Wheat Transgenic Event Ind-øø412-7
20230075569 · 2023-03-09
Inventors
- Patricia MIRANDA (Rosario, Sante Fe, AR)
- Martin VAZQUEZ (Rosario, Sante Fe, AR)
- Carlos DEZAR (Rosario, Sante Fe, AR)
- Francisco AYALA (Rosario, Sante Fe, AR)
- Geronimo WATSON (Rosario, Sante Fe, AR)
Cpc classification
Y02E50/30
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
C12N15/8271
CHEMISTRY; METALLURGY
Y02A40/146
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
International classification
Abstract
The present invention refers to a wheat plant, seed or part of it comprising event IND-ØØ412-7, a commodity product resulting from the seed, a recombinant DNA molecule comprised in event IND-ØØ412-7, DNA primers and probes useful for detecting event IND-ØØ412-7, DNA detection kit, method for producing a wheat plant tolerant to abiotic stresses and method for detecting the presence of DNA belonging to wheat event IND-ØØ412-7 in a sample.
Claims
1. A wheat plant or a part of it comprising event IND-ØØ412-7, where representative wheat seeds comprising event IND-ØØ412-7 have been deposited under ATCC PTA-126141 access number.
2. A seed of the plant according to claim 1, where the seed comprises event IND-ØØ412-7.
3. A commodity product resulting from the seed according to claim 2.
4. The commodity product according to claim 3, additionally defined as meal, flour, flakes, bioethanol, biogas, or other biomaterials.
5. A part of the wheat plant according to claim 1, defined as a cell, pollen, ovule, flower, shoot, root or leaf.
6. The plant according to claim 1, where the plant produces improved yield under conditions of abiotic stress compared to the plant without the event under the same conditions.
7. The wheat plant according to claim 1, also defined as a progeny plant of any generation of a wheat plant comprising event IND-ØØ412-7.
8. The wheat plant according to claim 1, where the plant genome comprises DNA molecules comprising SEQ ID No: 1 and SEQ ID No: 2.
9. The wheat plant according to claim 7, where the DNA derived from the plant produces a diagnostic amplicon for event IND-ØØ412-7 when tested in a DNA amplification method, comprising this amplicon Sequences in SEQ ID Nos: 7, 8, 9 and 10.
10. The wheat plant according to claim 2, where the DNA derived from the seed produces a diagnostic amplicon for event IND-ØØ412-7 when tested in a DNA amplification method, comprising this amplicon sequences in SEQ ID Nos: 7, 8, 9 and 10.
11. The meal, flour, flakes, bioethanol, biogas, or other biomaterials according to claim 4, additionally defined as comprising a DNA molecule that produces a diagnostic amplicon for event IND-ØØ412-7 when tested in a DNA amplification method, comprising that amplicon SEQ ID Nos: 7, 8, 9 and 10.
12. A recombinant DNA molecule comprised in event IND-ØØ412-7, characterized by comprising the sequences in SEQ ID Nos: 7, 8, 9 and 10, and represented by the deposit made under access number ATCC PTA-126141.
13. The DNA molecule according to claim 12, characterized by improving the yield of wheat crop under abiotic stress conditions.
14. The recombinant DNA molecule according to claim 12, characterized by being formed by the splicing of a heterologous nucleic acid molecules of sequences in SEQ ID Nos: 7, 8, 9 and 10, and wheat plant cell or seed.
15. The recombinant DNA molecule according to claim 12, characterized by being found in a wheat plant, plant cell, seed, progeny plant, part of the plant, or commodity product derived from wheat transgenic event IND-ØØ412-7.
16. A DNA molecule comprising a nucleic acid molecule having a nucleotide sequence complementary to a sufficient portion of the contiguous nucleotide sequence of SEQ ID No: 1 or SEQ ID No: 2 for them to operate as a DNA probe hybridizing under stringent conditions to a DNA molecule comprising a nucleotide sequence of SEQ ID No: 1 or SEQ ID No: 2, and not hybridizing under stringent conditions to a DNA molecule not comprising a nucleotide sequence of SEQ ID No: 1 or SEQ ID No: 2.
17. A DNA polynucleotide primer molecule comprising at least 15 contiguous nucleotides of SEQ ID No: 5 and SEQ ID No: 6, or its complement, which is useful in a DNA amplification method to produce a diagnostic amplicon for event IND-ØØ412-7.
18. An isolated DNA polynucleotide primer molecule comprising the sequence of SEQ ID NO: 11, 12, 13 and 14.
19. A sequence of functional expression in plants characterized by comprising the sequence of SEQ ID No: 3 and SEQ ID No: 4.
20. Use of a sequence, according to claim 19, to transform plants, as shown in SEQ ID No: 3 and SEQ ID No: 4.
21. A DNA detection kit comprising at least a DNA molecule comprising a nucleotide sequence with a sufficient length of contiguous nucleotides of SEQ ID No: 5 or SEQ ID No: 6 to operate as DNA primer or specific probe to detect the presence of DNA derived from wheat transgenic event IND-ØØ412-7, where detection of this DNA proves the presence of this wheat transgenic event IND-ØØ412-7 in a sample.
22. A method for producing a wheat plant tolerant to abiotic stresses, comprising the following steps: (a) introducing event IND-ØØ412-7 in the genome of a wheat cell; (b) selecting the cells containing the bar marker gene; and (c) regenerating a wheat plant from the cell of item (b).
23. A method for producing a wheat plant tolerant to abiotic stresses, comprising the following steps: (a) crossing a first wheat plant comprising event IND-ØØ412-7 with a second wheat plant lacking event IND-ØØ412-7 to produce the progeny plants; and (b) selecting at least a first progeny plant comprising event IND-ØØ412-7, tolerant to abiotic stresses.
24. The method according to claim 23, which also comprises selfing of the first progeny plant to produce progeny plants from second generation and selection of at least a first homozygous plant for event IND-ØØ412-7.
25. A method for detecting the presence of DNA belonging to wheat event IND-ØØ412-7 in a sample, characterized by: (a) comparing a sample that contains wheat DNA with a set of primers that produces a diagnostic amplicon for wheat event IND-ØØ412-7 when used in an amplification reaction of nucleic acid with genomic DNA of wheat event IND-ØØ412-7; and (b) performing a nucleic acid amplification reaction, thus producing the diagnostic amplicon; and (c) detecting the diagnostic amplicon.
26. A method for producing a commodity product manufactured from wheat which comprises, (a) obtaining the wheat plant or a part of it according to claim 1; and (b) manufacturing a commodity product from the wheat plant or from part of it.
27. The method according to claim 26, where the commodity product is defined as meal, flour, flakes, protein isolate, bioethanol, biogas, or other biomaterials.
28. A non-living plant material comprising a recombinant DNA molecule according to claim 12.
29. An isolated DNA polynucleotide probe molecule obtained using the nucleic acid sequence of SEQ ID Nos: 11, 12, 13, and 14.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0040]
[0041]
[0042]
[0043]
[0044]
[0045]
[0046]
[0047]
[0048]
[0049]
[0050]
[0051]
BRIEF DESCRIPTION OF THE SEQUENCES
[0052] SEQ ID No. 1: Long insert without flanking regions [0053] SEQ ID No. 2: Short insert without flanking regions [0054] SEQ ID No. 3: pIND4+HB4 [0055] SEQ ID No. 4: pIND4+BAR [0056] SEQ ID No. 5: Long insert with flanking regions [0057] SEQ ID No. 6: Short insert with flanking regions [0058] SEQ ID No. 7: 5′ flanking region (long insert) [0059] SEQ ID No. 8: 3′ flanking region (long insert) [0060] SEQ ID No. 9: 5′ flanking region (short insert) [0061] SEQ ID No. 10: 3′ flanking region (short insert) [0062] SEQ ID No. 11: HB4 forward primer [0063] SEQ ID No. 12: HB4 reverse primer [0064] SEQ ID No. 13: Bar forward primer [0065] SEQ ID No. 14: Bar reverse primer
DETAILED DESCRIPTION
[0066] The following definitions and methods are presented to better define the invention and to guide those trained in this technique to put it in practice. Unless otherwise stated, the terms used here are to be construed with the same meaning conventionally given to them by those trained in the relevant technique.
EXAMPLES
Example 1: Construction of Plasmids pIND4-HB4 and pIND4-Bar
[0067] The vectors used to obtain wheat IND-ØØ412-7 are based on a series of plasmids that use the corn ubiquitin promoter to direct the expression of genes in plants (Christensen and Quail, 1996). This promoter has proved to be very efficient in monocotyledons (Christensen et al., 1992). These plasmids use vector base pUC8 to perform the cloning and have been generated as a result of cloning the Pst1 fragment of the Ubi-1 corn ubiquitin gene of 1992pb. This fragment is the functional promoter and consists of: 899pb of the sequence of gene Ubi-1, a sequence of 83pb of the 5′-untranslated region from the first exon and the sequence of 1010pb of the first intron, ending in the reconstruction of the Pst1 site. The original intron, present in the 5′-untranslated region of gene Ubi-1 was retained in all these vectors since previous studies revealed that introns stimulate the expression of transgenes in cereal plants (Vasil et al., 1993).
[0068] Two plasmids based on this series, pIND4-HB4 y el pIND4-Bar, have been used in the genetic modification present in IND-ØØ412-7.
[0069] pIND4-HB4 (SEQ ID NO:3)
[0070] This plasmid has a polycloning site from which site BamHI was used to clone the encoding region of gene HaHB4. This restriction site is located after the sequences of the corn Ubi-1 gene promoter, the first exon and the first intron of the gene. This construct prUbi-1/Ubi1-Exon/Ubi-1Intron/HaHB4 was designed to obtain the constitutive expression of HAHB4. After the polycloning site and after the CDS of HaHB4, this vector has a sequence of the nopaline-synthase gene terminator of A. tumefaciens which includes the polyadenylation signal.
[0071] pIND4-Bar (SEQ ID NO: 4)
[0072] This plasmid has also been constructed by binding Ubi-1 regulatory regions to the encoding region of the bar gene of S. hygroscopicus in the BamHI site. This construct, prUbi-1/Ubi1-Exon/Ubi-1Intron/bar, allows selection of the transgenic plants expressing PAT and tolerate glufosinate ammonium herbicides, which become inactive due to this enzyme (Thompson et al., 1987). After the bar encoding region, this vector also contains the nopaline-synthase gene terminator of A. tumefaciens, which includes the polyadenylation signal.
Example 2: Transformation of Wheat Plants and Selection of Event IND-ØØ412-7
[0073] The co-transformation method used to obtain event IND-ØØ412-7 was based on the methods developed by Barcelo and Lazzeri (1995), Pastori et al. (2001), and Rasco-Gaunt et al. (2001). These methods are also used in several research centers.
[0074] Firstly, the wheat kernels were harvested and sterilized. The kernels were collected from the spikelets and were sterilized. Then, the embryos were isolated and their axes were removed to avoid early germination. The scutella were placed in the appropriate medium, in the middle of a Petri plate, with the undamaged region of the explant facing upwards for it to experience the impact of the microparticles.
[0075] For bombardment, the gold particles covered with DNA from both plasmids of interest, pIND4-HB4 y pIND4-Bar, were boosted inside the cells of the explants using gene gun PDS-1000/He (Biolistic® PDS-1000/He Particle Delivery System, BIO-RAD).
[0076] After bombardment, the explants treated were placed in the fresh culture medium under the hormonal conditions necessary for the generation of the embryogenic calli. The selection process started three weeks later, once the embryos were already developed. The selection agent used in this case was glufosinate ammonium.
[0077] The seedlings that survived selection rounds due to the PAT expression and developed a good root system were transferred and placed in a growth chamber. At this point, samples were taken to prove the presence of bar and HaHb4 using PCR. Once the plants were developed, they were transferred to bigger pots where they were grown until harvest.
[0078] Event Selection
[0079] Transgenic plants were generated following a biolistic protocol using the British variety Cadenza. The first multiplication (T.sub.1 seed) was carried in a growth chamber between August and December of 2007. Approximately 20 individuals derived from each transgenic event were sampled for a segregation test by PCR determination (Table 1).
TABLE-US-00001 TABLE 1 Segregation test. Lines with p-values > 0.15 were carried to next generation PCR Line Positive Negative n .sub.X2 (3:1) p-value Ta.IV.ii.a.1 2 14 16 33.33 0.00 Ta.IV.ii.a.2 9 8 17 4.41 0.04 Ta.IV.ii.a.3 14 6 20 0.27 0.61 Ta.IV.ii.a.4 12 7 19 1.42 0.23 Ta.IV.ii.a.5 8 10 18 8.96 0.00 Ta.IV.ii.a.6 17 2 19 2.12 0.15 Ta.IV.ii.a.7 3 15 18 32.67 0.00 Ta.IV.ii.a.8 7 11 18 12.52 0.00 Ta.IV.ii.a.9 5 15 20 26.67 0.00 Ta.IV.ii.a.10 5 15 20 28.12 0.00 Ta.IV.ii.a.11 15 5 20 0.00 1.00 Ta.IV.ii.a.12 14 4 18 0.07 0.79
[0080] Lines derived from selfings of selected events (3:1 segregation in T1) were sowed in August of 2008 under a hail shelter. Growth and development of these lines were characterized throughout the growing season (Table 2).
TABLE-US-00002 TABLE 2 Phenology. Days after sowing Line 12 20 27 34 42 49 57 63 70 77 84 91 98 105 111 119 126 131 Zadocks scale value Wild Type 1.1 1.3 1.4 2.1 2.2 2.4 2.5 2.6 2.6 3.1 3.7 5.5 5.9 7.3 8.5 8.7 8.9 9.2 Wild Type 1.1 1.3 1.4 2.1 2.2 2.4 2.5 2.6 2.6 3.1 3.7 5.5 5.9 7.3 8.5 8.7 8.9 9.2 Ta.IV.ii.a.1.2 1.1 1.3 1.4 2.1 2.2 2.3 2.5 2.6 2.6 3.1 3.7 4.7 5.9 7.3 8.3 8.7 8.9 9.2 Ta.IV.ii.a.1.5 1.1 1.3 1.4 2.1 2.2 2.4 2.5 2.6 2.6 3.1 3.7 5.5 5.9 7.3 8.5 8.7 8.9 9.2 Ta.IV.ii.a.1.12 1.1 1.3 1.4 2.1 2.2 2.4 2.5 2.6 2.6 3.1 3.7 5.5 5.9 7.3 8.5 8.7 8.9 9.2 Ta.IV.ii.a.3.1 1.1 1.3 1.4 2.1 2.2 2.4 2.5 2.6 2.6 3.1 3.7 4.5 5.9 7.3 8.3 8.7 8.9 9.2 Ta.IV.ii.a.3.2 1.1 1.3 1.4 2.1 2.2 2.4 2.5 2.6 2.6 3.1 3.7 5.5 5.9 7.3 8.5 8.7 8.9 9.2 Ta.IV.ii.a.3.6 1.1 1.3 1.4 2.1 2.2 2.4 2.5 2.6 2.6 3.1 3.7 5.5 5.9 7.3 8.5 8.7 8.9 9.2 Ta.IV.ii.a.3.7 1.1 1.3 1.4 2.1 2.2 2.4 2.5 2.6 2.6 3.1 3.7 5.5 5.9 7.3 8.5 8.7 8.9 9.2 Ta.IV.ii.a.3.10 1.1 1.3 1.4 2.1 2.2 2.4 2.5 2.6 2.6 3.1 3.7 5.5 5.9 7.3 8.5 8.7 8.9 9.2 Ta.IV.ii.a.3.11 1.1 1.3 1.4 2.2 2.3 2.4 2.5 2.6 2.6 3.2 3.7 4.5 5.5 5.9 7.3 7.7 8.5 8.9 Ta.IV.ii.a.3.13 1.1 1.3 1.4 2.1 2.2 2.4 2.5 2.6 2.6 3.1 3.7 5.5 5.9 7.3 8.5 8.7 8.9 9.2 Ta.IV.ii.a.3.14 1.1 1.3 1.4 2.2 2.3 2.4 2.5 2.6 2.6 3.2 3.7 5.5 5.9 7.3 8.5 8.7 8.9 9.2 Ta.IV.ii.a.3.17 1.1 1.3 1.4 2.2 2.3 2.4 2.5 2.6 2.6 3.1 3.7 5.5 5.9 7.3 8.5 8.7 8.9 9.2 Ta.IV.ii.a.3.18 1.1 1.3 1.4 2.1 2.2 2.4 2.5 2.6 2.6 3.1 3.7 5.5 5.9 7.3 8.5 8.7 8.9 9.2 Ta.IV.ii.a.4.1 1.1 1.3 1.4 2.1 2.2 2.4 2.5 2.6 2.6 3.1 3.7 5.5 5.9 7.3 8.5 8.7 8.9 9.2 Ta.IV.ii.a.4.2 1.1 1.3 1.4 2.1 2.2 2.4 2.5 2.6 2.6 3.1 3.7 5.5 5.9 7.3 8.5 8.7 8.9 9.2 Ta.IV.ii.a.4.3 1.1 1.3 1.4 2.1 2.2 2.4 2.5 2.6 2.6 3.1 3.7 5.5 5.9 7.3 8.5 8.7 8.9 9.2 Ta.IV.ii.a.4.5 1.1 1.3 1.4 2.1 2.2 2.4 2.5 2.6 2.6 3.1 3.7 5.5 5.9 7.3 8.5 8.7 8.9 9.2 Ta.IV.ii.a.4.7 1.1 1.3 1.4 2.1 2.2 2.4 2.5 2.6 2.6 3.1 3.7 5.5 5.9 7.3 8.5 8.7 8.9 9.2 Ta.IV.ii.a.4.14 1.1 1.3 1.4 2.1 2.2 2.4 2.5 2.6 2.6 3.1 3.7 5.5 5.9 7.3 8.5 8.7 8.9 9.2 Ta.IV.ii.a.4.15 1.1 1.3 1.4 2.1 2.2 2.4 2.5 2.6 2.6 3.1 3.7 5.5 5.9 7.3 8.5 8.7 8.9 9.2 Ta.IV.ii.a.4.16 1.1 1.3 1.4 2.1 2.2 2.4 2.5 2.6 2.6 3.1 3.7 5.5 5.9 7.3 8.5 8.7 8.9 9.2 Ta.IV.ii.a.4.17 1.1 1.3 1.4 2.1 2.2 2.4 2.5 2.6 2.6 3.1 3.7 5.5 5.9 7.3 8.5 8.7 8.9 9.2 Ta.IV.ii.a.4.18 1.1 1.3 1.4 2.1 2.2 2.4 2.5 2.6 2.6 3.1 3.7 5.5 5.9 7.3 8.5 8.7 8.9 9.2 Ta.IV.ii.a.6.1 1.1 1.3 1.4 2.1 2.3 2.4 2.5 2.6 2.6 3.2 3.7 5.5 5.9 7.3 8.5 8.7 8.9 9.2 Ta.IV.ii.a.6.2 1.1 1.3 1.4 2.1 2.2 2.4 2.5 2.6 2.6 3.1 3.7 5.5 5.9 7.3 8.5 8.7 8.9 9.2 Ta.IV.ii.a.6.3 1.1 1.3 1.4 2.1 2.2 2.4 2.5 2.6 2.6 3.1 3.7 5.5 5.9 7.3 8.5 8.7 8.9 9.2 Ta.IV.ii.a.6.4 1.1 1.3 1.4 2.1 2.2 2.4 2.5 2.6 2.6 3.1 3.7 5.5 5.9 7.3 8.5 8.7 8.9 9.2 Ta.IV.ii.a.6.5 1.1 1.3 1.4 2.1 2.2 2.4 2.5 2.6 2.6 3.1 3.7 5.5 5.9 7.3 8.5 8.7 8.9 9.2 Ta.IV.ii.a.6.6 1.1 1.3 1.4 2.1 2.2 2.4 2.5 2.6 2.6 3.1 3.7 5.5 5.9 7.3 8.5 8.7 8.9 9.2 Ta.IV.ii.a.6.7 1.1 1.3 1.4 2.1 2.2 2.4 2.5 2.6 2.6 3.1 3.7 5.5 5.9 7.3 8.5 8.7 8.9 9.2 Ta.IV.ii.a.6.8 1.1 1.3 1.4 2.1 2.2 2.4 2.5 2.6 2.6 3.1 3.7 5.5 5.9 7.3 8.5 8.7 8.9 9.2 Ta.IV.ii.a.6.9 1.1 1.3 1.4 2.1 2.2 2.4 2.5 2.6 2.6 3.1 3.7 5.5 5.9 7.3 8.5 8.7 8.9 9.2 Ta.IV.ii.a.6.11 1.1 1.3 1.4 2.1 2.2 2.4 2.5 2.6 2.6 3.1 3.7 5.5 5.9 7.3 8.5 8.7 8.9 9.2 Ta.IV.ii.a.6.12 1.1 1.3 1.4 2.1 2.2 2.4 2.5 2.6 2.6 3.1 3.7 5.5 5.9 7.3 8.5 8.7 8.9 9.2 Ta.IV.ii.a.6.13 1.1 1.3 1.4 2.1 2.2 2.4 2.5 2.6 2.6 3.1 3.7 5.5 5.9 7.3 8.5 8.7 8.9 9.2 Ta.IV.ii.a.6.14 1.1 1.3 1.4 2.1 2.2 2.4 2.5 2.6 2.6 3.1 3.7 5.5 5.9 7.3 8.5 8.7 8.9 9.2 Ta.IV.ii.a.6.15 1.1 1.3 1.4 2.1 2.2 2.4 2.5 2.6 2.6 3.1 3.7 5.5 5.9 7.3 8.5 8.7 8.9 9.2 Ta.IV.ii.a.6.17 1.1 1.3 1.4 2.1 2.2 2.4 2.5 2.6 2.6 3.1 3.7 5.5 5.9 7.3 8.5 8.7 8.9 9.2 Ta.IV.ii.a.11.2 1.1 1.3 1.4 2.1 2.2 2.4 2.5 2.6 2.6 3.1 3.7 5.5 5.9 7.3 8.5 8.7 8.9 9.2 Ta.IV.ii.a.11.3 1.1 1.3 1.4 2.1 2.2 2.4 2.5 2.6 2.6 3.1 3.7 5.5 5.9 7.3 8.5 8.7 8.9 9.2 Ta.IV.ii.a.11.5 1.1 1.3 1.4 2.2 2.2 2.4 2.5 2.6 2.6 3.1 3.7 5.5 5.9 7.3 8.5 8.7 8.9 9.2 Ta.IV.ii.a.11.6 1.1 1.3 1.4 2.2 2.2 2.4 2.5 2.6 2.6 3.1 3.7 4.3 5.9 7.3 8.3 8.5 8.7 8.9 Ta.IV.ii.a.11.7 1.1 1.3 1.4 2.1 2.2 2.4 2.5 2.6 2.6 3.1 3.7 5.5 5.9 7.3 8.5 8.7 8.9 9.2 Ta.IV.ii.a.11.8 1.1 1.3 1.4 2.1 2.2 2.4 2.5 2.6 2.6 3.1 3.7 5.5 5.9 7.3 8.5 8.7 8.9 9.2 Ta.IV.ii.a.11.9 1.1 1.3 1.4 2.1 2.2 2.4 2.5 2.6 2.6 3.1 3.7 5.5 5.9 7.3 8.5 8.7 8.9 9.2 Ta.IV.ii.a.11.10 1.1 1.3 1.4 2.1 2.2 2.4 2.5 2.6 2.6 3.1 3.7 5.5 5.9 7.3 8.5 8.7 8.9 9.2 Ta.IV.ii.a.11.13 1.1 1.3 1.4 2.1 2.2 2.4 2.5 2.6 2.6 3.1 3.7 5.5 5.9 7.3 8.5 8.7 8.9 9.2 Ta.IV.ii.a.11.15 1.1 1.3 1.4 2.1 2.2 2.4 2.5 2.6 2.6 3.1 3.7 5.5 5.9 7.3 8.5 8.7 8.9 9.2 Ta.IV.ii.a.11.17 1.1 1.3 1.4 2.1 2.2 2.4 2.5 2.6 2.6 3.1 3.7 5.5 5.9 7.3 8.5 8.7 8.9 9.2 Ta.IV.ii.a.12.1 1.1 1.3 1.4 2.1 2.2 2.4 2.5 2.6 2.6 3.2 3.7 5.5 5.9 7.3 8.5 8.7 8.9 9.2 Ta.IV.ii.a.12.3 1.1 1.3 1.4 2.1 2.2 2.4 2.5 2.6 2.6 3.2 3.7 5.5 5.9 7.3 8.5 8.7 8.9 9.2 Ta.IV.ii.a.12.4 1.1 1.3 1.4 2.1 2.2 2.4 2.5 2.6 2.6 3.1 3.7 5.5 5.9 7.3 8.5 8.7 8.9 9.2 Ta.IV.ii.a.12.5 1.1 1.3 1.4 2.1 2.2 2.4 2.5 2.6 2.6 3.2 3.7 5.5 5.9 7.3 8.5 8.7 8.9 9.2 Ta.IV.ii.a.12.6 1.1 1.3 1.4 2.1 2.2 2.4 2.5 2.6 2.6 3.1 3.7 5.5 5.9 7.3 8.5 8.7 8.9 9.2 Ta.IV.ii.a.12.7 1.1 1.3 1.4 2.1 2.2 2.4 2.5 2.6 2.6 3.1 3.7 5.5 5.9 7.3 8.5 8.7 8.9 9.2 Ta.IV.ii.a.12.8 1.1 1.3 1.4 2.1 2.2 2.4 2.5 2.6 2.6 3.1 3.7 5.5 5.9 7.3 8.5 8.7 8.9 9.2 Ta.IV.ii.a.12.9 1.1 1.3 1.4 2.1 2.2 2.4 2.5 2.6 2.6 3.1 3.7 5.5 5.9 7.3 8.5 8.7 8.9 9.2 Ta.IV.ii.a.12.11 1.1 1.3 1.4 2.1 2.2 2.4 2.5 2.6 2.6 3.2 3.7 5.5 5.9 7.3 8.5 8.7 8.9 9.2 Ta.IV.ii.a.12.13 1.1 1.3 1.4 2.1 2.2 2.4 2.5 2.6 2.6 3.1 3.7 5.5 5.9 7.3 8.5 8.7 8.9 9.2 Ta.IV.ii.a.12.14 1.1 1.3 1.4 2.1 2.2 2.4 2.5 2.6 2.6 3.1 3.7 5.5 5.9 7.3 8.5 8.7 8.9 9.2
[0081] During the vegetative stage, plants were sampled for PCR analysis to identify homozygous lines. With three selected homozygous lines, 6 field trials were conducted during 2009 and 2011 at Monte Buey (Córdoba, 2009), Gutenberg (Córdoba, 2010), Camet (Buenos Aires, 2011), Corral de Bustos (Córdoba, 2011), Daireaux (Buenos Aires, 2011), and Villa Saboya (Buenos Aires, 2011).
[0082] Trials included three homozygous lines (events) and the wild type (parental control). Yield data were analyzed using ANOVA with a completely randomized block design at a 95% confidence level using Infostat (Di Rienzo et al., 2010). In this analysis the data were pooled among sites, and sources of variation included genotypes, environments and the genotype by environment interaction. Means were compared a posteriori with a Fisher lest significant test (α=0.05).
[0083] Analysis of variance show statistically significant differences for the effect of genotype (p=0.0003,
Example 3: Characterization of DNA Sequences in Wheat Event IND-ØØ412-7
[0084] Due to the complex nature of the wheat genome, a strategy to reduce the background genomic information in order to elucidate the insertion structure, sequence and its flanking sequences in the wheat genome was designed. The carrier chromosome was identified using DArT technology platform (Diversity Arrays Technology, Jaccoudy et al., 2001). Once the HaHB4 carrier chromosome was identified, it was isolated applying a chromosome sorting technique (Doležel et al., 1989; JanVra'na et al., 2000; Suchánková et al., 2006; Šimková et al., 2008). The sequencing strategy to identify the insertion region of IND-ØØ412-7 in the isolated chromosome consisted of a combined NGS approach using two complementary sequencing technologies: Illumina and Pacific Biosciencies. Illumina produced high-throughput short reads of 100 bp from both sides of a 500 bp-fragment sequencing library. On the other hand, PacBio produced low-throughput single molecule reads from a 15-20 kb-fragment library.
[0085] As the size of the insert increases, the likelihood of the polymerase passing over the sequence more than once decreases. For this reason, larger sequences possess a higher error rate than smaller ones. To solve this problem, special algorithms that correct these sequences using smaller sequences obtained by Illumina have been developed. Using this algorithm, PacBio RSII sequences are corrected and a precise and reliable assembly of the sample is obtained (Koren et al., 2012).
[0086] a) Southern Blot Analysis.
[0087] The copy number of genes of interest was determined in homozygous IND-ØØ412-7 plants by Southern blot analysis.
[0088] Leaf tissue from greenhouse- or field-grown homozygous IND-ØØ412-7 plants or Cadenza plants were used for DNA isolation. One gram of leaf tissue from either IND-ØØ412-7 or Cadenza was flash frozen using liquid nitrogen and ground into fine powder using a pre-chilled pestle and mortar. DNA was extracted with Qiagen DNeasy Maxi Prep Kit following manufacturer's protocol. After elution, the DNA was precipitated by adding 1/10 volume of 3M sodium acetate and 2-3 volumes of 100% ethanol. The pellet was washed with 70% ethanol and suspended in 80 μL of 1× TE buffer. The DNA was quantified using a QuBit fluorometer. The concentration of DNA for IND-ØØ412-7 was 1100 ng/μL and that of Cadenza was 900 ng/μL.
[0089] Genomic DNA from event IND-ØØ412-7 was digested with three enzymes: HindIII, BamH1 and AseI. For each 50 μL digestion reaction, 5 μg genomic DNA was mixed with either HindIII, BamHI or AseI enzymes at concentrations of 10 U/μg of DNA. The samples were digested overnight (˜16 hours) at 37° C. For digests of the control plasmid, 100-200 picograms of plasmid DNA were used.
[0090] The restriction digests of IND-ØØ412-7 and Cadenza genomic DNA were loaded into a 0.7% agarose gel along with DIG labeled Molecular Weight Marker VII (Roche Cat No. 1669940910). The samples were run at 50 V overnight. The gel was incubated in denaturing buffer twice for 30 minutes each time. The denatured gel was washed in transfer buffer for 15 minutes prior to alkaline transfer (outlined below).
[0091] There is one HindIII site in the pIND-4 plasmid, located very close to 5′ prUBI-1 extreme. No other HindIII site was present in the plasmids (
[0092] Additionally, there is one BamHI site in the pIND-4 plasmid, located very close to initiation codon of HaHB4 and bar CDSs. No other BamHI sites are present in the plasmids (
[0093] Finally, there are five AseI restriction sites in the plasmid (
[0094] Molecular probes for HaHB4 and bar CDSs were synthesized following the procedure outlined in the Roche PCR DIG Probe Synthesis Kit (Cat. No. 11636090910) and using oligonucleotides mentioned in Table 3.
TABLE-US-00003 TABLE 3 List of primers used for the preparation of the probes used in Southern blot analyses. Hybridi- Size zation Primer Probe (bp) (° C) Type Sequence HB4 200 45 Forward GGGCTTCATCCTGGTCAAGTGGC Reverse TCTTGATGCTTTTCTGCTACATTT CTCAGC Bar 282 55 Forward CACGCAACGCCTACGACTGGACGG CC Reverse GTACCGGCAGGCTGAAGTCCAGCT
[0095] Alkaline transfer of DNA from the agarose gel was performed using the Turboblotter-Rapid downward transfer system (Whatman). The DNA was transferred to a 12×21 cm Nylon membrane (Nytran™ Super Charge, Sigma-Aldrich Co., St. Louis, Mo.) for 4 hours. The membrane was washed in neutralizing buffer (0.2M sodium phosphate, pH 6.8). The DNA was permanently cross-linked to the membrane by Ultraviolet Cross linker (CL-1000) with 2 exposures of 1500 mJ.
[0096] The membrane was incubated in 50 mL of Roche DIG EasyHyb hybridization buffer (Cat. no. 11 603 558 001) at pre-calculated hybridization temperatures (45° C., 55° C. for bar gene and HaHB4 gene probes respectively) on an orbital shaker.
[0097] Aliquots of 35 μL and 45 μL bar and HaHB4 probes, were diluted by adding 65 and 55 μL, respectively, of 1× TE buffer. The probe solutions were incubated at 95° C. for 10 min and cooled to 4° C. for 2 min. They were added to 8.75 mL of DIG hybridization buffer and poured to the bottom of the hybridization bottle. The membranes were incubated at the described hybridization temperatures for 16 hours in a hybridization oven (VWR scientific products) with an orbital shaker.
[0098] After hybridization, the membranes were washed with washing buffer according to instructions provided with the Roche, DIG Luminescent Detection Kit. After 1 hour of blocking with 1× blocking reagent, the membranes were incubated for 30 min in a solution containing 50 mL of 1× blocking reagent and 5 μL of anti-digoxigenin-AP. The membrane was washed twice with washing buffer for 30 minutes each time and finally treated with detection buffer for 5 minutes. At this point the membrane was placed in a KPL Hybridization Bag (KPL Cat. No. 60-00-51). 5 mL of CSPD solution from the DIG Luminescent Detection Kit was applied evenly across the membrane. The membrane was incubated with CSPD solution for 5 minutes at room temperature. The hybridization bag with the membrane was heat sealed and incubated at 37° C. for 15 minutes. The hybridization bag was placed in a cassette with Kodak Biomax Light Film (Cat. No. 178 8207) in dark room and exposed for 20 minutes. The films were developed at dark using a Konika QX-60A X-ray film processor. Subsequent exposures were made at 1 hour or 2 hours as required.
[0099] The analysis of hybridization bands obtained with HaHB4 probe allowed to assume the presence of three copies of this CDS (
[0100] On the other hand, the analysis of hybridization bands obtained with bar probe allowed us to assume the presence of seven copies of this CDS with BamHI (
[0101] In brief, southern blots results showed a complex insertion pattern with possible internal DNA rearrangements, suggesting that a genomic sequencing approach should be necessary to resolve the insertion structure in IND-ØØ412-7 event.
[0102] b) Identification and Isolation of Chromosome Containing the Insertion Sequences in IND-ØØ412-7
[0103] DArT was used to identify that HaHB4 gene located in chromosome 2D of wheat genome. Each polymorphic DNA fragment (which corresponds to a point on the plate) is actually a molecular marker that may serve for the genotyping of a segregating population of a biparental cross (the presence or absence of the marker in the segregating material) and the detection of associations of these markers with characteristic of agronomic interest (region of the polymorphism). In the case of IND-ØØ412-7 event, this technology was used to genotype the F2 generation of the cross IND-ØØ412-7× Bag17, and to search for possible linkage of these markers with HaHB4 transgene. The presence or absence of HaHB4 was determined in each F2 individual and, after genotyping, associations were determined between DArT markers and HaHB4. This transgene presented association with one marker located in the 2D chromosome (http://www.cerealab.unimore.it/). The fact that only one marker presented association to HaHB4 may be because there is not saturated marker map available for this particular chromosome (Jia et al., 2013; http://ccg.murdoch.edu.au/cmap/ccg-live/cgi-bin/cmap/viewer).
[0104] The HaHB4 CDS was most probable located in the long arm near the centromere associated to the marker Gpw3105.
[0105] Using this information, 5 ug of chromosome 2D DNA that was suitable for Illumina library preparation were obtained. However, due to the nature of the DNA amplification process post-sorting, the DNA was partially suitable for PacBio libraries (
[0106] Diversity panels were generated using DNA from the IND-ØØ412-7 and wild genotype Cadenza.
[0107] Genomic DNA was extracted from seedlings. About 5 ng DNA from each genotype was digested evaluated for 1 hour at 37° C. with 2 U of restriction enzymes (EcoRI, PstI and MspI) in a final volume of 8 μL. After digestion, 2 μL of ligation mixture were added and the sample was incubated for 3 hours at 37° C. The ligation mixture is comprised of 0.2 μL of T4 ligase (New England Biolabs), 0.2 μL of 50 mM ATP, 1.2 μL of MilliQ water (MQ) and 0.1 μL of suitable specific enzyme at a concentration of 50 pmol/μL (MspI) and 5 pmol/μL (EcoRI and PstI). After ligation, the mixture was diluted to a final volume of 500 μL using MQ water, and 2 μL was used as template in a PCR reaction. The reaction was conducted in a final volume of 50 μL, 2 U Red Taq polymerase (Sigma) and primers. After an initial incubation at 95° C. for 3 minutes, the reaction followed the following protocol: 30 cycles of 94° C. for 30 seconds, 60° C. for 45 seconds and 72° C. for 1 minute. A final extension was performed at 72° C. for 8 minutes.
[0108] The amplicons thus generated were ligated into the PCR2.1TOPO vector (Invitrogen) and subsequently transformed by heat shock cells of E. coli TOP10F '(Invitrogen) following manufacturer's instructions. The transformants were selected on media containing ampicillin and X-gal. Individual white colonies (containing the recombinant plasmid) were transferred to a tube by ringing containing 20 μL of 10% glycerol. From each sample in glycerol, 5 μL aliquot was taken and was transferred to a tube containing 45 μL of PCR master mix RedTaq tube (Sigma) and 15 pmol of each primer M13 forward and M13 reverse. The profile cycler used was 1 cycle at 95° C. for 5 minutes; 35 cycles of 94° C. for 30 seconds, 52° C. for 30 seconds and 72° C. for 1 minute. After amplification, PCR products were precipitated using 1 volume of isopropanol at room temperature and washed with 100 μL of 70% ethanol. The ethanol was removed and the products were dried at room temperature.
[0109] The products were re-suspended in MQ water, 3×SSC or 1×SSC+0.01% sarkosyl (Sigma) at a final concentration of ˜20 ng/μL. The purified fragments were transferred to a 384-well plate (Genetix) and 6 replicates were set for passage in Polysine™ chips (Menzel Glazer) using the Affymetrix™ 417 System. After 1 day of fixation, the chips were processed according to the http://microarrays.org/protocols.html published procedure (2001) with the slight modification that sodium borohydride was used (Sigma) instead of using succinic anhydride and 1-methyl-2-pyrrolidone as blocking solution, prepared in PBS buffer pH 7.4 (137 mM NaCl, 2.7 mM KCl, 10 mM NaHPO, KHHPO 2 mM). The chips were immersed in boiling water for 30 seconds to denature the DNA and then immediately immersed in iced 100% ethanol for 10 seconds. The chips were dried at room temperature.
[0110] After PCR amplification, the products were purified using columns (Qiagen) or precipitated by addition of isopropanol to remove excess dNTPs. The Cy3 and Cy5 (Pharmacia) fluorescent dyes were incorporated using labeling kit Deca-random-prime DNA (Fermentas) according to the manufacturer's instructions.
[0111] The samples labeled with Cy3 and Cy5 (5 μL of each) dyes were mixed with 2 μL of a solution of 20 ug/uL DNA from herring sperm (Sigma) dissolved in Express Hybridization solution (Clontech) and denatured at 96° C. for 3 minutes. The denatured probes were mixed with 10 to 15 μL of hybridization solution, transferred directly to the surface of the microarray, and covered with a glass (24×24 mm, Mediglass). The chips were immediately placed in a humidification chamber at 65° C. overnight for hybridization. After hybridization, the chips were washed with 1×SSC with 0.1% SDS for 5 min, 1×SSC for 2 minutes, 0.2×SSC for 2 minutes and 20 seconds 0.02×SSC.
[0112] The chips were scanned using the Affymetrix 418™ scanner. The intensity of each signal was analyzed using the Scanalyse v.2.44 (Standford University) and GenePix Pro v.3 (Axon instruments) program.
[0113] c) Junction Sequence Analysis and Structure of the Insertion in IND-ØØ412-7 Using Illumina and PacBio Sequencing.
[0114] Results from Southern blot analysis suggested a complex pattern of transgenic insertion. Therefore, isolated chromosome 2D DNA library was sequenced using Illumina Hiseq platform. We produced more than 1.2 billion reads in 2×100 bp paired-end configuration representing more than 124 Gb of sequencing data. Sequencing coverage of the whole chromosome was estimated between 40 and 50× based on not redundant mappable reads on single copy genes located in chromosome 2D such as PpoD1b (He et al, 2009). Sample enrichment in chromosome 2D was verified by mapping reads to known single copy genes located outside the chromosome such LOXs (Feng et al., 2012). In these cases, coverage was estimated between 1 and 5×, thereby confirming a highly enriched DNA in chromosome 2D sequences.
[0115] Read mapping on plasmids used for transformation allowed us to verify the Southern blot results. It was concluded that we had obtained 3 complete or nearly complete copies of HaHB4 CDS based on 100× coverage and 8 complete or nearly complete copies of bar CDS based on 400× coverage.
[0116] Several other plasmid elements were identified with coverage up to 1200×.
[0117] Junction Sequence Analysis (JSA) protocol (Kovalic et al., 2012) using Illumina reads identified up to 4 different flanking sequences with wheat DNA and several chimeric junction sequences involving plasmid elements. In brief, Illumina data also showed a complex pattern of the insertion event involving internal plasmid rearrangements in IND-ØØ412-7.
[0118] Consequently, PacBio long sequencing reads to assist the scaffolding process of the Illumina reads assembly were generated. PacBio long reads would allow reading through complex internal structures and rearrangements.
[0119] Due to the DNA sample quality obtained after chromosome sorting which allow us to generate a library of around 5 Kb average size, the P4-C2 chemistry of PacBio was used. This chemistry produces an average of 5.5 Kb long reads. 20 SMART cells to generate 1,806,197 reads totaling 3.5 Gb of sequencing data with an average read length of approximately 2 Kb and a maximum of 13 Kb were used. Based on a chromosome 2D size of 800 Mb, a coverage of 4.7× of the whole chromosome was estimated. PacBio statistics are shown in Table 4 and read length distribution and Q scores shown in
TABLE-US-00004 TABLE 4 PacBio Statistics. Library average size 5500 bp # smart cells: 20 # Sequences 1,806,197 Total bases 3.513.329.966 bp. (3, 5 Gb.) Mean sequence length 1.943,32 ± 1.605,46 Minimum length 50 bp Maximum length 32,913
[0120] Based on a combined analysis of sequencing data from IIlumina and PacBio the flanking sequences of the insertion were firstly defined.
[0121] A set of four parameters as a cut-off to determine the true identity of a flanking sequence was established: [0122] 1. Supported by IIlumina data, [0123] 2. Supported by PacBio data, [0124] 3. Supported by IIlumina coverage as a single copy, and [0125] 4. Supported by PCR amplification from IND-ØØ412-7 DNA.
[0126] Four different flanking sequences passed all filters to meet the selected criteria named JPLa, JPLb, JPSa and JPSb.
[0127] A similar approach was used to determine all of the internal chimeric plasmid-plasmid junction sequences but considering the Illumina coverage for the individual plasmid elements involved. Internal junction sequences that passed all filters were extended using Illumina data and mapped on the long PacBio reads to produce a final assembly. The quality of the final assembly was checked back to the initial southern blot data and the results were confirmed.
[0128] In brief, two different insertions of the plasmids in highly repetitive regions of chromosome 2D in the wheat genome were described. One of the insertions is 47,611 bp long and the other is 20,418 bp long totaling 68,029 bp of insertions in IND-ØØ412-7 event (
[0129] d) Detection, Structure and Copy Number of Vector Sequences not Related to the Genes of Interest.
[0130] From the analysis of the insertion events it was evident the presence of plasmid vector sequences and other coding regions unrelated to the genes and regulatory regions of interest introduced during the wheat transformation process.
[0131] Elements of plasmid backbone detected in the insertion of the IND-ØØ412-7 are bla gene conferring ampicillin resistance in bacteria, and bacterial origin of replication of pBR322 plasmid (
[0132] All of the plasmid backbone sequences in IND-ØØ412-7 insertion have a confirmed origin in the vectors pIND4-HB4 and pIND4-Bar used for transformation as demonstrated by the identity of the nucleotide sequences using blast.
[0133] However, sequences corresponding to the gus gene (Jefferson et al., 1987) and the promoter of the wheat gbl1 gene (Jones, 2005) leading its expression were detected. These sequences originated in a third plasmid used to monitor the efficiency of transformation; nevertheless, these elements have been incorporated during the integration process. The gus CDS was found in four copies while the gbl1 promoter was found in five copies (
[0134] e) Localization of IND-ØØ412-7 Insertion in the Wheat Genome.
[0135] The insertions were located in the wheat chromosome 2D. These insertions were detected in no annotated sequences and it is highly unlikely that they were interrupting coding sequences for the reasons explained below.
[0136] All of the flanking wheat sequences corresponded to DNA segments with high similarity to retrotransposons indicating insertion events in highly repetitive DNA regions (Mayer et al, 2014).
[0137] To confirm this, JPs (Junction points) were blasted against IWGSC project database through EnsemblPlants website (http://plants.ensembl.org/Triticum_aestivum/Info/Index). Multiple hits against multiple T. aestivum chromosome sites were observed in each case. Although uneven in some cases, full sequence coverage was observed for each JP (
[0138] JP sequences were also blasted against NCBI non-redundant database. Two of these sequences (JP Short, JPSa and JPSb) matched against known retrotransposon elements (Table 5). While the other two JP sequences (JP Long, JPLa and JPLb) had no significant hits against the NCBI database, they are highly conserved and repeated multiple times across multiple chromosomes in the wheat database, strongly suggesting unknown repeated DNA elements.
TABLE-US-00005 TABLE 5 Best hit example of JP sequences blast against NCBI non-redundant database Query Subject Stats Name Start End Name Start End Notes Score E-val % ID L. JPSa 1 266 FN564434 122244 122509 Retrotransposon 386 1E−92 89 266 gypsy JPSb 1 499 AF326781 144816 145314 Transposon 582 7E−146 83 499 gypsy-like retrotransposon Fatima JPLa 201 300 IWGSC_CSS_ 5AS 364 463 unknown repeat 500 4E−15 100 100 scaff_1551050 element JPLb 1 169 IWGSC_CSS_ 5DS 2630 2797 unknown repeat 507 2E−15 81 174 scaff_2755707 element L.: Length
[0139] Stability and Integrity of the IND-ØØ412-7 Insertions
[0140] Inserts Segregation Over Sexual Transfer.
[0141] Homozygous plants for the insertion IND-ØØ412-7 were crossed with a commercial variety, Baguette 17, to obtain the F1 generation. After the selfing of F1 plants, 349 F2 seeds were obtained. Plants grown from these seeds were used for segregation analysis. DNA was extracted from young leaves. Prior to DNA extraction, leaf tissue was frozen in liquid nitrogen and processed to a fine powder in a mortar with a pestle or in tubes in a “96 mill” for minipreps. The following techniques were used to extract plant DNA, depending on the amounts of DNA needed for experimental purposes:
[0142] CTAB Method:
[0143] Genomic DNA was extracted following a Hexadecyltrimethylammonium bromide (CTAB)-based method (http://irc.igd.cornell.edu/Protocols/DoyleProtocol.pdf). Briefly, 600 μL of CTAB buffer (2% w/v CTAB, 100 mM TrisHCl, 20 mM EDTA, 1.4 M NaCl, and β-mercaptoethanol) and 5 μg RNase A were added to approximately 100 mg of ground leaf tissue and incubated at 55-60° C. for 15-20 minutes with intermittent mixing. 600 μL of chloroform was added to the samples and mixed by hand 2-3 minutes, then centrifuged at 10,000 rpm for 8 minutes. The upper aqueous phase was put into a clean microtube and the DNA was precipitated with 400 μL of isopropanol. The sample was centrifuged at 12,500 rpm for 10 minutes to pellet the precipitated DNA. The DNA pellets were washed with 300 μL of 70% ethanol by centrifuging the samples at 12,500 rpm for 5 minutes. The DNA pellets were air-dried, then resuspended in 100 μL of TE buffer (10 mM TrisHCl, 1 mM EDTA, pH 8.0). All extracted DNA was stored in a 4° C. refrigerator or in a −20° C. freezer.
[0144] To ensure the integrity of the samples, end point PCR of a wheat endogenous control was performed with a specific primer. Then, end point PCR was performed using different combinations of primers to determine the presence of HaHB4 and bar CDS. A Chi-square (χ2) analysis was used to evaluate the expected 3:1 segregation (presence or absence of CDSs of interest).
[0145] Table 6 summarizes the results obtained by PCR analysis.
TABLE-US-00006 TABLE 6 Results of segregation analysis by means of PCR. Total HaHB4+bar+ HaHB4+bar− HaHB4−bar+ HaHB4−bar− 349 259 0 0 90 Total: number of individuals tested; HaHB4+bar+: number of individuals positive to HaHB4 and bar CDSs; bar−HaHB4+: number of individuals positive to HaHB4 CDS; HaHB4−bar+: number of individuals positive to bar CDS; HaHB4−bar−: number of individuals negative to HaHB4 and bar CDSs.
[0146] Table 7 shows the statistical analysis:
TABLE-US-00007 TABLE 7 Statistical analysis of segregation results. Expected results Observed results (No. of plants) (No. of plants) + − + − X.sup.2 p-value 261.75 87.25 259 90 0.11 0.74
[0147] The value of χ2 (degrees of freedom=1, α=0.05) showed no statistically significant difference between the expected and observed results indicating a Mendelian segregation 3:1 for each of the CDSs analyzed (HaHB4 and bar).
[0148] The results obtained in the F2 generation indicate that both transgenes are stably inherited during sexual transfer. In the segregating population, both genes had a 3:1 segregation according to the Mendelian principles. Finally, even though both CDSs come from a process of co-transformation by bombardment, the two genes are linked, as each individual F2 analyzed presents the same results for both CDSs, bar and HaHB4.
[0149] The previous analysis was made with oligonucleotides that detect almost the entire CDSs.
[0150] After confirmation of the stability of the complete CDSs of bar and HaHB4, it was decided to proceed with the characterization the other genetic elements, or part of them, and flanking sequences. With the aim of detecting the presence/absence of HaHB4, bar and bla transgenes copies in IND-ØØ412-7, oligonucleotides that hybridize with all copies (complete and incomplete) were designed. Also, the four insert-to-plant junctions were detected to determine their segregation in the F2 generation. These studies were made in 92 individuals of the F2 population. The results are shown in Table 8.
TABLE-US-00008 TABLE 8 Statistical analysis of segregation results. Expected results Observed results (No. of plants) (No. of plants) + − + − X.sup.2 p-value 69 23 65 27 0.9275 0.336
[0151] The χ2 value (d.f.=1, α=0.05) in the F2 generation indicated no statistically significant difference between the observed and the expected 3:1 segregation ratio for the data analyzed.
[0152] All transgenic plants analyzed presented consistent results for the three elements of IND-ØØ412-7 detected (HaHB4, bar and bla) and for the four insert-to-plant junctions (JPSa, JPSb, JPLa and JPLb). These results support the conclusion that the IND-ØØ412-7 construct resides at a single locus within the wheat genome and is inherited according to Mendelian inheritance principles.
Example 4: Yield Increase as an Indicator of Abiotic Stress Tolerance
[0153] Fifteen field trials were conducted at multiple test sites and planting dates to evaluate yield and yield components of transgenic event IND-ØØ412-7 and the parental non-transgenic control line (cv Cadenza). Sites were located within the major wheat production areas of Argentina, ranged between latitude 32° S and 38° S. The area covers diverse environmental conditions of Argentinean wheat crop production. Trials included representative locations from pampa's wheat regions described by Kugler and Godoy (1974): IIN (7 trials), IIS (6 trials) and IV (two trials). At each site the planting date was adjusted according to farmers' usual practice, starting in May/June at northern sites and in July at southern sites. Planting and harvest dates are reported in Table 9.
TABLE-US-00009 TABLE 9 Selected locations for field trials and dates of planting and harvest. Wheat Planting Site ID Site location Province region date Harvest date A12-1 Monte Buey Córdoba IIN May 31, 2012 Dec. 26, 2012 A12-2 Monte Buey Córdoba IIN Jun. 19, 2012 Dec. 26, 2012 A13 Monte Buey Córdoba IIN Jun. 14, 2013 Dec. 12, 2013 D12 Corral de Córdoba IIN May 30, 2012 Dec. 12, 2012 Bustos D13 Corral de Córdoba IIN Jun. 17, 2013 Dec. 17, 2013 Bustos F12 Villa Saboya Buenos IIS Jun. 7, 2012 Dec. 22, 2012 Aires F13 Villa Saboya Buenos IIS Jun. 26, 2013 Dec. 12, 2013 Aires G12-1 Carmen de Buenos IIS Jun. 14, 2012 Jan. 4, 2013 Areco Aires G12-2 Carmen de Buenos IIS Jul. 6, 2012 Jan. 4, 2013 Areco Aires H12 Daireaux Buenos IIS Jun. 12, 2012 Dec. 28, 2012 Aires H13 Daireaux Buenos IIS Jun. 27, 2013 Dec. 19, 2013 Aires I12 Balcarce Buenos IV Jul. 25, 2012 Jan. 7, 2013 Aires I13 Balcarce Buenos IV Jul. 26, 2013 Jan. 13, 2014 Aires P12 Landeta Santa Fe IIN Jun. 3, 2012 —.sup.a P13 Landeta Santa Fe IIN Jun. 10, 2013 Dec. 11, 2013 .sup.aTrial lost by flood at maturity
[0154] Weather conditions were registered during the growing season for each site. Annual rainfall registered across sites ranged from 424 mm to 1497 mm for trials H13 and G12 respectively (Table 10), indicating a wide weather variation across sites and years. During 2013 rainfall accumulated during the growing period (June-December) registered values under 500 mm for all sites. Trials planted in 2013 had higher probability of drought stress conditions than the trials planted in 2012. For 2012 rainfall values were above 500 mm for the same period at all sites (Table 10).
TABLE-US-00010 TABLE 10 Weather data (rainfall) for each site during 2012 and 2013 for the wheat field sites. Site ID .sup.a Month A12 A13 D12 D13 F12 F13 G12 H12 H13 I12 I13 P12 P13 January 47 36 103 25 110 0 75.5 112 32 46 69 98 17 February 214 87 282 159 227 5 211 111 10 66 33 164 106 March 212 68 211 42.9 104 96 166 184 46 78 98 211 55 April 9 106 19 83 105 30 57 33 70 46 45 83 112 May 48 44 49 33 56 31 120 166 17.5 85 10 44 35 June 0 16 0 24.5 0 0 7 0 6 0 23 2 17 July 0 12 0 13.5 0 8 11 0 45 0 50 0 5 August 68 0 56 0 48 0 203 135 3 295 17 87 0 September 135 2.5 132 4.5 55 15 72.5 70 36 42 141 115 16 October 321 162 291 126 245 58 285 252 37.5 27 50.5 236 33 November 73 131 155 184 165 150 98 87 111 77 183 64 294 December 128 97 156 24.1 41 54 191 179 11 150 10 314 0 June-December .sup.b 725 421 790 377 554 285 868 723 250 591 452 818 365 Year 1255 762 1453 720 1156 447 1497 1328 425 912 730 1418 690 .sup.a A12 = Monte Buey, two planting dates, year 2012; A13 = Monte Buey, year 2013; D12 = Corral de Bustos, year 2012; D13 = Corral de Bustos, year 2013; F12 = Villa Saboya, year 2012; F13 = Villa Saboya, year 2013; G12 = Carmen de Areco, two planting dates, year 2012; H12 = Daireaux, year 2012; H13 = Daireaux, year 2013; I12 = Balcarce, year 2012; I13 = Balcarce, year 2013; P12 = Landeta, year 2012; P13 = Landeta, year 2013. .sup.b Growing period
[0155] Field trials were established at each site following a completely randomized block design. Four replications were evaluated at all locations. Plots consisted of seven rows spaced 0.2 m apart and five meters in length. All field trials were bordered with plots of 7 rows and 5 meters' length. Prior to planting, seed pool of IND-ØØ412-7 and Cadenza were tested by PCR to confirm presence and absence of Hahb4 respectively. All seeds were treated with insecticide (Thiamethoxam, 0.4 mL kg.sup.−1), and fungicide (Difenoconazole, 0.2 mL kg.sup.−1 and Metalaxyl-M, 0.15 mL kg.sup.−1) using the protocol indicated on the corresponding product label.
[0156] All chemicals applied to crop were performed according to farmer's usual practice. Herbicides applied during fall prior to planting consisted of Gliphosate (2.0 L ha.sup.−1) and Metsulfuron-metil (6.8 g ha.sup.−1). Fungicide was applied to control foliar fungal diseases at trials P12, D12, A12-1, A12-2, F12, H12, G12-1, G12-2 and I12. Fungicide was sprayed once at each trial when 50% of the plots reached the growth stage 5.1 (Zadoks, 1974). An insecticide spray to control stink bugs (Nezara sp., Piezodorus sp. and Dichelops sp.) was applied at Zadoks growth stage 3.1 on trials A12-1, A12-2, D12, F12, P12. Conversely, trials P13, D13, A13, F13, H13 and 113 were grown without fungicide or insecticide spray due to low pressure of diseases and pests. Fertilizers and chemicals applied at each trial are described in Table 11.
TABLE-US-00011 TABLE 11 Fertilization and chemical inputs for pest control at each trial Growth Site ID Chemical Stage.sup.a Rate Units Purpose A12-1 Monoammonium GS 0 160 kg ha.sup.−1 Fertilizer phosphate.sup.b Urea.sup.c GS 2.4 150 kg ha.sup.−1 Fertilizer Cypermethrin 25 EC GS 3.1 25 g ha.sup.−1 Insecticide Azoxystrobin + GS 5.1 0.5 l ha.sup.−1 Fungicide Cyproconazole (Amistar Xtra ® 28 SC) A12-2 Monoammonium GS 0 160 kg ha.sup.−1 Fertilizer phosphate Urea GS 2.3 150 kg ha.sup.−1 Fertilizer Cypermethrin 25 EC GS 3.1 25 g ha.sup.−1 Insecticide Azoxystrobin + GS 5.1 0.5 l ha.sup.−1 Fungicide Cyproconazole (Amistar Xtra ® 28 SC) A13 Monoammonium GS 0 160 kg ha.sup.−1 Fertilizer phosphate Urea GS 0 150 kg ha.sup.−1 Fertilizer Urea GS 2.6 150 kg ha.sup.−1 Fertilizer D12 Monoammonium GS 0 160 kg ha.sup.−1 Fertilizer phosphate Urea GS 2.3 150 kg ha.sup.−1 Fertilizer Cypermethrin 25 EC GS 3.1 25 g ha.sup.−1 Insecticide Azoxystrobin + GS 5.1 0.5 l ha.sup.−1 Fungicide Cyproconazole (Amistar Xtra ® 28 SC) D13 Monoammonium GS 0 160 kg ha.sup.−1 Fertilizer phosphate Urea GS 0 150 kg ha.sup.−1 Fertilizer Urea GS 2.6 150 kg ha.sup.−1 Fertilizer F12 Monoammonium GS 0 160 kg ha.sup.−1 Fertilizer phosphate Urea GS 2.3 150 kg ha.sup.−1 Fertilizer Cypermethrin 25 EC GS 3.1 25 g ha.sup.−1 Insecticide Azoxystrobin + GS 5.1 0.5 l ha.sup.−1 Fungicide Cyproconazole (Amistar Xtra ® 28 SC) F13 Monoammonium GS 0 160 kg ha.sup.−1 Fertilizer phosphate Urea GS 0 150 kg ha.sup.−1 Fertilizer Urea GS 2.6 150 kg ha.sup.−1 Fertilizer .sup.aGS: Zadoks Scale (Zadoks, 1974) .sup.bEquivalent Grade 11-52-0 .sup.bEquivalent Grade 46-0-0 Note: Dose in the table corresponds to the commercial product
TABLE-US-00012 TABLE 11 Fertilization and chemical inputs for pest control at each trial. Continued. Growth Site ID Chemical Stage.sup.a Rate Units Purpose G12-1 Monoammonium GS 0 160 kg ha.sup.−1 Fertilizer phosphate Urea GS 2.3 150 kg ha.sup.−1 Fertilizer Azoxystrobin + Cyproconazole GS 5.1 0.5 l ha.sup.−1 Fungicide (Amistar Xtra ® 28 SC) G12-2 Monoammonium GS 0 160 kg ha.sup.−1 Fertilizer phosphate Urea GS 2.3 150 kg ha.sup.−1 Fertilizer Azoxystrobin + Cyproconazole GS 5.1 0.5 l ha.sup.−1 Fungicide (Amistar Xtra ® 28 SC) H12 Monoammonium GS 0 160 kg ha.sup.−1 Fertilizer phosphate Urea GS 3.1 300 kg ha.sup.−1 Fertilizer Azoxystrobin + Cyproconazole GS 5.1 0.5 l ha.sup.−1 Fungicide (Amistar Xtra ® 28 SC) H13 Monoammonium GS 0 160 kg ha.sup.−1 Fertilizer phosphate Urea GS 0 150 kg ha.sup.−1 Fertilizer Urea GS 2.6 150 kg ha.sup.−1 Fertilizer I12 Monoammonium GS 0 160 kg ha.sup.−1 Fertilizer phosphate Urea GS 2.3 150 kg ha.sup.−1 Fertilizer Azoxystrobin + GS 5.1 0.5 l ha.sup.−1 Fungicide Cyproconazole (Amistar Xtra ® 28 SC) I13 Monoammonium GS 0 160 kg ha.sup.−1 Fertilizer phosphate Urea GS 0 150 kg ha.sup.−1 Fertilizer Urea GS 2.6 150 kg ha.sup.−1 Fertilizer P12 Monoammonium GS 0 160 kg ha.sup.−1 Fertilizer phosphate Urea GS 2.3 150 kg ha.sup.−1 Fertilizer Cypermethrin 25 EC GS 3.1 25 g ha.sup.−1 Insecticide Azoxystrobin + GS 5.1 0.5 l ha.sup.−1 Fungicide Cyproconazole (Amistar Xtra ® 28 SC) P13 Monoammonium GS 0 160 kg ha.sup.−1 Fertilizer phosphate Urea GS 0 150 kg ha.sup.−1 Fertilizer
[0157] Agronomic data were assessed at each field trial. The agronomic variables consisted of early stand (NPL), number of spikes m.sup.−2 (NE), number of kernels by spike.sup.−1 (NGE), thousand kernel weight (PMG), test weight (PH), yield (REND), aerial biomass (BMA) and harvest index (IC).
[0158] Early stand was assessed by counting emerged plants in a central plot area of 0.6 m.sup.2 before tillering. NE, BMA, weight of grains (PG), PMG and IC were assessed at harvest on a central plot sample of 0.6 m.sup.2. PMG was assessed on a sample of 10 g of the grains harvested at each plot. The NGE was calculated according to:
NGE=(PG/NE)×1000/PMG Eq. [1]
[0159] PH was assessed with the Argentinean standard protocol used for wheat commercialization (Shopper's grain scale). Yield was assessed on the five central rows of each plot for trials A12-1, A12-2, D12, F12 and H12. In the rest of the trials, yield was assessed on the whole plot (7 rows). Yield was corrected by grain moisture (13.5%) and expressed as kg ha.sup.−1.
[0160] Data of the transgenic event and the control Cadenza were analyzed using ANOVA with a completely randomized block design at a 95% confidence level using Infostat (Di Rienzo et al., 2010). Comparisons between the transgenic event and Cadenza were performed in a combined site analysis for REND, PMG, PH, NPL, NE, NGE, BMA and IC. In this analysis the data were pooled among sites, and sources of variation included genotypes (transgenic and control), environments and the genotype by environment interaction.
[0161] In the combined site analysis, three statistically significant differences were detected out of 8 comparisons between IND-ØØ412-7 and the control (Table 12). A statistically significant difference was detected between IND-ØØ412-7 and the conventional control for REND (p=0.0103), PMG (p=0.0039) and PH (p=0.0430). In addition, no statistically significant trial by genotype interaction was detected.
[0162] The REND of IND-ØØ412-7 was 133 kg ha.sup.−1 higher than the control, which represents an average yield increase of 5%. Conversely, PMG and PH showed lower values in IND-ØØ412-7 compared with the control. No consistent differences were observed in cycle or biotic stress response between the event and the parental control. Overall, significant differences in yield between IND-ØØ412-7 and the control suggests that the transgenic event set more seeds per unit land area. Smaller seed size might occur due to lower source-to-sink ratio during seed filling that also leads to lower PH. Differences between IND-ØØ412-7 and the control represented 5% and 2% for PMG and PH respectively.
TABLE-US-00013 TABLE 12 Comparison between IND-ØØ412-7 and the parental control Cadenza in a combined site analysis of yield and yield components. Mean (MSE) .sup.b Variable .sup.a Unit IND-ØØ412-7 Cadenza NPL Plants m.sup.−2 225 (6.7) 221 (6.7) NE Spikes m.sup.−2 412 (11.1) 410 (9.7) NGE Kernels spike.sup.−1 21.7 (0.8) 21.8 (0.7) PMG g 28.3 (0.8) 29.7 (0.7) * PH kg hl.sup.−1 63.7 (1.1) 64.8 (1.0) * YIELD kg ha.sup.−1 2641 (163) 2508 (156) * BMA kg ha.sup.−1 10583 (743) 10081 (750) IC — 0.31 (0.01) 0.31 (0.01) .sup.a NPL = plants m.sup.2; NE = spikes m.sup.2; NG = kernels spike.sup.−1; PH = test weight; PMG = thousand kernel weight; REND = yield; BMA = aerial biomass; IC = harvest index. n = 60 for NPL; n = 56 for PMG, PH and REND; n = 52 for NG and NE; n = 24 for BMA and IC. .sup.b SE: standard error of the mean * Statistically significant differences (α = 0.05) between control Cadenza and event IND-ØØ412-7