTTGTCGGCCTTTTGTCGG up(auxin ocsenhancer ACGTAAGCGCTTACGT 119 responsive; (Agrobacteriumsp.) constitutive) up(nitrogen AtNRE AAGAGATGAGCTCTTGAGC 120 responsive) AATGTAAAGGGTCAAGTTG TTTCT up(nitrogen AtNRE AGAAACAACTTGACCCTTT 121 responsive) ACATTGCTCAAGAGCTCAT CTCTT up(auxin 3xDR5auxin-response ACCTTTTGTCGGCCTTTTGT 122 responsive) element;complementary CGGCCTTTTGTCGG strandofahybrid up(auxin 3xDR5auxin-response TCGGTCCGACAAAAGGCCG 123 responsive) element;sticky-ended ACAAAAGGCGGACAAAAG G up(auxin 3xDR5auxin-response ACCGACCTTTTGTCGGCCTT 124 responsive) element;sticky-ended TTGTCGGCCTTTTGTCGG up(Pistarvation P1BS GNATATNC 125 response) .sup.1 Y =T or C; W =A or T; S =C or G; M =A or C; N =A, G, C, or T; K =G or T; R =A or G; K =G or T; D =A, G, or T; B =C, G, or T; H =A, C, or T

    [0041] The transcriptional enhancer element of SEQ ID NO: 16 comprises 3 copies of a 12-nucleotide core element nucleotide sequence of SEQ ID NO: 17. The 12 nucleotide core element nucleotide sequence of SEQ ID NO: 17 is present at several locations in the maize genome. For example, it can be found at several chromosomal locations of the maize variety B73. According to the B73v4 version of the genomic sequences (available on the https world wide web internet site maizegdb.org/genome/assembly/Zm-B73-REFERENCE-GRAMENE-4.0 and hereinafter referred to as B73v4 maize genome), SEQ ID NO: 17 can be found on Chr3 coordinates 1,063,395 . . . 1,063,406 (intron of Zm00001d039287), on Chr3 coordinates 12,253,969 . . . 12,253,980 (immediately downstream of Zm00001d039695), on Chr3 coordinates 12,265,615 . . . 12,265,626 (intron of Zm00001d039695), on Chr3 coordinates 12,277,428 . . . 12,277,439 (intron of Zm00001d039695), on Chr3 coordinates 147,698,750 . . . 147,698,761 (not within 2 kb of an annotated gene model), on Chr6, coordinates 107,132,183 . . . 107,132,194 (about 2 kb downstream of Zm00001d036949), on Chr10, coordinates 53,761,662 . . . 53,761,673 (not within 2 kb of an annotated gene model).

    [0042] In certain embodiments, a modified Zm1d31079 gene or modified Zm1d44812 gene with increased expression that provides for reduced plant height is obtained by inserting a heterologous intron in the 5 UTR and/or within the coding region of a Zm1d31079 gene or the Zm1d44812 gene. Materials and methods for intron mediated enhancement (IME) of plant gene expression described previously (Laxa, M. Front. Plant Sci., 6 Jan. 2017 doi.org/10.3389/fpls.2016.01977; Rose, A. B. Plant J. 17 Nov. 2004 doi.org/10.1111/j.1365-313X.2004.02247.x; Parra, G. et al. Nucleic Acids Research, Volume 39, Issue 13, 1 Jul. 2011, 5328-5337, doi.org/10.1093/nar/gkr043) can be adapted for use in enhancing expression of Zm1d31079 gene or Zm1d44812 gene. Heterologous introns that can be used to increase expression of plant genes include an Actin, Hsp70, PEPC, UBQ (e.g., UBQ1, UBQ10), EF-1, EF-1, Histone H3, ATPK1, RHD3, or MHX intron (e.g., a rice or maize Actin, Hsp70, PEPC, UBQ1, UBQ10, EF-1, EF-1, Histone H3, ATPK1, RHD3, or MHX intron). In certain embodiments, the intron is inserted within or at about 500, 200, 100, 50, 30, or 20 base pairs of the transcription start site (TSS). In certain embodiments, the intron is inserted in the 5 UTR and/or in the coding region within at about 500, 200, 100, 50, 30, or 20 base pairs of the transcription start site (TSS) of a Zm1d31079 gene or the Zm1d44812 gene. In certain embodiments, the intron is inserted in the 5 UTR and/or in the coding region within at about 20 to about 100 or 200 base pairs of the transcription start site (TSS) of a Zm1d31079 gene or the Zm1d44812 gene.

    [0043] In certain embodiments, a modified Zm1d31079 gene or modified Zm1d44812 gene with increased expression that provides for reduced plant height is obtained by inserting a heterologous translational enhancer in the 5 UTR and/or within the coding region of the Zm1d31079 gene or the Zm1d44812 gene. Translational enhancers can comprise 5 UTRs and/or 5 UTR and one or more codons of a coding region. Translational enhancers include 5 UTRs of various rice genes that can enhance translation of linked heterologous reporter genes (e.g., a 5 UTR of a rice Adh gene (Sugio et al. J. Biosci. Bioengin. 105(3), 300-302 (2008) doi.org/10.1263/jbb.105.300; glutathione transferase U50, glutathione peroxidase 1, 20S proteasome alpha1 subunit, pathogenesis-related protein 4b, glycine-rich cell-wall structural protein 1, or UspA domain containing protein; Yamasaki et al. Plant Biotechnology 35, 365-373 (2018) DOI: 10.5511/plantbiotechnology.18.0903a). In certain embodiments, the translational enhancer is encoded by a DNA molecule comprising the DNA sequence of any aforementioned 5UTR and all or part of the 5UTR is substituted for all or part of the Zm1d31079 5 UTR or the Zm1d44812 5 UTR in the modified Zm1d31079 or the modified Zm1d44812 gene.

    [0044] Expression of a Zm1d31079 or Zm1d44812 encoding transgene can also be increased by in vitro insertion or formation of the in the transgene such that it is operably linked to the promoter that is operably linked to transgene and then introducing the transgene into the maize plant genome (e.g., by Agrobacterium-mediated transformation or biolistics). In certain embodiments, such transgenes can comprise a modified promoter that comprises any of the aforementioned modified Zm1d31079 or Zm1d44812 with the insertions and/or substitutions of the aforementioned transcription enhancers. In certain embodiments, such transgenes can comprise a whole or partial substitution of a Zm1d31079 or Zm1d44812 promoter, 5 UTR, and/or intron with a heterologous promoter, 5 UTR, and/or intron.

    [0045] Expression of a modified Zm1d31079 gene or the modified Zm1d44812 gene can be increased in comparison to a control maize plant comprising the unmodified Zm1d31079 gene or the unmodified Zm1d44812 gene. Such increases in expression can be measured by a variety of methods. In certain embodiments, a reduced plant height trait conferred by increased expression of a modified Zm1d31079 gene or the modified Zm1d44812 gene is measured in maize plants comprising the expression increasing element and compared to control maize plants comprising the unmodified Zm1d31079 gene or the unmodified Zm1d44812 gene. Reduction in height traits can be assessed by comparing any measure of the reduced height trait itself (e.g., total height, internode length, etc.) or a proxy for the trait (e.g., yield of seed and/or other biomass in kg/hectare) in maize plants comprising the modified Zm1d31079 gene or the modified Zm1d44812 gene can be increased in comparison to a control maize plant comprising the unmodified Zm1d31079 gene or the unmodified Zm1d44812 gene. In certain embodiments, increased expression of the encoded transcript itself is directly measured by determining amounts of the Zm1d31079 gene or the Zm1d44812 gene-encoding transcript (e.g., an mRNA or non-coding RNA) in maize plants comprising the modified Zm1d31079 gene or the modified Zm1d44812 gene and compared to amounts of the transcript-encoding polynucleotide in control maize plants comprising the unmodified Zm1d31079 gene or the unmodified Zm1d44812 gene. Amounts of the Zm1d31079 gene or the Zm1d44812 gene-encoding transcript can be determined by a variety of techniques including PCR (e.g., quantitative reverse-transcriptase PCR; qRT-PCR), hybridization, CRISPR-, and/or sequencing-based techniques (Khodakov et al., doi.org/10.1016/j.addr.2016.04.005; Gootenberg, et al. doi: 10.1126/science.aaq0179). In certain embodiments, expression of a Zm1d31079 gene or the Zm1d44812 gene-encoding polynucleotide can also be determined by measuring amounts of a Zm1d31079 or the Zm1d44812 protein encoded by the transcript in maize plants comprising the transcription enhancer and compared to amounts of the Zm1d31079 or the Zm1d44812 protein in control maize plants comprising the unmodified Zm1d31079 gene or the unmodified Zm1d44812 gene. Amounts of the Zm1d31079 or the Zm1d44812 protein can be determined by a variety of techniques including immunoassays for the protein, and mass spectroscopy-based techniques (Chen et al. doi: 10.1186/s12967-015-0537-6; Bruce et al. doi: 10.1002/0471250953.bi1321s41). The magnitude of the increase in transcript production may depend on the baseline expression level of the unmodified endogenous Zm1d31079 or the Zm1d44812 transcript-encoding polynucleotide in the respective cells or tissues. By way of a non-limiting example, the magnitude of the increase in expression of an endogenous Zm1d31079 or the Zm1d44812 gene modified by insertion or formation of SEQ ID NO: 16 in an endogenous Zm1d31079 or the Zm1d44812 promoter over baseline expression levels of the unmodified endogenous Zm1d31079 or the Zm1d44812 gene will be greatest where baseline Zm1d31079 or the Zm1d44812 expression levels are low. In certain embodiments, expression of the endogenous Zm1d31079 or the Zm1d44812 gene modified by insertion of a heterologous expression enhancer (e.g., the transcription enhancer of SEQ ID NO: 16) can be increased by at least 1.2-, 1.5-, 2-, 3-, 4-, or 5-fold over baseline expression levels of the unmodified endogenous Zm1d31079 or the Zm1d44812 gene. In certain embodiments, expression of the endogenous Zm1d31079 or the Zm1d44812 gene modified by insertion or formation of the heterologous expression enhancer (e.g., the transcription enhancer of SEQ ID NO: 16) can be increased by at least about 1.2- or 1.5-fold to about 2-, 3-, 4-, 5-, 6-fold or more over baseline expression levels of the unmodified endogenous Zm1d31079 or the Zm1d44812 gene in unmodified control plants.

    [0046] In certain embodiments, it will be desirable to use genome editing molecules to introduce or form a heterologous expression enhancing element (e.g., a heterologous transcription enhancer, a heterologous translational enhancing element, and/or a heterologous intron) in an endogenous Zm1d31079 or the Zm1d44812 gene. Gene editing molecules of use in methods provided herein include molecules capable of introducing a double-strand break (DSB) or single-strand break (SSB) at a specific site or sequence in a double-stranded DNA, such as in genomic DNA or in a target gene located within the genomic DNA as well as accompanying guide RNA or donor or other DNA template polynucleotides. Examples of such gene editing molecules include: (a) a nuclease comprising an RNA-guided nuclease, an RNA-guided DNA endonuclease or RNA directed DNA endonuclease (RdDe), a class 1 CRISPR type nuclease system, a type II Cas nuclease, a Cas9, a nCas9 nickase, a type V Cas nuclease, a Cas12a nuclease, a nCas12a nickase, a Cas12d (CasY), a Cas12e (CasX), a Cas12b (C2c1), a Cas12c (C2c3), a Cas12i, a Cas12j, a Cas14, an engineered nuclease, a codon-optimized nuclease, a zinc-finger nuclease (ZFN) or nickase, a transcription activator-like effector nuclease (TAL-effector nuclease or TALEN) or nickase (TALE-nickase), an Argonaute, and a meganuclease or engineered meganuclease; (b) a polynucleotide encoding one or more nucleases capable of effectuating site-specific alteration (including introduction of a DSB or SSB) of a target nucleotide sequence; (c) a guide RNA (gRNA) for use with an RNA-guided nuclease, or a DNA encoding a gRNA for use with an RNA-guided nuclease; (d) donor DNA template polynucleotides suitable for insertion at a break in genomic DNA by homology-directed repair (HDR) or microhomology-mediated end joining (MMEJ); and (e) other DNA templates (e.g., dsDNA, ssDNA, or combinations thereof) suitable for insertion at a break in genomic DNA (e.g., by non-homologous end joining (NHEJ).

    [0047] CRISPR technology for editing the genes of eukaryotes is disclosed in US Patent Application Publications 2016/0138008A1 and US2015/0344912A1, and in U.S. Pat. Nos. 8,697,359, 8,771,945, 8,945,839, 8,999,641, 8,993,233, 8,895,308, 8,865,406, 8,889,418, 8,871,445, 8,889,356, 8,932,814, 8,795,965, and 8,906,616. Cpf1 endonuclease and corresponding guide RNAs and PAM sites are disclosed in US Patent Application Publication 2016/0208243 A1. Plant RNA promoters for expressing CRISPR guide RNA and plant codon optimized CRISPR Cas9 endonuclease are disclosed in International Patent Application PCT/US2015/018104 (published as WO 2015/131101 and claiming priority to U.S. Provisional Patent Application 61/945,700). Methods of using CRISPR technology for genome editing in plants are disclosed in US Patent Application Publications US 2015/0082478A1 and US 2015/0059010A1 and in International Patent Application PCT/US2015/038767 A1 (published as WO 2016/007347 and claiming priority to U.S. Provisional Patent Application 62/023,246). In certain embodiments, an RNA-guided endonuclease that leaves a blunt end following cleavage of the target site is used. Blunt-end cutting RNA-guided endonucleases include Cas9, Cas12c, Cas12i, and Cas 12h (Yan et al., 2019). In certain embodiments, an RNA-guided endonuclease that leaves a staggered single stranded DNA overhanging end following cleavage of the target site following cleavage of the target site is used. Staggered-end cutting RNA-guided endonucleases include Cas12a, Cas12b, and Cas12e. Target Cas nuclease cleavage sites in both the promoters of the endogenous Zm1d31079 or the Zm1d44812 gene are set forth respectively in SEQ ID NO: 1 and SEQ ID NO: 8 as depicted in FIGS. 1 and 2. All of the patent publications referenced in this paragraph are incorporated herein by reference in their entirety.

    [0048] CRISPR-type genome editing can be adapted for use in the plant cells and methods provided herein in several ways. CRISPR elements, e.g., gene editing molecules comprising CRISPR endonucleases and CRISPR guide RNAs including single guide RNAs or guide RNAs in combination with tracrRNAs or scoutRNA, or polynucleotides encoding the same, are useful in effectuating genome editing without remnants of the CRISPR elements or selective genetic markers occurring in progeny. In certain embodiments, the CRISPR elements are provided directly to the eukaryotic cell (e.g., maize plant cells), systems, methods, and compositions as isolated molecules, as isolated or semi-purified products of a cell free synthetic process (e.g., in vitro translation), or as isolated or semi-purified products of in a cell-based synthetic process (e.g., such as in a bacterial or other cell lysate). In certain embodiments, maize plants or maize plant cells used in the systems, methods, and compositions provided herein can comprise a transgene that expresses a CRISPR endonuclease (e.g., a Cas9, a Cpf1-type or other CRISPR endonuclease). In certain embodiments, one or more CRISPR endonucleases with unique PAM recognition sites can be used. Guide RNAs (sgRNAs or crRNAs and a tracrRNA) to form an RNA-guided endonuclease/guide RNA complex which can specifically bind sequences in the gDNA target site that are adjacent to a protospacer adjacent motif (PAM) sequence. The type of RNA-guided endonuclease typically informs the location of suitable PAM sites and design of crRNAs or sgRNAs. G-rich PAM sites, e.g., 5-NGG are typically targeted for design of crRNAs or sgRNAs used with Cas9 proteins. Examples of PAM sequences include 5-NGG (Streptococcus pyogenes), 5-NNAGAA (Streptococcus thermophilus CRISPR1), 5-NGGNG (Streptococcus thermophilus CRISPR3), 5-NNGRRT or 5-NNGRR (Staphylococcus aureus Cas9, SaCas9), and 5-NNNGATT (Neisseria meningitidis). T-rich PAM sites (e.g., 5-TTN or 5-TTTV, where V is A, C, or G) are typically targeted for design of crRNAs or sgRNAs used with Cas12a proteins. In some instances, Cas12a can also recognize a 5-CTA PAM motif. Other examples of potential Cas12a PAM sequences include TTN, CTN, TCN, CCN, TTTN, TCTN, TTCN, CTTN, ATTN, TCCN, TTGN, GTTN, CCCN, CCTN, TTAN, TCGN, CTCN, ACTN, GCTN, TCAN, GCCN, and CCGN (wherein N is defined as any nucleotide). Cpf1 endonuclease and corresponding guide RNAs and PAM sites are disclosed in US Patent Application Publication 2016/0208243 A1, which is incorporated herein by reference for its disclosure of DNA encoding Cpf1 endonucleases and guide RNAs and PAM sites.

    [0049] In certain embodiments, zinc finger nucleases or zinc finger nickases can also be used in the methods provided herein. Zinc-finger nucleases are site-specific endonucleases comprising two protein domains: a DNA-binding domain, comprising a plurality of individual zinc finger repeats that each recognize between 9 and 18 base pairs, and a DNA-cleavage domain that comprises a nuclease domain (typically Fokl). The cleavage domain dimerizes in order to cleave DNA; therefore, a pair of ZFNs are required to target non-palindromic target polynucleotides. In certain embodiments, zinc finger nuclease and zinc finger nickase design methods which have been described (Urnov et al. (2010) Nature Rev. Genet., 11:636-646; Mohanta et al. (2017) Genes vol. 8, 12: 399; Ramirez et al. Nucleic Acids Res. (2012); 40(12): 5560-5568; Liu et al. (2013) Nature Communications, 4: 2565) can be adapted for use in the methods set forth herein. The zinc finger binding domains of the zinc finger nuclease or nickase provide specificity and can be engineered to specifically recognize any desired target DNA sequence. The zinc finger DNA binding domains are derived from the DNA-binding domain of a large class of eukaryotic transcription factors called zinc finger proteins (ZFPs). The DNA-binding domain of ZFPs typically contains a tandem array of at least three zinc fingers each recognizing a specific triplet of DNA. A number of strategies can be used to design the binding specificity of the zinc finger binding domain. One approach, termed modular assembly, relies on the functional autonomy of individual zinc fingers with DNA. In this approach, a given sequence is targeted by identifying zinc fingers for each component triplet in the sequence and linking them into a multi-finger peptide. Several alternative strategies for designing zinc finger DNA binding domains have also been developed. These methods are designed to accommodate the ability of zinc fingers to contact neighboring fingers as well as nucleotide bases outside their target triplet. Typically, the engineered zinc finger DNA binding domain has a novel binding specificity, compared to a naturally occurring zinc finger protein. Engineering methods include, for example, rational design and various types of selection. Rational design includes, for example, the use of databases of triplet (or quadruplet) nucleotide sequences and individual zinc finger amino acid sequences, in which each triplet or quadruplet nucleotide sequence is associated with one or more amino acid sequences of zinc fingers which bind the particular triplet or quadruplet sequence. See, e.g., U.S. Pat. Nos. 6,453,242 and 6,534,261, both incorporated herein by reference in their entirety. Exemplary selection methods (e.g., phage display and yeast two-hybrid systems) can be adapted for use in the methods described herein. In addition, enhancement of binding specificity for zinc finger binding domains has been described in U.S. Pat. No. 6,794,136, incorporated herein by reference in its entirety. In addition, individual zinc finger domains may be linked together using any suitable linker sequences. Examples of linker sequences are publicly known, e.g., see U.S. Pat. Nos. 6,479,626; 6,903,185; and 7,153,949, incorporated herein by reference in their entirety. The nucleic acid cleavage domain is non-specific and is typically a restriction endonuclease, such as Fokl. This endonuclease must dimerize to cleave DNA. Thus, cleavage by Fokl as part of a ZFN requires two adjacent and independent binding events, which must occur in both the correct orientation and with appropriate spacing to permit dimer formation. The requirement for two DNA binding events enables more specific targeting of long and potentially unique recognition sites. Fokl variants with enhanced activities have been described and can be adapted for use in the methods described herein; see, e.g., Guo et al. (2010) J. Mol. Biol., 400:96-107.

    [0050] Transcription activator like effectors (TALEs) are proteins secreted by certain Xanthomonas species to modulate gene expression in host plants and to facilitate the colonization by and survival of the bacterium. TALEs act as transcription factors and modulate expression of resistance genes in the plants. Recent studies of TALEs have revealed the code linking the repetitive region of TALEs with their target DNA-binding sites. TALEs comprise a highly conserved and repetitive region consisting of tandem repeats of mostly 33 or 34 amino acid segments. The repeat monomers differ from each other mainly at amino acid positions 12 and 13. A strong correlation between unique pairs of amino acids at positions 12 and 13 and the corresponding nucleotide in the TALE-binding site has been found. The simple relationship between amino acid sequence and DNA recognition of the TALE binding domain allows for the design of DNA binding domains of any desired specificity. TALEs can be linked to a non-specific DNA cleavage domain to prepare genome editing proteins, referred to as TAL-effector nucleases or TALENs. As in the case of ZFNs, a restriction endonuclease, such as Fokl, can be conveniently used. Methods for use of TALENs in plants have been described and can be adapted for use in the methods described herein, see Mahfouz et al. (2011) Proc. Natl. Acad. Sci. USA, 108:2623-2628; Mahfouz (2011) GM Crops, 2:99-103; and Mohanta et al. (2017) Genes vol. 8, 12: 399). TALE nickases have also been described and can be adapted for use in methods described herein (Wu et al.; Biochem Biophys Res Commun. (2014); 446(1):261-6; Luo et al; Scientific Reports 6, Article number: 20657 (2016)).

    [0051] In certain embodiments where heterologous expression enhancing element (e.g., a heterologous transcription enhancer, a heterologous translational enhancing element, and/or a heterologous intron) is inserted into the genome at a site of a double stranded break in the endogenous Zm1d31079 or the Zm1d44812 gene introduced by one or more nucleases or nickases (e.g., a CRISPR/guide RNA complex with site-specific endonuclease or nickase, an aZF nuclease or nickase, and/or a TALE nuclease or nickase), the donor DNA template or other DNA template comprises the heterologous expression enhancing element (e.g., a heterologous transcription enhancer, a heterologous translational enhancing element, and/or a heterologous intron). In certain embodiments where the heterologous expression enhancing element is formed in the genome at a site of a double stranded break in the maize plant genome introduced by a nuclease, the donor DNA template or other DNA template can comprise less than the complete set of nucleotides or base pairs of the transcription enhancer (e.g., less than the entire 36 nucleotides or base pairs of SEQ ID NO: 16 sequence) and genomic DNA at the site of integration can contribute the nucleotides or base pairs of the transcription enhancer that are absent from the donor DNA template or other DNA template. In certain embodiments where SEQ ID NO: 16 is formed in the genomic DNA, the donor DNA template or other DNA template can comprise up to 35 contiguous nucleotides or base pairs of SEQ ID NO:16, the genomic DNA at the site of integration can contribute 1 or more nucleotides or base pairs of the SEQ ID NO:16 sequence which are lacking from the donor DNA template or other DNA template, and the complete 36 base pair sequence of SEQ ID NO:16 is formed at the site of integration in the genome. Donor DNA template molecules used in the methods provided herein include DNA molecules comprising, from 5 to 3, a first homology arm, a replacement DNA, and a second homology arm, wherein the homology arms containing sequences that are partially or completely homologous to genomic DNA (gDNA) sequences flanking a target site-specific endonuclease cleavage site in the gDNA. In certain embodiments, the replacement DNA can comprise an insertion, deletion, or substitution of 1 or more DNA base pairs relative to the target gDNA. In one embodiment, the donor DNA template molecule is double-stranded and perfectly base-paired through all or most of its length, with the possible exception of any unpaired nucleotides at either terminus or both termini. In another embodiment, the donor DNA template molecule is double-stranded and includes one or more non-terminal mismatches or non-terminal unpaired nucleotides within the otherwise double-stranded duplex. In an embodiment, the donor DNA template molecule that is integrated at the site of at least one double-strand break (DSB) includes between 2-20 nucleotides in one (if single-stranded) or in both strands (if double-stranded), e. g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides on one or on both strands, each of which can be base-paired to a nucleotide on the opposite strand of the targeted integration site (in the case of a perfectly base-paired double-stranded polynucleotide molecule). Such donor DNA templates can be integrated in genomic DNA containing blunt and/or staggered double stranded DNA breaks by homology-directed repair (HDR) or microhomology-mediated end joining (MMEJ). In certain embodiments, a donor DNA template homology arm can be about 20, 50, 100, 200, 400, or 600 to about 800, or 1000 base pairs in length. In certain embodiments, integration of the donor DNA templates by HDR can be facilitated by use of an exonuclease (e.g., bacteriophage lambda exonuclease), a single-stranded DNA annealing protein (SSAP; e.g., bacteriophage lambda beta SSAP protein), and a single-stranded DNA binding protein (SSB; e.g., an E. coli SSB) essentially as set forth in US Patent Application Publication 20200407754, which is incorporated herein by reference in its entirety. In certain embodiments, a donor DNA template molecule can be delivered to a maize plant cell in a circular (e.g., a plasmid or a viral vector including a geminivirus vector) or a linear DNA molecule. In certain embodiments, a circular or linear DNA molecule that is used can comprise a modified donor DNA template molecule comprising, from 5 to 3, a first copy of the target sequence-specific endonuclease cleavage site sequence, the first homology arm, the replacement DNA, the second homology arm, and a second copy of the target sequence-specific endonuclease cleavage site sequence. In other embodiments, DNA templates suitable for NHEJ insertion will lack homology arms that are partially or completely homologous to genomic DNA (gDNA) sequences flanking a target site-specific endonuclease cleavage site in the gDNA. In certain embodiments, the DNA template comprising all of an expression enhancing element (e.g., dsDNA, ssDNA, or combinations thereof) can be inserted at a double-stranded break in gDNA by non-homologous end joining (NHEJ). In certain embodiments, the DNA template (e.g., dsDNA, ssDNA, or combinations thereof) comprising less than the complete set of nucleotides of the expression enhancing element (e.g., a transcription enhancer less than 36 nucleotides or base pairs of SEQ ID NO:16 sequence) can be inserted at a double-stranded break in gDNA by non-homologous end joining (NHEJ), gDNA at the site of insertion can contribute the nucleotides or base pairs of the expression enhancing element (e.g., SEQ ID NO:16) that are absent from the DNA template, and the expression enhancing element (e.g., SEQ ID NO:16) can be formed at the site of the double-stranded break in the gDNA.

    [0052] In some embodiments, the expression enhancing element (e.g., a heterologous transcription enhancer, a heterologous translational enhancing element, and/or a heterologous intron) replaces or largely replaces a corresponding sequence in a gene, such as in a promoter, a 5 UTR, or an intron. Accordingly, a replacement rather than an insertion leaves the positioning of other elements unchanged. A replacement target site may be chosen by similarity to the expression enhancing element or a portion thereof. A replacement template could be used in an HDR process, and/or DNA base editing and/or genome editing could be used to produce the desired replacement region that corresponds to the expression enhancing element or a portion thereof. Base editors include for example, a site-specific base edit mediated by a C*G to T.Math.A or an A.Math.T to G*C base editing deaminase enzymes (Gaudelli et al., Programmable base editing of A.Math.T to G*C in genomic DNA without DNA cleavage. Nature (2017); Nishida et al. Targeted nucleotide editing using hybrid prokaryotic and vertebrate adaptive immune systems. Science 353 (6305) (2016); Komor et al. Programmable editing of a target base in genomic DNA without double-stranded DNA cleavage. Nature 533 (7603) (2016):420-4. Catalytically dead dCas9 fused to a cytidine deaminase or an adenine deaminase protein becomes a specific base editor that can alter DNA bases without inducing a DNA break. Base editors convert C->T (or G->A on the opposite strand) or an adenine base editor that would convert adenine to inosine, resulting in an A->G change within an editing window specified by the gRNA.

    [0053] Various treatments can be used for delivery of gene editing molecules and/or other molecules to a plant cell. In certain embodiments, one or more treatments is employed to deliver the gene editing or other molecules (e.g., comprising a polynucleotide, polypeptide, or combination thereof) into a eukaryotic or plant cell, e.g., through barriers such as a cell wall, a plasma membrane, a nuclear envelope, and/or other lipid bilayer. In certain embodiments, a polynucleotide-, polypeptide-, or RNP (ribonucleoprotein)-containing composition comprising the molecules are delivered directly, for example by direct contact of the composition with a plant cell. Aforementioned compositions can be provided in the form of a liquid, a solution, a suspension, an emulsion, a reverse emulsion, a colloid, a dispersion, a gel, liposomes, micelles, an injectable material, an aerosol, a solid, a powder, a particulate, a nanoparticle, or a combination thereof can be applied directly to a plant, plant part, plant cell, or plant explant (e.g., through abrasion or puncture or otherwise disruption of the cell wall or cell membrane, by spraying or dipping or soaking or otherwise directly contacting, by microinjection). For example, a plant cell or plant protoplast is soaked in a liquid genome editing molecule-containing composition, whereby the agent is delivered to the plant cell. In certain embodiments, the agent-containing composition is delivered using negative or positive pressure, for example, using vacuum infiltration or application of hydrodynamic or fluid pressure. In certain embodiments, the agent-containing composition is introduced into a plant cell or plant protoplast, e.g., by microinjection or by disruption or deformation of the cell wall or cell membrane, for example by physical treatments such as by application of negative or positive pressure, shear forces, or treatment with a chemical or physical delivery agent such as surfactants, liposomes, or nanoparticles; see, e.g., delivery of materials to cells employing microfluidic flow through a cell-deforming constriction as described in US Published Patent Application 2014/0287509, incorporated by reference in its entirety herein. Other techniques useful for delivering the agent-containing composition to a eukaryotic cell, plant cell or plant protoplast include: ultrasound or sonication; vibration, friction, shear stress, vortexing, cavitation; centrifugation or application of mechanical force; mechanical cell wall or cell membrane deformation or breakage; enzymatic cell wall or cell membrane breakage or permeabilization; abrasion or mechanical scarification (e.g., abrasion with carborundum or other particulate abrasive or scarification with a file or sandpaper) or chemical scarification (e.g., treatment with an acid or caustic agent); and electroporation. In certain embodiments, the agent-containing composition is provided by bacterially mediated (e.g., Agrobacterium sp., Rhizobium sp., Sinorhizobium sp., Mesorhizobium sp., Bradyrhizobium sp., Azobacter sp., Phyllobacterium sp.) transfection of the plant cell or plant protoplast with a polynucleotide encoding the genome editing molecules (e.g., RNA dependent DNA endonuclease, RNA dependent DNA binding protein, RNA dependent nickase, ABE, or CBE, and/or guide RNA); see, e.g., Broothaerts et al. (2005) Nature, 433:629-633). Any of these techniques or a combination thereof are alternatively employed on the plant explant, plant part or tissue or intact plant (or seed) from which a plant cell is optionally subsequently obtained or isolated; in certain embodiments, the agent-containing composition is delivered in a separate step after the plant cell has been isolated.

    [0054] Commodity plant products obtained from maize plants or maize plant parts comprising at least one modified Zm1d31079 gene or the modified Zm1d44812 gene as well as methods for making such products are provided. In certain embodiments, the commodity products are processed products are made from the maize plant or its seeds, including: (a) maize seed meal (defatted or non-defatted); (b) extracted maize proteins, oils, sugars, syrups, and starches; (c) soy fermentation products; (d) maize based animal feed or human food products (e.g., feed and food comprising maize seed meal (defatted or non-defatted) and other ingredients (e.g., other cereal grains, other seed meal, other protein meal, other oil, other starch, other sugar, a binder, a preservative, a humectant, a vitamin, and/or mineral); (e) a pharmaceutical; (f) raw or processed biomass (e.g., cellulosic and/or lignocellulosic material; silage); and (g) various industrial products.

    [0055] Also provided herein are methods for detecting a DNA fragment comprising a modified Zm1d31079 gene or the modified Zm1d44812 gene comprising a detectable amount of a DNA molecule comprising a heterologous transcription enhancer, a heterologous intron, and/or heterologous translational enhancing element located in a DNA fragment of a modified Zm1d31079 gene or in a DNA fragment of a modified Zm1d44812 gene in any of the aforementioned biological samples and commodity products. Non-limiting and illustrative examples of such DNA fragments include those wherein the SEQ ID NO: 16 enhancer is inserted. Detection of the DNA molecules comprising insertions and/or substitutions of the enhancer in the transcriptional regulatory region can be achieved by any combination of nucleic acid amplification (e.g., PCR amplification), hybridization, sequencing, and/or mass-spectrometry based techniques. Methods set forth for detecting foreign nucleic acids in transgenic loci set forth in US 20190136331 and U.S. Pat. No. 9,738,904, both incorporated herein by reference in their entireties, can be adapted for use in detection of the nucleic acids provided herein. In certain embodiments, such detection is achieved by amplification and/or hybridization-based detection methods using a method (e.g., selective amplification primers) and/or probe (e.g., capable of selective hybridization or generation of a specific primer extension product) which specifically recognizes the target DNA molecule (e.g., a heterologous transcription enhancer, a heterologous intron, and/or heterologous translational enhancing element located in a DNA fragment of a modified Zm1d31079 gene or in a DNA fragment of a modified Zm1d44812 gene) but does not recognize DNA from an unmodified Zm1d31079 gene or Zm1d44812 gene. In certain embodiments, the hybridization probes (e.g., polynucleotides comprising at least about 18 to 30 base pairs which span the junction of a, respectively) can comprise detectable labels (e.g., fluorescent, radioactive, epitope, and chemiluminescent labels). In certain embodiments, a single nucleotide polymorphism detection assay can be adapted for detection of the target DNA molecule (e.g., a heterologous transcription enhancer, a heterologous intron, and/or heterologous translational enhancing element located in a DNA fragment of a modified Zm1d31079 gene or in a DNA fragment of a modified Zm1d44812 gene).

    [0056] Inbred and hybrid maize plants and seeds comprising a modified Zm1d31079 gene or the modified Zm1d44812 gene are provided herein along with methods for making and using such hybrid and inbred seed. Methods for inbred seed production include selfing inbred maize plants and restricting cross-pollination by any maize plants other than the inbred maize plant. Methods for production of such hybrid seed can comprise crossing elite crop maize plant lines where at least one of the pollen donor or recipient comprises the modified Zm1d31079 gene or the modified Zm1d44812 gene comprising an expression enhancing element (e.g. transcriptional enhancer). In certain embodiments, methods of making hybrid seed can comprise crossing elite crop maize plant lines where the pollen recipient comprises the modified Zm1d31079 gene or the modified Zm1d44812 gene comprising an expression enhancing element (e.g. transcriptional enhancer) and where the pollen recipient is homozygous for the modified Zm1d31079 gene or the modified Zm1d44812 gene. In certain embodiments, methods of making hybrid seed can comprise crossing elite crop maize plant lines where both the pollen donor and recipient comprise the modified Zm1d31079 gene or the modified Zm1d44812 gene comprising an expression enhancing element (e.g. transcriptional enhancer) and where both the pollen donor and pollen recipient are homozygous for the modified Zm1d31079 gene or the modified Zm1d44812 gene. Methods for hybrid seed production have been disclosed (MacRobert, J. F., P. S. Setimela, J. Gethi, and M. Worku. 2014. Maize Hybrid Seed Production Manual. Mexico, D.F.: CIMMYT) and can be adapted to the production of hybrids disclosed herein. In certain embodiments, the inbred maize plant, the hybrid maize plant, the pollen donor and/or the pollen recipient can each comprise a transgenic locus which confers a trait (e.g., herbicide tolerance or insect resistance such as coleopteran or lepidopteran insects). Transgenes that can be introduced into the maize plant lines comprising a modified Zm1d31079 gene or the modified Zm1d44812 gene by breeding or by direct transformation include: (i) transgenes that confer insect resistance (e.g., transgenes that produce Bacillus thuringiensis proteins including Cry1Ab, Cry1Ac, Cry1F, Cry2Ab, Cry2Ae, Cry3A, Cry3Bb, Cry9c, Cry34, Cry35, VIP3A, and variants thereof; transgenes that induce insect-inhibitory RNAi responses); and (ii) transgenes that confer tolerance to distinct herbicides (e.g., CP4-EPSPS or other EPSPS genes which confer glyphosate tolerance; PAT or BAR genes which confer resistance to glufosinate herbicides; aad-1 genes which confer resistance to 2,4-D and aryloxyphenoxypropionate herbicides; DMO genes which confer resistance to dicamba herbicide). Examples of selected transgenic maize plant events which contain transgenes that confer traits such as herbicide tolerance and/or pest tolerance are disclosed in U.S. Pat. Nos. 6,342,660, 7,956,246, 8,575,434, 7,314,970, 8,759,618, 6,852,915, 10,316,330, 8,618,358, 8,450,561, 8,686,230, 9,428,765, 8,455,720, 7,897,748, 8,273,959, 8,093,453, 8,502,047, and 8,466,346, which are each incorporated herein by reference in their entireties.

    [0057] In certain embodiments, maize plants provided herein which comprise a modified Zm1d31079 gene or the modified Zm1d44812 gene can further comprise one or more targeted genetic changes introduced by one or more of gene editing molecules or systems. Such targeted genetic changes include those conferring traits such as improved yield, improved food and/or feed characteristics (e.g., improved oil, starch, protein, or amino acid quality or quantity), improved nitrogen use efficiency, improved biofuel use characteristics, herbicide tolerance (e.g., by targeting endogenous ALS, EPSPS, HPPD, or other herbicide target genes), delayed flowering, non-flowering, increased biotic stress resistance (e.g., resistance to insect, nematode, bacterial, or fungal damage), increased abiotic stress resistance (e.g., resistance to drought, cold, heat, metal, or salt), enhanced lodging resistance, enhanced growth rate, enhanced biomass, enhanced branching, delayed flowering time, delayed senescence, increased flower number, improved architecture for high density planting, improved photosynthesis, increased root mass, increased cell number, improved seedling vigor, improved seedling size, increased rate of cell division, improved metabolic efficiency, and increased meristem size in comparison to a control maize plant lacking the targeted genetic change. Types of targeted genetic changes that can be introduced include insertions, deletions, and substitutions of one or more nucleotides in the maize plant genome. Sites in endogenous maize plant genes for the targeted genetic changes include promoter, coding, and non-coding regions (e.g., 5 UTRs, introns, splice donor and acceptor sites and 3 UTRs). In certain embodiments, the targeted genetic change comprises an insertion of a regulatory or other DNA sequence in an endogenous maize plant gene. Non-limiting examples of regulatory sequences which can be inserted into endogenous maize plant genes with gene editing molecules to effect targeted genetic changes which confer useful phenotypes include those set forth in US Patent Application Publication 20190352655, which is incorporated herein by reference in its entirety, such as: (a) auxin response element (AuxRE) sequence; (b) at least one D1-4 sequence (Ulmasov et al. (1997) Plant Cell, 9:1963-1971), (c) at least one DR5 sequence (Ulmasov et al. (1997) Plant Cell, 9:1963-1971); (d) at least one m5-DR5 sequence (Ulmasov et al. (1997) Plant Cell, 9:1963-1971); (e) at least one P3 sequence; (f) a small RNA recognition site sequence bound by a corresponding small RNA (e.g., an siRNA, a microRNA (miRNA), a trans-acting siRNA as described in U.S. Pat. No. 8,030,473, or a phased sRNA as described in U.S. Pat. No. 8,404,928; both of these cited patents are incorporated by reference herein); (g) a microRNA (miRNA) recognition site sequence; (h) a microRNA (miRNA) recognition sequence for an engineered miRNA wherein the specific binding agent is the corresponding engineered mature miRNA; (i) a transposon recognition sequence; (j) a sequence recognized by an ethylene-responsive element binding-factor-associated amphiphilic repression (EAR) motif; (k) a splice site sequence (e.g., a donor site, a branching site, or an acceptor site; see, for example, the splice sites and splicing signals set forth in the internet site lemur[dot]amu[dot]edu[dot]pl/share/ERISdb/home.html); (l) a recombinase recognition site sequence that is recognized by a site-specific recombinase; (m) a sequence encoding an RNA or amino acid aptamer or an RNA riboswitch, the specific binding agent is the corresponding ligand, and the change in expression is upregulation or downregulation; (n) a hormone responsive element recognized by a nuclear receptor or a hormone-binding domain thereof; (o) a transcription factor binding sequence; and (p) a polycomb response element (see Xiao et al. (2017) Nature Genetics, 49:1546-1552, doi: 10.1038/ng.3937). Non-limiting examples of target maize genes that can be subjected to targeted gene edits to confer useful traits include quality and herbicide tolerance traits. In certain embodiments, such targeted genetic changes can be combined with plants which comprise the modified Zm1d31079 gene or the modified Zm1d44812 gene by breeding techniques. Such breeding techniques include crossing and/or introgression by backcrossing to a recurrent parent. In such crosses, the plants which comprise the modified Zm1d31079 gene or the modified Zm1d44812 gene can be either a pollen donor or recipient. In certain embodiments, plants which comprise the modified Zm1d31079 gene or the modified Zm1d44812 gene can be used as the recurrent parent in such backcrosses to introgress the targeted genetic change into plant germplasm comprising the modified Zm1d31079 gene or the modified Zm1d44812 gene. In certain embodiments, plants which comprise the target genetic change(s) can be used as the recurrent parent in such backcrosses to introgress the genomic region comprising the modified Zm1d31079 gene or the modified Zm1d44812 gene into plant germplasm comprising the target genetic change(s).

    [0058] In certain embodiments, plants provided herein which comprise a modified Zm1d31079 gene or the modified Zm1d44812 gene can further comprise one or more genetic loci conferring traits such as improved yield, improved food and/or feed characteristics (e.g., improved oil, starch, protein, or amino acid quality or quantity), improved nitrogen use efficiency, improved biofuel use characteristics (e.g., improved ethanol production), tolerance to herbicides (e.g., by targeting endogenous ALS, EPSPS, HPPD, or other herbicide target genes), delayed flowering, non-flowering, increased biotic stress resistance (e.g., resistance to insect, nematode, bacterial, or fungal damage), increased abiotic stress resistance (e.g., resistance to drought, cold, heat, metal, or salt), enhanced lodging resistance, enhanced growth rate, enhanced biomass, enhanced tillering, enhanced branching, delayed flowering time, delayed senescence, increased flower number, improved architecture for high density planting, improved photosynthesis, increased root mass, increased cell number, improved seedling vigor, improved seedling size, increased rate of cell division, improved metabolic efficiency, and increased meristem size in comparison to a control plant lacking the targeted genetic change. Sources of such genetic loci include elite cultivars, sexually compatible wild or other relatives (e.g., Zea sp.), plant germplasm which has been subjected to random mutagenesis (e.g., with a chemical mutagen such as EMS or with gamma-ray mutagenesis), and the like. In certain embodiments, such genetic loci can be combined with plants which comprise the modified Zm1d31079 gene or the modified Zm1d44812 gene by breeding techniques. Such breeding techniques include crossing and/or introgression by backcrossing to a recurrent parent. In such crosses, the plants which comprise modified Zm1d31079 gene or the modified Zm1d44812 gene can be either a pollen donor or recipient. In certain embodiments, plants which comprise the modified Zm1d31079 gene or the modified Zm1d44812 gene can be used as the recurrent parent in such backcrosses to introgress the genetic locus into plant germplasm comprising the genetically altered transcriptional regulatory region. In certain embodiments, plants which comprise the genetic locus or loci can be used as the recurrent parent in such backcrosses to introgress the genomic region comprising modified Zm1d31079 gene or the modified Zm1d44812 gene into plant germplasm comprising the genetic locus or loci.

    [0059] Also provided herein are methods for producing a commodity plant product or plant material comprising growing any of the aforementioned plants comprising the modified Zm1d31079 gene or the modified Zm1d44812 gene or growing plants from seeds comprising the modified Zm1d31079 gene or the modified Zm1d44812 gene In certain embodiments, such plants and/or seeds are irrigated, fertilized, and/or treated with a biological agent (e.g., a plant beneficial microorganism including a Bacillus sp., a Rhizobium sp., a Bradyrhizobium sp., and the like), nematicide (e.g., a carbamate or organophosphate insecticide), insecticide (e.g., a neonicotinoid, pyrethroid, carbamate, or organophosphate insecticide) and/or fungicide (e.g., a benzimidazole, imidazole, or strobilurin fungicide). Plants can be treated with such fertilizers, biological agents, nematicides, insecticides, and fungicides by methods including spraying, fumigating, and/or soil drenching. Seeds can be treated with such fertilizers, biological agents, nematicides, insecticides, and fungicides by methods including in-furrow applications or by coating (e.g., with a drum coater, rotary coater, tumbling drum, fluidized bed, and/or spouted bed apparatus). Methods and compositions including various binders, fillers, film coats, and active ingredients such as fertilizers, surfactants, plant growth regulators, crop desiccants, fungicides, bacteriocides, bacteriostats, insecticides, and insect repellants for coating seeds that can be adapted for use with seeds provided herein are disclosed in U.S. Pat. No. 10,745,578, which is incorporated herein by reference in its entirety.

    EMBODIMENTS

    [0060] Various embodiments of the DNA molecules, plants, plant parts, genomes, chromosomes, methods, biological samples, and other compositions described herein are set forth in the following set of numbered embodiments. [0061] 1. A maize plant comprising a modified Zm1d31079 gene wherein a heterologous expression enhancing element is located in the modified gene, and wherein the unmodified Zm1d31079 gene comprises the DNA molecule of SEQ ID NO: 1 or an allelic variant thereof. [0062] 2. The maize plant of embodiment 1, wherein the modified Zm1d31079 gene and/or the unmodified Zm1d31079 gene encode the Zm1d31079 protein of SEQ ID NO: 2 or an allelic variant thereof. [0063] 3. The maize plant of embodiment 1 or 2, wherein the modified Zm1d31079 gene is located in the native chromosomal location of the unmodified Zm1d31079 gene. [0064] 4. The maize plant of embodiment 1 or 2, wherein the modified Zm1d31079 gene comprises a transgene located in a chromosomal location other than in the native chromosomal location of the unmodified Zm1d31079 gene. [0065] 5. A maize plant comprising a modified Zm1d44812 gene wherein a heterologous expression enhancing element is located in the modified gene, and wherein the unmodified Zm1d44812 gene comprises the DNA molecule of SEQ ID NO: 8 or an allelic variant thereof, and wherein the modified Zm1d44812 gene is located in the native chromosomal location of the unmodified Zm1d44812 gene. [0066] 6. The maize plant of embodiment 5, wherein the modified Zm1d44812 gene and/or the unmodified Zm1d44812 gene encode the Zm1d44812 protein of SEQ ID NO: 9 or an allelic variant thereof. [0067] 7. The maize plant of embodiment 5 or 6, wherein expression of a Zm1d44812 gene product in a plant having the modified Zm1d44812 gene is respectively increased by about 5% to 10% or 20% in at least one tissue in the maize plant in comparison to a control maize plant lacking the modified Zm1d44812 gene. [0068] 8. The maize plant of embodiment 5, 6, 7, or 8, wherein the height of the maize plant is reduced in comparison to a control maize plant lacking the lacking the modified Zm1d44812 gene, optionally wherein the height is reduced by about 5% or 10% to about 15%, 20%, 30%, or 50% in comparison to a control maize plant lacking the modified Zm1d44812 gene. [0069] 9. The maize plant of any one of embodiments 1-8, wherein the heterologous expression enhancing element comprises: (i) a heterologous transcription enhancer, a heterologous translational enhancing element, and/or a heterologous intron; or (ii) a heterologous promoter, heterologous 5 UTR, and/or heterologous intron. [0070] 10. The maize plant of embodiment 9, wherein the heterologous transcription enhancer is located in the promoter, the 5 untranslated region (5 UTR), an intron, a 3 untranslated region (3 UTR), or a 3 flanking region of the modified Zm1d31079 gene or the modified Zm1d44812 gene. [0071] 11. The maize plant of embodiment 9 or 10, wherein the heterologous transcription enhancer comprises a DNA molecule set forth in SEQ ID NO: 16, 17, SEQ ID NO: 19-124, and/or 125. [0072] 12. The maize plant of embodiment 9, 10, or 11, wherein the transcription enhancer is located about 10, 20, 30, 40, 100, or 150 base pairs (bp) to about 200, 240, 300, 350, 400, 500, or 1000 bp 5 of the transcriptional start site (TSS) of the Zm1d31079 or Zm1d44812 gene. [0073] 13. The maize plant of embodiment 9, wherein the transcription enhancer comprises SEQ ID NO: 16, 17, 19-124, and/or 125 and the insertion is located: [0074] (i) about 116 to about 96 base pairs or about 106 base pairs 5 to the TSS of the Zm1d31079 gene; [0075] (ii) about 119 to about 99 base pairs or about 109 base pairs 5 to the TSS of the Zm1d31079 gene; [0076] (iii) about 170 to about 150 base pairs or about 160 base pairs 5 to the TSS of the Zm1d31079 gene; [0077] (iv) about 252 to about 232 base pairs or about 242 base pairs 5 to the TSS of the Zm1d31079 gene; [0078] (v) about 261 to about 241 base pairs or about 251 base pairs 5 to the TSS of the Zm1d31079 gene; [0079] (vi) in a double stranded break introduced in the Zm1d31079 promoter with a Cas9 nuclease and a guide RNA encoded by SEQ ID NO: 4, 5, or 6; or [0080] (vii) in a double stranded break introduced in the Zm1d31079 promoter with a Cas12 nuclease and a guide RNA encoded by SEQ ID NO: 3 or 7. [0081] 14. The maize plant of embodiment 9 wherein the transcription enhancer comprises SEQ ID NO: 16, 17, 19-124, and/or 125 and the insertion is located: [0082] (i) about 85 to about 65 base pairs or about 75 base pairs 5 to the TSS of the Zm1d44812 gene; [0083] (ii) about 93 to about 73 base pairs or about 83 base pairs 5 to the TSS of the Zm1d44812 gene; [0084] (iii) about 183 to about 163 base pairs or about 173 base pairs 5 to the TSS of the Zm1d44812 gene; [0085] (iv) about 188 to about 168 base pairs or about 178 base pairs 5 to the TSS of the Zm1d44812 gene; [0086] (v) about 269 to about 249 base pairs or about 259 base pairs 5 to the TSS of the Zm1d44812 gene; [0087] (vi) in a double stranded break introduced in the Zm1d44812 promoter with a Cas9 nuclease and a guide RNA encoded by SEQ ID NO: 10, 12, or 15; or [0088] (vii) in a double stranded break introduced in the Zm1d44812 promoter with a Cas12 nuclease and a guide RNA encoded by SEQ ID NO: 11, 13, or 14. [0089] 15. The maize plant of embodiment 9, wherein the heterologous intron is located in the 5 UTR and/or within the coding region of the modified Zm1d31079 gene or the modified Zm1d44812 gene, optionally wherein the intron is located within about 500, 200, 100, 50, 30, or 20 base pairs of the transcription start site (TSS). [0090] 16. The maize plant of embodiment 15, wherein the heterologous intron comprises a UBQ, EF-1, EF-1, Histone H3, ATPK1, RHD3, or MHX intron, optionally wherein the UBQ, EF-1, EF-1, Histone H3, ATPK1, RHD3, or MHX intron comprises a rice or maize intron. [0091] 17. The maize plant of embodiment 9, wherein the heterologous translational enhancer is located in the 5 UTR and/or within the coding region of the modified Zm1d31079 gene or the modified Zm1d44812 gene. [0092] 18. The maize plant of embodiment 17, wherein the translational enhancer is encoded by a DNA molecule comprising the DNA sequence of a rice alcohol dehydrogenase (OsAdh), glutathione transferase U50 (OsGst U50), glutathione peroxidase 1 (OsGsp 1), 20S proteasome alpha1 subunit (Os20S1), pathogenesis-related protein 4b (OsPrp4b), glycine-rich cell-wall structural protein 1 (OsGrcwp1), or UspA domain containing protein (OsUspA) 5UTR and wherein all or part of said OsAdh, Os GstU50, Os20S1, OsPrp4b, Os Grcwp1, or OsUspA 5UTR is substituted for all or part of the Zm1d31079 5 UTR or the Zm1d44812 5 UTR in the modified Zm1d31079 or the modified Zm1d44812 gene. [0093] 19. The maize plant of any one of embodiments 1 to 18, wherein expression of the Zm1d31079 or Zm1d44812 gene is increased in at least one tissue of the maize plant in comparison to a control maize plant lacking the modified Zm1d31079 gene or the modified Zm1d44812 gene, optionally wherein expression of the Zm1d31079 or Zm1d44812 gene is increased in at least stalk tissue. [0094] 20. The maize plant of any one of embodiments 1 to 19, wherein height of the maize plant is reduced in comparison to a control maize plant lacking the lacking the modified Zm1d31079 gene or the modified Zm1d44812 gene, optionally wherein the height is reduced by about 5% or 10% to about 15%, 20%, 30%, or 50% in comparison to a control maize plant lacking the modified Zm1d31079 gene or the modified Zm1d44812 gene. [0095] 21. The maize plant of any one of embodiments 1 to 20, wherein the maize plant is a hybrid maize plant which is heterozygous for the modified Zm1d31079 or the modified Zm1d44812 gene. [0096] 22. The maize plant of any one of embodiments 1 to 21, wherein expression of a Zm1d31079 gene product or a Zm1d44812 gene product in a plant having the modified Zm1d31079 gene or the modified Zm1d44812 gene is respectively increased by about 20% to 80% in at least one tissue in the maize plant in comparison to a control maize plant lacking the modified Zm1d31079 gene or the modified Zm1d44812 gene. [0097] 23. The maize plant of any one of embodiments 1 to 21, wherein expression of a Zm1d31079 gene product or a Zm1d44812 gene product in a plant having the modified Zm1d31079 gene or the modified Zm1d44812 gene is increased by about 1.2-fold or 1.5-fold to about 2-fold, 3-fold, or 5-fold in at least one maize tissue in the maize plant in comparison to a control maize plant lacking the modified Zm1d31079 gene or the modified Zm1d44812 gene. [0098] 24. A maize plant part comprising the modified Zm1d31079 gene or the modified Zm1d44812 gene of any one of embodiments 1 to 23. [0099] 25. The maize plant part of embodiment 24, wherein the part is a seed, stalk, stem, or leaf. [0100] 26. The maize plant part of embodiment 25, wherein the seed further comprises at least a partial coating of a composition comprising a biological agent, nematicide, insecticide, or fungicide. [0101] 27. The maize plant part of embodiment 25 or 26, wherein the maize plant seed is a hybrid maize plant seed which is heterozygous for the modified Zm1d31079 or the modified Zm1d44812 gene. [0102] 28. A method of producing maize seed, comprising growing the maize plant of any one of embodiments 1 to 23 and harvesting seed therefrom. [0103] 29. A method of producing hybrid maize seed comprising crossing a maize plant homozygous for the modified Zm1d31079 gene set forth in any one of embodiments 1 to 4, 9-13, or 15-23 to another maize plant homozygous for the modified Zm1d31079 gene and harvesting seed from a pollen recipient of the cross. [0104] 30. A method of producing hybrid maize seed comprising crossing a maize plant homozygous for the modified Zm1d44812 gene set forth in any one of embodiments 5 to 12 or 14 to 23 to another maize plant homozygous for the modified Zm1d44812 gene and harvesting seed from a pollen recipient of the cross. [0105] 31. A method of producing inbred maize seed comprising selfing: (i) a maize plant homozygous for the modified Zm1d31079 gene set forth in any one of embodiments 1 to 4, 9-13, or 15-23; or (ii) a maize plant homozygous for the modified Zm1d44812 gene set forth in any one of embodiments 5 to 12 or 14 to 23. [0106] 32. A method of producing a maize plant comprising an added desired trait, said method comprising introducing a transgene, a targeted genetic change, and/or a genetic locus conferring the desired trait into the maize plant of any one of embodiments 1 to 23. [0107] 33. A method of producing a commodity maize plant product, said method comprising: (i) processing a maize plant of any one of embodiments 1 to 23 or a maize seed obtained therefrom; and (ii) recovering the commodity maize plant product from the processed maize plant or maize seed. [0108] 34. The method of embodiment 33, wherein the commodity maize plant product is seed meal, starch, syrup, silage, oil, or protein. [0109] 35. The method of embodiment 33, wherein the commodity maize plant product comprises a detectable amount of a DNA molecule comprising the heterologous transcription enhancer, the heterologous translational enhancing element, and/or the heterologous intron located in a DNA fragment of the modified Zm1d31079 gene or in a DNA fragment of the modified Zm1d44812 gene. [0110] 36. A biological sample comprising a detectable amount of a DNA molecule comprising a heterologous transcription enhancer, a heterologous intron, and/or heterologous translational enhancing element located in a DNA fragment of a modified Zm1d31079 gene or in a DNA fragment of a modified Zm1d44812 gene. [0111] 37. The biological sample of embodiment 36, wherein the biological sample comprises material obtained from the maize plant of any one of embodiments 1 to 23 or a part thereof, wherein the part is optionally a seed or is optionally a part of embodiment 24-27. [0112] 38. The biological sample of embodiment 37, wherein the biological sample is non-regenerable. [0113] 39. The biological sample of embodiment 37, wherein the biological sample comprises maize seed meal. [0114] 40. A method of making a maize plant of any one of embodiments 1 to 3 or 5 to 23, comprising: [0115] (a) contacting a maize plant genome with gene editing molecules comprising a first site-specific nuclease which introduces a double stranded DNA break in a promoter region, a 5 UTR, a coding region, a 3 UTR, or a 3 flanking region in: (i) an unmodified Zm1d31079 gene comprising the DNA molecule of SEQ ID NO: 1 or an allelic variant thereof; or (ii) an unmodified Zm1d44812 gene comprising the DNA molecule of SEQ ID NO: 8 or an allelic variant thereof; and a donor DNA template or other DNA template comprising a heterologous expression enhancing element; and [0116] (b) selecting a maize plant comprising a modified Zm1d31079 gene or a modified Zm1d44812 gene, wherein the modified Zm1d31079 gene or the modified Zm1d44812 gene comprises an insertion of the heterologous expression enhancing element in the promoter region, the 5 UTR, the coding region, the 3 UTR, or the 3 flanking region of the gene, wherein expression of the modified Zm1d31079 gene or a modified Zm1d44812 gene is increased in at least one tissue, and wherein height of the maize plant comprising the modified Zm1d31079 gene or the modified Zm1d44812 gene is decreased in comparison to a control maize plant lacking the modified Zm1d31079 gene or the modified Zm1d44812 gene. [0117] 41. The method of embodiment 40, wherein the heterologous expression enhancing element comprises a heterologous transcription enhancer, a heterologous translational enhancing element, and/or a heterologous intron. [0118] 42. The method of embodiment 40 or 41, wherein the double stranded break is introduced in the promoter, the 5 untranslated region (5 UTR), an intron, a 3 untranslated region (3 UTR), or a 3 flanking region of the unmodified Zm1d31079 gene or the unmodified Zm1d44812 gene and the donor DNA template or other DNA template comprises the heterologous transcription enhancer. [0119] 43. The method of embodiment 42, wherein the transcription enhancer comprises a DNA molecule set forth in SEQ ID NO: 16, 17, 19-124, and/or SEQ ID NO: 125. [0120] 44. The method of embodiment 40, wherein the double stranded break is introduced about 10, 20, 30, 40, 100, or 150 base pairs (bp) to about 200, 240, 300, 350, 400, 500, or 1000 bp 5 of the transcriptional start site (TSS) of the Zm1d31079 or Zm1d44812 gene. [0121] 45. The method of embodiment 44, wherein the transcription enhancer comprises SEQ ID NO: 16, 17, 19-124, and/or 125 and the double stranded break is introduced: [0122] (i) about 116 to about 96 base pairs or about 106 base pairs 5 to the TSS of the Zm1d31079 gene; [0123] (ii) about 119 to about 99 base pairs or about 109 base pairs 5 to the TSS of the Zm1d31079 gene; [0124] (iii) about 170 to about 150 base pairs or about 160 base pairs 5 to the TSS of the Zm1d31079 gene; [0125] (iv) about 252 to about 142 base pairs or about 242 base pairs 5 to the TSS of the Zm1d31079 gene; [0126] (v) about 261 to about 241 base pairs or about 251 base pairs 5 to the TSS of the Zm1d31079 gene; [0127] (vi) in the Zm1d31079 promoter with a Cas9 nuclease and a guide RNA encoded by SEQ ID NO: 4, 5, or 6; or [0128] (vii) in the Zm1d31079 promoter with a Cas12 nuclease and a guide RNA encoded by SEQ ID NO: 3 or 7. [0129] 46. The method of embodiment 44, wherein the transcription enhancer comprises SEQ ID NO: 16, 17, 19-124, and/or 125 and the double stranded break is introduced: [0130] (i) about 85 to about 65 base pairs or about 75 base pairs 5 to the TSS of the Zm1d44812 gene; [0131] (ii) about 93 to about 73 base pairs or about 83 base pairs 5 to the TSS of the Zm1d44812 gene; [0132] (iii) about 183 to about 163 base pairs or about 173 base pairs 5 to the TSS of the Zm1d44812 gene; [0133] (iv) about 188 to about 168 base pairs or about 178 base pairs 5 to the TSS of the Zm1d44812 gene; [0134] (v) about 269 to about 249 base pairs or about 259 base pairs 5 to the TSS of the Zm1d44812 gene; [0135] (v) in the Zm1d44812 promoter with a Cas9 nuclease and a guide RNA encoded by SEQ ID NO: 10, 12, or 15; or [0136] (vi) in the Zm1d44812 promoter with a Cas12 nuclease and a guide RNA encoded by SEQ ID NO: 11, 13, or 14. [0137] 47. The method of embodiment 41, wherein the DNA donor or other DNA template comprises a heterologous translational enhancer and the double stranded break is introduced in the 5 UTR and/or within the coding region of the unmodified Zm1d31079 gene or the unmodified Zm1d44812 gene. [0138] 48. The method of embodiment 47, wherein the translational enhancer is encoded by a DNA molecule comprising the DNA sequence of a rice alcohol dehydrogenase (OsAdh), glutathione transferase U50 (OsGst U50), glutathione peroxidase 1 (OsGsp 1), 20S proteasome alpha1 subunit (Os20S1), pathogenesis-related protein 4b (OsPrp4b), glycine-rich cell-wall structural protein 1 (Os Grcwp1), or UspA domain containing protein (OsUspA) 5UTR and wherein all or part of said OsAdh, Os GstU50, Os20S1, OsPrp4b, OsGrcwp1, or OsUspA 5UTR is substituted for all or part of the Zm1d31079 or the Zm1d44812 5 UTR in the modified Zm1d31079 or the modified Zm1d44812 gene. [0139] 49. The method of embodiment 41, wherein the DNA donor or other DNA template comprises a heterologous intron and the double stranded break is introduced in the 5 UTR and/or within the coding region of the modified Zm1d31079 gene or the modified Zm1d44812 gene, optionally wherein the double stranded break is introduced within about 500, 200, 100, 50, 30, or 20 base pairs of the TSS. [0140] 50. The method of embodiment 49, wherein the heterologous intron comprises a UBQ10, EF-1, EF-1, Histone H3, ATPK1, RHD3, or MHX intron, optionally wherein the UBQ10, EF-1, EF-1, Histone H3, ATPK1, RHD3, or MHX intron comprises a rice or maize intron. [0141] 51. A method of making a maize plant of any one of embodiments 1-2 or 4-23, comprising: [0142] (a) contacting a maize plant genome with a transgene comprising a modified Zm1d31079 gene, wherein the modified Zm1d31079 gene comprises a heterologous promoter, heterologous 5 UTR, and/or heterologous intron which is operably linked to a coding region encoding the Zm1d31079 protein of SEQ ID NO: 2 or an allelic variant thereof; and [0143] (b) selecting a transgenic maize plant comprising the modified Zm1d31079 gene, wherein expression of the modified Zm1d31079 gene is increased in at least one tissue and wherein height of the maize plant is decreased in comparison to a control maize plant lacking the modified Zm1d31079 gene. [0144] 52. The method of embodiment 51, wherein the promoter is a ubiquitin promoter, an actin promoter, or a plant viral promoter, optionally wherein the plant viral promoter comprises a caulimovirus promoter. [0145] 53. The method of embodiment 51, wherein the heterologous intron comprises a UBQ, EF-1, EF-1, Histone H3, ATPK1, RHD3, or MHX intron, optionally wherein the UBQ, EF-1, EF-1, Histone H3, ATPK1, RHD3, or MHX intron comprises a rice or maize intron.

    EXAMPLES

    Example 1. Insertion of a Transcription Enhancer in the Zm1d31079 (SEQ ID NO: 1) and Zm1d44812 (SEQ ID NO: 8) Promoters

    [0146] Maize genes Zm1d31079 (SEQ ID NO: 1) and Zm1d44812 (SEQ ID NO: 8) were targeted for insertion of a transcription enhancer (SEQ ID NO: 16) to increase expression of the genes and decrease maize plant height. Guide RNAs were designed at different distances of the transcriptional start sites (TSS) of the genes in order to create an allelic series and assess whether increasing the distance to the TSS would result in milder phenotypes for plant height. Summaries of the guide RNAs designed for the two genes are provided in Tables 2 and 3.

    TABLE-US-00002 TABLE2 Zm1d31079guideRNAdesign DNAsequencethat SEQID encodesspacer Distance gRNAname NO: elementofgRNA toTSS Nuclease Zm1d31079Pro-106 3 tgcacctgcttctgccacatggc 106 CasS.sup.1 Zm1d31079Pro-109 4 ctgcacctgcttctgccaca 109 CasB.sup.2 Zm1d31079Pro-160 5 aattaatgcagcgtcggaat 160 CasB Zm1d31079Pro-242 6 ctgtttgggcaaccgccatg 242 CasB Zm1d31079Pro-251 7 ggcaaccgccatgagggcagggc 251 CasS .sup.1Cas nuclease which provides a staggered cut. .sup.2Cas nuclease which provides a blunt cut.

    TABLE-US-00003 TABLE3 Zmld44812guideRNAdesign SEQID Distance gRNA NO: Sequence toTSS Nuclease Zm1d44812Pro-75 10 actgcacactccccgacacg 75 CasB Zm1d44812Pro-83 11 cagttacacccctcccctccccc 83 CasS Zm1d44812Pro-173 12 acctttggataaatgacagc 173 CasB Zm1d44812Pro-178 13 ctgtcaacaatcctagctccagc 178 CasS Zm1d44812Pro-249 14 accccaaattggatccctttcat 249 CasS Zm1d44812Pro-259 15 taaatgaaagggatccaatt 259 CasB

    [0147] Immature embryos of a transgenic B104 editor maize line constitutively overexpressing a CasB nuclease polypeptide were harvested 13 days after pollination and transformed by biolistics with: a plasmid containing herbicide and visual selection markers (p35S::pat::tNOS and pZmUbi::mScarlet::tZmUbi), a single guide RNA for the CasB nuclease comprising one of the indicated spacers (Zm1d31079_Pro-109, Zm1d44812_Pro-75, Zm1d31079_Pro-242, or Zm1d44812_Pro-259), and DNA of the 3 enhancer (/5Phos/G*T*AAGCGCTTACGTAAGCGCTTACGTAAGCGCTT*A*C; SEQ ID NO: 18; * is a phosphorothioate bond) for NHEJ insertion. The guide RNA and DNA were from Integrated DNA Technologies (Coralville, IA, USA). Callus was induced, the transformed cells selected, and transformed T0 generation plants regenerated by conventional methods. The following plants in Table 4 were regenerated in T0 and selected for further characterization.

    TABLE-US-00004 TABLE 4 Transformation Results T0 Line (gRNA) Plants recover ZM185 (Zmd31079_Pro-109) 1 event, 2 plants ZM186 (Zmd31079-Pro-109) 1 event, 3 plants ZM187 (Zm1d44812_Pro-75) 1 event, 4 plants ZM200 (Zm1d31079_Pro-242) 7 events, 7 plants ZM202 (Zm1d31079_Pro-242) 2 events, 5 plants ZM203 (Zm1d44812_Pro-259) 2 event, 7 plants

    [0148] DNA fragments encompassing the targeted sites were PCR-amplified, and the presence of an insert in the edited T0 plants was observed. The edited plants were observed to have diminished height at the T0 stage. FIGS. 3, 4, 5, 6, 7, and 8 show the difference between T0 plants comprising the enhancer insertions in the Zm1d31079 or Zm1d44812 promoters and control plants lacking the insertions in those promoters. The control plants were edited T0 plants at the similar development stage but bearing edits in genes unrelated to plant height.

    Example 2. Further Analysis of Plants Comprising an Insertion of a Transcription Enhancer in the Zm1d31079 (SEQ ID NO: 1) and Zm1d44812 (SEQ ID NO: 8) Promoters

    [0149] T0 plants such as those described in Example 1 are backcrossed to a B104 wild type. The resulting T1 plants are analyzed for the presence/absence of the enhancer at the target site and T1 plants are grown and subjected to phenotypic analysis, using siblings lacking the enhancer insertion as controls and focusing on plant height and general plant development. Selected T1 plants are crossed to a different genotype (e.g. PHRO3) to produce hybrid F1 seed, the resulting F1 plants are subjected to a phenotypic analysis comprising quantitative height component measurements. In addition, molecular analysis is performed where relevant to measure the changes in expression levels of the target Zm1d31079 and Zm1d44812 genes.

    Example 3. Analysis of Plants Comprising an Insertion of a Triplicated ZmOCS Transcription Enhancer in the Zm1d31079 Promoter

    [0150] Two lines were created with triplicated ZmOCS enhancer element (SEQ ID NO: 16) insertions in the promoter of the Zm1d31079 (SEQ ID NO: 1) gene: one with the triplicated ZmOCS enhancer inserted at 109 bases upstream of the transcription start site (TSS) of the Zm1d31079 gene, and one with the triplicated ZmOCS enhancer inserted at 242 bases upstream of the TSS of the Zm1d31079 gene. Expression in young shoot apices showed that insertion of the enhancer led to higher expression of Zm1d31079 in both lines, with a stronger effect in individuals homozygous for the enhancer compared to heterozygous individuals (FIG. 9). For each, T2 individuals homozygous or heterozygous for the triplicated ZmOCS enhancer insertion were grown in the greenhouse and compared to segregating siblings that did not contain the enhancer insertion. Genotypes were spaced out to avoid shading effects. Plant height (from soil to collar of the youngest leaf) was measured regularly throughout development (FIG. 10), and plant height (from soil level to the collar of the flag leaf) and ear height (from soil level to the base of the ear) were measured at maturity, showing that the presence of the triplicated ZmOCS enhancer in both cases led to a statistically significant decrease in both plant height and ear height (Table 5). In both lines for which triplicated ZmOCS enhancer insertion heterozygotes were phenotyped, the effect on plant height was weaker compared to triplicated ZmOCS enhancer insertion homozygotes (Table 5; FIG. 10).

    TABLE-US-00005 TABLE 5 Plant height and ear height for two lines segregating for triplicated ZmOCS enhancer insertions in the Zm1d31079 promoter. Plant height Ear height Line (cm).sup.1 (cm).sup.1 109 segregating control 180.1 5.4 94.0 5.7 (no enhancer) 109 3x ZmOCS enhancer 129.7 9.4 *** 56.9 6.9 *** (homozygous) 242 segregating control 167.6 11.4 79.7 6.6 (no enhancer) 242 3x ZmOCS enhancer 140.2 7.3 *** 57.3 5.2 *** (homozygous) 109 segregating control 181.8 9.3 91.4 5.2 (no enhancer) 109 3x ZmOCS enhancer 169.3 9.7 * 81.4 4.1 ** (heterozygous) 242 segregating control 170.9 11.2 80.5 6.3 (no enhancer) 242 3x ZmOCS enhancer 155.3 7.7 * 70.5 6.7 * (heterozygous) .sup.1Average standard deviation is shown, with N = 5-8 per group. Statistical significance is indicated by asterisks (*, p < 0.05; **, p < 0.01; ***, p < 0.001; p-value calculated as effect of genotype in linear model).

    [0151] The breadth and scope of the present disclosure should not be limited by any of the above-described exemplary embodiments but should be defined only in accordance with the following claims and their equivalents.