Methods and compositions for modulating splicing

Abstract

Described herein are small molecule splicing modulator compounds that modulate splicing of mRNA, such as pre-mRNA, encoded by genes, and methods of use of the small molecule splicing modulator compounds for modulating splicing and treating diseases and conditions.

Claims

1. A compound of Formula (I), or a pharmaceutically acceptable salt thereof: ##STR00754## wherein, A is CR.sup.ACR.sup.A; E is NR, O, S, S(O), S(O).sub.2, or S(O)(NR.sup.E), R is hydrogen, R.sup.15 and R.sup.18 are both hydrogen or both deuterium, and ring Q is substituted or unsubstituted bicyclic aryl, or substituted or unsubstituted bicyclic heteroaryl; or E is NR, R is substituted or unsubstituted C.sub.1-C.sub.4 alkyl, substituted or unsubstituted C.sub.1-C.sub.4 fluoroalkyl, substituted or unsubstituted C.sub.1-C.sub.4 heteroalkyl, substituted or unsubstituted C.sub.3-C.sub.6 cycloalkyl, or substituted or unsubstituted C.sub.2-C.sub.5 heterocycloalkyl, R.sup.15 and R.sup.18 (i) are the same and selected from the group consisting of hydrogen and deuterium, (ii) are the same and selected from the group consisting of F, OR.sup.1, substituted or unsubstituted C.sub.1-C.sub.4 alkyl, a substituted or unsubstituted C.sub.1-C.sub.4 fluoroalkyl, and substituted or unsubstituted C.sub.1-C.sub.4 heteroalkyl, or (iii) are not the same and selected from the group consisting of hydrogen, deuterium, F, OR.sup.1, substituted or unsubstituted C.sub.1-C.sub.4 alkyl, a substituted or unsubstituted C.sub.1-C.sub.4 fluoroalkyl, and substituted or unsubstituted C.sub.1-C.sub.4 heteroalkyl, and ring Q is substituted or unsubstituted bicyclic aryl or substituted or unsubstituted bicyclic heteroaryl; R.sup.E is hydrogen, substituted or unsubstituted C.sub.1-C.sub.3 alkyl, substituted or unsubstituted C.sub.3-C.sub.6 cycloalkyl, substituted or unsubstituted C.sub.2-C.sub.5 heterocycloalkyl, substituted or unsubstituted C.sub.2-C.sub.3 alkenyl, or substituted or unsubstituted C.sub.2-C.sub.3 alkynyl; each R.sup.A is independently selected from the group consisting of hydrogen, deuterium, F, Cl, CN, OR.sup.1, SR.sup.1, S(O)R.sup.1, S(O).sub.2R.sup.1, substituted or unsubstituted C.sub.1-C.sub.4 alkyl, substituted or unsubstituted C.sub.1-C.sub.4 haloalkyl, substituted or unsubstituted C.sub.1-C.sub.4 heteroalkyl, substituted or unsubstituted C.sub.3-C.sub.4 cycloalkyl, and substituted or unsubstituted C.sub.2-C.sub.3 heterocycloalkyl; X is NR.sup.3; Z is CR.sup.2; W is substituted or unsubstituted C.sub.2 alkylene, substituted or unsubstituted C.sub.1-C.sub.2 heteroalkylene, substituted or unsubstituted C.sub.3-C.sub.8 cycloalkylene, substituted or unsubstituted C.sub.2-C.sub.7 heterocycloalkylene, or substituted or unsubstituted C.sub.2-C.sub.3 alkenylene; each R.sup.1 is independently hydrogen, deuterium, substituted or unsubstituted C.sub.1-C.sub.4 alkyl, CD.sub.3, substituted or unsubstituted C.sub.1-C.sub.4 haloalkyl, substituted or unsubstituted C.sub.1-C.sub.4 heteroalkyl, substituted or unsubstituted C.sub.3-C.sub.6 cycloalkyl, substituted or unsubstituted C.sub.2-C.sub.5 heterocycloalkyl, substituted or unsubstituted aryl, or substituted or unsubstituted heteroaryl; R.sup.2 is hydrogen, deuterium, substituted or unsubstituted C.sub.1-C.sub.4 alkyl,-CD.sub.3, or substituted or unsubstituted C.sub.1-C.sub.4 haloalkyl; R.sup.3 is hydrogen, CN, substituted or unsubstituted C.sub.1-C.sub.4 alkyl,-CD.sub.3, substituted or unsubstituted C.sub.1-C.sub.4 haloalkyl, substituted or unsubstituted C.sub.1-C.sub.4 heteroalkyl, C.sub.1-C.sub.4 alkyleneOR.sup.1, substituted or unsubstituted C.sub.3-C.sub.4 cycloalkyl, or substituted or unsubstituted C.sub.2-C.sub.3 heterocycloalkyl; each R.sup.11, R.sup.12, R.sup.13, and R.sup.14 is independently selected from the group consisting of hydrogen, deuterium, F, OR.sup.1, substituted or unsubstituted C.sub.1-C.sub.4 alkyl, a substituted or unsubstituted C.sub.1-C.sub.4 fluoroalkyl, and substituted or unsubstituted C.sub.1-C.sub.4 heteroalkyl; wherein R.sup.16 is F and R.sup.17 is hydrogen; or wherein R.sup.16 is hydrogen and R.sup.17 is F; a is 0; b is 0; c is 1; and d is 1.

2. The compound of claim 1, or a pharmaceutically acceptable salt thereof, wherein E is NR, R is hydrogen, R.sup.15 and R.sup.18 are both hydrogen or both deuterium, and ring Q is substituted or unsubstituted bicyclic aryl, or substituted or unsubstituted bicyclic heteroaryl.

3. The compound of claim 1, or a pharmaceutically acceptable salt thereof, wherein the compound has a structure of ##STR00755## wherein R is substituted or unsubstituted C.sub.1-C.sub.4 alkyl, substituted or unsubstituted C.sub.1-C.sub.4 fluoroalkyl, substituted or unsubstituted C.sub.1-C.sub.4 heteroalkyl, substituted or unsubstituted C.sub.3-C.sub.6 cycloalkyl, or substituted or unsubstituted C.sub.2-C.sub.5 heterocycloalkyl, R.sup.15 and R.sup.18 (i) are the same and selected from the group consisting of hydrogen and deuterium, (ii) are the same and selected from the group consisting of F, OR.sup.1, substituted or unsubstituted C.sub.1-C.sub.4 alkyl, a substituted or unsubstituted C.sub.1-C.sub.4 fluoroalkyl, and substituted or unsubstituted C.sub.1-C.sub.4 heteroalkyl, or (iii) are not the same and selected from the group consisting of hydrogen, deuterium, F, OR.sup.1, substituted or unsubstituted C.sub.1-C.sub.4 alkyl, a substituted or unsubstituted C.sub.1-C.sub.4 fluoroalkyl, and substituted or unsubstituted C.sub.1-C.sub.4 heteroalkyl, and ring Q is substituted or unsubstituted bicyclic aryl or substituted or unsubstituted bicyclic heteroaryl.

4. The compound of claim 3, or a pharmaceutically acceptable salt thereof, wherein ring Q is selected from the group consisting of: ##STR00756## ##STR00757## ##STR00758## ##STR00759## wherein R.sup.B1 is selected from hydrogen, deuterium, substituted or unsubstituted C.sub.1-C.sub.6 alkyl,-CD.sub.3, substituted or unsubstituted C.sub.1-C.sub.6 fluoroalkyl, substituted or unsubstituted C.sub.1-C.sub.6 heteroalkyl, substituted or unsubstituted C.sub.3-7 cycloalkyl, and substituted or unsubstituted C.sub.2-C.sub.7 heterocycloalkyl.

5. The compound of claim 1, or a pharmaceutically acceptable salt thereof, wherein the compound of Formula (I) has the structure of Formula (Ic): ##STR00760##

6. The compound of claim 1, or a pharmaceutically acceptable salt thereof, wherein ring Q is substituted or unsubstituted bicyclic heteroaryl; wherein if heteroaryl is substituted, then it is substituted with one or more substituents each independently selected from D, halogen, CN, NH.sub.2, OH, O, NH(CH.sub.3), N(CH.sub.3).sub.2, NH(cyclopropyl), CH.sub.3, CH.sub.2CH.sub.3, CF.sub.3, OCH.sub.3, and OCF.sub.3.

7. The compound of claim 1, or a pharmaceutically acceptable salt thereof, wherein ring Q is selected from the group consisting of: ##STR00761## ##STR00762## wherein ring Q is optionally substituted with 1, 2, 3, 4, or 5 R.sup.B, wherein each R.sup.B is independently selected from deuterium, halogen, hydroxy, cyano, substituted or unsubstituted C.sub.1-C.sub.6 alkyl,-CD.sub.3, substituted or unsubstituted C.sub.1-C.sub.6 fluoroalkyl, substituted or unsubstituted C.sub.2-C.sub.6 alkenyl, substituted or unsubstituted C.sub.2-C.sub.6 alkynyl, substituted or unsubstituted C.sub.1-C.sub.6 alkoxy, deuterium substituted C.sub.1-C.sub.6 alkoxy, OCD.sub.3, substituted or unsubstituted C.sub.3-7 cycloalkyl, substituted or unsubstituted C.sub.2-C.sub.7 heterocycloalkyl, substituted or unsubstituted aryl, and substituted or unsubstituted heteroaryl.

8. The compound of claim 1, or a pharmaceutically acceptable salt thereof, wherein W is substituted or unsubstituted C.sub.2 alkylene or substituted or unsubstituted C.sub.1-C.sub.2 heteroalkylene.

9. The compound of claim 8, or a pharmaceutically acceptable salt thereof, wherein W is CH.sub.2OCH.sub.2 or CH.sub.2CH.sub.2.

10. The compound of claim 1, or a pharmaceutically acceptable salt thereof, wherein R is hydrogen or methyl.

11. The compound of claim 1, or a pharmaceutically acceptable salt thereof, wherein R.sup.2 and R.sup.A are hydrogen.

12. The compound of claim 1, or a pharmaceutically acceptable salt thereof, wherein R.sup.3 is hydrogen, CH.sub.3 or CH.sub.2CH.sub.3.

13. The compound of claim 1, or a pharmaceutically acceptable salt thereof, wherein R.sup.15 is selected from hydrogen and CH.sub.3, and R.sup.18 is selected from hydrogen and CH.sub.3.

14. The compound of claim 1, or a pharmaceutically acceptable salt thereof, wherein ring Q is unsubstituted bicyclic heteroaryl.

15. The compound of claim 1, or a pharmaceutically acceptable salt thereof, wherein ring Q is substituted bicyclic heteroaryl.

16. The compound of claim 1, or a pharmaceutically acceptable salt thereof, wherein ring Q is substituted with one or more of the following groups independently selected from D, halogen, CN, NH.sub.2, NH(CH.sub.3), N(CH.sub.3).sub.2, OH, CO.sub.2H, CO.sub.2(C.sub.1-C.sub.4 alkyl), C(O)NH.sub.2, C(O)NH(C.sub.1-C.sub.4 alkyl), C(O)N(C.sub.1-C.sub.4 alkyl).sub.2, S(O).sub.2NH.sub.2, S(O).sub.2NH(C.sub.1-C.sub.4 alkyl), S(O).sub.2N(C.sub.1-C.sub.4 alkyl).sub.2, C.sub.1-C.sub.4 alkyl, C.sub.3-C.sub.6 cycloalkyl, C.sub.1-C.sub.4 fluoroalkyl, C.sub.1-C.sub.4 heteroalkyl, C.sub.1-C.sub.4 alkoxy, C.sub.1-C.sub.4 fluoroalkoxy, SC.sub.1-C.sub.4 alkyl, S(O)C.sub.1-C.sub.4 alkyl, S(O).sub.2(C.sub.1-C.sub.4 alkyl), and oxo.

17. The compound of claim 16, or a pharmaceutically acceptable salt thereof, wherein ring Q is substituted with one or more of the following groups independently selected from D, halogen, CN, NH.sub.2, NH(CH.sub.3), N(CH.sub.3).sub.2, OH, CO.sub.2H, CO.sub.2(C.sub.1-C.sub.4 alkyl), C(O)NH.sub.2, C(O)NH(C.sub.1-C.sub.4 alkyl), C(O)N(C.sub.1-C.sub.4 alkyl).sub.2, C.sub.1-C.sub.4 alkyl, C.sub.3-C.sub.6 cycloalkyl, C.sub.1-C.sub.4 fluoroalkyl, C.sub.1-C.sub.4 heteroalkyl, C.sub.1-C.sub.4 alkoxy, C.sub.1-C.sub.4 fluoroalkoxy, and oxo.

Description

EXAMPLE

(1) These examples are provided for illustrative purposes only and not to limit the scope of the claims provided herein. The starting materials and reagents used for the synthesis of the compounds described herein may be synthesized or can be obtained from commercial sources, such as, but not limited to, Sigma-Aldrich, Acros Organics, Fluka, and Fischer Scientific.

A. Biological Examples

Example A1: Splicing Assay (MAPTau, MADD, FOXM1)

(2) Various cells lines are treated with SMSMs described herein. RNA is then isolated, cDNA synthesized, qPCR performed and the levels of various mRNA targets of the SMSMs are determined. In some instances, RNA is isolated, cDNA synthesized, qPCR performed and the levels of mRNA isoforms in the various cell samples is determined.

(3) Materials

(4) Cells to Ct kit: ThermoFisher, AM1728. TaqMan Gene Expression Master Mix: ThermoFisher, 4369542. PPIA probe/primer. ThermoFisher, Hs03045993_gH, VIC-MGB_PL.

(5) TABLE-US-00013 Probe/primersequences: FoxM1 FOXM1A2probe/primer:IDTDNA Primer1: (SEQIDNO:77) ACAGGTGGTGTTTGGTTACA Primer2: (SEQIDNO:78) AAATTAAACAAGCTGGTGATGGG Probe: (SEQIDNO:79) /56-FAM/AGTTCTTTA/Zen/GTGGCGATCTGCGAGA/ 3IABkFQ/ FOXM1BCprobe/primer:IDTDNA Primer1: (SEQIDNO:80) GAGCTTGCCCGCCATAG Primer2: (SEQIDNO:81) CTGGTCCTGCAGAAGAAAGAG Probe: (SEQIDNO:82) /5HEX/CCAAGGTGC/ZEN/TGCTAGCTGAGGA/3IABkFQ/ MADD Isoform4(WT) Primer1: (SEQIDNO:83) GGCTAAATACTCTAATGGAGATTGTTAC Primer2: (SEQIDNO:84) GGCTGTGTTTAATGACAGATGAC Probe: (SEQIDNO:85) /5HEX/AGTGGTGAA/ZEN/GGAAACAGGAGGGCGTTAG/ 3IABkFQ/ Isoform3(Ex16) Primer1: (SEQIDNO:86) CACTGTTGGGCTGTGTTTAATG Primer2: (SEQIDNO:87) ACAGTACCAGCTTCAGTCTTTC Probe: (SEQIDNO:88) /56-FAM/TCTGAAAGG/ZEN/AAACAGGAGGGCGTT/ 3IABkFQ/ MAPTau MAPTFulllength(4R)probe/primer:IDTDNA Primer1: (SEQIDNO:89) CCATGCCAGACCTGAAGAAT Primer2: (SEQIDNO:90) TTGGACTGGACGTTGCTAAG Probe: (SEQIDNO:91) /5HEX/AATTATCTG/ZEN/CACCTTCCCGCCTCC/ 3IABkFQ/ MAPTTruncation(3R)probe/primer:IDTDNA Primer1: (SEQIDNO:92) AGATCGGCTCCACTGAGAA Primer2: (SEQIDNO:93) GGTTTATGATGGATGTTGCCTAATG Probe: (SEQIDNO:94) /56-FAM/CAACTGGTT/ZEN/TGTAGACTATTTGCACCTT CCC/3IABkFQ/
Cells:

(6) Cells used include 93-T449, A-375, A-673, ASPC-1, BxPC-3, CCL-136, Daoy, DU-145, G-401, Hep-3B, MR-32, K-562, LP-LoVo, MDA-MB-157, MDA-MB-231-luc, MDA-MB-468, MG-63, Ms751, NCI-H358, PACA-2, PANC-1, PC-3, RGX-MPC-11, RGX-PACA-2, SH-SY5Y, SJSA, SKOV3, SNU-16, SW872 (HTB-92), TOLEDO, T.T, U-118, U-251MG, U-87MG, and Z-138 cells.

(7) On the day of the experiment, a 96-well plate is seeded with the cell lines of interest. The cells are diluted with full growth media to a concentration of 2.010.sup.5 cells/mL and 100 L of cells are added to each well (20,000 cells per well). The cells are treated with a compound immediately after plating.

(8) The compounds are then added to the cell plate using the HP compound dispenser. In the initial experiment, a top concentration of 10 M and an 8 point 4-fold dilution scheme is used. The stock compounds are made at a concentration of 5 mM, and the DMSO concentration is set to 0.2%. DMSO is used to normalize all the compound-containing wells and the untreated cells.

(9) The treated cells are incubated at 37 C. in a 5% CO.sub.2 incubator for the desired amount of time. Plates are placed in a plastic bag with a wet paper towel to prevent evaporation.

(10) RNA is isolated using the Cells to C.sub.T kit (ThermoFisher, AM1728). The cells are washed once with 100 L cold PBS. 50 L of lysis buffer is added to each well/tube (49.5 L lysis buffer+0.5 L DNase I per well/tube). The lysis reaction is mixed and incubated at room temperature for 5 minutes. 5 L of stop solution is added directly into each cell lysis reaction and mixed by pipetting up and down 5 times. The plates/tubes are incubated at room temperature for 2 minutes then placed on ice if the cDNA synthesis is to be performed immediately. Otherwise, the plates/tubes are stored at 80 C. cDNA synthesis reactions are then performed. Reverse Transcription (RT) Master mix is prepared according to the table below.

(11) TABLE-US-00014 Component Each reaction 2x RT Buffer 25 L 20x RT Enzyme Mix 2.5 L Nuclease-free water 12.5 L

(12) 40 L RT master mix is added to PCR tubes or plate wells. 10 L of RNA is added to each tube/well.

(13) The RT thermal cycler program is then run and tubes or plate wells are incubated at 37 C. for 1 hour, then at 95 C. for 5 minutes to deactivate the enzyme.

(14) The qPCR is performed using a QuantStudio 6 instrument (ThermoFisher) and the following cycling conditions and according to the tables below. All samples and standards are analyzed in triplicate. Cycle 1: 2 minutes at 50 C. Cycle 2: 10 minutes at 95 C. Cycle 3 (repeat 40 times): 15 seconds at 95 C., 1 minute at 60 C.

(15) Isoform 1 or Isoform 2 Standard Samples

(16) TABLE-US-00015 Component Per qPCR well 2x TaqMan Gene Expression Master Mix 10 L 40x isoform 1 or isoform 2 probe/primer 0.5 L Nuclease-free water 4.5 L Standard DNA 5 L
Unknown Sample (FOXM1 Isoform A2/FOXM1 Isoform BC Quantitation

(17) TABLE-US-00016 Component Per qPCR well 2x TaqMan Gene Expression Master Mix 10 L 40x isoform 1 probe/primer 0.5 L 40x isoform 2 probe/primer 0.5 L Nuclease-free water 5 L Sample DNA 4 L

(18) TABLE-US-00017 Component Per qPCR well 2x TaqMan Gene Expression Master Mix 10 L 60x PPIA probe/primer 0.33 L Nuclease-free water 4.67 L Standard DNA 5 L
Unknown Sample (PPIA Quantitation)

(19) TABLE-US-00018 Component Per qPCR well 2x TaqMan Gene Expression Master Mix 10 L 60x PPIA probe/primer 0.33 L Nuclease-free water 5.67 L Sample DNA 4 L

(20) The determined isoform 2 and isoform 1 quantities are then be used to determine the isoform 2: isoform 2 ratio at the various compound concentrations. The PPIA quantities are used in the normalization to account of cell proliferation effects of the compounds.

(21) Standard Construction

(22) TABLE-US-00019 PPIAstandard(5834bps) GBlocksequence(IDTDNA) (SEQIDNO:95) GAATTCGGCCAGGCTCGTGCCGTTTTGCAGACGCCACCGCCGAGGAAAA CCGTGTACTATTAGCCATGGTCAACCCCACCGTGTTCTTCGACATTGCC GTCGACGGCGAGCCCTTGGGCCGCGTCTCCTTTGAGCTGTTTGCAGACA AGGTCCCAAAGACAGCAGAAAATTTTCGTGCTCTGAGCACTGGAGAGAA AGGATTTGGTTATAAGGGTTCCTGCTTTCACAGAATTATTCCAGGGTTT ATGTGTCAGGGTGGTGACTTCACACGCCATAATGGCACTGGTGGCAAGT CCATCTATGGGGAGAAATTTGAAGATGAGAACTTCATCCTAAAGCATAC GGGTCCTGGCATCTTGTCCATGGCAAATGCTGGACCCAACACAAATGGT TCCCGCGGCCGC. FoxM1A2(5558bps) GBlocksequence(IDTDNA) (SEQIDNO:96) GAATTCGTTTTTGGGGAACAGGTGGTGTTTGGTTACATGAGTAAGTTCT TTAGTGGCGATCTGCGAGATTTTGGTACACCCATCACCAGCTTGTTTAA TTTTATCTTTCTTTGTTTATCAGCGGCCGC FoxM2BC(6439bps) GBlocksequence(IDTDNA) (SEQIDNO:97) GAATTCGGCGGAAGATGAAGCCACTGCTACCACGGGTCAGCTCATACCT GGTACCTATCCAGTTCCCGGTGAACCAGTCACTGGTGTTGCAGCCCTCG GTGAAGGTGCCATTGCCCCTGGCGGCTTCCCTCATGAGCTCAGAGCTTG CCCGCCATAGCAAGCGAGTCCGCATTGCCCCCAAGGTGCTGCTAGCTGA GGAGGGGATAGCTCCTCTTTCTTCTGCAGGACCAGGGAAAGAGGAGAAA CTCCTGTTTGGAGAAGGGTTTTCTCCTTTGCTTCCAGTTCAGACTATCA AGGAGGAAGAAATCCAGCCTGGGGAGGAAATGCCACACTTAGCGAGACC CATCAAAGTGGAGAGCCCTCCCTTGGAAGAGTGGCCCTCCCCGGCCCCA TCTTTCAAAGAGGAATCATCTCACTCCTGGGAGGATTCGTCCCAATCTC CCACCCCAAGACCCAAGAAGTCCTACAGTGGGCTTAGGTCCCCAACCCG GTGTGTCTCGGAAATGCTTGTGATTCAACACAGGGAGAGGAGGGAGAGG AGCCGGTCTCGGAGGAAACAGCATCTACTGCCTCCCTGTGTGGATGAGC CGGAGCTGCTCTTCTCAGAGGGGCCCAGTACTTCCCGCTGGGCCGCAGA GCTCCCGTTCCCAGCAGACTCCTCTGACCCTGCCTCCCAGCTCAGCTAC TCCCAGGAAGTGGGAGGACCTTTTAAGACACCCATTAAGGAAACGCTGC CCATCTCCTCCACCCCGAGCAAATCTGTCCTCCCCAGAACCCCTGAATC CTGGAGGCTCACGCCCCCAGCCAAAGTAGGGGGACTGGATTTCAGCCCA GTACAAACCTCCCAGGGTGCCTCTGACCCCTTGCCTGACCCCCTGGGGC TGATGGATCTCAGCACCACTCCCTTGCAAAGTGCTCCCCCCCTTGAATC ACCGCAAAGGCTCCTCAGTTCAGAACCCTTAGACCTCATCTCCGTCCCC TTTGGCAACTCTTCTCCCTCAGCGGCCGC MADDIsoform4(WT)(5668bps) GBlocksequence(IDTDNA) (SEQIDNO:98) GAATTCAAAGGTGCCCGAGAGAAGGCCACGCCCTTCCCCAGTCTGAAAG TATTTGGGCTAAATACTCTAATGGAGATTGTTACTGAAGCCGGCCCCGG GAGTGGTGAAGGAAACAGGAGGGCGTTAGTGGATCAGAAGTCATCTGTC ATTAAACACAGCCCAACAGTGAAAAGAGAACCTCCATCACCCCAGGGTC GATCCAGCAATTCTAGTGAGAACCAGCAGTTCCTGCGGCCGC MADDIsoform3(Ex16)(5689bps) GBlocksequence(IDTDNA) (SEQIDNO:99) GAATTCACCGAGGGCTTCGGGGGCATCATGTCTTTTGCCAGCAGCCTCT ATCGGAACCACAGTACCAGCTTCAGTCTTTCAAACCTCACACTGCCCAC CAAAGGTGCCCGAGAGAAGGCCACGCCCTTCCCCAGTCTGAAAGGAAAC AGGAGGGCGTTAGTGGATCAGAAGTCATCTGTCATTAAACACAGCCCAA CAGTGAAAAGAGAACCTCCATCACCCCAGGGTCGATCCAGCAATTCTAG TGAGAAGCGGCCGC MAPTauFulllength(4R)(5654bps) GBlocksequence(IDTDNA) (SEQIDNO:100) GAATTCTCCGCCAAGAGCCGCCTGCAGACAGCCCCCGTGCCCATGCCAG ACCTGAAGAATGTCAAGTCCAAGATCGGCTCCACTGAGAACCTGAAGCA CCAGCCGGGAGGCGGGAAGGTGCAGATAATTAATAAGAAGCTGGATCTT AGCAACGTCCAGTCCAAGTGTGGCTCAAAGGATAATATCAAACACGTCC CGGGAGGCGGCAGTGTGCAAGCGGCCGC MAPTauTruncation(3R)(5644bps) GBlocksequence(IDTDNA) (SEQIDNO:101) GAATTCTCAAGTCCAAGATCGGCTCCACTGAGAACCTGAAGCACCAGCC GGGAGGCGGGAAGGTGCAAATAGTCTACAAACCAGTTGACCTGAGCAAG GTGACCTCCAAGTGTGGCTCATTAGGCAACATCCATCATAAACCAGGAG GTGGCCAGGTGGAAGTAAAATCTGAGAAGCTTGACTTCAAGGACAGAGT CCAGTCGAAGGCGGCCGC

(23) The G Blocks are inserted into the pCI-neo mammalian expression vector (Promega) at the EcoRI and Not restriction sites (bolded) using Infusion cloning technology (Clontech). The plasmids are then purified using standard miniprep or maxiprep kits (Machercy Nagel).

(24) Standard Curve Preparation

(25) The dilution necessary to make the top standard is calculated. A top concentration 200,000,000 copies/L of the stock plasmid is prepared in TE buffer. A series of 10-fold dilutions, also in TE, are then made. A total of 5 L of each standard is used in a qPCR well to generate samples containing 10.sup.9 copies, 10.sup.8 copies, 10.sup.7 copies, 10.sup.6 copies, 10.sup.5 copies, 10.sup.4 copies, 10.sup.3 copies, 10.sup.2 copies, 10.sup.1 copies, and 0 copies.

(26) An assay to measure the FOXM1.sup.A2 mRNA and FOXM1.sup.BC mRNA, or MADD.sup.WT (isoform 4) mRNA and MADD.sup.Ex16 (isoform 3) mRNA, or MAPTau.sup.4R mRNA and MAPTau.sup.3R mRNA simultaneously in cell wells is performed. The RNA values are measured relative to DMSO control and also included a housekeeping gene, PPIA to ensure data is consistent. The mRNA values are measured after 24 hours of incubation with the SMSM compounds. The SMSMs dose dependently increased FOXM1.sup.A2 levels while concomitantly decreasing FOXM1.sup.BC levels with EC.sub.50 and IC.sub.50 values in the nanomolar range.

Example A2: SMN2 Splicing AssayMonitoring Expression Levels of SMN2 Splice Variant Using Real-Time Quantitative PCR

(27) Various cells lines are treated with the SMSMs described herein. RNA is then isolated, cDNA synthesized, qPCR performed and the levels of various mRNA targets of the SMSMs are determined. In some instances, RNA is isolated, cDNA synthesized, qPCR performed and the levels of mRNA isoforms in the various cell samples are determined.

(28) Materials

(29) Cells to Ct kit: ThermoFisher, AM1728. TaqMan Gene Expression Master Mix: ThermoFisher, 4369542. PPIA probe/primer: ThermoFisher, Hs03045993_gH, VIC-MGB_PL.

(30) Probe/Primer Sequences.

(31) The table below summarizes primers that can be used.

(32) TABLE-US-00020 Sequence(5-3) Primer Primer 5-Mod. 3-Mod. Species GCTCACATTCCTTAA FLForward 0.04mol None None Human ATTAAGGAGAAA(SEQ Primer IDNO:102) TGGCTATCATACTGG 7Forward 0.04mol None None Human CTATTATATGGAA(SEQ Primer IDNO:103) TCCAGATCTGTCTGA ReversePrimer 0.04mol None None Human TCGTTTCTT(SEQIDNO: 104) CTGGCATAGAGCAGC Probe 0.2mol FAM BHQ-1 Human ACTAAATGACACCAC (Fluorescein) (SEQIDNO:105)
Cells
SMA Type I Patient Cells (GM03813 (Coriell))
Protocol

(33) On the day of the experiment, a 96-well plate is seeded with the cell lines of interest. The cells are diluted with full growth media to a concentration of 2.010.sup.5 cells/mL and 100 L of cells are added to each well (20,000 cells per well). The cells are treated with a compound immediately after plating.

(34) The compounds are then added to the cell plate using the HP compound dispenser. In the initial experiment, a top concentration of 10 M and an 8 point 4-fold dilution scheme is used. The stock compounds are made at a concentration of 5 mM, and the DMSO concentration is set to 0.2%. DMSO is used to normalize all the compound-containing wells and the untreated cells.

(35) The treated cells are incubated at 37 C. in a 5% CO.sub.2 incubator for the desired amount of time. Plates are placed in a plastic bag with a wet paper towel to prevent evaporation.

(36) RNA is isolated using the Cells to CT kit (ThermoFisher, AM1728). The cells are washed once with 100 L cold PBS. 50 L of lysis buffer is added to each well/tube (49.5 L lysis buffer+0.5 L DNase I per well/tube). The lysis reaction is mixed and incubated at room temperature for 5 minutes. 5 L of stop solution is added directly into each cell lysis reaction and mixed by pipetting up and down 5 times. The plates/tubes are incubated at room temperature for 2 minutes then placed on ice if the cDNA synthesis is to be performed immediately. Otherwise, the plates/tubes are stored at 80 C.

(37) cDNA synthesis reactions are then performed. 40 L RT master mix is added to PCR tubes or plate wells. 10 L of RNA is added to each tube/well. The RT thermal cycler program is then run and tubes or plate wells are incubated at 37 C. for 1 hour, then at 95 C. for 5 minutes to deactivate the enzyme.

(38) The qPCR is performed using a QuantStudio 6 instrument (ThermoFisher) and the following cycling conditions and according to the tables below. All samples and standards are analyzed in triplicate. Cycle 1: 2 minutes at 50 C. Cycle 2: 10 minutes at 95 C. Cycle 3 (repeat 40 times): 15 seconds at 95 C., 1 minute at 60 C.

(39) SMN2.sup.FL or SMN2.sup.7 Standard Samples

(40) TABLE-US-00021 Component Per qPCR well 2x TaqMan Gene Expression Master Mix 10 L 40x SMN2.sup.FL or SMN2.sup.7 probe/primer 0.5 L Nuclease-free water 4.5 L Standard DNA 5 L
Unknown sample (FOXM1 Isoform A2/FOXM1 Isoform BC Quantitation)

(41) TABLE-US-00022 Component Per qPCR well 2x TaqMan Gene Expression Master Mix 10 L 40x SMN2.sup.FL probe/primer 0.5 L 40x SMN2.sup.7 probe/primer 0.5 L Nuclease-free water 5 L Sample DNA 4 L
PPIA Standard Sample

(42) TABLE-US-00023 Component Per qPCR well 2x TaqMan Gene Expression Master Mix 10 L 60x PPIA probe/primer 0.33 L Nuclease-free water 4.67 L Standard DNA 5 L
Unknown sample (PPIA quantitation)

(43) TABLE-US-00024 Component Per qPCR well 2x TaqMan Gene Expression Master Mix 10 L 60x PPIA probe/primer 0.33 L Nuclease-free water 5.67 L Sample DNA 4 L

(44) The determined SMN2.sup.7 and SMN2.sup.FL quantities are then be used to determine the SMN2.sup.7:SMN2.sup.FL ratio at the various compound concentrations. The PPIA quantities are used in the normalization to account of cell proliferation effects of the compounds.

(45) Standard Construction

(46) TABLE-US-00025 PPIAstandard(5834bps) GBlocksequence(IDTDNA) (SEQIDNO:95) GAATTCGGCCAGGCTCGTGCCGTTTTGCAGACGCCACCGCCGAGGAAAAC CGTGTACTATTAGCCATGGTCAACCCCACCGTGTTCTTCGACATTGCCGT CGACGGCGAGCCCTTGGGCCGCGTCTCCTTTGAGCTGTTTGCAGACAAGG TCCCAAAGACAGCAGAAAATTTTCGTGCTCTGAGCACTGGAGAGAAAGGA TTTGGTTATAAGGGTTCCTGCTTTCACAGAATTATTCCAGGGTTTATGTG TCAGGGTGGTGACTTCACACGCCATAATGGCACTGGTGGCAAGTCCATCT ATGGGGAGAAATTTGAAGATGAGAACTTCATCCTAAAGCATACGGGTCCT GGCATCTTGTCCATGGCAAATGCTGGACCCAACACAAATGGTTCCCGCGG CCGC

(47) SMN2.sup.FL standard G Block sequence (IDT DNA) are used

(48) SMN2.sup.7 standard G Block sequence (IDT DNA) are used

(49) The G Blocks are inserted into the pCI-neo mammalian expression vector (Promega) at the EcoRI and NotI restriction sites (bolded) using Infusion cloning technology (Clontech). The plasmids are then purified using standard miniprep or maxiprep kits (Macherey Nagel).

(50) Standard Curve Preparation

(51) The dilution to make the top standard is calculated. A top concentration 200,000,000 copies/L of the stock plasmid is prepared in TE buffer. A series of 10-fold dilutions, also in TE, are then made. A total of 5 L of each standard is used in a qPCR well to generate samples containing 10.sup.9 copies, 10.sup.8 copies, 10.sup.7 copies, 10.sup.6 copies, 10.sup.5 copies, 10.sup.4 copies, 10.sup.3 copies, 10.sup.2 copies, 10.sup.1 copies, and 0 copies.

(52) An assay to measure the SMN2.sup.FL mRNA and SMN2.sup.7 mRNA simultaneously in cell wells is performed. The RNA values are measured relative to DMSO control and also included a housekeeping gene, PPIA to ensure data is consistent. The mRNA values are measured after 24 hours of incubation with the SMSM compounds. The SMSMs dose dependently increased the SMN2.sup.FL values while concomitantly decreasing the SMN2.sup.7values at the same with EC.sub.50 and IC.sub.50 values in the nanomolar range.

(53) Additionally, to monitor expression levels of SMN2 splice variant using real-time quantitative PCR, SMA type I patient cells (GM03813 (Coriell)) are plated at 5,000 cells/well in 200 l Dulbecco's modified Eagle's medium (DMEM) with GlutaMAX and 10% fetal bovine serum (FBS) (Life Technologies, Inc.) in 96-well plates, and incubated for 6 hours in a cell culture incubator. Cells are then treated with SMSMs at different concentrations (0.5% DMSO) in duplicate for 24 hours. After removal of the supernatant, cells are lysed in Cells-To-Ct lysis buffer (Life Technologies, Inc.) according to the manufacturer's recommendations. The mRNA levels of SMN2 FL, SMN2 7 are quantified using Taqman-based RT-qPCR and SMN2-specific primers and probes. The SMN2 forward and reverse primers are each used at a final concentration of 0.4 M. The SMN2 probe is used at a final concentration of 0.15 M. RT-qPCR is carried out at the following temperatures for indicated times: Step 1:48 C. (15 min); Step 2: 95 C. (10 min); Step 3: 95 C. (15 sec); Step 4: 60 C. (1 min); Steps 3 and 4 are repeated for 40 cycles. The Ct values for each mRNA are converted to mRNA abundance using actual PCR efficiencies.

Example A3: IKBKAP Splicing Assay

(54) Various cells lines are treated with the SMSMs described herein. RNA is then isolated, cDNA synthesized, qPCR performed and the levels of IKBKAP targets of the SMSMs are determined.

(55) Materials

(56) Cells to Ct kit: ThermoFisher, AM1728. TaqMan Gene Expression Master Mix: ThermoFisher, 4369542. PPIA probe/primer. ThermoFisher, Hs03045993_gH, VIC-MGB_PL.

(57) TABLE-US-00026 Probe/primersequences: IKBKAP IKBKAPWTprobe/primer:IDTDNA Primer1: (SEQIDNO:106) ACCAGGGCTCGATGATGAA Primer2: (SEQIDNO:107) GCAGCAATCATGTGTCCCA Probe: (SEQIDNO:108) /56-FAM/GTTCACGGA/ZEN/TTGTCACTGTTGTGCC/ 3IABkFQ/ IKBKAPMUprobe/primer:IDTDNA Primer1: (SEQIDNO:109) GAAGGTTTCCACATTTCCAAG Primer2: (SEQIDNO:110) CACAAAGCTTGTATTACAGACT Probe: (SEQIDNO:111) /5HEX/CTCAATCTG/ZEN/ATTTATGATCATAACC CTAAGGTG/3IABkFQ/
Protocol

(58) On the day of the experiment, a 96-well plate is seeded with the cell lines of interest. The cells are diluted with full growth media to a concentration of 2.010.sup.5 cells/mL and 100 L of cells are added to each well (20,000 cells per well). The cells are treated with a compound immediately after plating.

(59) The compounds are then added to the cell plate using the HP compound dispenser. In the initial experiment, a top concentration of 10 M and an 8 point 4-fold dilution scheme is used. The stock compounds are made at a concentration of 5 mM, and the DMSO concentration is set to 0.2%. DMSO is used to normalize all the compound-containing wells and the untreated cells.

(60) The treated cells are incubated at 37 C. in a 5% CO.sub.2 incubator for the desired amount of time. Plates are placed in a plastic bag with a wet paper towel to prevent evaporation.

(61) RNA is isolated using the Cells to CT kit (ThermoFisher, AM1728). The cells are washed once with 100 L cold PBS. 50 L of lysis buffer is added to each well/tube (49.5 L lysis buffer+0.5 L DNase I per well/tube). The lysis reaction is mixed and incubated at room temperature for 5 minutes. 5 L of stop solution is added directly into each cell lysis reaction and mixed by pipetting up and down 5 times. The plates/tubes are incubated at room temperature for 2 minutes then placed on ice if the cDNA synthesis is to be performed immediately. Otherwise, the plates/tubes are stored at 80 C.

(62) cDNA synthesis reactions are then performed. 40 L RT master mix is added to PCR tubes or plate wells. 10 L of RNA is added to each tube/well. The RT thermal cycler program is then run and tubes or plate wells are incubated at 37 C. for 1 hour, then at 95 C. for 5 minutes to deactivate the enzyme.

(63) The qPCR is performed using a QuantStudio 6 instrument (Thermofisher) and the following cycling conditions and according to the tables below. All samples and standards are analyzed in triplicate. Cycle 1: 2 minutes at 50 C. Cycle 2: 10 minutes at 95 C. Cycle 3 (repeat 40 times): 15 seconds at 95 C., 1 minute at 60 C.

(64) IKBKAP.sup.FL or IKBKAP.sup.20 Standard Samples

(65) TABLE-US-00027 Component Per qPCR well 2x TaqMan Gene Expression Master Mix 10 L 40x IKBKAP.sup.FL or IKBKAP.sup.20 probe/primer 0.5 L Nuclease-free water 4.5 L Standard DNA 5 L
Unknown sample (IKBKAP.sup.FL/IKBKAP.sup.20 Quantitation)

(66) TABLE-US-00028 Component Per qPCR well 2x TaqMan Gene Expression Master Mix 10 L 40x IKBKAP.sup.FL probe/primer 0.5 L 40x IKBKAP.sup.20 probe/primer 0.5 L Nuclease-free water 5 L Sample DNA 4 L
PPIA Standard Sample

(67) TABLE-US-00029 Component Per qPCR well 2x TaqMan Gene Expression Master Mix 10 L 60x PPIA probe/primer 0.33 L Nuclease-free water 4.67 L Standard DNA 5 L
Unknown Sample (PPIA Quantitation)

(68) TABLE-US-00030 Component Per qPCR well 2x TaqMan Gene Expression Master Mix 10 L 60x PPIA probe/primer 0.33 L Nuclease-free water 5.67 L Sample DNA 4 L

(69) The determined IKBKAP.sup.FL and IKBKAP.sup.20 isoform quantities are then used to determine the IKBKAP.sup.FL:IKBKAP.sup.20 ratio at increasing SMSM compound concentrations. The PPIA quantities are used in the normalization to account of cell proliferation effects of the compounds.

(70) Standard construction

(71) TABLE-US-00031 PPIAstandard(5834bps) GBlocksequence(IDTDNA (SEQIDNO:95) GAATTCGGCCAGGCTCGTGCCGTTTTGCAGACGCCACCGCCGAGGAAAAC CGTGTACTATTAGCCATGGTCAACCCCACCGTGTTCTTCGACATTGCCGT CGACGGCGAGCCCTTGGGCCGCGTCTCCTTTGAGCTGTTTGCAGACAAGG TCCCAAAGACAGCAGAAAATTTTCGTGCTCTGAGCACTGGAGAGAAAGGA TTTGGTTATAAGGGTTCCTGCTTTCACAGAATTATTCCAGGGTTTATGTG TCAGGGTGGTGACTTCACACGCCATAATGGCACTGGTGGCAAGTCCATCT ATGGGGAGAAATTTGAAGATGAGAACTTCATCCTAAAGCATACGGGTCCT GGCATCTTGTCCATGGCAAATGCTGGACCCAACACAAATGGTTCCCGCGG CCGC IKBKAPWT(5639bps) (SEQIDNO:112) GAATTCCTTCATTTAAAACATTACAGGCCGGCCTGAGCAGCAATCATGTG TCCCATGGGGAAGTTCTGCGGAAAGTGGAGAGGGGTTCACGGATTGTCAC TGTTGTGCCCCAGGACACAAAGCTTGTATTACAGATGCCAAGGGGAAACT TAGAAGTTGTTCATCATCGAGCCCTGGTTTTAGCTCAGATTCGGAAGTGG TGCGGCCGC IKBKAPMU(5645bps) (SEQIDNO:113) GAATTCCGGATTGTCACTGTTGTGCCCCAGGACACAAAGCTTGTATTACA GACTTATGTTTAAAGAGGCATTTGAATGCATGAGAAAGCTGAGAATCAAT CTCAATCTGATTTATGATCATAACCCTAAGGTGTTTCTTGGAAATGTGGA AACCTTCATTAAACAGATAGATTCTGTGAATCATATTAACTTGTTTTTTA CAGAATTGCGGCCGC

(72) The G Blocks are inserted into the pCI-neo mammalian expression vector (Promega) at the EcoRI and NotI restriction sites (bolded) using Infusion cloning technology (Clontech). The plasmids are then purified using standard miniprep or maxiprep kits (Macherey Nagel).

(73) Standard Curve Preparation

(74) The dilution necessary to make the top standard is calculated. A top concentration 200,000,000 copies/L of the stock plasmid is prepared in TE buffer. A series of 10-fold dilutions, also in TE, are then made. A total of 5 L of each standard is used in a qPCR well to generate samples containing 10.sup.9 copies, 10.sup.8 copies, 10.sup.7 copies, 10.sup.6 copies, 10.sup.5 copies, 10.sup.4 copies, 10.sup.3 copies, 10.sup.2 copies, 10.sup.1 copies, and 0 copies.

(75) An assay to measure the IKBKAP.sup.FL mRNA and IKBKAP.sup.20 mRNA simultaneously in cell wells is performed. The RNA values are measured relative to DMSO control and also included a housekeeping gene, PPIA to ensure data is consistent. The mRNA values are measured after 24 hours of incubation with the SMSM compounds.

Example A4: Cell Viability and Proliferation

(76) Small molecule splicing modulators are tested in a dose-response assay using different cancer cell lines. Cells are first plated in 96-well plastic tissue culture plates (10,000 cells per well). The cells are treated with 500 nM of SMSM or vehicle alone (DMSO) for 48 hours. Following treatment, the cells are washed with PBS, stained with a crystal violet staining solution, and allowed to dry for 48-72 hrs. After drying, sodium citrate buffer is added to each well and allowed to incubate for 5 min at room temperature. The absorbance is measured at 450 nM using a microplate reader (Biorad; Hercules, CA). The relative cell proliferation for each of the cancer cell lines is determined.

(77) To measure cell viability, cells are plated in 96-well plastic tissue culture plates at a density of 510.sup.3 cells/well. Twenty-four hours after plating, cells are mated with various SMSMs. After 72 hours, the cell culture media are removed and plates are stained with 100 mL/well of a solution containing 0.5% crystal violet and 25% methanol, rinsed with deionized water, dried overnight, and resuspended in 100 mL citrate buffer (0.1 M sodium citrate in 50% ethanol) to assess plating efficiency. Intensity of crystal violet staining, assessed at 570 nm and quantified using a Vmax Kinetic Microplate Reader and Softmax software (Molecular Devices Corp., Menlo Park, CA), are directly proportional to cell number. Data are normalized to vehicle-treated cells and are presented as the meanSE from representative experiments. SMSMs that are effective are determined for various cells lines.

(78) Small molecule splicing modulators are tested in a dose-response assay using cancer cells and NHDF cells.

(79) Cancer cells or NHDF cells are first plated in 96-well plastic tissue culture plates (10,000 cells per well). The cells are treated with vehicle alone (DMSO), or increasing concentrations of SMSM compounds for 72 h. Following treatment, cell proliferation is determined using a crystal violet assay. The relative cell proliferation at each concentration is determined.

Example A5: Monitoring Expression Levels of FOXM1 Splice Variants Using Real-Time Quantitative PCR

(80) Human fibroblasts are plated at 10,000 cells/well in 200 L DMEM with GlutaMAX and 10% FBS in 96-well plates in a cell culture incubator (37 C., 5% CO.sub.2. 100% relative humidity). Cells are then treated with SMSMs at different concentrations (0.1-1000 nM, each in 0.5% DMSO) in triplicate for 24 hours. RNA extraction is performed as per instructions in the Cells-to-CT Kits (Ambion, Applied Biosystems). RNA samples are frozen at 20 C. until further analysis. Relative expression levels of full-length FOXM1 (FOXM1.sup.FL) or FOXM1 lacking exon Vila (FOXM1.sup.VIIa) with GAPDH for internal control, is measured using one-step multiplex reverse transcription-polymerise chain reaction (RT-PCR). TagMan FAM probes are used for relative quantitation of FOXM1.sup.FL or FOXM1.sup.VIIa expression levels and TagMan VIC probes are used for relative quantitation of human GAPDH levels. The fidelity of the amplification methods is determined using the Ct relative quantification method for quantitative PCR.

Example A6: Maximum Tolerable Dose Study

(81) Survival of mice after administration of SMSMs after 10 or 11 days is assessed.

(82) Tolerance of the drug treatments is determined by measuring the weight of the mice during the period of drug administration. Body weight is measured prior to tumor inoculation and prior to the treatment administration and then daily. The changes in the final weight of the mice for the SMSM treatments are determined.

Example A7: Dose Range and Time Course Studies

(83) Dose range and time course studies comparing anti-neoplastic effects of SMSMs against vehicle are conducted.

(84) Exemplary experimental groups used for this study are shown in the table below.

(85) TABLE-US-00032 Group Dose Dosing Route of # Group Treatment (mg/kg) Schedule Administration Mice 1 Vehicle NA QDx14 PO 10 2 SMSM 3 mg/kg BIDx14 IP 10 3 SMSM 5 mg/kg BIDx14 PO 10 4 SMSM 7.5 mg/kg BIDx14 PO 10 5 SMSM 10 mg/kg QDx14 PO 10

(86) Female NCrNu mice are used. Age range of enrolment is 7-10 weeks. A total of 75 animals are for the studies.

(87) Each mouse are inoculated into a right flank with the single cell suspension of 95% viable tumor cells (510.sup.6 cells/mouse) in serum-free RPMI 1640 Media for tumor development. Treatments are administered when mean tumor size reached approximately 75 mm.sup.3.

(88) An acclimation period of a minimum of 72 hrs is allowed between animal receipt and tumor inoculation in order to accustom the animals to the laboratory environment. Immunodeficient NCrNu mice are maintained in a pathogen-free environment. Animals are fed a diet of Irradiated Mouse pellet feed Purina rodent diet #5053 (Fisher Feeds, Bound Brook, Ni) and chlorinated water from a reverse osmosis (RO) system (4-6 ppm).

(89) Before commencement of treatment, all animals are weighed and assigned to treatment groups using a randomization procedure. Mice are randomized into groups based upon their tumor sizes to ensure that each group had approximately the same mean tumor size and range of tumor size.

(90) After inoculation, the animals are checked daily for morbidity and mortality. At the time of routine monitoring, the animals are checked for any effects of tumor growth on normal behavior such as mobility, food and water consumption, body weight gain/loss, eye/hair matting and any other abnormal effects. Deaths and observed clinical signs are recorded. Animals that are observed to be in a continuing deteriorating condition or bearing a tumor exceeding 2,000 mm.sup.3 in size are euthanized.

(91) Body weight is measured prior to tumor inoculation and prior to the treatment administration and then daily. Tumor size are measured 2-3 times per week in two dimensions using a caliper, and the volume are expressed in mm.sup.3 using the formula: V=0.5ab.sup.2 where a and b are the long and short diameters of the tumor, respectively.

(92) Studies are terminated when the tumor size in the vehicle treated group reached 2,000 mm.sup.3. Each mouse is bled at 2 hrs after the last dose and at least 50 l of plasma are collected from each mouse. All of the collected plasma samples and retainer dosing solutions for each dose level are used for bioanalytical measurements. All tumors are also collected and weighed One necrosis-free tumor fragment of approximately 50 mg is taken from each tumor and flash-frozen for RNA isolation. The remaining tumor is flash frozen for PK analysis.

Example A8: In Vivo SMSM Treatment Effect on Inhibition of Tumor Growth

(93) Studies are performed to assess the effects of in vivo SMSM treatment on various tumors. Studies are also performed to assess the effects of in vivo SMSM treatment on mRNA levels. Immunocompromised nude mice with pre-existing cancer xenografts are treated with vehicle or SMSMs. Tumor tissues from subcutaneous xenografts are broken into a powder using a BioPulverizer (Biospec Products, Inc.). After SMSM treatment, mRNA is isolated from the xenografts and is analyzed by qRT-PCR.

(94) Tumor size is measured 2 times per week in two dimensions using a caliper. Studies are terminated when the tumor size in the vehicle treated group reached 2,000 mm.sup.3. Each mouse is bled at 2 hrs after the last dose and at least 50 l of plasma is collected from each mouse. All of the collected plasma samples and retainer dosing solutions for each dose level are used for bioanalytical measurements. All tumors are also collected and weighed. One necrosis-free tumor fragment of approximately 50 mg is taken from each tumor and flash-frozen for RNA isolation. The remaining tumor is flash frozen for PK analysis.

(95) The effects of in vivo SMSM treatments on pre-existing subcutaneous cancer xenografts are assessed. For these in vivo experiments, 110.sup.6 cancer cells (cells re-suspended in 100 l PBS are subcutaneously injected into the flanks of nude mice. When the tumor reached approximately 100 mm.sup.3 (volume=()()(length/2)(width/2).sup.2), the SMSM treatments are initiated.

Example A9: Quantitative Splicing Assay (HTT)

(96) GM04724 (CAG 70/20) Huntington's disease patient lymphoblasts (Coriell) are plated in 96-well v-bottom plates at 50,000 cells/well. Immediately after plating, cells are dosed with compound for 24 h at concentrations ranging from 2.5 uM to 0.15 nM (0.1% DMSO). Treated cells are lysed and cDNA synthesized using the Fast Advanced Cells-to-Ct kit (Thermofisher A35378) according to the manufacturer's instructions. 2 uL of each cDNA are used in qPCR reactions to confirm the compound-induced inclusion of a cryptic exon within intron 49 of the Huntingtin (HTT) transcripts. The qPCR reactions are prepared in 384-well plates in 10 uL volume, using TagMan Fast Advanced Master Mix [ThermoFisher, 4444965] with primers and probes shown in the table below. Reactions are run in a Quant studio 6 qPCR instrument with default settings.

(97) TABLE-US-00033 Probe/primersequences: HTTcryp49b-FAM: Probe: (SEQIDNO:114) 5CAGCAGAGCCCTGTCCTG3 Primer1: (SEQIDNO:115) 5CCCACAGCGCTGAAGGA3 Primer2: (SEQIDNO:116) 5TCCAGACTCAGCGGGATCT3 HTTex49_50-FAM: Probe: (SEQIDNO:117) 5TGGCAACCCTTGAGGCCCTGT3 Primer1: (SEQIDNO:118) 5CCTCCTGAGAAAGAGAAGGACA3 Primer2: (SEQIDNO:119) 5TCTGCTCATGGATCAAATGCC3 TBP-YAK(endogenouscontrol) Probe: (SEQIDNO:120) 5CCGCAGCTGCAAAATATTGTATCCACA3 Primer1: (SEQIDNO:121) 5TCGGAGAGTTCTGGGATT3 Primer2: (SEQIDNO:122) 5AAGTGCAATGGTCTTTAGGT3

Example A10: mHTT Protein Assay

(98) Compounds are tested on GM04724 (CAG 70/20) Huntington's disease patient lymphoblast cells at doses ranging from 10 M to 0.6 nM. 4,500 cells/well are seeded in 384 well plates. One plate replica is carried out for parallel viability testing by CellTiter Glo (CTG). Compounds are incubated for 48 hours. mHTT protein levels are assessed by the 2B7-MW1 assay via Mesoscale Discovery (MSD) as previously reported (Macdonald et al., 2014). The antibody pair is comprised of previously characterized monoclonals (2B7 and MW1) interrogating two regions for HTT conformation and biological properties: the N, 17 domain and the polyQ domain (Baldo et al., 2012; Ko et., 2001). 2B7-MW1 is dependent on subject/animal specific levels of HTT at the time of treatment. 2B7-MW1 is dependent on polyQ expansion (e.g., the higher the expansion the higher the signal) and on mHTT size (e.g., a similar polyQ will give higher signal with smaller HTT size). The viability readout is carried out by CTG according to the manufacturer's instructions.

Example A11: Quantitative Splicing Assay (SMN)

(99) Spinal muscular atrophy (SMA) patient fibroblasts (GM03813, Coriell) are plated in 96-well plates at 50,000 cells/well. Immediately after plating, cells are dosed with compounds for 24 h at concentrations ranging from 2.5 M to 0.6 nM (0.1% DMSO). Treated cells are lysed and cDNA synthesized using the Fast Advanced Cells-to-Ct kit (Thermofisher A35378) according to the manufacturer's instructions. 2 L of each cDNA are used in qPCR reactions. The qPCR reactions are prepared in 384-well plates in 10 L volume, using TagMan Fast Advanced Master Mix (ThermoFisher, 4444%5) with primers and probes shown in the table below. Reactions are run in a Quant Studio 6 qPCR instrument with default settings.

(100) TABLE-US-00034 Probe/primersequences: SMNFL-FAM: Probe: (SEQIDNO:105) 5CTGGCATAGAGCAGCACTAAATGACACCAC3 Primer1: (SEQIDNO:102) 5GCTCACATTCCTTAAATTAAGGAGAAA3 Primer2: (SEQIDNO:104) 5TCCAGATCTGTCTGATCGTTTCTT3 SMN7-FAM: Probe: (SEQIDNO:105) 5CTGGCATAGAGCAGCACTAAATGACACCAC3 Primer1: (SEQIDNO:103) 5TGGCTATCATACTGGCTATTATATGGAA3 Primer2: (SEQIDNO:104) 5TCCAGATCTGTCTGATCGTTTCTT3 TBP-YAK(endogenouscontrol) Probe: (SEQIDNO:120) 5CCGCAGCTGCAAAATATTGTATCCACA3 Primer1: (SEQIDNO:121) 5TCGGAGAGTTCTGGGATT3 Primer2: (SEQIDNO:122) 5AAGTGCAATGGTCTTTAGGT3

Example A12: SMN Protein Assay

(101) Compounds are tested on spinal muscular atrophy (SMA) patient fibroblasts (GM03813, Coriell) at doses ranging from 2.5 M to 0.6 nM. 7000 cells/well are seeded in 96-well plates. Compounds are incubated for 48 hours and the cells were lysed with 100 L of lysis buffer. 20 L of lysate is used for SMN protein measurement by Mesoscale Discovery (MSD) assay developed by PharmOptima (Michigan). A standard curve prepared with SMN protein ranging from 1 g/ml to 19.5 pg/ml is used in each MSD plate to calculate the absolute SMN protein amount in each sample.

(102) One plate with 700 cells/well is prepared for parallel viability testing by Cell Tier Glo reagents (Promega, G7572/G7573 (CTG). The viability readout is carried out according to the manufacturer's instructions.

Example A13: Assessment of Blood-Brain-Barrier (BBB) Penetration Potential Via an MDCK-MDR1 Permeability Assay

(103) The permeability of compounds is assessed for BBB penetration potential by use of an MDCK-MDR1 assay (Catalog EA203) performed by Absorption Systems, Exton PA. See, Evaluation of the MDR-MDCK cell line as a permeability screen for the blood-brain barrier, Wang, Q. Rager, J. D.; Weinstein, K.; Kardos, P. S.; Dobson, G. L.; Li, J.; Hidalgo, I. J.

(104) Experimental Procedure: MDR1-MDCK cell monolayers are grown to confluence on collagen-coated, microporous membranes in 12-well assay plates. The permeability assay buffer is Hanks' balanced salt solution containing 10 mM HEPES and 15 mM glucose at a pH of 7.4. The buffer in the receiver chamber also contained 1% bovine serum albumin. The dosing solution concentration is 5 M of test article in the assay buffer. Cell monolayers are dosed on the apical side (A-to-B) or basolateral side (B-to-A) and incubated at 37 C. with 5% CO.sub.2 in a humidified incubator. Samples are taken from the donor and receiver chambers at 120 minutes. Each determination is performed in duplicate. The flux of lucifer yellow is also measured post-experimentally for each monolayer to ensure no damage is inflicted to the cell monolayers during the flux period. All samples are assayed by LC-MS/MS using electrospray ionization. Analytical conditions are outlined below.

(105) The apparent permeability (P.sub.app) and percent recovery are calculated as follows:

(106) $\begin{array}{cc}{P}_{\mathrm{app}}=\left({\mathrm{dC}}_r\text{/}\mathrm{dt}\right)V_r\text{/}\left(A{C}_A\right)& \left(1\right)\\ \mathrm{Percent}\mathrm{Recovery}=100\left(\left(V_r{C}_r^{\mathrm{final}}\right)+\left(V_d{C}_d^{\mathrm{final}}\right)\right)\text{/}\left(V_d{C}_N\right)& \left(2\right)\end{array}$ where, dC.sub.r/dt is the slope of the cumulative concentration in the receiver compartment versus time in M s.sup.1; V.sub.r is the volume of the receiver compartment in cm.sup.3; V.sub.d is the volume of the donor compartment in cm.sup.3; A is the area of the insert (1.13 cm.sup.2 for 12-well); C.sub.A is the average of the nominal dosing concentration and the measured 120 minute donor concentration in M; C.sub.N is the nominal concentration of the dosing solution in M; C.sub.r.sup.final is the cumulative receiver concentration in M at the end of the incubation period; C.sub.d.sup.final is the concentration of the donor in M at the end of the incubation period. Efflux ratio (ER) is defined as P.sub.app (B-to-A)/P.sub.app (A-to-B).

(107) Analytical Method: Liquid Chromatography. Column: Waters ACQUITY UPLC BEH Phenyl 30 2.1 mm, 1.7 m; M.P. Buffer. 25 mM ammonium formate buffer, pH 3.5; Aqueous Reservoir (A): 90% water, 10% buffer, Organic Reservoir (B): 90% acetonitrile, 10% buffer, Flow Rate: 0.7 mL/minute; Gradient Program:

(108) TABLE-US-00035 Time (min) % A % B 0.00 99 1 0.65 1 99 0.75 1 99 0.80 99 1 1.00 99 1 Total Run Time: 1.00 minute Autosampler. 2 L injection volume Wash1: water/methanol/2-propanol:1/1/1; with 0.2% formic acid Wash2: 0.1% formic acid in water Brain Penetration Potential Classification: A-B P.sub.app3.0 and Efflux Ratio <3.0: High A-B P.sub.app3.0 and 10Efflux Ratio >3.0: Moderate A-B P.sub.app3.0 and Efflux Ratio10: Low A-B P.sub.app<3.0: Low

B. Chemical Synthesis Examples

(109) Compounds described herein can be synthesized using standard synthetic techniques or using methods known in the art in combination with methods described herein. Unless otherwise indicated, conventional methods of mass spectroscopy, NMR, HPLC, protein chemistry, biochemistry, recombinant DNA techniques and pharmacology can be employed. Compounds can be prepared using standard organic chemistry techniques such as those described in, for example, March's Advanced Organic Chemistry, 6th Edition, John Wiley and Sons, Inc. Alternative reaction conditions for the synthetic transformations described herein may be employed such as variation of solvent, reaction temperature, reaction time, as well as different chemical reagents and other reaction conditions. The starting materials can be available from commercial sources or can be readily prepared. By way of example only, provided are schemes for preparing the Examples described herein.

(110) The following abbreviations are used: DCMdichloromethane; DIPEAN,N-diisopropylethylamine; DMSOdimethyl sulfoxide; DMFN,N-dimethylformamide; EDCIN-(3-Dimethylaminopropyl)-N-ethylcarbodiimide; HOBt1-hydroxybenzotriazole; THF-tetrahydrofuran; Et.sub.2Odiethyl ether, EtOAcethyl acetate; EtOHethyl alcohol; LCMSliquid chromatography mass spectrometer, Msmesylate; MeCNacetonitrile; McOHmethyl alcohol; MTBEmethyl tort-butyl ether; SFCsupercritical fluid chromatography; TMSCltrimethylsilyl chloride; hhour, minminute; rtroom temperature (22-25 C.); ggrams; mLmilliliters; mgmilligrams; mmolmillimoles.

(111) Suitable reference books and treatise that detail the synthesis of reactants useful in the preparation of compounds described herein, or provide references to articles that describe the preparation, include for example, Synthetic Organic Chemistry, John Wiley & Sons, Inc., New York; S. R. Sandler et al., Organic Functional Group Preparations, 2nd Ed., Academic Press, New York, 1983; H. O. House, Modern Synthetic Reactions, 2nd Ed., W. A. Benjamin, Inc. Menlo Park, Calif. 1972; T. L. Gilchrist, Heterocyclic Chemistry, 2nd Ed., John Wiley & Sons, New York, 1992; J. March, Advanced Organic Chemistry: Reactions, Mechanisms and Structure, 4th Ed., Wiley Interscience, New York, 1992. Additional suitable reference books and treatise that detail the synthesis of reactants useful in the preparation of compounds described herein, or provide references to articles that describe the preparation, include for example, Fuhrhop, J. and Penzlin G. Organic Synthesis: Concepts, Methods, Starting Materials, Second, Revised and Enlarged Edition (1994) John Wiley & Sons ISBN: 3 527-29074-5; Hoffman, R.V. Organic Chemistry, An Intermediate Text (1996) Oxford University Press, ISBN 0-19-509618-5; Larock, R. C. Comprehensive Organic Transformations: A Guide to Functional Group Preparations 2nd Edition (1999) Wiley-VCH, ISBN: 0-471-19031-4; March, J. Advanced Organic Chemistry: Reactions, Mechanisms, and Structure 4th Edition (1992) John Wiley & Sons, ISBN: 0-471 60180-2; Otera, J. (editor) Modern Carbonyl Chemistry (2000) Wiley-VCH, ISBN: 3-527-29871-1; Patai, S. Patai's 1992 Guide to the Chemistry of Functional Groups (1992) Interscience ISBN: 0-471-93022-9; Solomon, T. W. G. Organic Chemistry 7th Edition (2000) John Wiley & Sons, ISBN: 0-471-19095-0; Stowell, J.C., Intermediate Organic Chemistry 2nd Edition (1993) Wiley-Interscience, ISBN: 0-471-57456 2; Industrial Organic Chemicals: Starting Materials and Intermediates: An Ullmann's Encyclopedia (1999) John Wiley & Sons, ISBN: 3-527-29645-X, in 8 volumes; Organic Reactions (1942-2000) John Wiley & Sons, in over 55 volumes; and Chemistry of Functional Groups John Wiley & Sons, in 73 volumes.

(112) In the reactions described, it may be necessary to protect reactive functional groups, for example hydroxy, amino, imino, thio or carboxy groups, where these are desired in the final product, in order to avoid their unwanted participation in reactions. A detailed description of techniques applicable to the creation of protecting groups and their removal are described in Greene and Wuts, Protective Groups in Organic Synthesis, 3rd Ed., John Wiley & Sons, New York, NY, 1999, and Kocienski, Protective Groups, Thieme Verlag, New York, NY, 1994, which are incorporated herein by reference for such disclosure).

(113) Examples can be made using known techniques and further chemically modified, in some embodiments, to facilitate intranuclear transfer to, e.g., a splicing complex component, a spliceosome or a pre-mRNA molecule. One of ordinary skill in the art will appreciate the standard medicinal chemistry approaches for chemical modifications for intranuclear transfer (e.g., reducing charge, optimizing size, and/or modifying lipophilicity).

(114) In some embodiments, the compounds made in the examples below are made from racemic starting materials (and/or intermediates) and separated into the individual enantiomers by chiral chromatography as final products or intermediates. Unless otherwise stated, it is understood that the absolute configuration of the separated intermediates and final compounds as drawn is arbitrarily assigned and was not determined.

(115) The following examples are provided for illustrative purposes only and not to limit the scope of the claims provided herein. The starting materials and reagents used for the synthesis of the compounds described herein may be synthesized or can be obtained from commercial sources, such as, but not limited to, Sigma-Aldrich, Acros Organics, Fluka, and Fischer Scientific.

(116) Stereochemistry: () indicates that the product is a racemic mixture of enantiomers. For example (f) (1S,2S,3R,5R) indicates that the relative product stereochemistry shown is based on known stereochemistry of similar compounds and or reactions and the product is a racemic mixture of enantiomers of both (1S,2S,3R,5R) and (1R,2R,3S,5S) stereoisomers.

(117) A compound in which the absolute stereochemistry of separated enantiomers is undetermined is represented as being either of the single enantiomers, for example (1S,2S,3R,5R) or (1R,2R,3S,SS) or drawn as being either possible single enantiomer. In such cases, the product is pure and a single enantiomer, but absolute stereochemistry is not identified, but relative stereochemistry is known and indicated.

Example B1. Synthesis and List of Boronic Acid Intermediates

(118) ##STR00322## ##STR00323##

Synthesis of (4-oxo-4,5-dihydrothieno[3,2-c]pyridin-2-yl)boronic acid (B1)

(119) ##STR00324##

(120) i-PrMgCl.Math.LiCl (20 mL, 26.08 mmol) was added drop wise into a solution of 2-bromothieno[3,2-c]pyridin-4(5H)-one (1 g 4.34 mmol) in THE (15 mL) at 0 C., and the resulting reaction mixture was stiffed for 1 h then was allowed to warm to room temperature. Then (MeO).sub.3B (895 mg, 8.69 mmol) was added and the reaction mixture was stirred overnight. HCl/dioxane was added to quench the reaction, the reaction mixture was concentrated and purified by silica gel chromatography (4% MeOH in DCM) to obtain the title compound. LCMS: mix 245.1 [M+H].sup.+; 1.14 min.

Synthesis of 6-methoxy-7-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)isoquinoline (B2)

(121) ##STR00325##

(122) Step 1: Synthesis of 7-bromo-6-methoxyisoquinoline. 2,2-dimethoxyethanamine (3.7 g, 34.9 mmol) and Na.sub.2SO.sub.4 (3.3 g, 23.3 mmol) were added to a stirred solution of 3-bromo-4-methoxybenzaldehyde (5 g, 23.3 mmol) in 50 mL of toluene. The reaction mixture was heated to reflux for 6 h using a Dean-stark apparatus. Solvent and excess reagents were distilled off. The crude product was dissolved in THE (50 mL). ClCOOCH.sub.3 (2.2 g, 23.3 mmol) was added dropwise at 0 C. After stirring for 5 min, P(OEt).sub.3 (4.6 g, 27.9 mmol) was added dropwise. The mixture was stirred for 18 h at room temperature. Then the solvents were distilled off. Excess reagents were removed by repeated addition of toluene and evaporation of the solvents. TiCl.sub.4 (17.6 g, 93.0 mmol) and CHCl.sub.3 (25 mL) were added. The mixture was heated to reflux for 48 h. The mixture was poured on ice and the pH was adjusted to 9 by using aqueous ammonia. The resulting mixture was extracted with EtOAc followed by removal off the solvents. The residue was purified by flash silica gel column chromatography (0-70% EtOAc/petroleum ether) to give the title compound (1.3 g, 16% yield) as a white solid. LCMS: m/z 240.0 [M+H].sup.+; t.sub.R=1.38 min.

(123) Step 2: Synthesis of 6-methoxy-7-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)isoquinoline (B2). A mixture of 7-bromo-6-methoxyisoquinoline (200 mg, 0.844 mmol), 4,4,4,4,5,5,5,5-octamethyl-2,2-bi(1,3,2-dioxaborolane) (321 mg, 1.266 mmol), Pd(dppf)Cl.sub.2 (124 mg, 0.169 mmol) and KOAc (166 mg, 1.69 mmol) in 1,4-dioxane (7 mL) was degassed and stirred at 105 C. for 8 h under N.sub.2 protection. The reaction was cooled to room temperature and the resulting solution of crude boronic ester was used directly in the following step. LCMS: m/z 286.0 [M+H].sup.+; t.sub.R=1.80 min.

Synthesis of 1-bromo-4-iodo-2-(methoxymethoxy)benzene (B3)

(124) ##STR00326##

(125) Step 1: Synthesis of 1-bromo-4-Bodo-2-(methoxymethoxy)benzene. MOMBr (1.25 g, 10 mmol) was added to a stirred solution of 2-bromo-5-iodophenol (1.5 g, 5 mmol) and K.sub.2CO.sub.3 (1.38 g, 10 mmol) in 20 mL of DMF at 0 C. The mixture was then stirred at room temperature for 16 h, quenched with 20 mL of H.sub.2O and extracted with EtOAc (20 mL3). The combined organic solvents were dried over anhydrous Na.sub.2SO.sub.4, concentrated and purified by silica gel column (0-5% EtOAc/petroleum ether) to give of 1-bromo-4-iodo-2-(methoxymethoxy)benzene as colorless liquid (1.45 g, 79% yield). LCMS: t.sub.R=1.50 min.

(126) Step 2: Synthesis of 4-(4-bromo-3-(methoxymethoxy)phenyl)-1-(tetrahydro-2H-pyran-2-yl)-1H-pyrazole. A mixture of 1-bromo-4-iodo-2-(methoxymethoxy)benzene (3.3 g, 9.6 mmol), 1-(tetrahydro-2H-pyran-2-yl)-4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1H-pyrazole (2.67 g, 9.6 mmol), Pd(dppf)Cl.sub.2 (866 mg, 1 mmol) and K2CO.sub.3 (2.66 g, 19.3 mmol) in 40 mL of dioxane and 4 mL of H.sub.2O was degassed and stirred at 105 C. for 8 h. After cooling to room temperature, the mixture was extracted with EtOAc (30 mL3). The combined organic solvents were concentrated and purified by silica gel column (10-50% EtOAc/petroleum ether) to give 4-(4-bromo-3-(methoxymethoxy)phenyl)-1-(tetrahydro-2H-pyran-2-yl)-1H-pyrazole as colorless oil (2.5 g, 69% yield). LCMS: m/z 367.1 [M+H].sup.+; t.sub.R=2.03 min.

(127) Step 3: Synthesis of 4-(3-(methoxymethoxy)-4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenyl)-1-(tetrahydro-2H-pyran-2-yl)-1H-pyrazole (B3). A mixture of 4-(4-bromo-3-(methoxymethoxy)phenyl)-1-(tetrahydro-2H pyran-2-yl)-1H-pyrazole (1.5 g, 4.1 mmol), 4,4,4,4,5,5,5,5-octamethyl-2,2-bi(1,3,2-dioxaborolane) (2.1 g, 8.2 mmol), Pd(dppf)Cl.sub.2 (369 mg, 0.41 mmol) and KOAc (804 mg, 8.2 mmol) in 20 mL of dioxane was degassed and stirred at 105 C. for 8 h. The mixture was filtered, concentrated, and purified by silica gel column to give 4-(3-(methoxymethoxy)-4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenyl)-1-(tetrahydro-2H-pyran-2-yl)-1H-pyrazole as colorless oil (0.81 g, 48% yield). LCMS: m/z 415.3 [M+H].sup.+; t.sub.R=2.10 min.

Synthesis of 5-methoxy-N,N-dimethyl-6-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)benzofuran-2-carboxamide (B4)

(128) ##STR00327##

(129) Step 1: Synthesis of 6-bromo-5-methoxybenzofuran-2-carboxyl c acid. Into a 40-mL sealed tube, was placed ethyl 6-bromo-5-methoxybenzofuran-2-carboxylate (2.00 g, 6.68 mmol, 1.00 equiv), THE (20 mL), H.sub.2O (2.0 mL), and LiOH (0.46 g, 19.2 mmol, 2.87 equiv). The resulting solution was stirred for 1 h at room temperature. The pH value of the solution was adjusted to pH 2 with HCl (2 mol/L). The resulting solution was extracted with ethyl acetate, dried over anhydrous sodium sulfate, and concentrated. This resulted in the title compound (1.5 g, 80%) as an off-white solid.

(130) Step 2: Synthesis of 6-bromo-5-methoxy-N,N-dimethylbenzofuran-2-carboxamide. To a solution of dimethylamine hydrochloride (0.40 g, 5.0 mmol, 1.0 equiv) in DMF (20 mL) was added Et.sub.3N (1.52 g, 15.0 mmol, 3 equiv), the reaction mixture was stirred at room temperature for IS min. Then 6-bromo-5-methoxybenzofuran-2-carboxylic acid (1.50 g, 5.0 mmol, 1 equiv) and HATU (2.28 g, 5.0 mmol, 1.2 equiv) was added and the reaction mixture was stirred for 3 h. The resulting mixture was diluted with water (30 mL) and the aqueous layer was extracted with ethyl acetate (20 mL2). The combined organic layers were washed with brine (30 mL5) and dried over anhydrous Na.sub.2SO.sub.4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluting with petroleum ether/ethyl acetate (100:11:1) to afford the title compound (1.33 g, 90%) as a white solid.

(131) Step 3: Synthesis of 5-methoxy-N,N-dimethyl-6-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1-benzofuran-2-carboxamide (B4). To a solution of 6-bromo-5-methoxy-N,N-dimethyl-1-benzofuran-2-carboxamide (800 mg, 2.68 mmol, 1.0 equiv) and 4,4,4,4,5,5,5,5-octamethyl-2,2-bi(1,3,2-dioxaborolane) (1.02 g, 4.025 mmol, 1.5 equiv) in dioxane (10 mL) was added Pd(dppf)Cl.sub.2 (196 mg, 0.268 mmol, 0.10 equiv) and KOAc (790 mg, 8.10 mmol, 3.0 equiv). After stirring for 3 h at 100 C. under a nitrogen atmosphere, the reaction was quenched by the addition of 50 mL of water. The resulting solution was extracted with 350 mL of ethyl acetate, dried over anhydrous sodium sulfate, and concentrated under reduced pressure to afford the title compound (1.5 g). The crude product was used directly in the next step without further purification.

Synthesis of 2-(3-(methoxymethoxy)-(4,4tetramethyl-1,3,2-dioxaborolan-2-yl)phenyl)-5-methyloxazole (B5)

(132) ##STR00328##

(133) Step 1: Synthesis of 4-bromo-3-hydroxy-N-(prop-2-yn-1-yl)benzamide. To a solution of prop-2-yn-1-amine (1.52 g, 27.7 mmol), HATU (10.5 g, 27.7 mmol), DIPEA (5.96 g, 46.08 mmol) in 50 mL of DMF was added 4-bromo-3-hydroxybenzoic acid (5 g, 23.04 mmol). The mixture was then stirred at room temperature overnight, quenched with 100 mL of LiCl (aqueous solution), and extracted with EtOAc (50 mL3). The combined organic solvents were washed with brine, and dried over anhydrous Na.sub.2SO.sub.4, and concentrated in vacuum to afford the title compound (5.8 g, 100% yield) as yellow solid (100% yield). LCMS: m/z 255.1 [M+H].sup.+; t.sub.R=1.59 min.

(134) Step 2: Synthesis of 2-bromo-5-(5-methyloxazol-2-yl)phenol. FeCl.sub.3 (1.80 mg, 11.07 mmol) was added to a stirred solution of 4-bromo-3-hydroxy-N-(prop-2-yn-1-yl)benzamide (5.60 g, 22.1 mmol) in 50 mL of 1,2-dichloroethane at room temperature. The mixture was then stirred at 80 C. for 2 h, quenched with 100 mL of H.sub.2O, and extracted with EtOAc (50 mL3). The combined organic solvents were dried over anhydrous Na.sub.2SO.sub.4, concentrated, and purified by silica gel column (0-16% methanol/dichloromethane) to give the title compound (3.20 g, 57.1% yield) as a white solid. LCMS: m/z 255.1 [M+H].sup.+; t.sub.R=1.87 min.

(135) Step 3: Synthesis of 2-(4-bromo-3-methoxymethoxy)phenyl)-5-methyloxazol. NaH (1.32 g, 33.2 mmol, 60% in mineral oil) was added to a stirred solution of 2-bromo-5-(5-methyloxazol-2-yl)phenol (2.10 g, 8.3 mmol) in 30 mL of THE at room temperature over 30 mins, bromo(methoxy)methane (1555 mg, 12.45 mmol) was added and mixture was then stirred at room temperature for 1 h, quenched with 30 mL of H.sub.2O, and extracted with EtOAc (20 mL3). The combined organic solvents were dried over anhydrous Na.sub.2SO.sub.4, concentrated, and purified by silica gel column (0-38% ethyl acetate/petroleum ether) to afford the title compound as a yellow liquid (3.70 g, 98.7% yield). LCMS: m/z 298.1 [M+H].sup.+; t.sub.R=2.12 min.

(136) Step 4: Synthesis of 2-(3-(methoxymethoxy)-4 (4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenyl)-S-methyloxazol (B5). To a solution of AcOK (2.38 g, 24.24 mmol), Pd(dppf)Cl.sub.2 (1.77 g, 2.42 mmol), 4,4,4,4,5,5,5,5-octamethyl-2,2-bi(1,3,2-dioxaborolane) (6.16 g, 24.24 mmol) in 40 mL of dioxane was added 2-(4-bromo-3-(methoxymethoxy) phenyl)-5-methyloxazole (3.60 g, 12.12 mmol). The mixture was then stirred at 100 C. for 2 h, concentrated, and purified by silica gel column (0-15% Ethyl acetate/Petroleum ether) to give the title compound (4.20 g, 90% yield) as yellow solid (90% yield). LCMS: m/z 346.1 [M+H].sup.+; t.sub.R=2.20 min.

Synthesis of 1-(3-hydroxy-4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenyl)-1H-imidazole-4-carbonitrile (B6)

(137) ##STR00329##

(138) Step 1: Synthesis of 1-(3-hydroxy-4-nitrophenyl)-1H-Imidazole-4-carbonitrile. The mixture of 5-fluoro-2-nitrophenol (4.0 g, 25.4 mmol), 1H-imidazole-4-carbonitrile (3.56 g, 38.2 mol) and Cs.sub.2CO.sub.3 (12.46 g, 38.22 mmol) in 100 mL of DMF was stirred at 120 C. for 16 h. The solid was filtered off, the filtrate was concentrated under vacuum to give 5 g of 1-(3-hydroxy-4-nitrophenyl)-1H-imidazole-4-carbonitrile (68% yield), which was used directly to next step. LCMS: m/z 231.2 [M+H].sup.+; t.sub.R=1.20 min.

(139) Step 2: Synthesis of 1-(4-amla o-3-hydroxyphenyl)-1H-imidazole-4-carbonitrile. A mixture of 1-(3-hydroxy-4-nitrophenyl)-1H-imidazole-4-carbonitrile (4 g, 17.4 mmol), Fe (2.92 g, 52.2 mol) and NH.sub.4Cl (2.8 g, 52.2 mmol) in 40 mL of EtOH and 20 mL of water was stirred at 80 C. for 2 h. The solid was filtered off. The filtrate was concentrated and purified by silica gel chromatography (80% EtOAc/petroleum ether) to give 3.2 g of 1-4-amino-3-hydroxyphenyl)-1H-imidazole-4-carbonitrile. (92% yield). LCMS: m/z 201.2 [M+H].sup.+; t.sub.R=1.28 min.

(140) Step 3: Synthesis of 1-(3-hydroxy-4,4,5,4-tetramethyl-1,3,2-dioxaborolan-2-yl)phenyl)-1H-imidazole-4-carbonitrile (B6). HCl (4.5 mL, 12 N aqueous solution) and water (4.5 mL) was added to the solution of 1-(4-amino-3-hydroxyphenyl)-1H-imidazole-4-carbonitrile (I g, 5.0 mmol) in 18 mL of MeOH at 0 C. NaNO.sub.2 (0.38 g, 5.5 mmol) in water (3 mL) was then added. After stirring at 0 C. for 30 min, 4,4,4,4,5,5,5,5-octamethyl-2,2-bi(1,3,2-dioxaborolane) (2.54 g, 10.0 mmol) was added. The mixture was stirred at room temperature overnight, quenched with H.sub.2O (50 mL) and extracted with CH.sub.2Cl.sub.2 (30 mL3). The combined organic layers were concentrated and purified with silica gel chromatography (0-100% EtOAc/petroleum ether) to give 170 mg of (1-(3-hydroxy-4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenyl)-1H-imidazole-4-carbonitrile (15% yield). LCMS: m/z 230.1 [M+H].sup.+; t.sub.R=1.26 min.

Synthesis of 2-(4-chloro-5-fluoro-2-(methoxymethoxy)phenyl)-4,4,5,5-tetramethyl-1,3,2-dioxaborolane (B7)

(141) ##STR00330##

(142) Step 1: Synthesis of 2-bromo-5-chloro-4-fluorophenol Into a 500-mL 4-necked round-bottom flask purged and maintained with an inert atmosphere of nitrogen, was placed 3-chloro-4-fluorophenol (30.0 g, 205 mmol, 1.0 equiv), CH.sub.2Cl.sub.2 (300 mL), Br.sub.2 (39.2 g, 246 mmol, 1.2 equiv). The resulting solution was stirred overnight at room temperature. The reaction was then quenched by the addition of 500 mL of water/ice. The resulting solution was extracted with 3500 mL of CH.sub.2Cl.sub.2 and the organic layers combined. The resulting mixture was washed with 1500 mL of brine. The mixture was dried over anhydrous sodium sulfate and concentrated under vacuum. The residue was applied onto a silica gel column with ethyl acetate/petroleum ether (0-20%). This resulted in of 2-bromo-5-chloro-4-fluorophenol (25 g, 54.27%) as a yellow solid.

(143) Step 2: Synthesis of 1-bromo-4-chloro-S-fluoro-2-(methoxymethoxy)benzene. Into a 250 mL 3-necked round-bottom flask were added 2-bromo-5-chloro 4-fluorophenol (8.00 g, 35.5 mmol, 1.0 equiv) and THE (110 mL). To the above mixture was added NaH (60 wt %, 1.70 g, 42.5 mmol, 1.2 equiv) in portions at 0 C. The resulting mixture was stirred for additional 30 min, then the above mixture was added bromo(methoxy)methane (8.00 g, 64.0 mmol, 1.8 equiv) dropwise at 0 C. The resulting mixture was stirred for 2 h and allowed to warm to room temperature. The reaction was cooled to 0 C. and quenched by the addition of saturated NH.sub.4Cl aq. (70 mL). The resulting mixture was extracted with EtOAc (350 mL). The combined organic layers were washed with brine (50 mL), dried over anhydrous Na.sub.2SO.sub.4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluting with petroleum ether to afford 1-bromo-4-chloro-5-fluoro-2-(methoxymethoxy)benzene (8.1 g, 84.7%) as a colorless oil.

(144) Step 3: Synthesis of 2-(4-chloro-5-fluoro-2-(methoxymethoxy)phenyl)-4,4,5,5-tetramethyl-1,3,2-diazaborolane (87). Into a 500-mL 3-necked round-bottom flask, was placed a solution of 1-bromo-4-chloro-5-fluoro-2-(methoxymethoxy)benzene (20.0 g, 74.2 mmol, 1.0 equiv) in dioxane (200 mL), bis(pinacolato)diboron (28.3 g, Ill mmol, 1.5 equiv), Pd(dppf)Cl.sub.2 (2.72 g, 3.71 mmol, 0.05 equiv), KOAc (14.6 g, 148 mmol, 2 equiv). The resulting solution was stirred for 3 h at 100 C. The resulting mixture was concentrated and residue was applied onto a silica gel column with ethyl acetate/petroleum ether (3:100). This resulted in 2-[4-chloro-5-fluoro-2-(methoxymethoxy)phenyl]-4,4,5,5-tetramethyl-1,3,2-dioxaborolane (13 g, 55.34%) as a solid.

Synthesis of (2-methoxy-4-(2H-1,2,3-triazol-2-yl)phenyl)boronic acid (B8)

(145) ##STR00331##

(146) Step 1: Synthesis of 4,S-dibromo-2-(3-methoxy-4-nitrophenyl)-2H-1,2,3-triazole. K.sub.2CO.sub.3 (4.04 g, 29.2 mmol) was added to a solution of 4-fluoro-2-methoxy-1-nitrobenzene (5 g, 29.2 mmol) and 4,5-dibromo-2H-1,2,3-triazole (6.63 g, 29.2 mmol) in DMF (100 mL). The resulting mixture was stirred at 80 C. for 16 hours. After cooling to room temperature, the mixture was poured into ice-water (100 mL) and extracted with EtOAc. The organic layers were washed with water (100 mL), dried over anhydrous MgSO.sub.4, concentrated in vacuum to give 4,5-dibromo-2-(3-methoxy-4-nitrophenyl)-2N-1,2,3-triazole (10 g, 97%) as a white solid. LCMS: m/z 378.9 [M+H].sup.+; t.sub.R=1.250 min.

(147) Step 2: Synthesis of 2-methoxy-4-(2H-1,2,3-triazol-2-yl)aniline. Pd/C (1 g 10% on activated carbon) was added to a solution of 4,5-dibromo-2-(3-methoxy-4-nitrophenyl)-2H-1,2,3-triazole (10 g, 26.5 mmol) in MeOH (150 mL). The mixture was stirred under hydrogen atmosphere for 5 h and filtered. The filtrate was concentrated in vacuum to give 2-methoxy-4-(2H-1,2,3-triazol-2-yl)aniline (5 g, yield 98%) as a white solid. LCMS: m/z 191 [M+H].sup.+; t.sub.R=0.574 min.

(148) Step 3: Synthesis of (2-methoxy-4-(2H-1,2,3-triazol-2-yl)phenyl)boronic acid. A pre-cooled (15 C.) solution of t-BuONO (2.61 g, 25.3 mmol) and 2-methoxy-4-(2H-1,2,3-triazol-2-yl)aniline (4.0 g, 21 mmol) in AcOH (80 mL) was added dropwise to a precooled solution of TiOH (3.79 g, 25.3 mmol) in AcOH (80 mL). The reaction was stirred for 10-20 min at 10-15 C., then poured into cold Et.sub.2O (1000 mL). The precipitated diazonium salt was collected by filtration and dried in vacuum to give 2-methoxy-4-(2H-1,2,3-triazol-2-yl)benzenediazonium, trifluoromethanesulfonic salt (7.4 g, yield 95%) as a white solid. LCMS: m/z 202.2 [M+].sup.+; t.sub.R=0.737 min. The 2-methoxy-4-(2H-1,2,3-triazol-2-yl)benzenediazonium, trifluoromethanesulfonic salt (7.4 g, 21 mmol) was dissolved in water (150 mL). Hypodermic acid (4.74 g, 52.7 mmol) was added. The reaction mixture was stirred at 25 C. for 3 h. The precipitate was collected by filtration and dried in vacuum to give (2-methoxy-4-(2H-1,2,3-triazol-2-yl)phenyl)boronic acid (4.6 g, yield 99%) as a white solid. LCMS: m/z 220.2 [M+H].sup.+; t.sub.R=1.127 min.

(149) Step 4: Synthesis of (2-hydroxy-4-(2H-1,2,3-triazol-2-yl)phenyl)boronic acid. BBr.sub.3 (4.6 mL, 18.26 mmol, 4M) was added to a solution of (2-methoxy-4-(2H-1,2,3-triazol-2-yl)phenyl)boronic acid (1000 mg, 4.57 mmol) in DCM (4 mL). The reaction mixture was stirred at 20 C. for 18 h under N2 atmosphere, concentrated in vacuum and purified by silica gel column (10-25% EtOAc/petroleum ether) to give (2-hydroxy-4-(2H-1,2,3-triazol-2-yl)phenyl)boronic acid (450 mg, 59% yield) as a yellow solid. LCMS: m/z 206.2 [M+H].sup.+; t.sub.R=0.898 min.

Synthesis of (4-(4 cyano-1H-Imidazol-1-yl)-2-methoxyphenyl)boronic acid (B9)

(150) ##STR00332##

(151) Step 1: Synthesis of 1-(3-hydroxy-4-nitrophenyl)-1H-imidazole-4-carbonitrile. The mixture of 5-fluoro-2-nitrophenol (4 g, 25.4 mmol), 1H-imidazole-4-carbonitrile (3.56 g, 38.2 mol) and Cs.sub.2CO.sub.3 (12.46 g, 38.2 mmol) in 100 mL of DMF was stirred at 120 C. for 16 h. The solid was filtered off, the filtrate was concentrated under vacuum to give 5 g of 1-(3-hydroxy-4-nitrophenyl)-1H-imidazole-4-carbonitrile (68% yield), which was used directly to next step. LCMS: m/z 231.2 [M+H].sup.+; t.sub.R=1.20 min.

(152) Step 2: Synthesis of 1-(4-amino-3-hydroxyphenyl)-1H-imidazole-4-carbonitrile. A mixture of 1-(3-hydroxy-1-nitrophenyl)-1H-imidazole-4-carbonitrile (4 g, 17.4 mmol), Fe (2.92 g, 52.2 mol) and NH.sub.4Cl (2.8 g, 52.2 mmol) in 40 mL of EtOH and 20 mL of water was stirred at 80 C. for 2 h. The solid was filtered off. The filtrate was concentrated and purified by silica gel chromatography (80% EtOAc/petroleum ether) to give 3.2 g of 1-(4-amino-3-hydroxyphenyl)-1H-imidazole-4-carbonitrile. (92% yield). LCMS: m/z 201.2 [M+H].sup.+; t.sub.R=1.28 mm.

(153) Step 3: Synthesis of 1-(3-hydroxy-4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenyl)-1H-imidazole-4-carbonitrile. HCl (4.5 mL, 12 N aqueous solution) and water (4.5 mL) was added to the solution of 1-(4amino-3-hydroxyphenyl)-1H-imidazole-4-carbonitrile (1 g, 5.0 mmol) in 18 mL of MeOH at 0 C. NaNO.sub.2 (0.38 g, 5.5 mmol) in water (3 mL) was then added. After stirring at 0 C. for 30 min, 4,4,4,4,5,5,5,5-octamethyl-2,2-bi(1,3,2-dioxaborolane) (2.54 g, 10.0 mmol) was added. The mixture was stirred at room temperature overnight, quenched with H.sub.2O (50 mL) and extracted with CH.sub.2Cl.sub.2 (30 mL3). The combined organic layers were concentrated and purified with silica gel chromatography (0-100% EtOAc/petroleum ether) to give 170 mg of(1-(3-hydroxy-4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenyl)-1H-imidazole-4-carbonitrile (15% yield). LCMS: m/z 230.1 [M+H].sup.+; t.sub.R=1.26 min.

Synthesis of 5-(4-ethyl-1H-1,2,3-triazol-1-yl)-2-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenol (B10)

(154) ##STR00333##

(155) Step 1: Synthesis of 2-(benzyloxy)-4-fluoro-1-nitrobenzene. Benzyl bromide (56 g, 0.33 mol) was added to a solution of 5-fluoro-2-nitrophenol (40 g, 0.25 mol) and K2CO.sub.3 (69 g, 0.5 mol) in DMF (400 mL). The mixture was stirred at room temperature for 1 h, quenched with water and extracted with EtOAc. The combined organic solvents were washed with LiCl aqueous solution (300 mL2), concentrated and purified by silica gel chromatography (20% EtOAc/petroleum ether) to give 61 g of 2-(benzyloxy)-4-fluoro-1-nitrobenzene (97% yield). LCMS: m/z 270.0 [M+Na].sup.+; t.sub.R=1.87 min.

(156) Step 2: Synthesis of 4-azido-2-(benzyloxy)-1-nitrobenzene. NaN.sub.3 (41 g, 0.63 mol) was added to a stirred solution of 2-(benzyloxy)-4-fluoro-1-nitrobenzene (61 g, 0.25 mol) in DMF (800 mL). The mixture was stirred at room temperature for 24 h and 60 C. for 3 h. After cooling to room temperature, the mixture was quenched with water and extracted with EtOAc. The combined organic solvents were washed with LiCl aqueous solution (500 ml2), dried over anhydrous Na.sub.2SO.sub.4, concentrated and purified by silica gel chromatography (20% EtOAc/petroleum ether) to give 65 g of 4-azido-2-(benzyloxy)-1-nitrobenzene. (98.5% yield). LCMS: m/z 293.0 [M+Na].sup.+; t.sub.R=1.93 min.

(157) Step 3: Synthesis of 1-(3-(benzyloxy)-4-nitrophenyl)-4-ethyl-1H-1,2,3-triazole. A mixture of 4-azido-2-(benzyloxy)-1-nitrobenzene (2.7 g, 10.0 mmol), pent-2-ynoic acid (0.98 g, 10.0 mmol), Cu.sub.2O (143 mg, 1.0 mmol) in 40 mL of CH.sub.3CN was degassed and stirred at 80 C. for 2 h. After cooling to room temperature, the mixture were concentrated and purified by silica gel column (0-100% EtOAc/petroleum ether) to give 3.2 g of 1-(3-(benzyloxy)-4-nitrophenyl)-4-ethyl-1H-1,2,3-triazole as yellow solid (89% yield). LCMS: m/z 325.2 [M+H].sup.+; t.sub.R=1.89 min.

(158) Step 4: Synthesis of 2-amino-5-(4-ethyl-1H-1,2,3-triazol-1-yl)phenol. To a solution of 1-(3-(benzyloxy)-4-nitrophenyl)-4-ethyl-1H-1,2,3-triazole (2.2 g, 6.8 mmol) in 40 mL of methanol was added Pd/C (0.8 g, 10% in activated carbon). The mixture was stirred at room temperature under hydrogen atmosphere for 2 h and filtered through a pad of Celite brand filter agent. The filtrate was concentrated and purified by silica gel column (0-10% EtOAc/petroleum ether) to give 1.2 g 2-amino-5-(4-ethyl-1H-1,2,3-triazol-1-yl)phenol (87% yield). LCMS: m/z 205.2 [M+H].sup.+; t.sub.R=1.23 min.

(159) Step 5: Synthesis of 5-(4-ethyl-1H-1,2,3-triazol-1-yl)-2-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenol. 2.7 mL of HCl (37% aqueous solution) was added to a solution of 2-amino-5-(4-ethyl-1H-1,2,3-triazol-1-yl)phenol (600 mg, 3.0 mmol) in 18 mL of methanol and a solution of NaNO.sub.2 (228 mg, 3.3 mmol) in 7.2 mL of water added at 0 C. The mixture was stirred at 0 C. for 30 min followed by addition of 4,4,4,4,5,5,5,5-octamethyl-2,2-bi(1,3,2-dioxaborolane) (2.29 g, 9.0 mmol). The mixture was then stirred at room temperature for 16 h, extracted with dichloromethane (50 mL2). The combined organic solvents were dried over anhydrous Na.sub.2SO.sub.4, concentrated and purified by silica gel column (0-100% EtOAc/petroleum ether) to give 283 mg of 5-(4-ethyl-1H-1,2,3-triazol-1-yl)-2-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenol (30% yield). LCMS: m/z 316.1 [M+H].sup.+; t.sub.R=1.91 min.

Synthesis of 3-(methoxymethoxy)-4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)benzonitrile (B11)

(160) ##STR00334##

(161) Step 1: Synthesis of 4-bromo-3-(methoxymethoxy)benzonitrile. NaH (1.62 g, 40.6 mmol, 60% in mineral oil) was added to a stirred solution of 4-bromo-3-hydroxybenzonitrile (4 g, 20.3 mmol) in 100 mL of DMF at 0 C. After stirring at 0 C. for 30 min, MOMBr (5.08 g, 40.6 mmol) was added. The mixture was then stirred at room temperature for 2 h, quenched with NH.sub.4Cl aqueous solution (10 mL), extracted with EtOAc (50 mL3). The combined organic solvents were dried over anhydrous Na.sub.2SO.sub.4, concentrated and purified by silica gel chromatography (0-20% EtOAc/petroleum ether) to give 4.8 g of 4-bromo-3-(methoxymethoxy)benzonitrile as colorless oil (98% yield). LCMS: m/z 241.9 [M+H].sup.+; t.sub.R=1.81 min.

(162) Synthesis of 3-(methoxymethoxy)-4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)benzoaric. A mixture of 4-bromo-3-(methoxymethoxy)benzonitrile (2 g, 8.3 mmol), 4,4,4,4,5,5,5,5-octamethyl-2,2-bi(1,3,2-dioxaborolane) (2.74 g, 10.8 mmol), Pd(dppf)Cl.sub.2 (607 mg, 0.83 mmol) and KOAc (1.63 g, 16.6 mmol) in 50 mL of dioxane was degassed and stirred at 100 C. for 2 h. After cooling to room temperature, the mixture was extracted with EtOAc (30 mL3). The combined organic solvents were concentrated and purified by silica gel column (0-20% EtOAc/petroleum ether) to give 2.27 g of 3-(methoxymethoxy)-4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)benzonitrile as colorless oil (95% yield). LCMS: m/z 290.3 [M+H].sup.+; t.sub.R=1.% min.

Synthesis of 5-(methoxymethoxy)-2-methyl-6-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)benzo[d]oxazole (B12)

(163) ##STR00335##

(164) Step 1: Synthesis of 2-amino-4-methoxyphenol. A mixture of 4-methoxy-2-nitrophenol (25 g, 0.15 mol) and Pd/C (2.5 g) in MeOH (500 mL) was stirred at 20 C. under hydrogen atmosphere (balloon) for 2 days. The reaction mixture was filtered and the filtrate was concentrated in vacuum to afford 2-amino-4-methoxyphenol as brown solid (20.0 g, yield 97.2%). LCMS: m/z 140.1 [M+H].sup.+; t.sub.R=0.93 min.

(165) Step 2: Synthesis of 5-methoxy-2-methylbenzo[d]oxazole. A mixture of 2-amino-4-methoxyphenol (20.0 g, 0.14 mol) in trimethyl orthoacetate (50 mL) was stirred at 100 C. for 1 h. The mixture was concentrated, and the residue was purified by silica gel chromatography (0-35% EtOAc/petroleum) to give 5-methoxy-2-methylbenzo[d]oxazole as orange oil (17.5 g, yield 74.6%). LCMS: adz 164.1 [M+H].sup.+; t.sub.R=1.41 min.

(166) Step 3: Synthesis of 6-bromo-5-methoxy-2-methylbenzo[d]oxazole. NBS (19.6 g, 0.11 mol) was added to a stirred solution of 5-methoxy-2-methylbenzo[d]oxazole (17.5 g, 0.11 mol) in AcOH (150 mL). After stirring at 20 C. for 18 h, the mixture was quenched with ice water, neutralized with Na.sub.2CO.sub.3 aqueous solution, extracted with EtOAc (200 mL3). The extracts were concentrated, and the residue was purified by silica gel chromatography (0-10% EtOAc/petroleum) to give 6-bromo-5-methoxy-2-methylbenzo[d]oxazole as pink solid (20.5 g, yield 77.0%). .sup.1H NMR (500 MHz, CDCl.sub.3) 7.68 (s, 1H), 7.17 (s, 1H), 3.93 (s, 3H), 2.61 (s, 3H). LCMS: m/z 242.1; 243.9 [M+H].sup.+; T.sub.R=1.70 min.

(167) Step 4: Synthesis of 6-bromo-2-methylbenzo[d]oxazol-5-ol. BBr.sub.3 (210 mL, 0.21 mol, 1N in CH.sub.2Cl.sub.2) was added to 6-bromo-5-methoxy-2-methylbenzo[d]oxazole (20.5 g, 0.085 mol) in CH.sub.2Cl.sub.2 (30 mL). at 0 C. This resulting mixture was stirred at 0 C. for 10 min, then stirred at 20 C. for 3 days. The mixture was quenched with ice water, neutralized with NaHCO.sub.3 aqueous, extracted with EtOAc (360 mL3). The extracts were concentrated, and the residue was purified by silica gel chromatography (0-20% MeOH/CH.sub.2Cl.sub.2) to give 6-bromo-2-methylbenzo[d]oxazol-5-01 as grey solid (19.0 g, yield 98.6%). LCMS: m/s 228.0; 230.0 [M+H].sup.+; t.sub.R=1.50 min.

(168) Step 5: Synthesis of 6-bromo-5-(methoxymethoxy)-2-methylbenzo[d]oxazole. MOMBr (15.6 g, 0.12 mol) was added drop wise to a solution of 6-bromo-2-methylbenzo[d]oxazol-5-ol (19.0 g, 0.08 mol) and DIPEA (37.7 g, 0.19 mol) in CH.sub.3CN (300 mL) at 5 C. After stirring for 30 min, the mixture was quenched with ice water, extracted with EtOAc (200 mL3). The extracts were washed with brine (300 mL), concentrated and purified by silica gel chromatography (0-25% EtOAc/petroleum) to give 6-bromo-5-(methoxymethoxy)-2-methylbenzo[d]oxazole as pink solid (18.0 g, yield 79.5%). LCMS: m/z 272.0; 274.0 [M+H].sup.+; t.sub.R=1.77 min.

(169) Step 6: Synthesis of 5-(methoxymethoxy)-2-methyl-6-(4, 4, 5, 5-tetramethyl-1, 3, 2-dioxaborolan-2-yl)benzo[d]oxazole (812). A mixture of 6-bromo-5-(methoxymethoxy)-2-methylbenzo[d]oxazole (50 g, 0.02 mol), 4,4,4,4,5,5,5,5-octamethyl-2,2-bi(1,3,2-dioxaborolane) (28.0 g, 0.11 mol), Pd(dppf)Cl.sub.2 (1.1 g, 15 mmol) and KOAc (10.8 g, 0.11 mol) in 1, 4-dioxane (300 mL) was degassed and stirred at 100 C. 50 h. The mixture was quenched with ice water, extracted with EtOAc (200 mL3). The extracts were washed with brine (200 mL), concentrated and purified by silica gel chromatography (0-25% EtOAc/petroleum) to give 5-(methoxymethoxy)-2-methyl-6-(4, 4, 5, 5-tetramethyl-1, 3, 2-dioxaborolan-2-yl)benzo[d]oxazole as pink solid (4.0 g, yield 68%). LCMS: m/z 320.2 [M+H].sup.+; t.sub.R=1.86 min.

Synth of 6-(methoxymethoxy)-7-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-4H-chromes-4-one (B13)

(170) ##STR00336##

(171) Step 1: Synthesis of 1-(4-bromo-2,5-dihydroxyphenyl)ethenone. Into a 1-L3-necked round-bottom flask, was placed 1-(4-bromo-2,5-dimethoxyphenyl)ethanone (30.00 g, 115.786 mmol, 1 equiv), DCM (300.00 mL). This was followed by the addition of BBr.sub.3 (1M in DCM, 347.97 mL, 347.97 mmol, 3 equiv) dropwise with stirring at 0 C. The resulting solution was stirred for 3 h at room temperature. The reaction was then quenched by the addition of 500 mL of NaHCO.sub.3/Water. The resulting solution was extracted with 3500 mL of dichloromethane and concentrated. The residue was applied onto a silica gel column and eluted with ethyl acetate/petroleum ether (1;1). This resulted in 14 g (52.3%) of 1-(4-bromo-2,5-dihydroxyphenyl)ethanone as a yellow solid.

(172) Step 2: Synthesis of 7-bromo-6-hydroxychromen-4-one. Into a 50-mL 3-necked round-bottom flask, was placed 1-(4-bromo-2,5-dihydroxyphenyl)ethanone (462 mg, 2.0 mmol) and triethyl orthoformate (1.80 mL). This was followed by the addition of perchloric acid (0.2 mL) dropwise with stirring at 0 C. The resulting solution was stirred overnight at room temperature. The reaction was then quenched by the addition of 10 mL of water. The resulting solution was extracted with 320 mL of ethyl acetate and the combined organic layers were concentrated. The residue was applied onto a silica gel column and eluted with ethyl acetate/petroleum ether (1:9-1:1). This resulted in 100 mg (20.75%) of 7-bromo-6-hydroxychromen-4-one as a brown solid.

(173) Step 3: Synthesis of 7-bromo-6-(methoxymethoxy)chromen-4-one. Into a 50 mL 3-necked round-bottom flask were added 7-bromo-6-hydroxychromen-4-one (366 mg, 1.52 mmol, 1.0 equiv) and THE (6 mL) at 0 C. To the above mixture was added NaH (91 mg, 3.8 mmol, 60 wt % in mineral oil) in portions at 0 C. The resulting mixture was stirred for additional 30 min at 0 C. Then to the above mixture was added MOMBr (285 mg, 2.3 mmol, 1.5 equiv) at 0 C. The resulting mixture was stirred for additional 1 h at room temperature. The resulting mixture was diluted with water (20 mL). The resulting mixture was extracted with EtOAc (320 mL). The organics were combined and dried over anhydrous Na.sub.2SO.sub.4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluting with hexane/EtOAc (9:1-1:1) to afford 7-bromo-6-(methoxymethoxy)chromen-4-one (340 mg, 45.63%) as a brown solid.

(174) Step 4: Synthesis of 6-(methoxymethoxy)-7-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-4H-chromen-4-one (B13). Into a 100 mL round-bottom flask were added 7-bromo-6-(methoxymethoxy)chromen-4-one (1.04 g, 3.65 mmol, 1.0 equiv), bis(pinacolato)diboron (66.80 mg, 0.263 mmol, 1.5 equiv), Pd(dppf)Cl.sub.2 (267 mg, 0.365 mmol, 0.10 equiv), KOAc (712 mg, 7.26 mmol, 2 equiv) and 1,4-dioxane (15 mL). The resulting mixture was stirred overnight at 100 C. under nitrogen atmosphere. The resulting solution was used in the next step directly without work up. LCMS: m/z 333 [M+H].sup.+.

Synthesis of 7-(methoxymethoxy)-6-4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)quinoline (B14)

(175) ##STR00337##

(176) ##STR00338##

(177) Step 1: Synthesis of 6-bromo-7-methoxyquinoline. H.sub.2SO.sub.4 (10.5 mL) in 12 mL of H.sub.2O was added 4-bromo-3-methoxyaniline (10.5 g, 51.7 mmol) and propane-1,2,3-triol (12.5 g, 135.7 mmol). The mixture was heated to 110 C., 3-nitrobenzenesulfonic acid (10 g, 49.5 mmol) was added portion-wise. Then 15 mL of H.sub.2O, 15 mL of propane-1,2,3-triol and 15 ml of H2SO.sub.4 were added successively. The mixture was stirred at 140 C. for 3 h. After cooling to room temperature, the mixture was poured onto ice, and the pH was adjusted to 8 by addition NH.sub.3H.sub.2O. The mixture was extracted with EtOAc (100 mL3). The combined organic solvents were dried over anhydrous Na.sub.2SO.sub.4, concentrated and purified by silica gel chromatography (25 100% EtOAc/petroleum ether) to give 9.9 g of 6-bromo-7-methoxyquinoline as a gray solid (83% yield). LCMS: m/z 240.1 [M+H].sup.+; t.sub.R=1.54 min.

(178) Step 2: Synthesis of 6-bromoquinolin-7-ol. To a solution of 6-bromo-7-methoxyquinoline (2 g, 8.4 mmol) in CH.sub.2Cl.sub.2 (4 mL) at 25 C. was added BBr.sub.3 (40 mL, 1N in CH.sub.2Cl.sub.2) and stirred at 25 C. for 16 h, monitored by LCMS. Then water (15 mL) and ammonia methanol solution was added to pH to 89. The precipitate was collected by filtration to give 1.02 g of 6-bromoquinolin-7-ol. LCMS: m/z 226.0 [M+H].sup.+; t.sub.R=1.15 min.

(179) Step 3: Synthesis of 6-bromo-7methoxymethoxy)quinoline. NaH (363 mg, 9.07 mmol, 60% in mineral oil) was added to a stirred solution of 6-bromoquinolin-7-ol (1.02 g, 4.53 mmol) in 65 mL of THE at 25 C. After stirring at 25 C. for 30 min, MOMBr (623 mg, 4.98 mmol) was added. The mixture was then stirred at room temperature for 1 h, quenched with NH.sub.4Cl aqueous solution (20 mL), extracted with EtOAc (60 mL3). The combined organic solvents were dried over anhydrous Na.sub.2SO.sub.4, concentrated and purified by silica gel chromatography (0-50% EtOAc/petroleum ether) to give 780 mg of 6-bromo-7-(methoxymethoxy)quinoline as colorless oil (64% yield), LCMS: LCMS: m/z 270.0 [M+H].sup.+; t.sub.R=1.67 min.

(180) Step 4: Synthesis of 7-(methoxymethoxy)-6-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)quinoline (B14). A mixture of 6-bromo-7-(methoxymethoxy)quinoline (100 mg, 0.42 mmol), 4,4,4,4,5,5,5,5-octamethyl-2,2-bi(1,3,2-dioxaborolane) (159 mg, 0.63 mmol), Pd(dppf)Cl.sub.2 (61 mg, 0.084 mmol) and KOAc (82 mg, 0.84 mmol) in 4 mL of dioxane was degassed and stirred at 100 C. for 2 h. After cooling to room temperature, the mixture was used directly to next step.

6-(methoxymethoxy)-7-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)quinoline (B15)

(181) ##STR00339##

(182) Step 1: Synthesis of 7-bromo-6-methoxyquinoline. A mixture of 3-bromo-4-methoxyaniline (10 g, 49.49 mmol), 3-nitrobenzenesulfonic acid (11.06 g, 54.4 mmol), propane-1,2,3-triol (45.6 g, 495 mmol) and H2SO.sub.4 (48.5 g, 495 mmol) in water (60 mL) was heated to 140 C. for 16 h. LCMS showed most of the starting material disappeared, and the mixture was poured into ice water (200 mL). NH.sub.3.Math.H.sub.2O was added dropwise to the mixture to make the pH to about 8. The mixture was extracted with ethyl acetate (150 mL). The organic phase was washed with sodium chloride solution, dried, concentrated, and purified by silica gel chromatography (0-20% EtOAc/petroleum ether) to give 7-bromo-6-methoxyquinoline (6.81 g, 57% yield) as white solid. LCMS: m/z 237.9 [M+H].sup.+; t.sub.R=1.44 min.

(183) Step 2: Synthesis of 7-bromoquinolin-6-ol. To a mixture of 7-bromo-6-methoxyquinoline (6.3 g, 26.46 mmol) in DCM (80 mL) was added 1M BBr.sub.3 in DCM (66 mL) dropwise at 78 C. The mixture was warmed to room temperature and stirred for 16 h. LCMS showed most of the starting material disappeared, and the mixture was quenched with ice water dropwise at 0 C. Sodium hydroxide solution was added to the mixture to make the pH to about 7. The solid was filtered to give 8.2 g of 7-bromoquinolin-6-ol as white solid (contained boric acid). LCMS: m/z 224.0 [M+H].sup.+; t.sub.R=1.12 min.

(184) Step 3: Synthesis of 7-bromo-6-(methoxymethoxy)quinoline. To a solution of 7-bromoquinolin-6-ol (2 g, 8.93 mmol) and DIPEA (2.31 g, 17.85 mmol) in DCM (30 mL) was added MOMBr (1.67 g, 13.39 mmol) at 0 C. The solution was stirred at room temperature for 2 h. LCMS showed most of the starting material disappeared, and the mixture was quenched with sodium bicarbonate solution (10 mL). The mixture was extracted with ethyl acetate (50 mL) and water (40 mL). The organic layer was dried over anhydrous Na.sub.2SO.sub.4, concentrated and purified by silica gel chromatography (0-25% EtOAc/petroleum ether) to give 7-bromo-6-(methoxymethoxy)quinoline (920 mg, 38% yield) as light yellow solid. LCMS: m/z 268.0 [M+H].sup.+; t.sub.R=1.53 min.

(185) Step 4: Synthesis of 6-(methoxyethoxy)-7-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)quinoline. A mixture of 7-bromo-6-(methoxymethoxy)quinoline (1.1 g, 4.1 mmol), 4,4,4,4,5,5,5,5-octamethyl-2,2-bi(1,3,2-dioxaborolane) (1.56 g, 6.15 mmol), Pd(dppf)Cl.sub.2 (300.2 mg, 0.41 mmol) and KOAc (1.21 g, 7.68 mmol) in dioxane (15 mL) was stirred at 100 C. under N2 for 16 h, concentrated and purified by silica gel chromatography (0-40% EtOAc/petroleum ether) to give 6-(methoxymethoxy)-7-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)quinoline (800 mg, 61% yield) as light yellow oil. LCMS: m/z 234.0 [M81].sup.+; t.sub.R=1.40 min.

Synthesis of 2-fluoro-5-(methoxymethoxy)-N-methyl-4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)benzamide (B16)

(186) ##STR00340##

(187) Step 1: 4-bromo-2-fluoro-5-hydroxybenzoic acid. Into a 2-L3-necked round-bottom flask, was placed 2-fluoro-5-hydroxybenzoic acid (40 g, 256 mmol), CHCl.sub.3 (400 mL). This was followed by the addition of Br.sub.2 (38.3 mL, 748 mmol, 3 equiv) in CH.sub.3COOH (400 mL) dropwise with stirring at 0 C. over 30 min. The resulting solution was stirred overnight at room temperature. The reaction was quenched with Na.sub.2S.sub.2O.sub.3 at room temperature. The resulting mixture was extracted with EtOAc (31 L), dried over anhydrous Na.sub.2SO.sub.4, filtered, and concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluting with PE/EtOAc (1:1) to afford 4-bromo-2-fluoro-5-hydroxybenzoic acid (40 g, 66.4%) as a yellow solid.

(188) Step 2: Synthesis of 4-bromo-2-fluoro-5-hydroxy-N-methylbenzamide. Into a 50-mL 3-necked round-bottom flask, was placed 4-bromo-2-fluoro-5-hydroxybenzoic acid (15 g, 63.8 mmol, 1.0 equiv), THE (150 mL), isopropyl chloroformate (19.48 g, 158.9 mmol, 2.3 equiv), TEA (15 g, 148 mmol, 2.3 equiv). The resulting solution was stirred for 0.5 hr at 0 C. The solids were filtered out. To the filtrate was added MeNH.sub.2 (1M in MeOH, 225 mL) at 0 C. The resulting solution was stirred for 2 h at room temperature. The resulting mixture was concentrated under reduced pressure and diluted with water (100 mL). The resulting mixture was extracted with EtOAc (3100 mL), dried over anhydrous Na.sub.2SO.sub.4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EtOAc (9:1-1:1) to afford 4-bromo-2-fluoro-5-hydroxy-N-methylbenzamide (7 g, 4421%) as a white solid. ES, m/z: 248 (M+1).

(189) Step 3: Synthesis of 4-bromo-2-fluoro-5-(methoxymethoxy)-N-methylbenzamide. Into a 50 mL 3-necked round-bottom flask were added 4-bromo-2-fluoro-5-hydroxy-N-methylbenzamide(5.00 g, 20.157 mmol, 1.00 equiv) and THE (75.00 mL) at 0 C. To the above mixture was added NaH (60%, 532.10 mg, 22.173 mmol, 1.10 equiv) in portions at 0 C. The resulting mixture was stirred for 30 min at 0 C. Then to the above mixture was added MOMBr (3.02 g, 24.183 mmol, 1.20 equiv) in portions at 0 C. The resulting mixture was stirred for additional 1 h at room temperature. The resulting mixture was diluted with water (100 mL). The resulting mixture was extracted with EtOAc (3100 mL). The organics were combined and dried over anhydrous Na.sub.2SO.sub.4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with hexane/EtOAc (9:1-1:1) to afford 4-bromo-2-fluoro-5-(methoxymethoxy)-N-methylbenzamide (5.0 g, 84.92%) as a light yellow solid. ES, m/z: 292 (M+1).

(190) Step 4: 2-fluoro-5-(methoxymethoxy)-N-methyl-4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)benzamide (B16). Into a 250 mL round-bottom flask were added 4-bromo-2-fluoro-5-(methoxymethoxy)-N-methylbenzamide (5 g, 17.1 mmol), bis(pinacolato)diboron (6.56 g, 25 mmol), Pd(dppf)Cl.sub.2 (1.4 g, 1.9 mmol), K.sub.2CO.sub.3 (4.75 g, 34 mmol) and 1,4-dioxane (50 mL). The mixture was stirred overnight at 100 C. under nitrogen atmosphere. The resulting mixture was diluted with water (100 mL) and extracted with EtOAc (3100 mL). The organics were combined and dried over anhydrous Na.sub.2SO.sub.4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE/EtOAc (5:1-1:1) to afford 2-fluoro-5-(methoxymethoxy)-N-methyl-4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)benzamide (3 g, 71.42%) as a yellow solid. ES, m/z: 340 (M+1).

Synthesis of 2-(3-(methoxymethoxy)-4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenyl)-5-methyloxazole (B17)

(191) ##STR00341##

(192) Step 1: Synthesis of 4-bromo-3-hydroxy-N-(prop-2-yn-1-yl)benzamide. To a solution of prop-2-yn-1-amine (1.52 g, 27.65 mmol), HATU (10.51 g, 27.65 mmol), DIPEA (5.96 g, 46.08 mmol) in 50 mL of DMF was added 4-bromo-3-hydroxybenzoic acid (5 g, 23.04 mmol). The mixture was then stirred at room temperature overnight, quenched with 100 mL of LiCl (aqueous solution), extracted with EtOAc (50 mL3). The combined organic solvents were washed with brine and dried over anhydrous Na.sub.2SO.sub.4, concentrated in vacuum to give 5.8 g of 4-bromo-3-hydroxy-N-(prop-2-yn-1-yl)benzamide as yellow solid (100% yield). LCMS: m/z 255.1 [M+H].sup.+; t.sub.R=1.59 min.

(193) Step 2: Synthesis of 2-bromo-5-(5-methyloxazol-2-yl)phenol. FeCl.sub.3 (1795 mg, 11.07 mmol) was added to a stirred solution of 4-bromo-3-hydroxy-N-(prop-2-yn-1-yl)benzamide (5.60 g, 22.13 mmol) in 50 mL of 1,2-dichloroethane at room temperature. The mixture was then stirred at 80 C. for 2 h, quenched with 100 mL of H.sub.2O, extracted with EtOAc (50 mL3). The combined organic solvents were dried over anhydrous Na.sub.2SO.sub.4, concentrated and purified by silica gel column (0-16% methanol/dichloromethane) to give 3.20 g of 2-bromo-5-(5-methyloxazol-2-yl)phenol as white solid (57.1% yield). LCMS: m/z 255.1 [M+H].sup.+; t.sub.R=1.87 min.

(194) Step 3: Synthesis of 2-(4-bromo 3-(methoxymethoxy)phenyl)-5-methyloxazole. NaH (1.33 mg, 33.2 mmol, 60% in mineral oil) was added to a stirred solution of 2-bromo-5-(5-methyloxazol-2-yl)phenol (2.10 g, 8.3 mmol) in 30 mL of THF at room temperature for 30 mins, bromo(methoxy)methane (1.56 g, 12.45 mmol) was added. The mixture was then stirred at room temperature for 1 h, quenched with 30 mL of H.sub.2O, extracted with EtOAc (20 mL3). The combined organic solvents were dried over anhydrous Na.sub.2SO.sub.4, concentrated and purified by silica gel column (0-38% Ethyl acetate/Petroleum ether) to give 3.70 g of 2-(4-bromo-3-(methoxymethoxy)phenyl)-5-methyloxazole as yellow liquid (99% yield). LCMS: m/z 298.1 [M+H].sup.+; t.sub.R=2.12 min.

(195) Step 4: Synthesis of 2-(3-(methoxymethoxy)-4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenyl)-5-methyloxazole (B17). To a solution of AcOK (2.38 gg, 24.24 mmol), Pd(dppf)Cl.sub.2 (1.77 g, 2.42 mmol), (4,4,4,4,5,5,5,5-octamethyl-2,2-bi(1,3,2-dioxaborolane) (6.16 g, 24.24 mmol) in 40 mL of dioxane was added 2-(4-bromo-3-(methoxymethoxy)phenyl)-5-methyloxazole (3.60 g, 12.12 mmol). The mixture was then stirred at 100 C. for 2 h, concentrated and purified by silica gel column (0-15% Ethyl acetate/Petroleum ether) to give 4.20 g of 2-(3-(methoxymethoxy)-4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenyl)-5-methyloxazole as yellow solid (90% yield).

Synthesis of 6-(methoxymethoxy)-2-methyl-7-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-4H-chromen-4-one (B18)

(196) ##STR00342##

(197) Step 1: Synthesis of 1-[4-bromo-2-hydroxy-5-(methoxymethoxy)phenyl]ethenone. Into a 50-mL 3-necked round-bottom flask purged and maintained with an inert atmosphere of nitrogen, was placed 1-(4-bromo-2,5-dihydroxyphenyl)ethanone (10.0 g, 43.28 mmol, 1.00 equiv), acetone (100.00 mL), K.sub.2CO.sub.3 (6.58 g, 23.81 mmol, 1.10 equiv), bromo(methoxymethoxy)methane (6.7 g, 47.6 mmol, 1.10 equiv). The resulting solution was stirred for 2 hr at room temperature. The solids were filtered out. The residue was applied onto a silica gel column with ethyl acetate/petroleum ether (3:1). The collected fractions were combined and concentrated. This resulted in 7 g (58.8%) of 1-[4-bromo-2-hydroxy-5-(methoxymethoxy)phenyl]ethanone as a yellow oil. (ES, m/z): [M+H].sub.=274.

(198) Step 2: Synthesis of 1-[4-bromo-2-hydroxy-5-(methoxymethoxy)phenyl]butane-1,3-dione. Into a 50 ml 3-necked round-bottom flask were added THF (80 mL) and NaH (2.79 g, 116.3 mmol, 60 wt %) at 0 C. The mixture of ethyl acetate (6.41 g, 72.7 mmol, 2.5 equiv) and 1-[4-bromo-2-hydroxy-5-(methoxymethoxy)phenyl]ethanone (8.00 g, 29.08 mmol, 1.0 equiv) dissolved in 3 ml THF was added slowly at 0 degrees C. Then the reaction was allowed to stir for 2 h at room temperature.

(199) The reaction was quenched by the addition of ice water at rt. The resulting mixture was extracted with ethyl acetate (100 ml3). The combined organic layers were washed with NaCl aq, dried over anhydrous Na.sub.2SO.sub.4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography. This resulted in 1-[4-bromo-2-hydroxy-5-(methoxymethoxy)phenyl]butane-1,3-dione (9 g, 97.6%) as yellow oil. (ES, m/z): [M+1]-316

(200) Step 3: Synthesis of 7-bromo-6-hydroxy-2-methylchromen-4-one. Into a 500-mL round-bottom flask, was placed 1-[4-bromo-2-hydroxy-5-(methoxymethoxy)phenyl]butane-1,3-dione (9.00 g, 28.38 mmol, 1.0 equiv), isopropyl alcohol (200 mL), Amberlyst 15 (9.0 g). The resulting solution was stirred for 3 h at 80 C. The solids were filtered out. The resulting mixture was concentrated under vacuum. This resulted in 7.2 g (99.5%) of 7-bromo-6-hydroxy-2-methylchromen-4-one as a light yellow solid. (ES, m/z): [M+H].sup.+=254.

(201) Step 4: Synthesis of 7-bromo-6-(methoxymethoxy)-2-methylchromen-4-one. Into a 150-mL 3-necked round-bottom flask purged and maintained with an inert atmosphere of nitrogen, was placed bromo(methoxymethoxy)methane (2.92 g, 18.82 mmol, 1.2 equiv), 7-bromo-6-hydroxy-2-methylchromen-4-one (4.0 g, 15.68 mmol, 1.0 equiv), NaH (0.45 g, 18.75 mmol, 95 wt % in mineral oil, 1.20 equiv), THE (40 mL). The resulting solution was stirred for 2 h at room temperature. The reaction was then quenched by the addition of 50 mL of ice/salt. The resulting solution was extracted with 350 mL of ethyl acetate and the organic layers combined and concentrated under vacuum. The residue was applied onto a silica gel column with ethyl acetate/hexane (20%). The collected fractions were combined and concentrated under vacuum. This resulted in 3 g (60.8%) of 7-bromo-6-(methoxymethoxy)-2-methylchromen-4-one as a yellow solid. (ES, m/z): [M+H].sup.+=298.

Synthesis of 6-(methoxymethoxy)-2-methyl-7-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)chromen-4-one (B18)

(202) Into a 50-mL 3-necked round-bottom flask purged and maintained with an inert atmosphere of nitrogen, was placed bis(pinacolato)diboron (1.32 g, 5.22 mmol, 1.20 equiv), 7-bromo-6-(methoxymethoxy)-2-methylchromen-4-one (1.30 g, 4.35 mmol, 1.0 equiv), KOAc (1.28 g, 13.04 mmol, 3.0 equiv), 1,4-dioxane (13.0 mL), Pd(dppf)Cl.sub.2 CH.sub.2Cl.sub.2 (0.35 g, 0.435 mmol, 0.10 equiv). The resulting solution was stirred for 2 h at 100 C. in an oil bath. The resulting mixture was concentrated under vacuum. This resulted in 1.5 g (crude) of 6-(methoxymethoxy)-2-methyl-7-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)chromen-4-one as a brown solid. (ES, m/z): [M+1].sup.+=347.

Synthesis of 7-(methoxymethoxy)-2-methyl-6-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)chromen-4-one (B19)

(203) Step 1: Synthesis of 1-(S-bromo-2,4-dihydroxyphenyl)ethenone. Into a 2-L 3-necked round-bottom flask, was placed 2 (20.00 g, 131.5 mmol, 1.00 equiv), chloroform (1 L), Bu.sub.4NBr.sub.3 (69.72 g, 144.595 mmol, 1.10 equiv). The resulting solution was stirred for 2 h at room temperature. The reaction was then quenched by the addition of 200 mL of 5% solution of sodium thiosulfate. The resulting mixture was washed with 1300 mL of HCl (1M). The mixture was dried over anhydrous sodium sulfate and concentrated under vacuum. The residue was applied onto a silica gel column with ethyl acetate/hexane (20%). This resulted in 20 g (65.8%) of 1-(5-bromo-2,4-dihydroxyphenyl)ethanone as a yellow solid. m/z: 231 (M+H.sup.+).

(204) Step 2: Synthesis of 1-[5-bromo-2-hydroxy-4-(methoxymethoxy)phenyl]ethenone. Into a 250-mL 3-necked round-bottom flask, was placed 1-(5-bromo-2,4-dihydroxyphenyl)ethanone (5.00 g, 21.64 mmol, 1.00 equiv), K.sub.2CO.sub.3 (3.59 g, 26.0 mmol, 1.20 equiv), acetone (100 mL), methane, bromomethoxy- (2.84 g, 22.73 mmol, 1.05 equiv). The resulting solution was stirred overnight at room temperature. The solids were filtered out. The resulting solution was diluted with 1 L of DCM. The resulting mixture was washed with 2200 mL of NaHCO.sub.3. The mixture was dried over anhydrous sodium sulfate and concentrated under vacuum. This resulted in 5 g (84.0%) of 1-[5-bromo-2-hydroxy-4-(methoxymethoxy)phenyl]ethanone as yellow oil. LCMS: m/z: 275 (M+H.sup.+).

(205) Step 3: Synthesis of 1-[5-bromo-2-hydroxy-4-(methoxymethoxy)phenyl]butane-1,3-dione. Into a 250-mL 3-necked round-bottom flask purged and maintained with an inert atmosphere of nitrogen, was placed 1-[5-bromo-2-hydroxy-4-(methoxymethoxy)phenyl]ethanone (6.00 g, 21.810 mmol, 1.00 equiv), THF (50.00 mL, 12.343 mmol, 67.91 equiv). This was followed by the addition of NaH (2.09 g, 87.2 mmol, 4.0 equiv) in several batches at 0 degrees C. in 10 min. To this was added EtOAc (3.84 g, 43.58 mmol, 2.0 equiv) at 0 degrees C. The resulting solution was stirred for 2 h at room temperature. The reaction was then quenched by the addition of 20 mL of water. The resulting solution was extracted with 2100 mL of ethyl acetate dried over anhydrous sodium sulfate and concentrated under vacuum. This resulted in 6 g (86.7%) of 1-[5-bromo-2-hydroxy-4-(methoxymethoxy)phenyl]butane-1,3-dione as a solid. m/z: 317 (M+H.sup.+).

(206) Step 4: Synthesis of 6-bromo-7-hydroxy-2-methylchromen-4-one. Into a 500-mL 3-necked round-bottom flask, was placed 1-[5-bromo-2-hydroxy-4-(methoxymethoxy)phenyl]butane-1,3-dione (6.0 g, 18.9 mmol, 1.00 equiv), i-PrOH (200 mL), Amberlyst-15 (20 g). The resulting solution was stirred for 1 h at 85 C. The solids were filtered off and washed with 100 mL of hot MeOH. The resulting mixture was concentrated under vacuum. This resulted in 4 g (82.9%) of 6-bromo-7-hydroxy-2-methylchromen-1-one as a yellow solid. m/z: 255(M+H.sup.+).

(207) Step 5: Synthesis of 6-bromo-7-(methoxymethoxy)-2-methylchromen-4-one. Into a 100-mL 3-necked round-bottom flask, was placed 6-bromo-7-hydroxy-2-methylchromen-4-one (4.00 g, 15.68 mmol, 1.0 equiv), THF (40.00 mL), NaH (60%, 0.56 g, 23.4 mmol, 1.5 equiv), methane, MOMBr (2.94 g, 23.5 mmol, 1.5 equiv). The resulting solution was stirred for 2 h at room temperature. The resulting solution was diluted with 30 mL of water. The resulting solution was extracted with 2100 mL of ethyl acetate dried over anhydrous sodium sulfate and concentrated under vacuum. The residue was applied onto a silica gel column with ethyl acetate/hexane (20%). This resulted in 3 g (64.0%) of 6-bromo-7-(methoxymethoxy)-2-methylchromen-4-one as a yellow solid. m/z: 299(M+H.sup.+).

(208) Step 6: Synthesis of 7-(methoxymethoxy)-2-methyl-6-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)chromen-4-one (B19). Into a 100-mL 3-necked round-bottom flask purged and maintained with an inert atmosphere of nitrogen, was placed 6-bromo-7-(methoxymethoxy)-2-methylchromen-4-one (3.0 g, 10.03 mmol, 1.0 equiv), bis(pinacolato)diboron (3.06 g, 12.05 mmol, 1.2 equiv), Pd(dppf)Cl.sub.2 (734 mg, 1.0 mmol, 0.10 equiv), KOAc (1.97 g, 20.06 mmol, 2.0 equiv), 1,4-dioxane (30 mL). The resulting solution was stirred for 2 hr at 100 C. The resulting solution was diluted with 300 mL of EtOAc. The resulting mixture was washed with 250 ml of water. The mixture was dried over anhydrous sodium sulfate and concentrated under vacuum. The residue was applied onto a silica gel column with ethyl acetate/hexane (50%). This resulted in 2 g (57.60%) of 7-(methoxymethoxy)-2-methyl-6-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)chromen-4-one as yellow oil. m/z: 347(M+H.sup.+).

Synthesis of 6-(methoxymethoxy)-3-methyl-7-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl) quinazolin-4(3H)-one (B20)

(209) ##STR00343##

(210) Step 1: Synthesis of 4-bromo-5-methoxy-2-nitrobenzoate. Into a 100-mL round-bottom flask, was placed methyl 4-bromo-5-fluoro-2-nitrobenzoate (25.0 g, 89.9 mmol, 1.0 equiv), MeOH (250 mL), MeONa (5.83 g, 107.9 mmol, 1.2 equiv). The resulting solution was stirred for overnight at 30 C. The resulting mixture was concentrated under vacuum. The residual was then quenched by the addition of 100 mL of water. The resulting solution was extracted with 2100 mL of ethyl acetate and concentrated under vacuum. This resulted in 25 g (95.9%) of methyl 4-bromo-5-methoxy-2-nitrobenzoate as a white solid.

(211) Step 2: Synthesis of 4-bromo-5-=ethoxy-2-nitrobenzoic acid. 4-bromo-5-methoxy-2-nitrobenzoic acid. Into a 500-mL round-bottom flask, was placed methyl 4-bromo-5-methoxy-2-nitrobenzoate (25.0 g, 86.19 mmol, 1.0 equiv), MeOH (250 mL), H.sub.2O (50 mL), LiOH (4.13 g, 173 mmol, 2.0 equiv). The resulting solution was stirred for 2 h at room temperature. The resulting mixture was concentrated under vacuum. The reaction was then quenched by the addition of 250 mL of water. The pH value of the solution was adjusted to 5 with HCl (1 mol/L). The solids were collected by filtration. This resulted in 23 g (96.7%) of 4-bromo-5-methoxy-2-nitrobenzoic acid as a white solid.

(212) Step 3: Synthesis of 4-bromo-5-methoxy-N-methyl-2-nitrobenzamide. Into a 250-mL round-bottom flask, was placed 4-bromo-5-methoxy-2-nitrobenzoic acid (10.00 g, 36.2 mmol, 1.0 equiv), DMF (100 mL), methanamine, hydrochloride (3.67 g, 54.34 mmol, 1.50 equiv), HATU (20.66 g, 54.33 mmol, 1.50 equiv), DIEA (14.05 g, 108.71 mmol, 3.0 equiv). The resulting solution was stirred for 1 h at room temperature. The reaction was then quenched by the addition of 500 mL of water/ice. The solids were collected by filtration and then dried under vacuum. This resulted in 9 g (86%) of 4-bromo-5-methoxy-N-methyl-2-nitrobenzamide as a white solid.

(213) Step 4: Synthesis of 2-amino-4-bromo-5-methoxy-N-methylbenzamide. Into a 500-mL round-bottom flask, was placed 4-bromo-5-methoxy-N-methyl-2-nitrobenzamide (9.00 g, 31.13 mmol, 1.0 equiv), THE (200 mL), H.sub.2O (50 mL), NH.sub.4Cl (16.65 g, 311.3 mmol, 10.0 equiv), Zn (20.36 g, 311.32 mmol, 10.0 equiv). The resulting mixture was stirred for 2 h at room temperature. The reaction was then quenched by the addition of 300 mL of water. The solids were filtered out. The filtrate was extracted with 2200 mL of ethyl acetate and the organic layers combined and concentrated under vacuum. This resulted in 10 g (crude) of 2-amino-4-bromo-5-methoxy-N-methylbenzamide as a light yellow solid.

(214) Step 5: Synthesis of 7-bromo-6-methoxy-3-methylquinazolin-4-one. Into a 250-mL 3-necked round-bottom flask, was placed 2-amino-4-bromo-5-methoxy-N-methylbenzamide (5.00 g, 19.30 mmol, 1.0 equiv), CH(OMe).sub.3 (50 mL), MeOH (50 mL), p-TsOH (0.33 g, 1.93 mmol, 0.10 equiv). The resulting solution was stirred for 4 h at 75 C. in an oil bath. The resulting mixture was concentrated under vacuum. The residual was slurried in 200 mL of water. The solids were collected by filtration. This resulted in 3.6 g (69.3%) of 7-bromo-6-methoxy-3-methylquinazolin-4-one as a white solid.

(215) Step 6: Synthesis of 7-bromo-6-hydroxy 3-methylquinazolin-4(3H)-one. To a solution of 7-bromo-6-methoxy-3-methylquinazolin-4(3H)-one (3.6 g, 13.43 mmol, 1.0 equiv) in CH.sub.2Cl.sub.2 (20 mL) at 25 C. was added BBr.sub.3 (30 mL, 1N in CH.sub.2Cl.sub.2) and stirred at 25 C. for 2 h, monitored by LCMS. Then water (15 mL) was added. The organic layer was extracted with water (100 mL2). The combined aqueous layers were adjusted with saturated K.sub.2CO.sub.3 aqueous solution to pH to 89 and extracted with dichloromethane (240 mL). The organic layers were dried over anhydrous Na.sub.2SO.sub.4, filtered and concentrated to give 7-bromo-6-hydroxy-3-methylquinazolin-4(3H)-one (3.2 g, crude) as a yellow solid, which was used directly to next step.

(216) Step 7: Synthesis of 7-bromo-6-(methoxymethoxy)-3-methylquinazolin-4(3H)-one. Into a 50-mL round-bottom flask, was placed 7-bromo-6-hydroxy-3-methylquinazolin-4(3H)-one (3.2 g, 12.598 mmol, 1.00 equiv), THE (30.00 mL). The solution was stirred at 0 C. and NaH (0.36 g, 15.118 mmol, 1.20 equiv) was added slowly. The resulting solution was stirred for 0.5 h at 0 C. Then bromomethoxy-methane (1.39 g, 11.11 mmol, 1.1 equiv) was added slowly. The resulting solution was allowed to stir for an additional 1 h at 0 C. The reaction was then quenched by the addition of 20 mL of water/ice. The resulting solution was extracted with 230 mL of ethyl acetate and then concentrated under vacuum. This resulted in 2 g (crude) of 7-bromo-6-(methoxymethoxy)-3-methylquinazolin-4(3H)-one as off-white solid.

(217) Step 8: Synthesis of 6-(methoxymethoxy)-3-methyl-7-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl) quinazolin-4(3H)-one (B20). Into a 40 mL vial were added 7-bromo-6-(methoxymethoxy)-3-methylquinazolin-4(3H)-one (2.00 g, 6.710 mmol, 1.00 equiv), bis(pinacolato)diboron (2.54 g, 10.0 mmol, 1.5 equiv), Pd(dppf)Cl.sub.2.Math.CH.sub.2Cl.sub.2 (0.46 g, 0.536 mmol, 0.08 equiv), 1,4-dioxane (25 mL) and KOAc (1.32 g, 13.4 mmol, 2.0 equiv). The resulting mixture was stirred for overnight at 100 C. under nitrogen atmosphere. The reaction was then quenched by the addition of 20 mL of water/ice. The resulting solution was extracted with 230 mL of ethyl acetate and then concentrated under vacuum. This resulted in 1.2 g (crude) of 6-(methoxymethoxy)-3-methyl-7-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl) quinazolin-4(3H)-one as a light green oil.

Synthesis of 2-fluoro-S-(methoxymethoxy)-N,N-dimethyl-4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)benzamide (B22)

(218) ##STR00344##

(219) Step 1: Synthesis of 4-bromo-2-fluoro-5-hydroxybenzoic acid. Into a 1-L 3-necked round-bottom flask purged and maintained with an inert atmosphere of nitrogen, was placed 2-fluoro-5-hydroxybenzoic acid (50.0 g, 320.3 mmol, 1.0 equiv), CHCl.sub.3 (500 mL). This was followed by the addition of Br.sub.2 (61.4 g, 384.4 mmol, 1.2 equiv) at 0 C. over 30 min. The resulting solution was stirred for 2 h at room temperature. The reaction was then quenched by the addition of 300 mL of water (Na.sub.2S.sub.2O.sub.3). The resulting solution was extracted with 3500 mL of dichloromethane dried over anhydrous sodium sulfate and concentrated under vacuum. The residue was applied onto a silica gel column and eluted with ethyl acetate/hexane (20%). This resulted in 45 g (59.8%) of 4-bromo-2-fluoro-5-hydroxybenzoic acid as yellow oil. m/z: 238(M+H.sup.+).

(220) Step 2: Synthesis of 4-bromo-2-fluoro-5-hydroxy-N,N-dimethylbenzamide. Into a 1-L 3-necked round-bottom flask, was placed 4-bromo-2-fluoro-5-hydroxybenzoic acid (20.0 g, 85.1 mmol, 1.0 equiv), THE (300 mL), triethylamine (19.8 g, 195.7 mmol, 2.3 equiv). This was followed by the addition of a solution of isopropyl chloroformate (26.0 g, 211.9 mmol, 2.5 equiv) in MeOH (300 mL) dropwise with stirring at 0 C. in 20 min. To this was added dimethylamine (7.60 g, 168.5 mmol, 2 equiv) at 0 C. The resulting solution was stirred for 2 h at room temperature. The resulting mixture was concentrated under vacuum. The residue was applied onto a silica gel column and eluted with ethyl acetate/hexane (50%). This resulted in 7 g (31.4%) of 4-bromo-2-fluoro-5-hydroxy-N,N-dimethylbenzamide as a yellow solid. LCMS m/z: 262 (M+H.sup.+).

(221) Step 3: Synthesis of 4-bromo-2-fluoro-5-(methoxymethoxy)-N,N-dimethylbenzamide. Into a 250-mL 3-necked round-bottom flask, was placed 4-bromo-2-fluoro-5-hydroxy-N,N-dimethylbenzamide (8.0 g, 30.53 mmol, 1.0 equiv), THE (100 mL), NaH (1.48 g, 61.6 mmol, 2.0 equiv), methane, bromomethoxy- (5.72 g, 45.77 mmol, 1.5 equiv). The resulting solution was stirred for 2 h at room temperature. The resulting solution was diluted with 500 mL of EtOAc. The resulting mixture was washed with 2100 ml of water. The mixture was dried over anhydrous sodium sulfate and concentrated under vacuum. The residue was applied onto a silica gel column eluting with ethyl acetate/hexane (50%). This resulted in 6 g (64.2%) of 4-bromo-2-fluoro-5-(methoxymethoxy)-N,N-dimethylbenzamide as colorless oil. m/z: 306 (M+H).

(222) Step 4: Synthesis of 2-fluoro-5-(methoxymethoxy)-N,N-dimethyl-4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)benzamide (B22). Into a 250-mL 3-necked round-bottom flask purged and maintained with an inert atmosphere of nitrogen, was placed Pd(dppf)Cl.sub.2 (977.2 mg, 1.34 mmol, 0.07 equiv), 4-bromo-2-fluoro-5-hydroxy-N,N-dimethylbenzamide (5.0 g, 19.08 mmol, 1.0 equiv), bis(pinacolato)diboron (5.81 g, 22.8 mmol, 1.2 equiv), KOAc (3.74 g, 38.16 mmol, 2.0 equiv), Dioxane (100 mL). The resulting solution was stirred overnight at 100 C. The resulting solution was diluted with 500 mL of EtOAc. The resulting mixture was washed with 2100 ml of water. The mixture was dried over anhydrous sodium sulfate and concentrated under vacuum. The residue was applied onto a silica gel column eluting with ethyl acetate/hexane (50%). This resulted in 3 g (44.5%) of 2-fluoro-5-(methoxymethoxy)-N,N-dimethyl-4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)benzamide as yellow oil. m/z: 354.1(M+H.sup.+).

Synthesis of 2-[4-chloro-5-fluoro-2-(methoxymethoxy)phenyl]-4,4,5,5-tetramethyl-1,3,2-dioxaborolane (B23)

(223) ##STR00345##

(224) Step 1: Synthesis of 2-bromo-5-chloro-4-fluorophenol. Into a 500-mL 4-necked round-bottom flask purged and maintained with an inert atmosphere of nitrogen, was placed 3-chloro-4-fluorophenol (30.0 g, 204.7 mmol, 1.0 equiv), CH.sub.2Cl.sub.2 (300 mL), Br.sub.2 (39.26 g, 245.65 mmol, 1.2 equiv). The resulting solution was stirred overnight at room temperature. The reaction was then quenched by the addition of 500 mL of water/ice. The resulting solution was extracted with 3500 mL of CH.sub.2Cl.sub.2 and the organic layers combined. The resulting mixture was washed with 1500 mL of brine. The mixture was dried over anhydrous sodium sulfate and concentrated under vacuum. The residue was applied onto a silica gel column eluting with ethyl acetate/petroleum ether (0-20%). This resulted in 25 g (54.2%) of 2-bromo-5-chloro-4-fluorophenol as a yellow solid.

(225) Step 2: Synthesis of 1-bromo-4-chloro-5-fluoro-2-(methoxymethoxy)benzene. Into a 250 mL 3-necked round-bottom flask were added 2-bromo-5-chloro-4-fluorophenol (8.00 g, 35.49 mmol, 1.0 equiv) and THE (110 mL). To the above mixture was added NaH (1.70 g, 42.50 mmol, 1.20 equiv, 60 wt %) in portions at 0 C. The resulting mixture was stirred for additional 30 min at 0 C. To the above mixture was added bromo(methoxy)methane (8.00 g, 64.02 mmol, 1.8 equiv) dropwise at 0 C. The resulting mixture was stirred for 2 h at room temperature. The reaction was quenched by the addition of saturated NH.sub.4Cl aq. (70 mL) at 0 C. The resulting mixture was extracted with EtOAc (350 mL). The combined organic layers were washed with brine (50 mL), dried over anhydrous Na.sub.2SO.sub.4. After filtration, the filtrate was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluted with PE to afford 1-bromo-4-chloro-5-fluoro-2-(methoxymethoxy)benzene (8.1 g, 84.7%) as a colorless oil.

(226) Step 3: Synthesis of 2-[4-fluoro-5-fluoro-2-(methoxymethoxy)phenyl]-4,4,5,5-tetramethyl-1,3,2-dioxaborolane (B23). Into a 500-mL 3-necked round-bottom flask, was placed a solution of 1-bromo-4-chloro-5-fluoro-2-(methoxymethoxy)benzene (20.0 g, 74.21 mmol, 1.0 equiv) in dioxane (200 mL), bis(pinacolato)diboron (28.27 g, 111.33 mmol, 1.5 equiv), Pd(dppf)Cl.sub.2 (2.72 g, 3.71 mmol, 0.05 equiv), KOAc (14.57 g, 148.4 mmol, 2 equiv). The resulting solution was stirred for 3 h at 100 C. The resulting mixture was concentrated. The residue was applied onto a silica gel column with ethyl acetate/petroleum ether (3:100). This resulted in 13 g (55.3%) of 2-[4-chloro-5-fluoro-2-(methoxymethoxy)phenyl]-4,4,5,5-tetramethyl-1,3,2-dioxaborolane as a solid.

Synthesis of (6-(methoxymethoxy)-4-oxo-3-(2,2,2-trifluoroethyl)-3,4-dihydroquinazolin-7-yl)boronic acid (B26)

(227) ##STR00346##

(228) Step 1: Synthesis of 4-Bromo-5-hydroxy-2-nitrobezoic acid. KOH (17 g, 303 mmol) was added to a suspension of 4-bromo-5-fluoro-2-nitrobenzoic acid (20 g, 75.8 mmol) in water (100 mL). The mixture was heated to 80 C. for 5 h. After cooled to room temperature, the mixture was acidified to pH of 4 by HCl aqueous solution. The precipitate was collected by filtration and dried on air to give 20 g of crude product 4-bromo-5-hydroxy-2-nitrobenzoic acid as yellow solid (91% yield). LCMS: m/z 283.9 [M+Na].sup.+; t.sub.R=1.47 min.

(229) Step 2: Synthesis of 4-bromo-5-hydroxy-2-nitro-N-(2,2,2-trifluoroethyl)benzamide. 2,2,2-Trifluoroethanamine (11.2 g, 113.7 mmol), DIPEA (19.6 g, 151.6 mmol) and HATU (43.2 g, 113.7 mmol) were added to a suspension of 4-bromo-5-hydroxy-2-nitrobenzoic acid (20 g, 75.8 mmol) in 50 mL of DMF and 50 mL of CH.sub.3CN. The mixture was stirred at room temperature for 1 h. The reaction mixture was concentrated to give crude 4-bromo-5-hydroxy-2-nitro-N-(2,2,2-trifluoroethyl)benzamide as yellow oil, which was used directly to next step. LCMS: m/z 342.9 [M+H].sup.+; t.sub.R=1.58 min.

(230) Step 3: Synthesis of 2-amino-bromo-5-hydroxy N-(2,2,2-trifluoroethyl)benzamide. Raney-Nickel (1.17 g, 20.0 mmol) was added to a solution of 4-bromo-5-hydroxy-2-nitro-N-(2,2,2-trifluoroethyl)benzamide (crude from above) and hydrazine hydrate (1 l g, 220 mmol) in MeOH (200 mL). The mixture was stirred at room temperature for 2 b and filtered through Celite brand filter agent. The filtrate was concentrated. The residue was purified on silica gel chromatography (0-50% EtOAc/petroleum ether) to give 19 g (total yield 76% for 3 steps) of 2-amino-4-bromo-5-hydroxy-N-(2,2,2-trifluoroethyl)benzamide as off-white solid. LCMS: m/z 313.1 [M+H].sup.+; t.sub.R=0.89 min.

(231) Step 4: Synthesis of 7-bromo-6-hydroxy-3-(2,2,2-trifluoroethyl)quinazolin-4(3H)-one. To a solution of 2-amino-4-bromo-5-hydroxy-N-(2,2,2-trifluoroethyl)benzamide (13.5 g, 43.3 mmol) and triethoxymethane (19.2 g, 129.8 mmol) in EtOH (80 mL) was added catalytic amount of 4-methylbenzenesulfonic acid (0.39 g, 2.2 mmol). The mixture was heated to 80 C. for 2 h, concentrated and the residue was triturated with petroleum ether. The solid was collected by filtration to give 9.4 g of 7-bromo-6-hydroxy-3-(2,2,2-trifluoroethyl)quinazolin-4(3H)-one as pink solid. The filtrate was concentrated and the residue was purified by silica gel chromatography (0-40% EtOAc/petroleum ether) to give 1.6 g of 7-bromo-6-hydroxy-3-(2,2,2-trifluoroethyl)quinazolin-4(3H)-one as pink solid (79% yield). LCMS: m/z 325.1 [M+H].sup.+; t.sub.R=1.74 min.

(232) Step 5: Synthesis of 7-bromo-6-(methoxymethoxy)-3-(2,2,2-trifluoroethyl)quinazolin-4(3H) one. NaH (2.1 g, 52.5 mmol, 60% in mineral oil) was added to a solution of 7-bromo-6-hydroxy-3-(2,2,2-trifluoroethyl)quinazolin-4(3H)-one (11.5 g, 35.5 mmol) in DMF (40 mL) at 0 T. The mixture was stirred for 30 min at 0 C., then bromomethyl methyl ether (3.5 mL, 42.8 mmol) was added. The resulting mixture was warmed to room temperature and stirred for 2 h, quenched with water and extracted with EtOAc (80 mL3). The extracts were washed with water and brine, and concentrated. The residue was triturated with EtOAc/petroleum ether (50%). The precipitate was filtered to give 8 g of 7-bromo-6-(methoxymethoxy)-3-(2,2,2-trifluoroethyl)quinazolin-4(3H)-one as white solid. The filtrate was concentrated and purified silica gel chromatography (0-20% EtOAc/CH.sub.2Cl.sub.2) to give an additional 3.8 g of 7-bromo-6-methoxymethoxy)-3-(2,2,2-trifluoroethyl)quinazolin-4(3H)-one as white solid (90% yield). LCMS: m/z 369.0 [M+H].sup.+; t.sub.R=1.97 min.

(233) Step 6: Synthesis of 6-(methoxymethoxy)-7-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-3-(2,2,2-trifluoroethyl)quinazolin-4(3H)-one (B26). To a solution of 7-bromo-6-(methoxymethoxy)-3-(2,2,2-trifluoroethyl)quinazolin-4(3H)-one (7.8 g, 21.2 mmol) in dioxane (60 mL) were added KOAc (6.6 g, 67.4 mmol), 4,4,4,4,5,5,5,5-octamethyl-2,2-bi(1,3,2-dioxaborolane) (11.4 g, 45 mmol) and Pd(dppf)Cl.sub.2 (823 mg, 1.13 mmol). The mixture was heated to 100 C. under N.sub.2 for 5 h. After concentration, the mixture was purified through a short silica gel column (EtOAc/petroleum ether, 50%) to give 8 g of crude product. LCMS showed mainly boronic acid signal. LCMS: m/z 333.1 [M+H].sup.+; t.sub.R=1.60 min; m/z 415.0 [M+H].sup.+; t.sub.R=2.05 min.

Synthesis of 6-methoxy-7-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)quinoxaline (B27)

(234) ##STR00347##

(235) Step 1: Synthesis of N-(5-bromo-4-methoxy-2-nitrophenyl)acetamide. 3-Bromo-4-methoxyaniline (5 g, 0.025 mmol) was added to the acetic anhydride (11.7 mL). The reaction was stirred for 1 h at room temperature. The mixture was added dropwise to the stirred solution of acetic anhydride (9.5 mL) and AcOH (6.5 mL) in HNO.sub.3 (1.8 mL, 0.028 mmol) at 0 C. Then reaction was stirred for 2 h at room temperature, quenched with saturated NaHCO.sub.3 aqueous solution. The mixture was extracted by EtOAc. The combined organic solvents were concentrated under reduced pressure. The residue was purified by silica gel flash column chromatography (0-10% EtOAc/petroleum ether) to give 6.5 g of N-(5-bromo-4-methoxy-2-nitrophenyl)acetamide (88% yield) as a black solid. LCMS: m/z 289.0 [M+H].sup.+; t.sub.R=1.68 min.

(236) Step 2: Synthesis of 5-bromo-4-methoxy-2-nitroinoline. KOH (2.4 g, 43.241 mmol) was added to a solution of N-(5-bromo-4-methoxy-2-nitrophenyl)acetamide (2.5 g, 8.648 mmol) in 25 mL of EtOH. The reaction mixture was stirred for 2 h at 80 C., and concentrated under reduced pressure. EtOAc and water was added and the organic layer separated. The organic phase was dried over Na.sub.2SO.sub.4 and concentrated to give 2.0 g crude of 5-bromo-4-methoxy-2-nitroaniline (88% yield) as a black solid. LCMS: m/z [M+H].sup.+; t.sub.R=1.70 min.

(237) Step 3: Synthesis of 4-bromo-5-methoxybenzene-1,2-diamine. Fe (5.2 g, 93.1 mmol) and AcOH (5 mL) was added to a solution of 5-bromo-4-methoxy-2-nitroaniline (2.3 g, 9.310 mmol) in 20 mL of THF. The reaction mixture was stirred for 2 h at 80 C. After cooling to room temperature, the mixture was filtered, and the filtrate was concentrated under reduced pressure. Water was added and the mixture was extracted with EtOAc. The combined organic solvents were dried over anhydrous Na.sub.2SO.sub.4 and concentrated under reduced pressure. The residue was purified by flash silica gel column chromatography (0-50% EtOAc/petroleum ether) to give 1.5 g of 4-bromo-5-methoxybenzene-1,2-diamine (41% yield) as a black solid. LCMS: m/z 217.0 [M+H].sup.+; 11=1.44 min.

(238) Step 4: Synthesis of 6-bromo-7-methoxyquinoxaline. 1,4-dioxane-2,3-diol (0.603 g, 5.017 mmol) was added to a solution of 4-bromo-5-methoxybenzene-1,2-diamine (1.089 g, 5.0 mmol) in 25 mL of EtOH. The reaction mixture was stirred overnight at room temperature, concentrated under reduced pressure, and purified by silica gel column chromatography (0-20% EtOAc/petroleum ether) to give 841 mg of 6-bromo-7-methoxyquinoxaline (70% yield) as a red solid. LCMS: m/z 241.0[M+H].sup.4; t.sub.R=1.65 min.

(239) Step 5: Synthesis of 6-methoxy-7-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)quinoxaline (B27). A mixture of 6-bromo-7-methoxyquinoxaline (200 mg, 0.837 mmol), 4,4,4,4,5,5,5,5-octamethyl-2,2-bi(1,3,2-dioxaborolane) (320 mg, 1.260 mmol), Pd(dppf)Cl.sub.2 (120 mg, 0.170 mmol), AcOK (160 mg 1.680 mmol) in 5 mL of dioxane was degassed and heated at 105 C. for 2 h under nitrogen atmosphere. After cooling to room temperature, the crude boronic ester was used directly to next step.

Synthesis of 6-methoxy-7-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)cinnoline (B28)

(240) ##STR00348##

(241) Step 1: Synthesis of 4-bromo-5-methoxy-2-nitroaniline. NBS (11.6 g, 65 mmol) was added to a solution of 5-methoxy-2-nitroaniline (10 g, 59.5 mmol) in acetonitrile (100 mL) under N.sub.2 protection. The reaction mixture was stirred and refluxed overnight. After cooling to room temperature, the mixture was quenched with water, and concentrated to give the crude product. The crude product was washed with water to give 14 g of 4-bromo-5-methoxy-2-nitroaniline (89% yield) as a brown solid. LCMS: m/z 247.1 [M+H].sup.+; t.sub.R=1.69 min.

(242) Step 2: Synthesis of 1-bromo-4-Iodo-2-methoxy-S-nitrobenzene. H.sub.2SO.sub.4 (conc, 2.25 mL) was added dropwise to a solution of 4-bromo-5-methoxy-2-nitroaniline (4 g, 16.3 mmol) in acetonitrile (100 mL) under N.sub.2 protection at 20 C. Then NaNO.sub.2 (2.25 g, 2 eq) was added slowly. The reaction mixture was stirred at 20 C. for 30 min, KI (10.8 g, 4 eq) was added at the same temperature. 100 mL of water was added to quench the reaction and the resulting mixture was extracted with DCM (180 mL3). The combined organic phases were washed with brine, dried over anhydrous Na.sub.2SO.sub.4, concentrated and purified by silica gel chromatography (0-50% EtOAc/petroleum ether) to give 2.5 g of 1-bromo-4-iodo-2-methoxy-5-nitrobenzene (42.8% yield) as a yellow solid. LCMS: m/z 358.2 [M+H].sup.+; t.sub.R=1.88 min.

(243) Step 3: Synthesis of 5-bromo-2-iodo-4-methoxyaniline. Fe (550 mg, 1.0 equiv) and HCl (0.98 ml, 1M) were added to a solution of 1-bromo-1-iodo-2-methoxy-5-nitrobenzene (3.5 g, 9.8 mmol) in EtOH (10 mL). The reaction mixture was stirred at 80 C. for 2 h, filtered and the filtrate's pH was adjusted to pH 8-9 by saturated K.sub.2CO.sub.3 aqueous solution. Then the mixture was extracted with DCM (50 mL3). The combined organic phases were washed with brine, dried over anhydrous Na.sub.2SO.sub.4, concentrated and purified by silica gel chromatography (0-20% EtOAc/petroleum ether) to give 3 g of 5-bromo-2-iodo-4-methoxyaniline (93.6% yield) as a yellow solid. LCMS: m/z 328.1 [M+H].sup.+; t.sub.R=1.75 min.

(244) Step 4: Synthesis of (E)-1-(5-bromo-2-iodo-4-methoxyphenyl)-3,3-diethyltriazole. 5-bromo-2-iodo-4-methoxyaniline (4.2 g, 12.8 mmol) was dissolved in a minimum amount of MeCN. HCl (12 M, 8.5 mL, conc.) and ice (10 g) were added. The suspension was cooled to 5 C., and a solution of NaNO.sub.2 (1.9 g, 2.2 equiv) in 1.5 mL of water and 0.5 mL of CH.sub.3CN was added slowly during which the temperature was kept between 5 and 2 C. Once the addition was complete, the solution was stirred at 5 C. for 30 min, and then it was transferred slowly via cannula to a solution of Et.sub.2NH (13.3 mL, 10 equiv) and K.sub.2CO.sub.3 (8.8 g, 5 equiv) in 3:1 water/CH.sub.3CN (0.1 M) and then cooled to 0 C. Once the transfer was complete, the mixture was allowed to gradually warm to room temperature overnight, diluted with water and extracted with Et.sub.2O. The combined organic layers were dried over MgSO.sub.4, filtered, concentrated and purified by silica gel chromatography (0-20% EtOAc/petroleum ether) to give 4 g of (E)-1-(5-bromo-2-iodo-4-methoxyphenyl)-3,3-diethyltriaz-1-ene (80% yield). LCMS: m/z 412.1 [M+H].sup.+; t.sub.R=2.21 min.

(245) Step 5: Synthesis of (E)-1-(5-bromo-4-methoxy-2-((trimethylsilyl)ethynyl)phenyl)-3,3-diethyltriaz-1-ene. A solution of (E)-1-(5-bromo-2-iodo-4-methoxyphenyl)-3,3-diethyltriaz-1-ene (4 g, 9.73 mmol), Pd(PPh.sub.3).sub.2Cl.sub.2 (273 mg, 0.04 equiv), CuI (130 mg, 0.07 equiv) and (trimethylsilyl) acetylene (1.43 mL, 10.2 mmol) in triethylamine (100 mL) was immediately degassed and heated to 50 C. with stirring overnight. After cooling to room temperature, the mixture was filtered, concentrated and purified by silica gel chromatography (0-5% EtOAc/petroleum ether) to give 3.2 g of (E)-1-(5-bromo-4-methoxy-2-((trimethylsilyl)ethynyl)phenyl)-3,3-diethyltriaz-1-ene (86% yield) as a white solid. LCMS: m/z 382.1 [M+H].sup.+; t.sub.R=2.53 min.

(246) Step 6: Synthesis of (E)-1-(S-bromo-2-ethynyl-4-methoxyphenyl)-3,3-diethyltriaz-1-ene. To a solution of (E)-1-(5-bromo-1-methoxy-2-((trimethylsilyl)ethynyl)phenyl)-3,3-diethyltriaz-1-ene (3.2 g, 8.4 mmol) in 100 mL of THE and 33 mL of H.sub.2O was added K.sub.2CO.sub.3 (11.6 g, 84 mmol). The mixture was stirred at room temperature under N.sub.2 protection for 4 h. Water was added to quench the reaction. The resulting mixture was extracted with EtOAc (100 ml3). The combined organic phases were washed with brine, dried over anhydrous Na.sub.2SO.sub.4, concentrated and purified by silica gel chromatography (0-10% EtOAc/petroleum ether) to give 2.5 g of (E)-1-(5-bromo-2-ethynyl-4-methoxyphenyl)-3,3-diethyltriaz-1-ene (96% yield) as a yellow solid. LCMS: m/z 310.2 [M+H].sup.+; t.sub.R=2.10 min.

(247) Step 7: Synthesis of 7-bromo-6-methoxycinnoline. A solution of (E-1-(5-bromo-2-ethynyl-4-methoxyphenyl)-3,3-diethyltriaz-1-ene (2.5 g, 8 mmol) in 1,2-dichlorobenzene (100 mL) was stirred at 200 C. under N.sub.2 protection for 4 h. After cooling to room temperature, the mixture was concentrated and purified by silica gel chromatography (0-50% EtOAc/petroleum ether) to give 450 mg of 7-bromo-6-methoxycinnoline (23% yield) as a yellow solid. LCMS: m/z 239.1 [M+H].sup.+; t.sub.R=1.55 min.

(248) Step 8: Synthesis of 6-methoxy-7-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)cinnoline (B28). To a solution of 7-bromo-6-methoxycinnoline (450 mg, 1.89 mmol) in dioxane (100 mL) was added Bis(pinacolato)diboron (720 mg, 2.84 mmol), Pd(dppf)Cl.sub.2 (276 mg, 0.378 mmol) and KOAc (370 mg, 3.78 mmol). The reaction mixture was stirred at 105 C. under N.sub.2 protection overnight. After cooling to room temperature, the crude 6-methoxy-7-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)cinnoline (400 mg) was directly in next step. LCMS: m/z 205.1 [M+H].sup.+; t.sub.R=1.08 min.

Synthesis of (2-hydroxy-4-(2H-1,2,3-triazol-2-yl)phenyl)boronic acid (B29)

(249) ##STR00349##

(250) Step 1: Synthesis of 4,5-dibromo-2-(3-methoxy-4-nitrophenyl)-2H-1,2,3-triazole. K.sub.2CO.sub.3 (4.04 g, 29.2 mmol) was added to a solution of 4-fluoro-2-methoxy-1-nitrobenzene (5 g, 29.2 mmol) and 4,5-dibromo-2H-1,2,3-triazole (6.63 g, 29.2 mmol) in DMF (100 mL). The resulting mixture was stirred at 80 C. for 16 h. After cooling to room temperature, the mixture was poured into ice-water (100 mL) and extracted with EtOAc. The organic layers were washed with water (100 mL), dried over anhydrous MgSO.sub.4, concentrated in vacuum to give 4,5-dibromo-2-(3-methoxy-4-nitrophenyl)-2H-1,2,3-triazole (10 g, 97%) as a white solid. LCMS: m/z 378.9 [M+H].sup.+; t.sub.R=250 min.

(251) Step 2: Synthesis of 2-methoxy-4-(2H-1,2,3-triazol-2-yl)aniline. Pd/C (1 g 10% on activated carbon) was added to a solution of 4,5-dibromo-2-(3-methoxy-4-nitrophenyl)-2H-1,2,3-triazole (10 g, 26.5 mmol) in MeOH (150 mL). The mixture was stirred under hydrogen atmosphere for 5 h and filtered. The filtrate was concentrated in vacuum to give 2-methoxy-4-(2H-1,2,3-triazol-2-yl)aniline (5 g, yield 98%) as a white solid. LCMS: m/z 191 [M+H].sup.+; t.sub.R=0.574 min.

(252) Step 3: Synthesis of (2-methoxy-4-(2H-1,2,3-triazol-2-yl)phenyl)boronic add. A pre-cooled (15 C.) solution of t-BuONO (2.61 g, 25.3 mmol) and 2-methoxy-4-(2H-1,2,3-triazol-2-yl)aniline (4.0 g, 21 mmol) in AcOH (80 mL) was added dropwise to a precooled solution of TfOH (3.79 g, 25.3 mmol) in AcOH (80 mL). The reaction was stirred for 10-20 min at 10-15 C., then poured into cold Et.sub.2O (1000 mL). The precipitated diazonium salt was collected by filtration and dried in vacuum to give 2-methoxy-4-(2H-1,2,3-triazol-2-yl)benzenediazonium, trifluoromethanesulfonic salt (7.4 g, yield 95%) as a white solid. LCMS: m/z 202.2 [M+].sup.+; t.sub.R=0.737 min. The 2-methoxy-4-(2H-1,2,3-triazol-2-yl)benzenediazonium, trifluoromethanesulfonic salt (7.4 g, 21 mmol) was dissolved in water (150 mL). Hypodiboric acid (4.74 g, 52.7 mmol) was added. The reaction mixture was stirred at 25 C. for 3 h. The precipitate was collected by filtration and dried in vacuum to give (2-methoxy-4-(2H-1,2,3-triazol-2-yl)phenyl)boronic acid (4.6 g, yield 99/6) as a white solid. LCMS: m/z 220.2 [M+H].sup.+; t.sub.R=1.127 min.

(253) Step 4: Synthesis of (2-hydroxy-4-(2H-1,2,3-triazol-2-yl)phenyl)boronic add. BBr.sub.3 (4.6 mL, 18.26 mmol, 4M) was added to a solution of (2-methoxy-4-(2H-1,2,3-triazol-2-yl)phenyl)boronic acid (1000 mg, 4.57 mmol) in DCM (4 mL). The reaction mixture was stirred at 20 C. for 18 h under N.sub.2 atmosphere, concentrated in vacuum and purified by silica gel column (10-25% EtOAc/petroleum ether) to give (2-hydroxy-4-(2H-1,2,3-triazol-2-yl)phenyl)boronic acid (450 mg, 59% yield) as a yellow solid. LCMS: m/z 206.2 [M+H].sup.+; t.sub.R=0.898 min.

Synthesis of (2-methoxy-4-((1-methyl-1H-pyrazol-4-yl)oxy)phenyl)boronic acid (B30)

(254) Step 1: Synthesis of 4-(3-methoxy-nitrophenoxy)-1-methyl-1H-pyrazole. A mixture of 4-fluoro-2-methoxy-1-nitrobenzene (2.1 g, 12.2 mmol), 1-methyl-1H-pyrazol-4-ol (1.0 g, 10.2 mmol) and K.sub.2CO.sub.3 (2.82 g, 20.4 mmol) in DMSO (50 mL) was degassed and stirred at 110 C. under nitrogen for 16 h. After cooling to the ambient temperature, the mixture was extracted with ethyl acetate (20 mL2). The combined organic layers were dried over anhydrous sodium sulfate. The residue was purified with silica gel chromatography (10% of ethyl acetate in petroleum ether) to give 4-(3-methoxy-4-nitrophenoxy)-1-methyl-1H-pyrazole (2.83 g, 90% yield) as a white solid. LCMS: m/z 250.1 [M+H].sup.+; t.sub.R=1.62 min.

(255) Step 2: Synthesis of 2-methoxy-4-((1-methyl-1H-pyrazol-4-yl)oxy)aniline. Pd/C (150 mg, 10% on activated carbon) was added to a solution of 4-(3-methoxy-4-nitrophenoxy)-1-methyl-1H-pyrazole (1.416 g) in methanol (30 mL). The resulting mixture was stirred at 25 C. under hydrogen for 3 h, filtered, concentrated and purified with silica gel chromatography (33% ethyl acetate/petroleum ether) to give 2-methoxy-4-(1-methyl-1H-pyrazol-4-yl)oxy)aniline (1.01 g, 86% yield) as a brown oil. LCMS: m/z 220.1 [M+H].sup.+; t.sub.R=0.67 min.

(256) Step 3: Synthesis of 2-methoxy-4-((1-methyl-1H-pyrazol-4-yl)oxy)benzenediazonium, triflic salt. TfOH (805 mg, 5.364 mmol) in acetic acid (25 mL) was added to a solution of 2-methoxy-4-((1-methyl-1H-pyrazol-4-yl)oxy)aniline (1.0 g, 4.47 mmol) and t-BuONO (1.31 g, 11.175 mmol) in acetic acid (25 mL). The resulting mixture was stirred at 10 C. under nitrogen for 20 mins. The mixture was poured to cold diethyl ether (70 mL), the precipitated diazonium salt was collected by filtration and died in vacuum to give 2-methoxy-4 ((1-methyl-1H-pyrazol-4-yl)oxy)benzenediazonium, triflic salt (1.65 g, 92% yield) as a brown oil. LCMS: m/z 231.1 [M+H].sup.+; t.sub.R=0.38 min.

(257) Step 4: Synthesis of (2-methoxy-4-((1-methyl-1H-pyrazol-4-yl)oxy)phenyl)boronic acid. 2-methoxy-4-((1-methyl-1H-pyrazol-4-yl)oxy)benzenediazonium, triflic salt (1.652 g, 4.127 mmol) was dissolved in water (12 mL). B.sub.2(OH).sub.4 (925 mg, 10.317 mmol) was added, and the resulting mixture was stirred at 25 C. under nitrogen for 3 h. The mixture was extracted with ethyl acetate (20 mL2). The combined organic layers were dried over anhydrous sodium sulfate, filtered, and then concentrated under reduced pressure. The residue was purified with silica gel chromatography (20% of methanol in dichloromethane) to give (2-methoxy-4-((1-methyl-1H-pyrazol-4-yl)oxy)phenyl)boronic acid (407 mg, 33% yield) as a brown oil. LCMS: m/z: 249.1 [M+H].sup.+; to t.sub.R=1.09 min.

Synthesis of 4-(4-methoxybenzyloxy)-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2 yl)picolinonitrile (B31)

(258) Step 1: Synthesis of 3-bromo 4-methoxybenzyloxy)pyridine. NaH (0.6 g, 15.0 mmol, 60% in mineral oil) was added to a solution of (4-methoxyphenyl)methanol (1.38 g, 10.0 mmol) in DMF (30 mL) at 0 C. After stirring for 20 min, 3-bromo-4-chloropyridine (1.78 g, 9.3 mmol) was added in portions. The mixture was stirred at 80 C. for 2 h. After cooling to room temperature, the reaction was quenched with water and the precipitate was collected by filtration and dried in vacuo to give 3-bromo-4-(4-methoxybenzyloxy)pyridine as white solid (2.71 g), which was used directly to next step. LCMS: m/z 294.1 [M+H].sup.+. t.sub.R=1.11 min.

(259) Step 2: Synthesis of 3-bromo-4 (4-methoxybenzyloxy)pyridine 1-oxide. m-CPBA (2.8 g, 16.3 mmol) was added to a solution of 3-bromo-4-(4-methoxybenzyloxy)pyridine (2.71 g, 9.2 mmol) in CH.sub.2Cl.sub.2 (30 mL) at room temperature. The mixture was stirred for 20 h and quenched with 1 N NaOH aqueous solution and extracted with CH.sub.2Cl=(50 mL2). The organic layers were concentrated to give 3-bromo-4-(4-methoxybenzyloxy)pyridine 1-oxide (2.9 g), which was used directly to next step. LCMS: m/z 312.1 [M+H].sup.+. t.sub.R=1.24 min.

(260) Step 3: Synthesis of 5-bromo-4-(4-methoxybenzyloxy)picolinonitrile. To a solution of 3-bromo-4-(4-methoxybenzyloxy)pyridine 1-oxide (2.71 g, 8.7 mmol) in CH.sub.2Cl.sub.2 (30 mL) were added TMSCN (1.4 g, 14.1 mmol) and dimethylcarbamic chloride (1.6 g, 14.9 mmol). The solution was stirred at room temperature for 20 h, quenched with aqueous NaHCO.sub.3 solution and extracted with CH.sub.2Cl.sub.2 (50 mL2). The combined organic layers were concentrated and purified on silica chromatography (0-40% EtOAc/petroleum ether) to give 5-bromo-4 (4-methoxybenzyloxy)picolinonitrile as white solid (0.52 g, t.sub.R=2.09 min) and 3-bromo-4-(4-methoxybenzyloxy)picolinonitrile as white solid (0.57 g, t.sub.R=2.03 min). LCMS: m/z 343.0 [M+Na].sup.+.

(261) Step 4: Synthesis of 4-((4-methoxybenzyl)oxy)-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)picolinonitrile (B31). A mixture of 5-bromo-4-(4-methoxybenzyloxy)picolinonitrile (0.45 g, 1.41 mmol), bis(pinacolato)diboron (716 mg, 2.82 mmol), Pd(dppf)Cl.sub.2 (50 mg, 0.07 mmol) and KOAc (414 mg, 4.22 mmol) in dioxane (10 mL) was degassed and stirred at 100 C. under argon for 2 h. After cooling to room temperature, the mixture was quenched with water (30 mL) and extracted with EtOAc (20 mL2). The extracts were washed with brine (20 mL), dried over anhydrous Na.sub.2SO.sub.4, filtered and the filtrate was concentrated and purified by silica gel chromatography (0-50% EtOAc/petroleum ether) to give 4 ((4-methoxybenzyl)oxy)-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)picolinonitrile as red oil (0.20 g). LCMS: m/z 367.2 [M+H].sup.+, t.sub.R=2.12 min.

Synthesis of 2-fluoro-4-(methoxymethoxy)-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)benzonitrile (B32)

(262) ##STR00350##

(263) Step 1: Synthesis of 5-bromo-2-fluoro-4-hydroxybenzonitrile. To a mixture of 2-fluoro-4-hydroxybenzonitrile (1.37 g, 10 mmol) in CH.sub.3CN (20 mL) was added triflic acid (1.80 g, 12 mmol) and NBS (1.88 g, 11 mmol) portionwise at 30 C. After addition, the resulting mixture was stirred at room temperature overnight, diluted with water (40 mL), and extracted with EtOAc (40 mL3). The combined organic layers were dried over anhydrous Na.sub.2SO.sub.4, concentrated it vacuo, and purified by reverse-phase chromatography (eluting with 20% CH.sub.3CN in water with water (0.01% TFA)) to give 678 mg of 5-bromo-2-fluoro-4-hydroxybenzonitrile (16% yield) as a yellow solid. LCMS: m/z 216.0 [M+H].sup.+, t.sub.R=1.65 min.

(264) Step 2: Synthesis of 5-bromo-2-fluor-4-(methoxyethoxy)benzonitrile. To a solution of 5-bromo-2-fluoro-4-hydroxybenzonitrile (678 mg, 3.1 mmol) in THE (15 mL) was added NaH (174 mg, 4.35 mmol, 60% in mineral oil) at 0 C. After stirring for 0.5 h, MOMBr (584 mg, 4.67 mmol) was added at 0 C. The mixture was stirred at room temperature for 1.5 h, quenched with water (20 mL), and extracted with EtOAc (20 mL3). The combined organic layers were washed with brine, dried over anhydrous Na.sub.2SO.sub.4, concentrated and purified by silica gel chromatography (10% EtOAc/petroleum ether) to give 615 mg of 5-bromo-2-fluoro-4-methoxymethoxy)benzonitrile (75% yield) as a white solid. LC-MS: m/z 260.0 [M+H].sup.+, t.sub.R=2.00 min.

(265) Step 3: Synthesis of 2-fluoro-4-(methoxymethoxy)-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)benzonitrile (B32). A mixture of 5-bromo-2-fluoro-4-(methoxymethoxy)benzonitrile (615 mg, 2.4 mmol), 4,4,4,4,5,5,5,5-octamethyl-2,2-bi(1,3,2-dioxaborolane) (1.2 g, 4.7 mmol), Pd(dppf Cl.sub.2 (194 mg, 0.24 mmol) and KOAc (698 mg, 7.1 mmol) in dioxane (8 mL) was stirred at 100 C. for 2 h under nitrogen atmosphere. The mixture was concentrated and purified by silica gel chromatography (5% MeOH/CH.sub.2Cl.sub.2) to give 727 mg of 2-fluoro-4-(methoxymethoxy)-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)benzonitrile (71% yield) as a white solid. LCMS showed boronic acid signal. LC-MS: m/z 226.1 [M+H].sup.+, t.sub.R=1.13 min.

Synthesis of 6-methoxy-7-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)isoquinoline (B33)

(266) ##STR00351##

(267) Step 1: Synthesis of 2-amino-5-bromo-4-methoxybenzoic acid. NBS (6.4 g, 56 mmol) in 5 mL of DMF was added to a solution of 2-amino-4-methoxybenzoic acid (6 g, 56 mmol) in 30 mL of DMF at 0 C. After stirring at 0 C. for 1 h, the mixture allow to warm up to room temperature and stirred for 16 h. Saturated Na.sub.2SO.sub.3 (80 mL) was added and the mixture was acidified with 1 N HCl aqueous solution till pH=3. The precipitate was collected by filtration and dried in vacuum to give 8.5 g of 2-amino-5-bromo-4-methoxybenzoic acid as white solid (96% yield), which was used directly to next step. LCMS: m/z 246.0 [M+H].sup.+; t.sub.R=1.12 min.

(268) Step 2: Synthesis of 6-bromo-7-methoxyquinazolin-4-ol. Formimidamide acetic acid (9.4 g, 90.2 mmol) was added to a solution of 2-amino-5-bromo-4-methoxybenzoic acid (8.5 g, 34.7 mmol) in 2-methoxyethan-1-ol (20 mL). The mixture was stirred at 135 C. for 16 h. After cooling to room to room temperature, the mixture was poured into 20 mL of H.sub.2O. The precipitate was collected by filtration and dried in vacuum to give 7.6 g of 6-bromo-7-methoxyquinazolin-4-ol (86% yield) as yellow solid, which was used directly to next step. LCMS: m/z 257.0 [M+H].sup.+; t.sub.R=1.48 min.

(269) Step 3: Synthesis of 6-bromo-4-chloro-7-methylquinazoline. DMF (1 m) was added to a stirred solution of 6-bromo-7-methoxyquinazolin-4-ol (7.6 g, 29.8 mmol) in 150 mL of SOCl.sub.2. The mixture was stirred at 80 C. for 3 h and concentrated. 50 mL of saturated NaHCO.sub.3 aqueous solution was added. The resulting mixture was extracted with EtOAc (50 mL3). The combined organic solvents were washed with brine (50 mL), dried over anhydrous Na.sub.2SO.sub.4, concentrated and purified by silica gel chromatography (0-70% CH.sub.2Cl.sub.2/petroleum ether) to give 6.1 g of 6-bromo-4-chloro-7-methoxyquinazoline as a white solid (75% yield). LCMS: m/z 273.0 [M+H].sup.+; t.sub.R=1.90 min.

(270) Step 4: Synthesis of 6-bromo-7-methoxyquinazoline. TsNHNH.sub.2 (5.81 g, 31.2 mmol) was added to a solution of 6-bromo-4-chloro-7-methoxyquinazoline (6.1 g, 22 mmol) in 80 mL of CH.sub.2Cl.sub.2. After stirring at 85 C. for 3 h, the mixture was concentrated. Then EtOH (100 mL) and NaOH aqueous solution (80 mL, 2N) were added. The mixture was then stirred at 85 C. for 3 h. After cooling to room temperature, the mixture was extracted with 2-methoxy-2-methylpropane (50 mL4). The combined organic solvents were washed with brine (50 mL), concentrated and purified by silica gel chromatography (0-45% EtOAc/petroleum ether) to give 5.3 g of 6-bromo-7-methoxyquinazoline as yellow solid (97% yield). LCMS: m/z 239.0 [M+H].sup.+; lit 1.57 min.

(271) Step 5: Synthesis of 6-bromoquinazoline-7-ol. A mixture of 6-bromo-7-methoxyquinazoline (4 g, 16.7 mmol), dec anethiol (8.76 g, 50 mmol) and K.sub.2CO.sub.3 (6.94 g, 50 mmol) in 10 mL of NMP was stirred at 120 C. for 4 h. The mixture was purified by prep-HPLC (0-50% H.sub.2O (0.02% TFA/MeOH) afford 1.2 g of 6-bromoquinazoline-7-ol as yellow solid (32% yield). LCMS: m/z 225.0 [M+H].sup.+; t.sub.R=1.28 min.

(272) Step 6: Synthesis of 6-bromo-7-(methoxymethoxy)quinazoline. NaH (373 mg, 9.33 mmol, 60. in mineral oil) was added to a stirred solution of 6-bromoquinazoline-7-ol (1.05 g, 4.67 mmol) in 20 mL of THE at 0 C. After stirring for 30 min, MOMBr (758 mg, 6.1 mmol) was added. The mixture was then stirred at room temperature, quenched with water (5 mL) and extracted with EtOAc (20 mL3). The combined organic solvents were concentrated and purified by silica gel chromatography (0-20% EtOAc/CH.sub.2Cl.sub.2) to give 440 mg of 6-bromo-7-(methoxymethoxy)quinazoline as yellow solid (35% yield). LCMS: m/z 269.0 [M+H].sup.+; t.sub.R=1.28 min.

(273) Step 7: Synthesis of 6-methoxy-7-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)isoquinoline (B33). A mixture of 6-bromo-7-(methoxymethoxy)quinazoline (120 mg, 0.446 mmol), 4,4,4,4,5,5,5,5-octamethyl-2,2-bi(1,3,2-dioxaborolane) (170 mg, 0.669 mmol), Pd(dppf)Cl.sub.2 (66 mg, 0.089 mmol) and KOAc (88 mg, 0.892 mmol) in 1,4-dioxane (3 mL) was degassed and stirred at 105 C. for 8 h under N.sub.2. The reaction was cooled to room temperature and used in the next step without any work-up. LCMS: m/z 317.2 [M+H].sup.+; t.sub.R=1.67 min.

Synthesis of 6-(methoxymethoxy)-1-methyl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1H-indazole (B34)

(274) ##STR00352##

(275) Step 1: Synthesis of 5-bromo-6-methoxy-1-methyl-1H-indazole. NaH (704 mg, 17.6 mmol, 60% in mineral oil) was added to a stirred solution of 5-bromo-6-methoxy-1H-indazole (2.0 g, 8.8 mmol) in 50 mL of DMF at room temperature. After stirring room temperature for 30 min, CH.sub.3I (1.9 g, 13.2 mmol) was added. The mixture was then stirred at room temperature for 2 h, quenched with ice water, extracted with EtOAc (100 mL3). The combined organic solvents were washed with brine, dried over anhydrous Na.sub.2SO.sub.4, concentrated and purified by silica gel chromatography (0.50% EtOAc/petroleum ether) to give 1.5 g of 5-bromo-6-methoxy-1-methyl-1H-indazole as white solid (71% yield). LCMS: m/z 241.0 [M+H].sup.+; t.sub.R=1.58 min.

(276) Step 2: Synthesis of 5-bromo-1-methyl-1H-indazol-6-ol. To a solution of 5-bromo-6-methoxy-1-methyl-1H-indazole (1.5 g, 6.2 mmol) in CH.sub.2Cl.sub.2 (10 mL) at room temperature was added BBr.sub.3 (40 mL, 1N in CH.sub.2Cl.sub.2). The reaction mixture was stirred at 50 C. for 20 h, then quenched with ice water. Saturated aqueous sodium bicarbonate was added to adjust pH to 89. The mixture was extracted with CH.sub.2Cl.sub.2 (100 mL3). The combined organic solvents were washed with brine (100 mL), dried over anhydrous Na.sub.2SO.sub.4, concentrated and purified by silica gel column (0-10% MeOH/CH.sub.2Cl.sub.2) to give 800 mg of 5-bromo-1-methyl-1H-indazol-6-ol as yellow solid (56% yield). LCMS: m/z 227.1 [M+H].sup.+; t.sub.R=1.78 min.

(277) Step 3: Synthesis of 5-bromo-6-methoxymethoxy)-1-methyl-1H-indazole. NaH (280 mg, 7.0 mmol, 60% in mineral oil) was added to a stirred solution of 5-bromo-1-methyl-1H-indazol-6-ol (800 mg, 3.5 mmol) in 10 mL of DMF at room temperature. After stirring room temperature for 30 min, MOMBr (657 mg, 5.3 mmol) was added. The mixture was then stirred at room temperature for 2 h, quenched with ice water, extracted with EtOAc (100 mL3). The combined organic solvents were washed with brine, dried over anhydrous Na.sub.2SO.sub.4, concentrated and purified by silica gel chromatography (0-25% EtOAc/petroleum ether) to give 950 mg of 5-bromo-6-(methoxymethoxy)-1-methyl-1H-indazole as yellow oil (99% yield). LCMS: m/z 271.2 [M+H].sup.+; t.sub.R=1.62 min.

(278) Step 4: Synthesis of 6-(methoxymethoxy)-1-methyl-5-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1H-Indazole (B34). A mixture of 5-bromo-6-(methoxymethoxy)-1-methyl-1H-indazole (200 mg, 0.74 mmol), 4,4,4,4,5,5,5,5-octamethyl-2,2-bi(1,3,2-dioxaborolane) (284 mg 1.12 mmol), Pd.sub.2(dba).sub.3 (128 mg, 0.14 mmol), X-Phos (134 mg, 0.28 mmol), and KOAc (146 mg, 1.48 mmol) in 6 mL of dioxane was degassed and stirred at 100 C. for 2 h. The mixture was cooled to room temperature. The crude boronic ester was used directly to next step. LCMS: m/z 337.2 [M+H].sup.+; t.sub.R=1.73 min.

Synthesis of 3-(methoxymethoxy)-N-methyl-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)benzamide (B35)

(279) ##STR00353##

(280) Step 1: Synthesis of 4-bromo-3-hydroxy-N-methylbenzamide. To the solution of 4-bromo-3-hydroxybenzoic acid (8.0 g, 37.0 mmol) in DMF (100 mL) were added HATU (15.5 g, 40.8 mmol), MeNH.sub.2 HCl (7.4 g, 110.0 mmol) and DIPEA (11.9 g, 92.2 mmol). The mixture was stirred at room temperature for 3 h, quenched with H.sub.2O (300 mL), and extracted with EtOAc (200 mL2). The combined organic phases were dried over anhydrous Na.sub.2SO.sub.4, concentrated, and purified by silica gel chromatography (0-5% EtOAc/petroleum ether) to give 8.0 g of 4-bromo-3-hydroxy-N-methylbenzamide as a white solid (95% yield). LCMS: m/z 232.1 [M+H].sup.+; t.sub.R=1.39 min.

(281) Step 2: Synthesis of 4-bromo-3--(methoxymethoxy)-N-methylbenzamide. NaH (4.72 g, 117.9 mmol, 60% in mineral oil) was added to a stirred solution of 4-bromo-3-hydroxy-N-methylbenzamide (9.0 g, 39.3 mmol) in 100 mL of THF at 25 C. After stirring at 25 C. for 30 min, MOMBr (5.8 g, 46.7 mmol) was added. The mixture was then stirred at room temperature for 16 h, quenched with NH.sub.4Cl aqueous solution (100 mL), and extracted with EtOAc (100 mL2). The combined organic solvents were dried over anhydrous Na.sub.2SO.sub.4, concentrated and purified by silica gel chromatography (0-25% EtOAc/petroleum ether) to give 7.0 g of 4-bromo-3-(methoxymethoxy)-N-methylbenzamide as colorless oil (84% yield), LCMS: LCMS: m/z 274.0 [M+H].sup.+; t.sub.R=1.71 min.

(282) Step 3: Synthesis of 3-(methoxymethoxy)-N-methyl-(4,4,5,5-tetramethyl-1,3,2-dioxaboran-2-yl)benzamide (B35). A mixture of 4-bromo-3-(methoxymethoxy)-N-methylbenzamide (300 mg, 0.41 mmol), 4,4,4,4,5,5,5,5-octamethyl-2,2-bi(1,3,2-dioxaborolane) (418 mg, 0.82 mmol), Pd(dppf)Cl.sub.2 (160 mg, 0.11 mmol) and KOAc (216 mg, 1.1 mmol) in 14 mL of dioxane was degassed and stirred at 100 C. for 2 h. After cooling to room temperature, the mixture was used in next step without further purification.

Synthesis of 5-(methoxymethoxy)-3-methyl-6-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)benzo[d]oxazol-2(3H)-one (B36)

(283) ##STR00354##

(284) Step 1: Synthesis of 2-amino-methoxyphenol. A mixture of 4-methoxy-2-nitrophenol (10 g, 59.17 mmol) and Pd/C (3 g, 10% on activated carbon) in MeOH (25 mL) was stirred at room temperature for 5 h under H.sub.2 atmosphere. Then the mixture was filtered and concentrated to give 8.5 g of 2-amino-4-methoxyphenol as yellow oil (97% yield), which was used directly to next step. LCMS: m/z 140.1 [M+H].sup.+; t.sub.R=0.35 min.

(285) Step 2: Synthesis of 5-methoxybenzo[d]oxazol-2(3H)-one. A mixture of 2-amino-4-methoxyphenol (18.5 g, 133 mmol) and CDI (28.05 g, 172.9 mmol) in THF (50 ml) was stirred at 70 C. for 2 h. After cooling to room temperature, the mixture was quenched with water (400 mL), and extracted with EtOAc (500 mL3). The combined organic solvents were washed with brine (400 ml3), dried over anhydrous Na.sub.2SO.sub.4 and concentrated to give 31.5 g of 5-methoxybenzo[d]oxazol-2(3R)-one as colorless oil (98% yield), which was used directly to next step. LCMS: m/z 166.2 [M+H].sup.+; t.sub.R=1.61 min.

(286) Step 3: Synthesis of 6-bromo-5-methoxybenzo[d]oxazol-2(3H)-one. NBS (20.0 g, 112.1 mmol) was added to a mixture of 5-methoxybenzo[d]oxazol-2(3H)-one (18.5 g, 112.1 mmol) and in DMF (50 ml). The mixture was stirred at room temperature for 1 h, quenched with water (200 mL), and extracted with EtOAc (250 mL3). The combined organic solvents were washed with LiCl aqueous solution (200 mL3), dried over anhydrous Na.sub.2SO.sub.4, concentrated and purified by silica gel chromatography (0-10% EtOAc/petroleum ether) to give 22.8 g of 6-bromo-5-methoxybenzo[d]oxazol-2(3H)-one as brown solid (91% yield). LCMS: m/z 245.9 [M+H].sup.+; t.sub.R=1.76 min.

(287) Step 4: Synthesis of 6-bromo-5-methoxy-3-methylbenzo[d]oxazol-2(3H)-one. Mel (26.5 g, 0.18 mol) was added to a mixture of 6-bromo-5-methoxybenzo[d]oxazol-2(3H)-one (22.8 g, 0.09 mol) and K.sub.2CO.sub.3 (25.8 g, 0.18 mol) in DMF (100 mL). The mixture was stirred at room temperature overnight, quenched with water (200 mL), and extracted with EtOAc (80 mL3). The combined organic solvents were washed with LiCl aqueous solution (200 ml3), dried over anhydrous Na.sub.2SO.sub.4, concentrated and purified by silica gel chromatography (0-30% EtOAc/petroleum ether) to give 23.2 g of 6-bromo-5-methoxy-3-methylbenzo[d]oxazol-2(3H)-one as brown solid (96% yield). LCMS: m/z 259.0 [M+H].sup.+; t.sub.R=1.72 min.

(288) Step 5: Synthesis of 6-bromo-5-hydroxy-3-methylbenzo[d]oxazol-2(3H)-one. To a solution of 6-bromo-5-methoxy-3-methylbenzo[d]oxazol-2(3H)-one (2.3 g, 8.91 mmol) in CH.sub.2Cl.sub.2 (20 mL) was added BBr.sub.3 (20 mL, 1N in CH.sub.2Cl.sub.2). The mixture was stirred at room temperature for 1 hour, quenched with water (100 mL) and the pH value was adjusted to 9-10 with K.sub.2CO.sub.3. The mixture was extracted with CH.sub.2Cl.sub.2/MeOH (10:1, v/v, 120 mL3). The combined organic layers were washed with brine, dried over anhydrous Na.sub.2SO.sub.4, and concentrated under reduced pressure to give 2 g of 6-bromo-5-hydroxy-3-methylbenzo[d]oxazol-2(3H)-one as yellow oil (71% yield), which was used directly to next step. LCMS: m/z 245.9 [M+H].sup.+; t.sub.R=1.51 min.

(289) Step 6: Synthesis of 6-bromo-5-(methoxymethoxy)-3-methylbenzo[d]oxazol-2(3H)-one. NaH (656 mg, 16.4 mmol, 60% in mineral oil) was added to a stirred solution of 6-bromo-5-hydroxy-3-methylbenzo[d]oxazol-2(3H)-one (2.0 g, 8.2 mmol) in 20 mL of DMF at 0 C. After stirring at 0 C. for 30 min, MOMBr (2.0 g, 16.4 mmol) was added. The mixture was then stirred at room temperature for 2 h, quenched with NH.sub.4Cl aqueous solution (50 mL), and extracted with EtOAc (80 mL3). The combined organic solvents were with LiCl aqueous solution (50 mL3), dried over anhydrous Na.sub.2SO.sub.4, concentrated and purified by silica gel chromatography (0-10% EtOAc/petroleum ether) to give 2.0 g of 6-bromo-5-(methoxymethoxy)-3-methylbenzo[d]oxazol-2(3H)-one as yellow oil (72% yield). LCMS: 289.0 [M+H].sup.+; t.sub.R=1.72 min.

(290) Step 7. Synthesis of 5-(methoxymethoxy)-3-methyl-6-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)benzo[d]oxazol-2(3H)-one (B36). A mixture of 6-bromo-5-(methoxymethoxy)-3-methylbenzo[d]oxazol-2(3H)-one (2 g, 6.94 mmol), 4,4,4,4,5,5,5,5-octamethyl-2,2-bi(1,3,2-dioxaborolane) (2.65 g, 10.41 mmol), Pd(dppf)Cl.sub.2 (51 mg, 0.694 mmol) and KOAc (2.04 g, 20.82 mmol) in 30 mL of dioxane was degassed and stirred at 100 C. for 2 h. After cooling to room temperature, the mixture was concentrated and purified by silica gel column (0-50% EtOAc/petroleum ether) to give 2.0 g of 5-(methoxymethoxy)-3-methyl-6-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)benzo[d]oxazol-2(3f)-one as yellow oil (87% yield). LCMS: m/z 336.2 [M+H]+; t.sub.R=1.81 min.

Synthesis of (4-oxo-4,5-dihydrothieno[3,2-c]pyridin-2-yl)boronic acid (B39)

(291) ##STR00355##

(292) i-PrMgCl.Math.LiCl (20 mL, 26.08 mmol) was dropped into a solution of 2-bromothieno[3,2-c]pyridin-4(51)-one (1 g, 4.34 mmol) in THE (15 mL) at 0 C. The resulting reaction mixture was stirred for 1 h, then warmed up to room temperature. Then B(OMe).sub.3 (895 mg, 8.69 mmol) was added and the reaction mixture was stirred overnight. HCl/dioxane was added to quench the reaction, and the mixture was concentrated and purified by silica gel chromatography (4% MeOH/CH.sub.2Cl.sub.2) to obtain (4-oxo-4,5-dihydrothieno[3,2-c]pyridin-2-yl)boronic acid. LCMS: m/z 245.1 [M+H].sup.+; t.sub.R=1.14 min.

Synthesis of (7-oxo-6,7-dihydrothieno[2,3-c]pyridin-2-yl)boronic acid (B40)

(293) ##STR00356##

(294) Step 1: Synthesis of (E)-3-(S-bromothiophen-3-yl)acrylic acid. To a solution of 5-bromothiophene-3-carbaldehyde (5 g, 26.2 mmol) and piperidine (1.12 g, 13.1 mmol) in pyridine (50 mL) was added malonic acid (8.17 g, 78.5 mmol). The reaction mixture was refluxed for 3 h, cooled to room temperature and concentrated. The residue was diluted with H.sub.2O (100 mL), and the precipitated was formed. The suspension was acidified to pH 2 with 6 M HCl. The precipitate was collected by filtration, washed with H.sub.2O (330 mL) and dissolved in EtOAc (20 mL). The solution was dried over anhydrous Na.sub.2SO.sub.4 and concentrated to give 5 g of (E)-3-(5-bromothiophen-3-yl)acrylic acid as a tan solid (82% yield). LCMS: m/z 232.9 [M+H].sup.+; t.sub.R=1.65 min.

(295) Step 2: Synthesis of (E)-3-(5-bromothiophen-3-yl)acryloyl azide. To a solution of (E)-3-(5-bromothiophen-3-yl)acrylic acid (1 g, 4.29 mmol) and Et.sub.3N (1.3 g, 12.88 mmol) in DCM (20 mL) was added diphenylphosphoryl azide (2.36 g, 8.58 mmol) at 0 C. The mixture was stirred at room temperature for 4 h, quenched with H.sub.2O (100 mL), and the aqueous phase was extracted with DCM (100 mL3). The combined organic layers were washed with brine (50 mL), dried over anhydrous Na.sub.2SO.sub.4, and concentrated under reduced pressure. The residue was purified by silica gel chromatography (0-5% ethyl acetate/petroleum ether) to give 900 mg of (E)-3-(5-bromothiophen-3-yl)acryloyl azide as white solid (82% yield). LCMS: m/z 232.0 [M-N.sub.2].sup.+; t.sub.R=1.95 min.

(296) Step 3: Synthesis of 2-bromothieno[2,3-c]pyridin-7(6H) one. To a solution of (E)-3-(5-bromothiophen-3-yl)acryloyl azide (900 mg, 3.49 mmol) in Ph.sub.2O was added n-Bu.sub.3N (968 mg, 5.23 mmol). The mixture was stirred for 2 h at 240 T. The mixture was cooled to room temperature and hexane (20 mL) and EtOAc (15 mL) were added. The precipitate was collected by filtration to give 600 mg of 2-bromothieno[2,3-c]pyridin-7(6H)-one as white solid (75% yield). LCMS: m/z 231.9 (M+H).sup.+; t.sub.R=1.44 min.

(297) Step 4: Synthesis of (7-oxo-6,7-dihydrothieno[2,3-c]pyridin-2-yl)boronic acid (B40). To a solution of 2-bromothieno[2,3-c]pyridin-7(61)-one (500 mg, 2.18 mmol) in THE was added n-BuLi (1.3 mL, 2.5 N in hexanes) at 78 C. After stirring for 30 mins, B(OMe).sub.3 (454 mg, 4.36 mmol) was added at 78 C. The reaction was stirred at 78 C. for 3 h, quenched with MeOH and concentrated under reduced pressure to give 500 mg of (7-oxo-6,7-dihydrothieno[2,3-c]pyridin-2-yl)boronic acid as green oil (crude), which was used directly for the next step. LCMS: m/z 196.1 [M+H].sup.+; t.sub.R=0.35 min.

Synthesis of (6-methyl-7-oxo-6,7-dihydrothieno[2,3-c]pyridin-2-yl)boronic acid (B41)

(298) ##STR00357##

(299) Step 1: Synthesis of 2-bromo-6-methylthieno[2,3-c]pyridin-7(6H)-one. To a solution of 2-bromothieno[2,3-c]pyridin-7(6H)-one (1 g, 4.35 mmol) in THF was added Mel (1.24 & 8.70 mmol) and Cs.sub.2CO.sub.3 (2.84 g, 8.70 mmol). The mixture was stirred at room temperature for 16 h. The reaction was concentrated under reduced pressure. The residue was purified by silica gel chromatography (0-15% ethyl acetate in dichloromethane) to give 900 mg of 2-bromo-6-methylthieno[2,3-c]pyridin-7(6H)-one as a white solid (86% yield). LCMS: m/z 246.0 [M+H].sup.+; t.sub.R=1.57 min.

(300) Step 2: Synthesis of (6-methyl-7-oxo-6,7-dihydrothieno[2,3-c]pyridin-2-yl)boronic acid (041). To a solution of 2-bromo-6-methylthieno[2,3-c]pyridin-7(6H)-one (400 mg, 1.65 mmol) in THF was added n-BuLi (0.98 mL, 2.5 N in hexanes) at 78 C. After stirring for 30 minutes, B(OMe).sub.3 (343 mg, 3.3 mmol) was added at 78 C. The reaction was stirred at same temperature for 3 h, then was quenched with MeOH and concentrated in vacuo to give 400 mg of (6-methyl-7-oxo-6,7-dihydrothieno[2,3-c]pyridin-2-yl)boronic acid as yellow oil (crude), which used directly for the next step. LCMS: m/z 210.1 [M+H]+; t.sub.R=0.35 min &0.48 min.

Synthesis of 1-(3-hydroxy-4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenyl)-1H-imidazole-4-carbonitrile (B42)

(301) ##STR00358##

(302) Step 1: Synthesis of 1-(3-hydroxy-4-nitrophenyl)-1H-imidazole-4-carbonitrile. A mixture of 5-fluoro-2-nitrophenol (4 g, 25.4 mmol), 1H-imidazole-4-carbonitrile (3.56 g, 38.22 mol) and Cs.sub.2CO.sub.3 (12.46 g, 38.22 mmol) in 100 mL of DMF was stirred at 120 C. for 16 h. The solid was filtered off, the filtrate was concentrated under vacuum to give 5 g of 1-(3-hydroxy-4-nitrophenyl)-1H-imidazole-4-carbonitrile (68% yield), which was used directly to next step. LCMS: m/z 231.2 [M+H].sup.+; t.sub.R=1.20 min.

(303) Step 2: Synthesis of 1-(4-amigo-3-hydroxyphenyl)-1H-imidazole-4-carbonitrile. A mixture of 1-(3-hydroxy-4-nitrophenyl)-1H-imidazole-4-carbonitrile (4 g, 17.4 mmol), Fe (2.92 g, 52.2 mol) and NH.sub.4Cl (2.8 g, 52.2 mmol) in 40 mL of EtOH and 20 mL of water was stirred at 80 C. for 2 h. The solid was filtered off. The filtrate was concentrated and purified by silica gel chromatography (80% EtOAc/petroleum ether) to give 3.2 g of 1-(4-amino-3-hydroxyphenyl)-1H-imidazole-4-carbonitrile. (92% yield). LCMS: m/z 201.2 [M+H].sup.+; t.sub.R=1.28 min.

(304) Step 3: Synthesis of 1-(3-hydroxy-4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenyl)-1H-imidazole-4-carbonitrile (B42). HCl (4.5 mL, 12 N aqueous solution) and water (4.5 mL) was added to the solution of 1-(4-amino-3-hydroxyphenyl)-1H-imidazolo-4-carbonitrile (I g, 5.0 mmol) in 18 mL of MeOH at 0 C. NaNO.sub.2 (0.38 g, 5.5 mmol) in water (3 mL) was then added. After stirring at 0 C. for 30 min, 4,4,4,4,5,5,5,5-octamethyl-2,2-bi(1,3,2-dioxaborolane) (2.54 g, 10.0 mmol) was added. The mixture was stirred at room temperature overnight, quenched with H.sub.2O (50 mL) and extracted with CH.sub.2Cl.sub.2 (30 mL3). The combined organic layers were concentrated and purified with silica gel chromatography (0-100% EtOAc/petroleum ether) to give 170 mg of (1-(3-hydroxy-4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenyl)-1H-imidazole-4-carbonitrile (15% yield). LCMS: m/z 230.1 [M+H].sup.+; t.sub.R=1.26 min.

Synthesis of 8-methoxy-7-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-4H-pyrido[1,2-a]pyrimidin-4-one (B43)

(305) ##STR00359##

(306) Step 1: Synthesis of 5-bromo-4-methoxypyridin-2-amine. Into a 250-mL 3-necked round-bottom flask, was placed a solution of 4-methoxypyridin-2-amine (10.0 g, 80.6 mmol, 1.0 equiv) in AcOH (100 mL). This was followed by the addition of Br.sub.2 (19.31 g, 120.828 mmol, 1.5 equiv) dropwise with stirring at 0 C. The resulting solution was stirred for 2 h at room temperature. The reaction was then quenched by the addition of 100 mL of water/ice. The pH value of the solution was adjusted to 8 with K.sub.2CO.sub.3. The resulting solution was extracted with 350 mL of dichloromethane dried over anhydrous sodium sulfate and concentrated. The residue was applied onto a silica gel column with ethyl acetate/petroleum ether (1:1). This resulted in 9.2 g (56.3%) of 5-bromo-4-methoxypyridin-2-amine as a white solid.

(307) Step 2: Synthesis of 5-[[(5-bromo-4-methoxypyridin-2-yl)amino]methylidene]-2,2-dimethyl-1,3-dioxane-4,6-dione. Into a 50-mL 3-necked round-bottom flask, was placed a solution of 2,2-dimethyl-1,3-dioxane-4,6-dione (0.71 g, 4.925 mmol, 1 equiv) in EtOH (10 mL), and triethyl orthoformate (2.19 g, 14.775 mmol, 3 equiv), and the resulting solution was stirred for 4 h at 80 C. Then 5-bromo-4-methoxypyridin-2-amine (1.00 g, 4.93 mmol, 1.0 equiv) was added. The resulting solution was allowed to react, with stirring, for an additional 2 h at 80 C. The solids were collected by filtration. This resulted in 667 mg (37.92%) of 5-[[(5-bromo-4-methoxypyridin-2-yl)amino]methylidene]-2,2-dimethyl-1,3-dioxane-4,6-dione as a white solid.

(308) Step 3: Synthesis of 7-bromo-8-methoxy-3H,9aH-pyrido[1,2-a]pyrimidin-4-one. Into a 250-mL round-bottom flask, was placed a solution of 5-[[(5-bromo-4-methoxypyridin-2-yl)amino]methylidene]-2,2-dimethyl-1,3-dioxane-4,6-dione (12.00 g, 33.6 mmol, 1.0 equiv) in diphenyl ether (100 mL). The resulting solution was stirred for 4 h at 250 C. The reaction mixture was gradually cooled to room temperature. The reaction mixture was applied onto a silica gel column with ethyl acetate/petroleum ether (4:1). This resulted in 3.6 g (41.7%) of 7-bromo-8-methoxy-3H,9aH-pyrido[1,2-a]pyrimidin-4-one as a brown solid.

Synthesis of 8-methoxy-7-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl) 4H-pyrido[1,2-a]pyrimidin-4-one (B43)

(309) Into a 40-mL vial purged and maintained with an inert atmosphere of nitrogen, was placed 7-bromo-8-methoxypyrido[1,2-a]pyrimidin-4-one (2.00 g, 7.84 mmol, 1.0 equiv), 1,4-dioxane (20 mL), bis(pinacolato)diboron (2.39 g, 9.41 mmol, 1.2 equiv), KOAc (1.54 g, 15.7 mmol, 2 equiv), Pd(dppf)Cl.sub.2 (0.29 g, 0.392 mmol, 0.05 equiv). The resulting solution was stirred for 3 h at 100 C. The resulting mixture was used in the next step directly without any further purification.

Synthesis of 7-methoxy-2-methyl-6 (4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)isoquinolin-1(2H)-one

(310) ##STR00360##

(311) Step 1: Synthesis of 4-bromo-3-methoxybenzoyl chloride. Into a 500-mL 3-necked round-bottom flask purged and maintained with an inert atmosphere of nitrogen, was placed 4-bromo-3-methoxybenzoic acid (20.00 g, 86.56 mmol, 1.0 equiv), DCM (200 mL), and DMF (2.0 mL, 27.5 mmol, 0.30 equiv). This was followed by the addition of oxalyl chloride (13.20 g, 104 mmol, 1.2 equiv) dropwise with stirring at 0 C. The resulting solution was stirred for 2 h at 25 C. The resulting mixture was concentrated under vacuum. This resulted in 24.2 g (98.6%) of 4-bromo-3-methoxybenzoyl chloride as a white solid.

(312) Step 2: Synthesis of (4-bromo-3-methoxyphenyl)formamido 2,2-dimethylpropanoate. Into a 500-mL 3-necked round-bottom flask purged and maintained with an inert atmosphere of nitrogen, was placed 4-bromo-3-methoxybenzoyl chloride (27.4 g, 109.8 mmol, 1.0 equiv), ethyl acetate (300 mL), and 0-pivaloylhydroxylammonium trifluoromethanesulfonate (29.20 g, 109.69 mmol, 1.0 equiv). This was followed by the addition of a solution of NaHCO.sub.3 (18.50 g, 220.2 mmol, 2.0 equiv) in H.sub.2O (50 mL) dropwise with stirring at 0 C. The resulting solution was stirred for 2 h at 0 C. The aqueous phase was extracted with 200 mL of ethyl acetate and the organic layers combined. The combined organic phase was washed with 300 mL saturated NaHCO.sub.3 aqueous solution, dried over Na.sub.2SO.sub.4 and concentrated under reduced pressure. The residue was applied onto a silica gel column with ethyl acetate/hexane (1:1) as eluent. This resulted in 27.4 g (75.6%) of (4-bromo-3-methoxyphenyl)formamido 2,2-dimethylpropanoate as yellow oil. LCMS: m/z [M+H].sup.+=330.

(313) Step 3: Synthesis of 6-bromo-7-methoxy-2H-isoquinolin-1-one. Into a 500-mL 3-necked round-bottom flask purged and maintained with an inert atmosphere of nitrogen, was placed (4-bromo-3-methoxyphenyl)formamido 2,2-dimethylpropanoate (25.0 g, 75.72 mmol, 1.0 equiv), vinyl acetate (9.80 g, 113.8 mmol, 1.5 equiv), MeOH (300 mL), CsOAc (4.51 g, 23.5 mmol, 0.3 equiv), bis[(pentamethylcyclopentadienyl)dichloro-rhodium] (468 mg, 0.757 mmol, 0.01 equiv). The resulting solution was stirred overnight at 40 C. The resulting mixture was concentrated under vacuum to leave the residue. The residue was recrystallized from 100 mL of MTBE to afford 15 g (78%) of 6-bromo-7-methoxy-2H-isoquinolin-1-one as a white solid. LCMS: m/z: [M+H].sup.+=254.

(314) Step 4: Synthesis of 6-bromo-7-methoxy-2-methylisoquinolin-1-one. Into a 100-mL 3-necked round-bottom flask purged and maintained with an inert atmosphere of nitrogen, was placed 6-bromo-7-methoxy-2H-isoquinolin-1-one (5.00 g, 19.68 mmol, 1.0 equiv), and 100 mL THF. This was followed by the addition of NaH (1.20 g, 30.003 mmol, 1.52 equiv, 60 wt %), in portions at 0 C. To this was added CH.sub.3I (3.40 g, 21.8 mmol, 1.11 equiv) dropwise with stirring at 0 C. The resulting solution was stirred for 4 h at 25 C. The reaction was then quenched by the addition of 100 mL of water/ice. The resulting solution was extracted with 3100 mL of ethyl acetate and the organic layers combined and dried over anhydrous sodium sulfate. The solids were filtered out, and the filtrated was concentrated under vacuum. This resulted in 3.2 g of 6-bromo-7-methoxy-2-methylisoquinolin-1-one as a yellow solid. LCMS: m/z [M].sup.+=268; .sup.1H NMR (300 MHz, DMSO-d.sub.6) 8.02 (s, 1H), 7.68 (s, 1H), 7.47-7.05 (m, 2H), 6.56 (d, J=7.3 Hz, 1H), 3.95 (s, 3H), 2.51 (dt, J=3.8, 1.9 Hz, 3H).

(315) Step 5: Synthesis of 7-methoxy-2-methyl-6-(4,4,5,5-tetramethyl-1,3,2-dioxaborolo-2-yl) isoquinolin-1(2H)-one (B44). Into a 250-mL 3-necked round-bottom flask purged and maintained with an inert atmosphere of nitrogen, was placed 6-bromo-7-methoxy-2-methylisoquinolin-1(2H)-one (1.33 g, 4.97 mmol, 1.0 equiv), potassium acetate (0.97 g, 9.93 mmol, 2.0 equiv), bis(pinacolato)diboron (2.52 g, 9.93 mmol, 2.00 equiv), Pd(dppf)Cl.sub.2 (0.36 g, 0.497 mmol, 0.10 equiv), and 1,4-dioxane (25 mL). The resulting solution was stirred for 2 bat 100 C. in an oil bath. The reaction mixture was cooled down to ambient temperature and quenched by the addition of 30 mL of water. The resulting solution was extracted with 230 mL of dichloromethane, and the organic phase was combined, dried over Na.sub.2SO.sub.4 and concentrated. This resulted in 3.0 g (crude, calculated as 3.476 mmol, 70%) of 7-methoxy-2-methyl-6-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl) isoquinolin-1(2H)-one as a dark green semi-solid, which was used directly in the next step.

Synthesis of 7-methoxy-3-methyl-6-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)quinazolin-4(3H)-one

(316) ##STR00361##

(317) Step 1: Synthesis of 2-amino-5-bromo-4-methoxybenzoic acid. Into a 250-mL round-bottom flask, was placed 2-amino-4-methoxybenzoic acid (2.00 g, 11.96 mmol, 1.0 equiv), dimethylformamide (60 mL). This was followed by the addition of N-bromoimide (2.30 g, 12.9 mmol, 1.1 equiv) in several batches at 0 C. The resulting solution was stirred for 1 h at room temperature. The reaction mixture was cooled to 0 C. with a water/ice bath. The reaction was then quenched by the addition of 13 mL of saturated aqueous NaHCO.sub.3. The pH value of the solution was adjusted to 3 with HCl (6 mol/L). The resulting solution was extracted with 325 mL of ethyl acetate. The organics were combined and washed with 325 mL of water and 251 mL of brine. The combined organic layers were dried over anhydrous sodium sulfate and concentrated. This resulted in 2.5 g (84.9%) of 2-amino-5-bromo-4-methoxybenzoic acid as a light brown solid.

(318) Step 2: Synthesis of 6-bromo-7-hydroxy-3-methylquinazolin-4-one. Into a 40-mL sealed tube, was placed 2-amino-5-bromo-4-methoxybenzoic acid (5.00 g, 20.32 mmol, 1.0 equiv), and methylformamide (8 mL). The resulting solution was stirred for 3 h at 180 C. The reaction mixture was cooled with a water/ice bath and then 25 mL of water was added. The solids were collected by filtration. This resulted in 1.0 g (19.3%) of 6-bromo-7-hydroxy-3-methylquinazolin-4-one as a light brown solid. LCMS: m/z: [M+H].sup.+=269.0.

(319) Step 3: Synthesis of 7-methoxy-3-methyl-4-oxoquinazolin-6-ylboronic acid (B45). Into a 40-mL sealed tube, was placed 6-bromo-7-methoxy-3-methylquinazolin-4-one (1.00 g, 3.72 mmol, 1.0 equiv), (BPin).sub.2 (1.43 g, 5.63 mmol, 1.5 equiv), KOAc (729.4 mg, 7.43 mmol, 2.0 equiv), Pd(dppf)Cl.sub.2 (163.2 mg, 0.223 mmol, 0.06 equiv), and 1,4-dioxane (20 mL). The resulting solution was stirred for 3 h at 100 C. The reaction mixture was cooled with a water/ice bath. The resulting solution was diluted with of water and then extracted with 320 ml of dichloromethane. The organics were combined, dried over anhydrous sodium sulfate, and concentrated to dryness under reduced pressure. This resulted in 500 mg (57.5%, crude) of 7-methoxy-3-methyl-4-oxoquinazolin-6-ylboronic acid as a light brown solid. LCMS: m/z: [M+H].sup.+ 235.1.

(320) Additional boronic acid or ester compounds below were made following the general synthetic methods applied to synthesize B1-B45.

(321) ##STR00362##

Example B2: Synthesis of 2-amino-pyridazine Intermediates

(322) ##STR00363##

Example B2a: Synthesis of () tert-butyl (1S,2R,3R,5R)-2-fluoro-3-(methylamino)-8-azabicyclo[3.2.1]octane-8-carboxylate (INT-1)

(323) ##STR00364##

(324) Step 1: Synthesis of () tert-butyl (1S,2S,5R)-2-fluoro-3-oxo-8-azabicyclo[3.2.1]octane-8-carboxylate. TMSCl (19.2 g, 17.78 mmol) and triethylamine (17.78 g, 17.78 mmol) was added to a stirred solution of tert-butyl 3-oxo-8-azabicyclo[3.2.1]octane-8-carboxylate (20 g, 8.89 mmol) in 270 mL of DMF. The mixture was stirred at 100 C. for 16 h. Water (300 mL) was added to the reaction, then the mixture was extracted with ethyl acetate (100 mL3). The combined organic phases were dried and concentrated, then purified by silica gel chromatography (10% EtOAc/petroleum ether) to give the title compound (21 g, 79% yield). LCMS: m/z 298.2 [M+H].sup.+; t.sub.R=2.33 min.

(325) Step 2: Synthesis of () tert-butyl (1S,2S,5S)-2-fluoro-8-aza-bicyclo[3.2.1]octan-3-one. Selectfluor (14.16 g, 40 mmol) was added to a solution of () tert-butyl 3-((trimethylsilyl)oxy)-8-azabicyclo[3.2.1]oct-2-ene-8-carboxylate (6 g, 20 mmol) in 120 mL of dry CH.sub.3CN at 0 C. After addition, the mixture was stirred at rt for 2 h. The mixture was concentrated, then purified by silica gel chromatography (50% EtOAc/petroleum ether) to give the title compound. (3.84 g, 78% yield). LCMS: m/z 188.2 [M55].sup.+; t.sub.R=1.86 min.

(326) Step 3: Synthesis of () tertbutyl (1S,2R,3R,5R)-3 (benzylamino)-2-fluoro-8-azabicyclo[3.2.1]octane-8-carboxylate. A mixture of () tort-butyl (1S,2S,5S)-2-fluoro-8-aza-bicyclo[3.2.1]octan-3-one (10 g, 41 mmol) and benzylamine (7.6 g, 82 mmol) in 160 mL of toluene was refluxed for 4 h. The mixture was concentrated. 160 mL of methanol was added. NaBH.sub.4 (3.1 g, 82 mmol) was added in small portions at 0 C. The mixture was stirred for 2 h at rt and concentrated H.sub.2O (80 mL) was added and the resulting mixture was extracted with EtOAc (60 mL3). The combined organic solvents were dried over anhydrous Na.sub.2SO.sub.4, concentrated and purified on silica gel chromatography (10-50% EtOAc/petroleum ether) to yield the title compound as a white solid (7.3 g, 53% yield). LCMS: m/z 335.1 [M+H].sup.+; t.sub.R=1.80 min.

(327) Step 4: Synthesis of () tert-butyl (1S,2R,3R,5R)-3-(benzyl(methyl)amino)-2-fluoro-8-azabicyclo[3.2.1]octane-8-carboxylate. To a solution of () ten-butyl (1S,2R,3R,5R)-3-(benzylamino)-2-fluoro-8-azabicyclo[3.2.1]octane-8-carboxylate (800 mg, 2.395 mmol, 1 equiv) in MeOH (100 ml) was added formaldehyde (143 mg, 4.8 mmol). The reaction mixture was stirred at rt for 0.5 h, then NaBH.sub.3CN (301 mg, 4.8) was added. The mixture was stirred for additional 3 h, monitored by LCMS. Solvent was evaporated and the resulting crude was purified by column chromatography on silica gel chromatography (50% EtOAc/petroleum ether) to yield the title compound (800 mg, 2.30 mmol, 96% yield) as white powder. LCMS: m/z 349.1 [M+H].sup.+; t.sub.R=1.42 min.

(328) Step 5: Synthesis of () tert-butyl (1S,2R,3R,5R)-2-fluoro-3-(methylamino)-8-azabicyclo[3.2.1]octane-8-carboxylate. To a solution of () tert-butyl (1S,2R,3R,5R)-3-(benzyl(methyl)amino)-2-fluoro-8-azabicyclo[3.2.1]octane-8-carboxylate (800 mg, 1 equiv) in EtOH (100 mL) was added Pd/C (80 mg, 10%). The reaction mixture was stirred under H.sub.2 atmosphere for 2 h and monitored by LCMS. The mixture was filtered and the filtrate was concentrated under reduced pressure to give the title compound (500 mg, 84% yield) as colorless oil, which was directly used in next step. LCMS: m/z 203.1 [M55].sup.4; t.sub.R=1.19 min.

(329) Step 6: Synthesis of tert-butyl (1S,2R,3R,5R)-3-((6-chloropyridazin-3-yl)(methyl)amino)-2-fluoro-8-azabicyclo[3.2.1]octane-8-carboxylate (INT-1). DIPEA (3.97 g, 30.7 mmol) was added to a solution of 3,6-dichloropyridazine (2.2 g, 14.7 mmol) and () (1S,2R,3R,5R)-tert-butyl 3-amino-2-fluoro-8-azabicyclo[3.2.1]octane-8-carboxylate (3.0 g, 12.3 mmol) in DMSO (30 mL). The mixture was stirred at 120 C. for 16 h. After cooling to room temperature, the mixture was quenched with H.sub.2O (50 mL) and extracted with EtOAc (30 mL3). The combined organic layers were concentrated and purified with silica gel chromatography (10-25% EtOAc/petroleum ether) to yield the fide compound (3.05 g, 8.65 mmol, 55% yield). LCMS: m/z 357.1 [M+H].sup.+; t.sub.R=1.79 min.

Example B2b: Synthesis of () tertbutyl exo-3-amino-6,6-difluoro-8-azabicyclo[3.2.1]octane-8-carboxylate (INT-2)

(330) ##STR00365##

(331) Step 1: Synthesis () 6-hydroxy-8-benzyl 8-azabicyclo[3.2.1]octan-3-one. 2,5-Dimethoxy-2,5-dihydrofuran (97.5 g, 750 mmol) was dissolved in water (650 mL) and treated with aqueous hydrochloric acid (3.75 ml, 2M) under an atmosphere of nitrogen. The mixture was heated to 99 C. with stirring and aqueous methanol (about 100 mL) was distilled from the reaction mixture. The reaction was cooled to ambient temperature, acetone dicarboxylic acid (146 g, 1.33 mol) wase added in one portion followed by a solution of sodium hydrogen phosphate (53.25 g, 375 mmol) and sodium hydroxide (15.0 g, 375 mmol) in water (500 mL). 1,4-Dioxane (100 mL) was added and a solution of benzylamine hydrochloride (71.75 g, 502 mmol) in water (330 mL) was added dropwise over 10 minutes. The mixture was rapidly stirred for a further 4 h, acidified with aqueous hydrochloric acid (2M). Dichloromethane (500 mL) was added and the reaction mixture stirred for 10 minutes. The aqueous phase was separated and filtered through a pad of Celite brand filter agent. The filtrate was extracted with dichloromethane (500 mL3). The aqueous phase was collected, basified with potassium carbonate and extracted with ethyl acetate (1000 mL3). The organic fractions were combined, dried over anhydrous Na.sub.2SO.sub.4 and concentrated under reduced pressure to give the title compound (36 g, 21% yield) as a brown oil, containing a mixture of exo- and endo-6-hydroxy-8-benzyl 8-azabicyclo[3.2.1]octan-3-one, which was used directly to next step. LCMS: m/z 232.1 [M+H].sup.+; t.sub.R=1.52 min.

(332) Step-2: Synthesis of (t) 8-benzyl-6-((tert-butyldimethylsilyl)oxy)-8-azabicyclo[3.2.1]octan-3-one.

(333) TBSCl (18.7 g, 124.6 mmol) was added to a stirred solution of () 6-hydroxy-8-benzyl 8-azabicyclo[3.2.1]octan-3-one (24 g, 104 mmol) and imidazole (10.6 g, 156 mmol) in CH.sub.2Cl.sub.2 (500 mL) at rt. The mixture was stirred at lot for 18 h, concentrated and purified by silica gel chromatography (14% EtOAc/petroleum ether) to give the title compound as a brown oil (28 g, 78% yield). LCMS: m/z 346.2 [M+H].sup.+; t.sub.R=2.46 min.

(334) Step 3: Synthesis of () (1S,3R,5R)-8-benzyl-6-((tert-butyldimethylsilyl)oxy)-8-azabicyclo[3.2.1]octan-3-ol. NaBH.sub.4 (8.8 g, 232 mmol) was added to a stirred solution of () 8-benzyl-6-((tert-butyldimethylsilyl)oxy)-8-azabicyclo[3.2.1]octan-3-one (40 g, 116 mmol) in MeOH (600 mL) at rt. The mixture was stirred at rt for 2 h, and concentrated to remove most of the solvent. 500 mL of water was added. The resulting mixture was extracted with EtOAc (500 mL2). The combined organic solvents were concentrated and purified by silica gel chromatography (0-24% EtOAc/petroleum ether) to give the title compound (38 g, 94% yield) as a brown oil LCMS: m/z 348.1 [M+H].sup.+; t.sub.R=1.57 min.

(335) Step 4: Synthesis of () (1S,3R,5R)-8-benzyl-6-((tert-butyldimethylsilyl)oxy)-8-azabicyclo[3.2.1]octan-3-yl acetate. Ac.sub.2O (7.9 g, 78 mmol) was added to a stirred solution of () 8-benzyl-6-((tert-butyldimethylsilyl)oxy)-8-azabicyclo[3.2.1]octan-3-ol (18 g, 52 mmol), Et.sub.3N (10.5 g, 104 mmol) and DMAP (634 mg, 122 mmol) in 200 mL of THF at 0 C. After addition, the mixture was stirred at rt for 18 h, concentrated and purified by silica gel chromatography (0-14% EtOAc/petroleum ether) to give the title compound (16 g, 78% yield). LCMS: m/z 390.1 [M+H].sup.+; t.sub.R=2.57 min.

(336) Step 5: Synthesis of () (1R,3R,5R)-8-benzyl-6-hydroxy-8-azabicyclo[3.2.1]octan-3-yl acetate. TBAF (43.3 mL, 43.3 mmol, 1 M solution in THF) was added to a stirred solution of () 8-benzyl-6-((tert-butyldimethylsilyl)oxy)-8-azabicyclo[3.2.1]octan-3-yl acetate (13 g, 33.4 mmol) in 100 mL of THF. The mixture was stirred at rt for 4 h and 30 mL of H.sub.2O was added. The mixture was extracted with EtOAc (50 mL3). The combined organic solvents were concentrated and purified by silica gel chromatography (0-40% EtOAc/petroleum ether) to give the title compound (8.7 g, 91% yield). LCMS: m/z 276.2 [M+H].sup.+; t.sub.R=1.76 min.

(337) Step 6: Synthesis of () (1S,3R,5R)-8-benzyl-6-oxo-8-azabicyclo[3.2.1]octan-3-yl acetate. Dess-Martin periodinane (13.9 g, 32.7 mmol) was added to a stirred solution of () 8-benzyl-6-hydroxy-8-azabicyclo[3.2.1]octan-3-yl acetate (6 g, 21.8 mmol) in 60 mL of CH.sub.2Cl.sub.2 at rt. The mixture was stirred at rt for 16 h, filtered, concentrated and purified by silica gel chromatography (0-20% EtOAc/petroleum ether) to give the title compound (4.45 g, 60% yield). LCMS: m/z 274.1 [M+H].sup.+; t.sub.R=1.85 min.

(338) Step 7: Synthesis of () (1S,3R,5R)-8-benzyl-6,6-difluoro-8-azabicyclo[3.2.1]octan-3-yl acetate. DAST (52.5 g, 326 mmol) was added to a stirred solution of () 8-benzyl-6-oxo-8-azabicyclo[3.2.1]octan-3-yl acetate (8.9 g, 32.6 mmol) in 90 mL of CH.sub.2Cl.sub.2 under nitrogen atmosphere. The mixture was stirred at 60 C. (oil bath) for 12 h. After cooling to rt, the mixture was quenched with H.sub.2O, extracted with CH.sub.2Cl.sub.2 (30 mL3), concentrated and purified by silica gel chromatography (0-28% EtOAc/petroleum ether) to give the title compound (5.3 g, 55% yield). LCMS: m/z 296.2 [M+H].sup.+; t.sub.R=2.20 min.

(339) Step 8: Synthesis of () tert-butyl (1S,3R,5R)-3-acetoxy-6,6-difluoro-8-azabicyclo[3.2.1]octane-8-carboxylate. A mixture of () 8-benzyl-6,6-difluoro-8-azabicyclo[3.2.1]octan-3-yl acetate (1.9 g, 6.44 mmol), Pd/C (500 mg, 10% on activated carbon) and (Boc) 20 (1.69 g, 7.73 mmol) in 50 mL of MeOH was stirred under H.sub.2 at balloon pressure for 16 h. The mixture was filtered, concentrated and purified by silica gel chromatography (0-37% EtOAc/petroleum ether) to give the title compound (1.5 g, 76% yield). LCMS: m/z 328.1 [M+23].sup.+; t.sub.R=1.94 min.

(340) Step 9: Synthesis of () tert-butyl (1S,3R,5R)-6,6-difluoro-3-hydroxy-8-azabicyclo[3.2.1]octane-8-carboxylate. K.sub.2CO.sub.3 (497 mg, 3.6 mmol) was added to a stirred solution of () tert-butyl 3-acetoxy-6,6-difluoro-8-azabicyclo[3.2.1]octane-8-carboxylate (550 mg, 1.8 mmol) in 5 mL of MeOH. The mixture was stirred at rt for 3 h, filtered, concentrated and purified by silica gel chromatography (0-30% EtOAc/petroleum ether) to give the title compound (280 mg, 68% yield). LCMS: m/z 208.1 [M55].sup.+; t.sub.R=1.62 min.

(341) Step 10: Synthesis of () tert-butyl (1S,5R)-6,6-difluoro-3-oxo-8-azabicyclo[3.2.1]octane-8-carboxylate. Dess-Martin periodinane (7.2 g, 16.9 mmol) was added to a stirred solution of () tert-butyl 6,6-difluoro-3-hydroxy-8-azabicyclo[3.2.1]octane-8-carboxylate (3.1 g, 11.3 mmol) in 50 mL of CH.sub.2Cl.sub.2 at rt. The mixture was stirred at rt for 16 h, filtered, concentrated and purified by silica gel chromatography (0-20% EtOAc/petroleum ether) to give the title compound (1.97 g, 67% yield). LCMS: m/z 279.0 [M+18].sup.+; t.sub.R=1.28 min.

(342) Step 11: Synthesis of () tert-butyl (1S,5R)-6,6-difluoro-3-(hydroxyimino)-8-azabicyclo[3.2.1]octane-8-carboxylate. A mixture of () tert-butyl 6,6-difluoro-3-oxo-8-azabicyclo[3.2.1]octane-8-carboxylate (1.5 g, 5.7 mmol), hydroxylamine hydrochloride (595 mg, 8.6 mmol) and AcONa (708 mg, 8.6 mmol) in 50 mL of EtOH was stirred at 80 C. for 2 h. The reaction was cooled to rt, and concentrated in vacuo. 50 mL of EtOAc and 20 mL of H.sub.2O was added, the organic phase was separated, washed with brine, dried over anhydrous Na.sub.2SO.sub.4 and concentrated to give the title compound (1.2 g, 93% yield) as yellow solid, which was used directly to next step. LCMS: m/z 221.1 [M55].sup.+; t.sub.R=1.71 min.

(343) Step 12: Synthesis of () tert-butyl (1S,3R,5R)-3-amino-6,6-difluoro-8-azabicyclo[3.2.1]octane-8-carboxylate. Na (333 mg, 14.5 mmol) was added in portions over 10 min to a mixture of () tert-butyl 6,6-difluoro-3-(hydroxyimino)-8-azabicyclo[3.2.1]octane-8-carboxylate (400 mg, 1.45 mmol) in 20 mL of n-PrOH at 105 C. After addition, the mixture was stirred at 105 C. for additional 30 min, cooled to rt and quenched with H.sub.2O (50 mL). The mixture was extracted with EtOAc (50 mL2). The combined organic layers were dried and concentrated under reduced pressure to afford the title compound (324 mg, 85% yield) as a yellow oil. LCMS: m/z 207.2 [M55].sup.+; t.sub.R=1.30 min.

(344) Step 13: Synthesis of () tert-butyl (1S,3R,5R)-3-((6-chloropyridazin-3-yl)amino)-6,6-difluoro-8-azabicyclo[3.2.1]octane-8-carboxylate. A mixture of tert-butyl exo-3-amino-6,6-difluoro-8-azabicyclo[3.2.1]octane-8-carboxylate (5.0 g, 19.0 mmol), 3,6-dichloropyridazine (5.65 g, 38.0 mmol) and DIPEA (7.4 g, 57.0 mmol) in 100 mL of DMSO was stirred at 120 C. for 16 h. The mixture was cooled to rt, quenched with H.sub.2O and extracted with ethyl acetate (2100 mL). The combined organic layers were washed with brine, dried over anhydrous Na.sub.2SO.sub.4, and concentrated under reduced pressure. The residue was purified by silica gel column (0-60% EtOAc/petroleum ether) to afford the title compound (8.8 g, 61.6% yield) as a yellow solid LCMS: m/z 319.3 [M56+H].sup.+; t.sub.R=1.87 min.

(345) Step 14: Synthesis of () tert-butyl (1S,3R,5R)-3-((6-chloropyridazin-3-yl)(methyl)amino)-6,6-difluoro-8-azabicyclo[3.2.1]octane-8-carboxylate (INT-2).

(346) NaH (1.6 g, 40.10 mmol, 60% in mineral oil) was added to a stirred solution of () tert-butyl (1S,3R,5R)-3-((6-chloropyridazin-3-yl)amino)-6,6-difluoro-8-azabicyclo[3.2.1]octane-8-carboxylate (5.0 g, 13.37 mmol) in 120 mL of DMF at 0 C. After stirring for 15 min at 0 C., CH.sub.3I (3.8 g, 26.7 mmol) was added. The mixture was then stirred at room temperature for 1 h, quenched with H.sub.2O and extracted with EtOAc (2100 mL). The combined organic phases were washed with brine, dried over anhydrous Na.sub.2SO.sub.4, concentrated under reduced pressure and purified by silica gel column (0-60% EtOAc/petroleum ether) to afford the title compound (4.0 g, 77% yield) as a yellow solid. LCMS: m/z 389.2 [M+H].sup.+; t.sub.R=1.95 min. Example B2c: Synthesis of () tert-butyl exo-3-amino-6,6-difluoro-8-azabicyclo[3.2.1]octane-8-carboxylate (INT-3)

(347) ##STR00366##

(348) Step 1: Synthesis of tert-butyl 3-((trimethylsilyl)oxy)-9-azabicyclo[3.3.1]non-2-ene-9-carboxylate. Chlorotrimethylsilane (34 g, 313.8 mmol) was added to a stirred solution of tert-butyl 3-oxo-9-azabicyclo[3.3.1]nonane-9-carboxylate (50 g, 209.2 mmol) and Et.sub.3N (42 g, 418.4 mmol) in 500 mL of DMF at 0 C. under nitrogen protection. After the addition, the mixture was then stirred at 100 C. for 18 h. The mixture was cooled to room temperature, quenched with H.sub.2O (500 mL), and extracted with EtOAc (200 mL3). The combined organic solvents were washed with brine (100 mL), dried over anhydrous Na.sub.2SO.sub.4, concentrated, and purified by silica gel column (0-5% EtOAc/petroleum ether) to give the title compound (46 g, 71% yield) as a colorless oil. LCMS: m/z 212.3 [M100].sup.+; t.sub.R=2.32 min.

(349) Step 2: Synthesis of () tert-butyl (1S,2S,5R)-2-fluoro-3-oxo-9-azabicyclo[3.3.1]nonane-9-carboxylate. Selectfluoro (62.8 g, 177.5 mmol) was added in three portions to a stirred solution of tert-butyl 3-((trimethylsilyl)oxy)-9-azabicyclo[3.3.1]non-2-ene-9-carboxylate (46 g, 147.9 mmol) in CH.sub.3CN (460 mL) at 0 C. under nitrogen protection. The mixture was then stirred at room temperature for 3 h, quenched with H.sub.2O (400 mL), and extracted with EtOAc (300 mL3). The combined organic solvents were concentrated and the residue purified by silica gel silica gel chromatography (0-10% EtOAc/petroleum ether) to give the title compound (19 g, 50% yield) as a white solid LCMS: m/z 202.1 [M55].sup.+; t.sub.R=1.86 min.

(350) Step 3: Synthesis of () tert-butyl (1S,2S,3S,5R)-2-fluoro-3-hydroxy-9-azabicyclo[3.3.1]nonane-9-carboxylate. NaBH.sub.4 (6.65 g, 175.1 mmol) was added to a mixture of () tert-butyl (1S,2S,5R)-2-fluoro-3-oxo-9-azabicyclo[3.3.1]nonane-9-carboxylate (30 g, 116.6 mmol) and in methanol (300 mL). The mixture was stirred at room temperature for 1 h, and concentrated in vacuum to remove methanol. Water (300 mL) was added and the mixture was extracted with EtOAc (100 mL3). The combined organic solvents were dried over anhydrous Na.sub.2SO.sub.4, concentrated and purified by silica gel chromatography (0-10% EtOAc/petroleum ether) to give () tert-butyl (1S,2S,3S,5R)-2-fluoro-3-hydroxy-9-azabicyclo[3.3.1]nonane-9-carboxylate (20 g, 66% yield) as a white solid; LCMS: m/z 204.3 [M55].sup.+; t.sub.R=1.72 min. Also isolated was a minor product, () tert-butyl (1S,2S,3R,5R)-2-fluoro-3-hydroxy-9-azabicyclo[3.3.1]nonane-9-carboxylate (7.5 g, 25% yield) as a white solid. LCMS: m/z 204.1 [M55].sup.+; t.sub.R=1.65 min. (67% yield).

(351) Step 4: Synthesis of () tert-butyl (1S,2S,3S,5R)-2-fluoro-3-((methylsulfonyl)oxy)-9-azabicyclo[3.3.1]nonane-9-carboxylate. Methanesulfonyl chloride (17.68 g, 154 mmol) was added to a solution of () tert-butyl (1S,2S,3S,5R)-2-fluoro-3-hydroxy-9-azabicyclo[3.3.1]nonane-9-carboxylate (20 g, 77 mmol) and triethylamine (15.6 g, 154 mmol) in N,N-dimethylformamide (100 mL) under an atmosphere of nitrogen at 0 C. The mixture was allowed to warm and stirred at room temperature for 6 h, quenched with water (200 mL), and extracted with ethyl acetate (300 mL3). The combined organic solvents were washed with LiCl solution (200 mL3), dried over anhydrous Na.sub.2SO.sub.4, filtered and concentrated to give the title compound (34.7 g, 90% yield) as a white solid, which was used directly to next step. LCMS: m/z 282.0 [M55].sup.+; t.sub.R=1.98 min.

(352) Step 5: Synthesis of () tert-butyl (1S,2S,3R,5R)-3-azido-2-fluoro-9-azabicyclo[3.3.1]nonane-9-carboxylate. A mixture of () tert-butyl (1S,2S,3R,5R)-2-fluoro-3-((methylsulfonyl)oxy)-9-azabicyclo[3.3.1]nonane-9-carboxylate (34.7 g, 103 mmol) and NaN.sub.3 (26.8 g, 412 mmol) in DMSO (100 mL) was stirred at 120 C. for 48 h. After cooled to room temperature, the mixture was quenched with water (300 mL), and extracted with ethyl acetate (500 mL3). The combined organic solvents were washed with brine (300 mL3), dried over anhydrous Na.sub.2SO.sub.4, filtered and concentrated to give the title compound (23.8 g, 98% yield), as a yellow oil, which was used directly in the next step. LCMS: m/z 229.1 [M55].sup.+; t.sub.R=2.06 min.

(353) Step 6: Synthesis of () tert-butyl (1S,2R,3R,5R)-3-amino-2-fluoro-9-azabicyclo[3.3.1]nonane-9-carboxylate. A mixture of () tert-butyl (1S,2S,3R,5R)-3-azido-2-fluoro-9-azabicyclo[3.3.1]nonane-9-carboxylate (23.8 g, 84 mmol) and Pd/C (3 g, 10% on activated carbon) in EtOAc (85 mL) was stirred at room temperature for 5 h under H.sub.2 atmosphere. Then the mixture was filtered and concentrated to give the title compound (21 g, 97% yield), as a yellow oil which was used directly in the next step. LCMS: m/z 203.2 [M55].sup.+; t.sub.R=1.22 min.

(354) Step 7: Synthesis of () tert-butyl (1S,2R,3R,5R)-3-((6-chloropyridazin-3-yl)amino)-2-fluoro-9-azabicyclo[3.3.1]nonane-9-carboxylate. A mixture of () tert-butyl (1S,2R,3R,5R)-3-amino-2-fluoro-9-azabicyclo[3.3.1]nonane-9-carboxylate as (23.4 g, 90 mmol), 3,6-dichloropyridazine (20.3 g, 140 mmol) and DIPEA (46.6 g, 360 mmol) in DMSO (100 mL) was stirred at 120 C. overnight. After cooling to room temperature, the mixture was quenched with 500 ml of water, extracted with EtOAc (800 mL3). The combined organic solvents were washed with water (500 mL), concentrated, and purified by silica gel column (20% EtOAc/petroleum ether) to give the title compound tert-butyl (1S,2R,3R,5R)-3-((6-chloropyridazin-3-yl)amino)-2-fluoro-9-azabicyclo[3.3.1]nonane-9-carboxylate (6.0 g, 18% yield) as white solid. LCMS: m/z 371.0 [M+H].sup.+; t.sub.R=1.98 min.

(355) Step 8: Synthesis of () tert-butyl (1S,2R,3R,5R)-3-((6-chloropyridazin-3-yl)(methyl)amino)-2-fluoro-9-azabicyclo[3.3.1]nonane-9-carboxylate (INT-3). NaH (1.3 g, 32 mmol, 60% in mineral oil) was added to a stirred solution of () tert-butyl (1S,2R,3R,5R)-3-((6-chloropyridazin-3-yl)amino)-2-fluoro-9-azabicyclo[3.3.1]nonane-9-carboxylate (6 g, 16 mmol) in DMF (25.0 mL) at 0 C. under nitrogen protection and stirred at room temperature for 20 min. Mel (4.6 g, 32 mmol) was added and the mixture was stirred at room temperature for 1 h. The reaction was quenched with H.sub.2O (200 mL) and extracted with EtOAc (300 ml3). The combined organic solvents were washed with LiCl aqueous solution (200 ml3), concentrated and purified by silica gel silica gel chromatography (0-10% EtOAc/petroleum ether) to give the title compound (5.42 g, 87% yield) as a yellow solid. LCMS: m/z 385.1 [M+H].sup.+; t.sub.R=2.12 min.

Example B2d: Synthesis of () tert-butyl (1S,5S,6R,7R)-6-fluoro-7-(methylamino)-3-oxa-9-azabicyclo[3.3.1]nonane-9-carboxylate (INT-4)

(356) ##STR00367##

(357) Step 1: Synthesis of () tert-butyl (1S,5S,6S)-6-fluoro-7-oxo-3-oxa-9-azabicyclo[3.3.1]nonane-9-carboxylate. LiHMDS (155.6 mL) was added to a stirred solution of tert-butyl-7-oxo-3-oxa-9-azabicyclo[3.3.1]nonane-9-carboxylate (25 g, 103.7 mmol) in THF (500 mL) at 78 C. After stirring at 78 C. for 20 min, NFSI (39.2 g, 124.4 mmol) in THF (100 mL) was added dropwise. The reaction mixture was stirred at 78 C. for 2 h, quenched with saturated NH.sub.4Cl aqueous solution (200 mL), extracted with EtOAc (300 mL3). The combined organic solvents were washed with brine (200 mL), dried over anhydrous MgSO.sub.4, concentrated and purified by silica gel column (5-20% EtOAc/petroleum ether) to give the title compound (12 g, yield: 45%) as a white solid. LCMS: m/z 260.2 [M+1].sup.+; t.sub.R=1.633 min.

(358) Step 2: Synthesis of () tert-butyl (1S,5S,6R,7R)-6-fluoro-7-(methylamino)-3-oxa-9-azabicyclo[3.3.1]nonane-9-carboxylate. AcOH (5 drops) was added to a solution of () tert-butyl (1S,5S,6S)-6-fluoro-7-oxo-3-oxa-9-azabicyclo[3.3.1]nonane-9-carboxylate (5 g, 19.32 mmol) and MeNH.sub.2 (19.4 mL, 38.6 mmol, 2N in THF) in MeOH (100 mL). The reaction was stirred at 20 C. for 16 h. MgCl.sub.2 (5.38 g, 58 mmol) was added to reaction mixture. After stirring at 20 C. for 15 min, NaBH.sub.4 (5.57 g, 154.6 mmol) was added. The reaction was stirred at 20 C. for further 15 min. The reaction was quenched by water (100 mL) and extracted with DCM (300 mL2). The combined organic solvents were washed with brine (100 mL), dried over anhydrous MgSO.sub.4, concentrated in vacuum and purified by silica gel column (1-20% MeOH/CH.sub.2Cl.sub.2) to give the title compound (1.5 g, 28% yield) as a colorless oil. LCMS: m/z 275.0 [M+1].sup.+; t.sub.R=1.549 min.

(359) Step 3: Synthesis of tert-butyl (1S,5S,6R,7R)-7-((6-chloropyridazin-3-yl)(methyl)amino)-6-fluoro-3-oxa-9-azabicyclo[3.3.1]nonane-9-carboxylate (INT-4). A mixture of tert-butyl (1S,5S,6R,7R)-6-fluoro-7-(methylamino)-3-oxa-9-azabicyclo[3.3.1]nonane-9-carboxylate (1.5 g, 5.77 mmol), 3,6-dichloropyridazine (1.29 g, 8.65 mmol) and DIPEA (2.23 g, 17.3 mmol) in DMSO (20 mL) was stirred at 135 C. for 96 h under N.sub.2 atmosphere. The reaction mixture was concentrated in vacuum and purified by silica gel column (20-50% EtOAc/petroleum ether) to give the title compound (360 mg, 16.2% yield) as a white solid. LCMS: m/z 387 [M+H].sup.+.

Example B2d: Synthesis of () tert-butyl (1S,2R,3R,5R)-3-((6-chloropyridazin-3-yl) (cyclopropyl)amino)-2-fluoro-8-azabicyclo[3.2.1]octane-8-carboxylate (INT-5)

(360) ##STR00368##

(361) Step 1: Synthesis of () tert-butyl (1S,2R,3R,5R)-3-((6-chloropyridazin-3-yl)amino)-2-fluoro-8-azabicyclo[3.2.1]octane-8-carboxylate. Into a 1-L round-bottom flask purged and maintained with an inert atmosphere of nitrogen, was placed tert-butyl (1S,2R,3R,5R)-3-amino-2-fluoro-8-azabicyclo[3.2.1]octane-8-carboxylate (100 g, 409 mmol, 1.0 equiv), 3,6-dichloropyridazine (122 g, 819 mmol, 2.0 equiv), DIEA (156 g, 1.23 mol, 3.0 equiv), DMSO (1 L). The resulting solution was stirred for 18 h at 130 C. The reaction mixture was cooled to room temperature. The resulting solution was diluted with 2 L of H.sub.2O. The resulting solution was extracted with 32 L of ethyl acetate and the organic layers were combined. The combined organic layers were washed with 21 L of brine and dried over anhydrous sodium sulfate. The solids were filtered out. The resulting mixture was concentrated under vacuum. The crude product was purified by silica gel column chromatography (gradient elution with EtOAc in petroleum ether=0 to 50%). This resulted in the title compound (63 g) as a yellow solid.

(362) Step 2: () tert-butyl (1S,2R,3R,5R)-3-((6-chloropyridazin-3-yl) (cyclopropyl)amino)-2-fluoro-8-azabicyclo[3.2.1]octane-8-carboxylate. To a solution of () tert-butyl (1S,2R,3R,5R)-3-((6-chloropyridazin-3-yl)amino)-2-fluoro-8-azabicyclo[3.2.1]octane-8-carboxylate (20.0 g, 56.05 mmol, 1.0 equiv.) in 1,2-dichloroethane (400 mL) were added cyclopropylboronic acid (14.4 g, 168 mmol, 3.0 equiv.), Cu(OAc).sub.2 (13.2 g, 72.9 mmol, 1.3 equiv.), 2,2-bipyridine (11.38 g, 72.9 mmol, 1.3 equiv.), Na.sub.2CO.sub.3 (17.82 g, 168 mmol, 3.0 equiv.) and 4 A molecular sieves (15 g) at room temperature. The mixture was heated to 50 C. for 16 h under air atmosphere, then the reaction mixture cooled to room temperature. The mixture was filtered through Celite brand filter agent and the filtrate was concentrated and purified on silica flash column with gradient elution with EtOAc in petroleum ether=0 to 60%) to afford the title compound 7.0 g (31.4%) as an off-white solid. LCMS: m/z 397 [M+H].sup.+.

Example B3: General Synthesis Method FHeterocycle Suzuki and Chiral Purification of Penultimate Intermediates

(363) ##STR00369##

Specific Example of General Method F: Synthesis of 4-(2-fluoro-4-(6-(((1S,2S,3R,5R)-2-fluoro-8-azabicyclo[3.2.1]octan-3-yl)(methyl)amino)pyridazin-3-yl)-5-hydroxyphenyl)-1-methylpyridin-2(1H)-one and 4-(2-fluoro-4-(6-(((1R,2R,3S,5S)-2-fluoro-8-azabicyclo[3.2.1]octan-3-yl)(methyl)amino)pyridazin-3-yl)-5-hydroxyphenyl)-1-methylpyridin-2(1H)-one

(364) ##STR00370##

(365) Step 1: Synthesis of 1-bromo-4-chloro-5-fluoro-2-(methoxymethoxy)benzene: Into a 500-mL 4-necked round-bottom flask purged and maintained with an inert atmosphere of nitrogen, was placed NaH (3.19 g, 133 mmol, 1.20 equiv), THF (250 mL). This was followed by the addition of 2-bromo-5-chloro-4-fluorophenol (25.00 g, 111 mmol, 1.00 equiv) dropwise with stirring at 0 C. The reaction mixture was stirred for 30 min at 0 C. To this was added a solution of bromo(methoxy)methane (16.63 g, 133 mmol, 1.20 equiv) in THF (50 mL) dropwise with stirring at 0 C. The resulting solution was stirred overnight at rt. The reaction was then quenched by the addition of 500 mL of water/ice. The resulting solution was extracted with 3500 mL of ethyl acetate and the organic layers combined. The resulting mixture was washed with 500 mL of brine, dried over anhydrous sodium sulfate, and concentrated under vacuum. The residue was purified by silica gel flash chromatography eluting with ethyl acetate/petroleum ether (0-20%) to afford the title compound (25 g, 83.7%) as a yellow oil.

(366) Step 2: Synthesis of 2-(4-chloro-5-fluoro-2-(methoxymethoxy)phenyl)-4,4,5,5-tetramethyl-1,3,2-dioxaborolane: Into a 250-mL 4-necked round-bottom flask purged and maintained with an inert atmosphere of nitrogen, was placed 1-bromo-4-chloro-5-fluoro-2-(methoxymethoxy)benzene (10.00 g, 37.1 mmol, 1.00 equiv), dioxane (100 mL), 4,4,4,4,5,5,5,5-octamethyl-2,2-bi(1,3,2-dioxaborolane) (11.3 g, 44.5 mmol, 1.20 equiv), KOAc (7.28 g, 74.2 mmol, 2.00 equiv), and Pd(dppf)Cl.sub.2 (1.36 g, 1.86 mmol, 0.05 equiv). The resulting solution was stirred overnight at 100 C. The reaction was then quenched by the addition of 200 mL of water. The resulting solution was extracted with 3200 mL of ethyl acetate and the organic layers combined, washed with brine, dried over anhydrous sodium sulfate, and concentrated under vacuum. The residue was purified by silica gel flash chromatography eluting with ethyl acetate/petroleum ether (0-20%) to afford the title compound (7 g, 59.6% yield) as an off-white solid.

(367) Step 3: Synthesis of () tert-butyl (1R,2S,3S,5S)-3-((6-(4-chloro-5-fluoro-2-(methoxymethoxy)phenyl)pyridazin-3-yl)(methyl)amino)-2-fluoro-8-azabicyclo[3.2.1]octane-8-carboxylate: Into a 50-mL 4-necked round-bottom flask purged and maintained with an inert atmosphere of nitrogen, was placed () tert-butyl (1S,2R,3R,5R)-3-[(6-chloropyridazin-3-yl)(methyl)amino]-2-fluoro-8-azabicyclo[3.2.1]octane-8-carboxylate (INT-1, 8.20 g, 22.1 mmol, 1.00 equiv), 1,4-dioxane (20.0 mL), 2-[4-chloro-5-fluoro-2-(methoxymethoxy)phenyl]-4,4,5,5-tetramethyl-1,3,2-dioxaborolane (7.00 g, 22.1 mmol, 1.00 equiv), K.sub.2CO.sub.3 (6.11 g, 44.2 mmol, 2.00 equiv), Pd(dppf)Cl.sub.2 (0.81 g, 1.11 mmol, 0.05 equiv), H.sub.2O (4.00 mL). The resulting solution was stirred overnight at 100 degrees C. The reaction was then quenched by the addition of 100 mL of water. The resulting solution was extracted with 3100 mL of ethyl acetate and the organic layers combined. The resulting mixture was washed with 1100 ml of brine. The mixture was dried over anhydrous sodium sulfate and concentrated under vacuum. The residue was purified by silica gel flash chromatography eluting with ethyl acetate/petroleum ether (0-80%) to afford the title compound (5.0 g, 43.1% yield) as a yellow oil.

(368) Step 4: Synthesis of () tert-butyl (1S,2R,3R,5R)-2-fluoro-3-((6-(5-fluoro-2-(methoxymethoxy)-4-(1-methyl-2-oxo-1,2-dihydropyridin-4-yl)phenyl)pyridazin-3-yl)(methyl)amino)-8-azabicyclo[3.2.1]octane-8-carboxylate: Into a 50-mL 4-necked round-bottom flask purged and maintained with an inert atmosphere of nitrogen, was placed () tert-butyl (1R,2S,3S,5S)-3-([6-[4-chloro-5-fluoro-2-(methoxymethoxy)phenyl]pyridazin-3-yl] (methyl)amino)-2-fluoro-8-azabicyclo[3.2.1]octane-8-carboxylate (5.00 g, 9.524 mmol, 1.00 equiv), Dioxane (10.00 mL), 1-methyl-4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl) pyridin-2-one (2.69 g, 11.429 mmol, 1.20 equiv), K.sub.2CO.sub.3 (2.63 g, 19.048 mmol, 2.00 equiv), Pd(dppf)Cl.sub.2 (0.35 g, 0.476 mmol, 0.05 equiv), H.sub.2O (2.00 mL). The resulting solution was stirred overnight at 100 degrees C. The reaction was then quenched by the addition of 100 mL of water. The resulting solution was extracted with 3100 mL of ethyl acetate and the organic layers combined. The resulting mixture was washed with 1100 of brine. The mixture was dried over anhydrous sodium sulfate and concentrated under vacuum. The residue was applied onto a silica gel column with ethyl acetate/petroleum ether (0-80%) to afford the title compound as a yellow solid.

(369) Step 5: Chiral purification to isolate tert-butyl (1S,2R,3R,5R)-2-fluoro-3-((6-(5-fluoro-2-(methoxymethoxy)-4-(1-methyl-2-oxo-1,2-dihydropyridin-4-yl)phenyl)pyridazin-3-yl)(methyl)amino)-8-azabicyclo[3.2.1]octane-8-carboxylate and tert-butyl (1R,2S,3S,5S)-2-fluoro-3-((6-(5-fluoro-2-(methoxymethoxy)-4-(1-methyl-2-oxo-1,2-dihydropyridin-4-yl)phenyl)pyridazin-3-yl)(methyl)amino)-8-azabicyclo[3.2.1]octane-8-carboxylate (PENT-1A & PENT-1B): Chiral Separation method-() tert-butyl (1S,2R,3R,5R)-2-fluoro-3-((6-(5-fluoro-2-(methoxymethoxy)-4-(1-methyl-2-oxo-1,2-dihydropyridin-4-yl)phenyl)pyridazin-3-yl)(methyl)amino)-8-azabicyclo[3.2.1]octane-8-carboxylate, 600 mg, was purified by chiral SFC purification by the following method to give the two title compounds (PENT-1A, t.sub.R=4.01 min, 650 mg) and (PENT-1B, t.sub.R=5.65 min, 600 mg). Column: CHIRALPAK IA, 2*25 cm, 5 m; Mobile Phase A: CO.sub.2, Mobile Phase B: MeOH: DCM=8:1; Flow rate: 40 mL/min; Gradient: 50% B; wavelength 220 nm.

(370) Step 6: Synthesis of 4-(2-fluoro-4-(6-(((1S,2S,3R,5R)-2-fluoro-8-azabicyclo[3.2.1]octan-3-yl)(methyl)amino)pyridazin-3-yl)-5-hydroxyphenyl)-1-methylpyridin-2(1H)-one and 4-(2-fluoro-4-(6-(((1R,2R,3S,5S)-2-fluoro-8-azabicyclo[3.2.1]octan-3-yl)(methyl)amino)pyridazin-3-yl)-5-hydroxyphenyl)-1-methylpyridin-2(1H)-one (Compound 1A & Compound 1B): Into a 25-mL round-bottom flask purged and maintained with an inert atmosphere of nitrogen, was placed tert-butyl (1S,2R,3R,5R)-2-fluoro-3-([6-[5-fluoro-2-(methoxymethoxy)-4-(1-methyl-2-oxopyridin-4-yl)phenyl] pyridazin-3-yl] (methyl)amino)-8-azabicyclo[3.2.1]octane-8-carboxylate (100.0 mg, 1 equiv), HCl (gas) in 1,4-dioxane (2.00 mL). The resulting solution was stirred for 3 h at rt. The reaction was then quenched by the addition of 20 mL of aqueous NaHCO.sub.3. The resulting solution was extracted with 320 mL of dichloromethane. The resulting mixture was washed with 120 mL brine, dried over anhydrous sodium sulfate and concentrated under vacuum. The crude product was purified by Flash-Prep-HPLC with the following conditions: Column, XB-C18; mobile phase, 0.1% NH.sub.4HCO.sub.3/H.sub.2O: ACN=10-60%; Detector, 254 nm; to give the title compound as Compound 1A (27 mg, 35.6%) as a yellow solid.

(371) .sup.1H NMR (300 MHz, DMSO-d6) 13.32 (s, 1H), 8.32 (d, J=9.9 Hz, 1H), 7.94 (d, J=12.4 Hz, 1H), 7.79 (d, J=7.1 Hz, 1H), 7.41 (d, J=9.9 Hz, 1H), 7.09 (d, J=6.8 Hz, 1H), 6.59 (s, 1H), 6.46 (dd, J=6.9, 2.1 Hz, 1H), 5.12 (s, 1H), 4.66 (d, J=52.1 Hz, 1H), 3.56 (s, 2H), 3.47 (s, 3H), 3.06 (d, J=1.8 Hz, 3H), 2.26 (t, J=12.3 Hz, 1H), 1.79 (s, 2H), 1.70 (d, J=12.6 Hz, 2H), 1.56 (d, J=8.6 Hz, 1H). LCMS: m/z 454.3 [M+H].sup.+.

(372) Following the procedure above but with PENT-1B (100 mg, 0.167 mmol) gave the title compound as Compound 1B (26 mg, 34.3% yield) as a yellow solid. .sup.1H NMR (300 MHz, DMSO-d6) 13.33 (s, 1H), 8.31 (d, J=10.0 Hz, 1H), 7.94 (d, J=12.4 Hz, 1H), 7.79 (d, J=7.1 Hz, 1H), 7.40 (d, J=9.9 Hz, 1H), 7.09 (d, J=6.9 Hz, 1H), 6.59 (t, J=1.7 Hz, 1H), 6.45 (dt, J=7.1, 1.9 Hz, 1H), 5.00 (s, 1H), 4.64 (d, J=52.2 Hz, 1H), 3.53 (s, 2H), 3.47 (s, 3H), 3.05 (d, J=1.8 Hz, 3H), 2.31-2.17 (m, 1H), 1.79 (s, 2H), 1.68 (d, J=12.3 Hz, 2H), 1.55 (s, 1H). LCMS: m/z 454.3 [M+H].sup.+.

(373) The examples in Table 3 were synthesized using a sequence analogous to that used to synthesize Compound 1A and Compound 1B by general Method F.

(374) TABLE-US-00036 TABLE 3 Additional Compounds Prepared by General Method F. Chiral Chiral Intermediate SMSM# Structure HPLC or SFC Purification Method Retention Time (min) 11A Instrument: SFC-80 (Thar, Waters) Column: AD 20 * 250 mm, 10 um (Daicel) Column Temperature: 35 C. Mobile Phase: CO2/MeOH (0.2% Methanol Ammonia) = 50/50 Flow rate: 80 g/min Back pressure: 100 bar Detection wavelength: 214 nm Cycle time: 6 min Sample solution: 200 mg dissolved in 25 ml Methanol Injection volume: 1.2 ml 1.33 or 11B 2.03 12A Instrument: SFC-80 (Thar, Waters) Column: AD 20 * 250 mm, 10 um (Daicel) Column Temperature: 35 C. Mobile phase: CO2/ MeOH (0.2% Methanol Ammonia) = 60/40 Flow rate: 80 g/min Back pressure: 100 bar Detection wavelength: 214 nm Cycle time: 6.5 min Sample solution: 160 mg dissolved in 20 ml Methanol Injection volume: 1.9 ml 1.66 or 12B 3.18 13A Instrument: SFC-80 (Thar, Waters) Column: OJ 20 * 250 mm, 10 um (Daicel) Column temperature: 35 C. Mobile phase: CO2/ MeOH (0.2% Methanol Ammonia) = 75/25 Flow rate: 100 g/min Back pressure: 100 bar Detection wavelength: 285 um Cycle time: 4.0 min Sample solution: 390 mg dissolved 1.49 in 28 ml Methanol or Injection volume: 1.0 ml 13B 2.13 14A Instrument: SFC-80 (Thar, Waters) Column: OD 20 * 250 mm, 10 um (Daicel) Column temperature: 35 C. Mobile phase: CO2/MeOH (0.2% Methanol Ammonia) = 65/35 Flow rate: 80 g/min Back pressure: 100 bar Detection wavelength: 214 nm Cycle time: 8 min Sample solution: 200 mg dissolved in 20 ml Methanol Injection volume: 4.5 ml 1.36 or 14B 1.54 15A Instrument: SFC-80 (Thar, Waters) Column: AD 20 * 250 mm, 10 um (Daicel) Column temperature: 35 C. Mobile phase: CO2/ MeOH (0.2% Methanol Ammonia) = 30/70 Flow rate: 80 g/min Back pressure: 100 bar Detection wavelength: 214 nm Cycle time: 8 min Sample solution: 400 mg dissolved in 20 ml Methanol 1.54 Injection volume: 4.5 ml or 15B 0 3.76 16A Instrument: SFC-80 (Thar, Waters) Column: AD 20 * 250 mm, 10 um (Daicel) Column temperature: 35 C. Mobile phase: CO2/ MeOH (0.2% Methanol Ammonia) = 45/55 Flow rate: 75 g/min Back pressure: 100 bar Detection wavelength: 214 nm Cycle time: 12.5 min Sample solution: 450 mg dissolved in 15 ml Methanol 0.83 or Injection volume: 1.9 ml 16B 2.9 17A Instrument: Gilson-281 Column: IE 20 * 250, 10 um Mobile Phase: ACN (0.1% DEA):MEOH (0.1% DEA) = 6:4 Flow Rate: 50 ml/min Run time per injection: 35 min Injection: 4 ml Sample solution: 82 mg in 20 mL DCM 5.99 or 17B 9.05 18A Instrument: SFC-80 (Thar, Waters) Column: OJ 20 * 250 mm, 10 um (Daicel) Column temperature: 35 C. Mobile phase: CO2/ETOH (0.5% Methanol Ammonia) = 80/20 Flow rate: 80 g/min Back pressure: 100 bar Detection wavelength: 254 nm Cycle time: 4.0 min Sample solution: 300 mg dissolved in 20 ml Methanol Injection volume: 1.0 ml 1.92 or 18B 2.65 19A Instrument: SFC-80 (Thar, Waters) Column: OJ 20 * 250 mm, 10 um (Daicel) Column temperature: 35 C. Mobile phase: CO2/ MeOH (0.2% Methanol Ammonia) = 75/25 Flow rate: 80 g/min Back pressure: 100 bar Detection wavelength: 214 nm Cycle time: 4.2 min Sample solution: 300 mg dissolved in 30 ml Methanol Injection volume: 1.0 mL 1.07 or 19B 1.37 20A Instrument: SFC-80 (Thar, Waters) Column: AD 20 * 250 mm, 10 um (Daicel) Column temperature: 35 C. Mobile phase: CO2/ MeOH (0.2% Methanol Ammonia) = 60/40 Flow rate: 80 g/min Back pressure: 100 bar Detection wavelength: 214 nm Cycle time: 5.6 min Sample solution: 300 mg dissolved in 35 ml Methanol 1.15 Injection volume: 2.0 mL or 20B 0 1.99 21A Instrument: SFC-80 (Thar, Waters) Column: AD 20 * 250 mm, 10 um (Daicel) Column temperature: 35 C. Mobile phase: CO2/ MeOH (0.2% Methanol Ammonia) = 60/40 Flow rate: 80 g/min Back pressure: 100 bar Detection wavelength: 214 nm Cycle time: 5.6 min Sample solution: 300 mg dissolved in 35 ml Methanol 1.55 Injection volume: 2.0 mL or 21B 3.25 22A Column: CHIRALPAK AD-3, 0.3 * 10 cm, 3.0 um Mobile Phase A: CO2, Mobile Phase B: IPA (10 mM NH3) Flow rate: 2.0 ml/min Gradient: 10% B to 50% B in 4 min Detection wavelength: 220 nm 3.04 or 22B 3.35 112A Column: CHIRALPAK IA, 2 * 25 cm, 5 um Mobile Phase A: HEX (10 mM NH3), Mobile Phase B: IPA-HPLC Flow rate: 20 mL/min Gradient: 50 B to 50 B in 20 min Detection wavelength 223/261 nm 7.8 or 112B 12.5

Example B4: General Synthesis MethodHeterocycle Suzuki (Reverse) and Chiral Purification of Penultimate Intermediates

(375) ##STR00397##

(376) Specific Example of General Method T: Compound 2A & 2B: Synthesis of 2-(6-(((1S,3R,5R)-6,6-difluoro-8-azabicyclo[3.2.1]octan-3-yl)(methyl)amino)pyridazin-3-yl)-5-(6-methoxypyridazin-4-yl)phenol and 2-(6-(((1R,3S,5S)-6,6-difluoro-8-azabicyclo[3.2.1]octan-3-yl)(methyl)amino)pyridazin-3-yl)-5-(6-methoxypyridazin-4-yl)phenol

(377) ##STR00398##

(378) Step 1: Synthesis of () tert-butyl (1S,3R,5R)-3-((6-(4-chloro-2-(methoxymethoxy)phenyl)pyridazin-3-yl)(methyl)amino)-6,6-difluoro-8-azabicyclo[3.2.1]octane-8-carboxylate: A mixture of () tert-butyl (1S,3R,5R)-3-((6-chloropyridazin-3-yl)(methyl)amino)-6,6-difluoro-8-azabicyclo[3.2.1]octane-8-carboxylate (400 mg, 1.03 mmol), 4-chloro-2-(methoxymethoxy)phenylboronic acid (335 mg, 1.55 mmol), Pd(dppf)Cl.sub.2 (154 mg, 0.21 mmol) and K.sub.2CO.sub.3 (284 mg, 2.06 mmol) in 4 mL of dioxane and 1 mL of H.sub.2O was degassed and stirred at 110 C. for 2 h. After cooling to rt, the mixture was concentrated and purified by silica gel column (10-60% EtOAc/petroleum ether) to give the title compound (350 mg, 64.8% yield) as a yellow solid LCMS: m/z 525.2 [M+H].sup.+; t.sub.R=2.23 min.

(379) Step 2: Synthesis of () tert-butyl (1S,3R,5R)-6,6-difluoro-3-((6-(2-(methoxymethoxy)-4-(6-methoxypyridazin-4-yl)phenyl)pyridazin-3-yl)(methyl)amino)-8-azabicyclo[3.2.1]octane-8-carboxylate: A mixture of () tert-butyl (1S,3R,5R)-3-((6-(4-chloro-2-(methoxymethoxy)phenyl)pyridazin-3-yl)(methyl)amino)-6,6-difluoro-8-azabicyclo[3.2.1]octane-8-carboxylate (380 mg, 0.73 mmol), 4,4,4,4,5,5,5,5-octamethyl-2,2-bi(1,3,2-dioxaborolane) (241 mg, 0.95 mmol), Pd.sub.2(dba).sub.3 (137 mg, 0.15 mmol), X-Phos (142 mg, 0.30 mmol) and KOAc (143 mg, 1.46 mmol) in 3 mL of 1,4-dioxane was degassed and stirred at 110 C. for 2 h. After cooling to room temperature, 5-chloro-3-methoxypyridazine (137 mg, 0.95 mmol), K.sub.2CO.sub.3 (202 mg, 1.46 mmol) and H.sub.2O (0.5 mL) were added. The mixture was stirred at 110 C. for 2 h, concentrated and purified by silica gel column (10-80% EtOAc/petroleum ether) to give the title compound (350 mg, 80% yield) as a yellow solid. LCMS: m/z 599.3 [M+H].sup.+; t.sub.R=1.91 min.

(380) Step 3: Chiral purification to isolate tert-butyl (1S,3R,5R)-6,6-difluoro-3-((6-(2-(methoxymethoxy)-4-(6-methoxypyridazin-4-yl)phenyl)pyridazin-3-yl)(methyl)amino)-8-azabicyclo[3.2.1]octane-8-carboxylate and tert-butyl (1R,3S,5S)-6,6-difluoro-3-((6-(2-(methoxymethoxy)-4-(6-methoxypyridazin-4-yl)phenyl)pyridazin-3-yl)(methyl)amino)-8-azabicyclo[3.2.1]octane-8-carboxylate (PENT-2A & PENT-2B): () tert-butyl (1S,3R,5R)-6,6-difluoro-3-((6-(2-(methoxymethoxy)-4-(6-methoxypyridazin-4-yl)phenyl)pyridazin-3-yl)(methyl)amino)-8-azabicyclo[3.2.1]octane-8-carboxylate, 350 mg, was purified by chiral SFC purification by the following method to give the two title compounds (PENT-2A, t.sub.R=1.42 min, 170 mg) and (PENT-2B, t.sub.R=1.81 min, 180 mg). Instrument: SFC-80 (Thar, Waters); Column: OJ 20*250 mm, 10 um (Daicel); Column temperature: 35 C.; Mobile phase: CO.sub.2/MeOH (0.2% Methanol Ammonia)=75/25; Flow rate: 80 g/min; Back pressure: 100 bar; Detection wavelength: 214 nm; Cycle time: 3.0 min; Sample solution: 100 mg dissolved in 15 mL methanol; Injection volume: 1.0 mL.

(381) Step 4: Synthesis of 2-(6-(((1S,3R,5R)-6,6-difluoro-8-azabicyclo[3.2.1]octan-3-yl)(methyl)amino)pyridazin-3-yl)-5-(6-methoxypyridazin-4-yl)phenol and 2-(6-(((1R,3S,5S)-6,6-difluoro-8-azabicyclo[3.2.1]octan-3-yl)(methyl)amino)pyridazin-3-yl)-5-(6-methoxypyridazin-4-yl)phenol (Compound 2A & Compound 2B): To the mixture of PENT-2A (100 mg, 0.17 mmol) in CH.sub.2Cl.sub.2 (3 mL) was added 4N HCl in dioxane (1.5 mL). The mixture was stirred at room temperature for 1 h and concentrated to dryness, then dissolved in water and saturated NaHCO.sub.3 aqueous solution was added until pH to 8-9. The mixture was extracted with CH.sub.2Cl.sub.2/MeOH (10 mL3, 10:1 v/v). The combined organic solvents were concentrated and dried by lyophilization to give the title compound as Compound 2A (46 mg, 61%) as yellow solid (61% yield). .sup.1H NMR (400 MHZ, DMSO-d.sub.6) 9.35 (s, 1H), 8.33 (d, J=10.0 Hz, 1H), 8.05 (d, J=8.3 Hz, 1H), 7.56 (s, 1H), 7.49 (d, 2H), 7.34 (d, J=9.9 Hz, 1H), 5.12 (s, 2H), 4.08 (s, 3H), 3.64 (s, 1H), 3.46 (d, J=13.7 Hz, 2H), 3.00 (s, 4H), 2.42-2.28 (m, 2H), 1.98-1.91 (m, 1H), 1.85-1.73 (m, 2H), 1.75-1.61 (m, 1H). LCMS: m/z 455.3 [M+H].sup.+; t.sub.R=1.69 min.

(382) Following the procedure above but with PENT-2B (100 mg, 0.17 mmol) gave the title compound as Compound 2B (32 mg, 42.1% yield) as a yellow solid. .sup.1H NMR (400 MHZ, DMSO-d.sub.6) 9.33 (s, 1H), 8.36 (d, J=9.7 Hz, 1H), 8.04 (d, J=8.5 Hz, 1H), 7.53 (s, 1H), 7.45 (d, J=15.0 Hz, 2H), 7.31 (d, J=9.6 Hz, 1H), 5.12 (s, 1H), 4.08 (s, 3H), 3.63 (s, 1H), 3.44 (d, J=13.5 Hz, 1H), 2.99 (s, 3H), 2.89 (s, 1H), 2.42-2.28 (m, 2H), 1.98-1.89 (m, 1H), 1.84-1.72 (m, 2H), 1.75-1.63 (m, 1H). LCMS: m/z 455.2 [M+H].sup.+; t.sub.R=1.69 min.

Example B5. General Synthesis Method KHeterocycle Suzuki (Reverse) and Chiral Purification of Aryl Halide Intermediates

(383) ##STR00399##

Specific Example of General Method K: Compound 28A & 28B: Synthesis of 5-(4-(6-(((1S,2S,3R,5R)-2-fluoro-9-azabicyclo[3.3.1]nonan-3-yl)(methyl)amino)pyridazin-3-yl)-3-hydroxyphenyl) pyrazine-2-carbonitrile and 5-(4-(6-(((1R,2R,3S,5S)-2-fluoro-9-azabicyclo[3.3.1]nonan-3-yl)(methyl)amino)pyridazin-3-yl)-3-hydroxyphenyl) pyrazine-2-carbonitrile

(384) ##STR00400##

(385) Step 1: Synthesis of () tert-butyl (1S,2R,3R,5R)-3-((6-(4-chloro-2-(methoxymethoxy)phenyl)pyridazin-3-yl)(methyl)amino)-2-fluoro-9-azabicyclo[3.3.1]nonane-9-carboxylate: A mixture of () tert-butyl (1S,2R,3R,5R)-3-((6-chloropyridazin-3-yl)(methyl)amino)-2-fluoro-9-azabicyclo[3.3.1]nonane-9-carboxylate (INT-3, 1.10 g, 2.60 mmol), 4-chloro-2-(methoxymethoxy)phenylboronic acid (843 mg, 3.90 mmol), Pd(dppf)Cl.sub.2 (190 mg, 0.26 mmol) and K.sub.2CO.sub.3 (720 mg, 5.20 mmol) in 1,4-dioxane (12 mL) and H.sub.2O (4 mL) was stirred at 110 C. for 2 h under N.sub.2 atmosphere. After cooling to room temperature, the mixture was concentrated and purified by silica gel chromatography (0-20% EtOAc/petroleum ether) to give of the title compound (1.11 g, 82% yield) as a yellow solid. LCMS: m/z 521.3 [M+H].sup.+; t.sub.R=1.80 min.

(386) Step 2: Chiral purification to isolate of tert-butyl (1S,2R,3R,5R)-3-((6-(4-chloro-2-(methoxymethoxy)phenyl)pyridazin-3-yl)(methyl)amino)-2-fluoro-9-azabicyclo[3.3.1]nonane-9-carboxylate and tert-butyl (1R,2S,3S,5S)-3-((6-(4-chloro-2-(methoxymethoxy)phenyl)pyridazin-3-yl)(methyl)amino)-2-fluoro-9-azabicyclo[3.3.1]nonane-9-carboxylate (HETX-28A & HETX-28B): Racemic intermediate, () tert-butyl (1S,2R,3R,5R)-3-((6-(4-chloro-2-(methoxymethoxy)phenyl)pyridazin-3-yl)(methyl)amino)-2-fluoro-9-azabicyclo[3.3.1]nonane-9-carboxylate, 1570 mg, was purified by chiral SFC purification by the following method to give the two title compounds as HETX-28A (t.sub.R=0.61 min, 820 mg) and HETX-28B (t.sub.R=2.1 min, 720 mg). Instrument: SFC-80 (Thar, Waters); Column: AD 20*250 mm, 10 um (Daicel); Column temperature: 35 C.; Mobile phase: CO.sub.2/MEOH/ACN (0.2% Methanol Ammonia)=40/30/30; Flow rate: 80 g/min. Back pressure: 100 bar; Detection wavelength: 280 nm; Cycle time: 15 min; Sample solution: 1570 mg dissolved in 25 mL methanol; Injection volume: 4 mL.

(387) Step 3: Synthesis of tert-butyl (1S,2R,3R,5R)-2-fluoro-3-((6-(2-(methoxymethoxy)-4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenyl)pyridazin-3-yl)(methyl)amino)-9-azabicyclo[3.3.1]nonane-9-carboxylate and tert-butyl (1R,2S,3S,5S)-2-fluoro-3-((6-(2-(methoxymethoxy)-4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenyl)pyridazin-3-yl)(methyl)amino)-9-azabicyclo[3.3.1]nonane-9-carboxylate (BOR-28A & BOR-28B): A mixture of HETX-28A (110 mg, 0.21 mmol), 4,4,4,4,5,5,5,5-octamethyl-2,2-bi(1,3,2-dioxaborolane) (54 mg, 0.315 mmol), Pd.sub.2(dba).sub.3 (38 mg, 0.042 mmol), X-phos (40 mg, 0.084 mmol) and KOAc (42 mg, 0.42 mmol) in 1,4-dioxane (5.0 mL) was stirred at 100 C. for 2 h under N.sub.2 atmosphere. After cooling to room temperature, the crude mixture containing the title compound as BOR-28A was used directly in the next step. LCMS: m/z 613.2 [M+H].sup.+; t.sub.R=2.04 min.

(388) Following the above procedure, but with HETX-28B (100 mg, 0.19 mmol), gave a crude solution of the title compound as BOR-28B, which was used without further purification in the next step. LCMS: m/z 613.2 [M+H].sup.+; t.sub.R=1.86 min.

(389) Step 4: Synthesis of tert-butyl (1S,2R,3R,5R)-3-((6-(4-(5-cyanopyrazin-2-yl)-2-(methoxymethoxy)phenyl)pyridazin-3-yl)(methyl)amino)-2-fluoro-9-azabicyclo[3.3.1]nonane-9-carboxylate and tert-butyl (1R,2S,3S,5S)-3-((6-(4-(5-cyanopyrazin-2-yl)-2-(methoxymethoxy)phenyl)pyridazin-3-yl)(methyl)amino)-2-fluoro-9-azabicyclo[3.3.1]nonane-9-carboxylate (PENT-28A & PENT-28B): To the crude solution of BOR-28A from step 3 (0.16 mmol), was added 2-chloropyrazine (34 mg, 0.24 mmol), Pd(dppf)Cl.sub.2 (12 mg, 0.016 mmol) and K.sub.2CO.sub.3 (45 mg, 0.32 mmol) in 1,4-dioxane (5 mL) and H.sub.2O (1 mL) was stirred at 110 C. for 2 h under N.sub.2 atmosphere. After cooling to room temperature, the mixture was concentrated and purified by silica gel chromatography (0-20% EtOAc/petroleum ether) to give the title compound as PENT-28A (50 mg, 52% yield) as a yellow oil. LCMS: m/z 590.3 [M+H].sup.+; t.sub.R=1.80 min.

(390) Following the procedure above, but with BOR-28B (0.16 mmol), gave the title compound as PENT-28B (50 mg, 52% yield) as a yellow oil. LCMS: m/z 590.1 [M+H].sup.+; t.sub.R=1.82 min.

(391) Step 5: Synthesis of 5-(4-(6-(((1S,2S,3R,5R)-2-fluoro-9-azabicyclo[3.3.1]nonan-3-yl)(methyl)amino)pyridazin-3-yl)-3-hydroxyphenyl) pyrazine-2-carbonitrile 5-(4-(6-(((1R,2R,3S,5S)-2-fluoro-9-azabicyclo[3.3.1]nonan-3-yl)(methyl)amino)pyridazin-3-yl)-3-hydroxyphenyl) pyrazine-2-carbonitrile (Compound 28A & Compound 28B): To a solution of PENT-28A in (50 mg, 0.08 mmol) in CH.sub.2Cl.sub.2 (4.0 mL) was added TFA (2 mL). The mixture was stirred at 25 C. for 1 h, then concentrated. The crude solid was dissolved into water (3 mL) and neutralized with saturated K.sub.2CO.sub.3 aqueous solution. The precipitate was collected by filtration, washed with water, and dried under reduced pressure to give the title compound as Compound 28A (20 mg, 67% yield) as a yellow solid. .sup.1H NMR (500 MHZ, MeOD-d.sub.4) 9.34 (s, 1H), 9.07 (s, 1H), 8.23 (d, J=9.9 Hz, 1H), 7.99 (d, J=8.3 Hz, 1H), 7.87-7.75 (m, 2H), 7.37 (d, J=9.9 Hz, 1H), 6.02-5.85 (m, 1H), 3.42-3.38 (m, 2H), 3.17 (s, 3H), 2.66-2.58 (m, 1H), 2.11-1.77 (m, 7H). LCMS: m/z 446.1 [M+H].sup.+; t.sub.R=1.38 min.

(392) Following the procedure above, but with PENT-28B, gave the title compound as Compound 28B (20.3 mg, 54% yield) as a yellow solid. .sup.1H NMR (500 MHZ, MeOD-d.sub.4) 9.34 (s, 1H), 9.07 (s, 1H), 8.23 (d, J=9.9 Hz, 1H), 7.99 (d, J=8.3 Hz, 1H), 7.87-7.75 (m, 2H), 7.37 (d, J=9.9 Hz, 1H), 6.02-5.85 (m, 1H), 3.42-3.38 (m, 2H), 3.17 (s, 3H), 2.66-2.58 (m, 1H), 2.11-1.77 (m, 7H). LCMS: m/z 446.1 [M+H].sup.+; (R=1.38 min.

(393) The examples in Table 4 were synthesized using a sequence analogous to that used to synthesize Compound 28A and Compound 28B by general Method K.

(394) TABLE-US-00037 TABLE 4 Additional Compounds Prepared by General method K Chiral Chiral Intermediate SMSM# Structure HPLC or SFC Purification Method Retention Time (min) 23A 01 Instrument: SFC-200 (Thar, Waters) Column: AD 50 * 250 mm, 10 um (Daicel) Column temperature: 35 C. Mobile phase: CO2/ETOH (1% Methanol Ammonia) = 65/35 Flow rate: 120 g/min Back pressure: 100 bar Detection wavelength: 214 nm Cycle time: 5.7 min Sample solution: 3000 mg dissolved in 80 mL MeOH 0.83 Injection volume: 3.5 mL or 23B 02 1.61 24A 03 Instrument: SFC-80 (Thar, Waters) Column: AD 20 * 250 mm, 10 um (Daicel) Column temperature: 35 C. Mobile phase: CO2/MEOH/ACN (0.2% Methanol Ammonia) = 40/30/30 Flow rate: 80 g/min Back pressure: 100 bar Detection wavelength: 280 nm Cycle time: 15 min Sample solution: 1570 mg dissolved in 25 ml Methanol 0.54 Injection volume: 4 mL or 24B 04 2.10 25A 05 Instrument: SFC-200 (Thar, Waters) Column: AD 20 * 250 mm, 10 um (Daicel) Column temperature: 35 C. Mobile phase: CO2/MEOH (0.2% Methanol Ammonia) = 80/20 Flow rate: 120 g/min Back pressure: 100 bar Detection wavelength: 214 nm Cycle time: 4.1 min Sample solution: 6000 mg dissolved 1.05 in 110 ml MEOH Injection volume: 2 mL 25B 06 2.07 26A 07 Instrument: SFC-80 (Thar, Waters) Column: AD 20 * 250 mm, 10 um (Daicel) Column temperature: 35 C. Mobile phase: CO2/MEOH/ACN (0.2% Methanol Ammonia) = 40/30/30 Flow rate: 80 g/min Back pressure: 100 bar Detection wavelength: 280 nm Cycle time: 15 min Sample solution: 1570 mg dissolved in 25 ml Methanol 0.54 Injection volume: 4 mL or 26B 08 2.10 27A 09 Instrument: SFC-80 (Thar, Waters) Column: AD 20 * 250 mm, 10 um (Daicel) Column temperature: 35 C. Mobile phase: CO2/MEOH/ACN (0.2% Methanol Ammonia) = 40/30/30 Flow rate: 80 g/min Back pressure: 100 bar Detection wavelength: 280 nm Cycle time: 15 min Sample solution: 1570 mg dissolved in 25 ml Methanol 0.54 Injection volume: 4 mL or 27B 0 2.10 29A Instrument: SFC-80 (Thar, Waters) Column: AD 20 * 250 mm, 10 um (Daicel) Column temperature: 35 C. Mobile phase: CO2/MEOH/ACN (0.2% Methanol Ammonia) = 40/30/30 Flow rate: 80 g/min Back pressure: 100 bar Detection wavelength: 280 nm Cycle time: 15 min Sample solution: 1570 mg dissolved in 25 ml Methanol 0.54 Injection volume: 4 mL or 29B 2.10

Example B6. General Synthesis Method GHeterocycle Suzuki and Chiral Purification of Aryl Halide Intermediates

(395) ##STR00413##

(396) Specific Example of General Method G, Compound 3A & 3B: Synthesis of 2-(6-(((1S,3R,5R)-6,6-difluoro-8-azabicyclo[3.2.1]octan-3-yl)(methyl)amino)pyridazin-3-yl)-5-(1-methyl-1H-pyrazol-4-yl)phenol and 2-(6-(((1R,3S,5S)-6,6-difluoro-8-azabicyclo[3.2.1]octan-3-yl)(methyl)amino)pyridazin-3-yl)-5-(1-methyl-1H-pyrazol-4-yl)phenol.

(397) ##STR00414##

(398) Step 1: Chiral purification to isolate tert-butyl (1S,3R,5R)-3-((6-(4-chloro-2-(methoxymethoxy)phenyl)pyridazin-3-yl)(methyl)amino)-6,6-difluoro-8-azabicyclo[3.2.1]octane-8-carboxylate and tert-butyl (1R,3S,5S)-3-((6-(4-chloro-2-(methoxymethoxy)phenyl)pyridazin-3-yl)(methyl)amino)-6,6-difluoro-8-azabicyclo[3.2.1]octane-8-carboxylate (HEX-3A & HEX-3B): () tert-butyl (1S,3R,5R)-3-((6-(4-chloro-2-(methoxymethoxy)phenyl)pyridazin-3-yl)(methyl)amino)-6,6-difluoro-8-azabicyclo[3.2.1]octane-8-carboxylate, 350 mg, was purified by chiral SFC purification by the following method to give the two title compounds HETX-3A (t.sub.R=1.63 min, 140 mg) and HETX-3B (t.sub.R=1.94 min, 135 mg). Instrument: SFC-80 (Thar, Waters); Column: OJ 20*250 mm, 10 um (Daicel); Column temperature: 35 C.; Mobile phase: CO.sub.2/MeOH (0.2% Methanol Ammonia)=75/25; Flow rate: 80 g/min; Back pressure: 100 bar; Detection wavelength: 285 nm; Cycle time: 4.5 min; Sample solution: 460 mg dissolved in 25 mL methanol; Injection volume: 1.0 mL.

(399) Step 2: Synthesis of tert-butyl (1S,3R,5R)-6,6-difluoro-3-((6-(2-(methoxymethoxy)-4-(1-methyl-1H-pyrazol-4-yl)phenyl)pyridazin-3-yl)(methyl)amino)-8-azabicyclo[3.2.1]octane-8-carboxylate and tert-butyl (1R,3S,5S)-6,6-difluoro-3-((6-(2-(methoxymethoxy)-4-(1-methyl-1H-pyrazol-4-yl)phenyl)pyridazin-3-yl)(methyl)amino)-8-azabicyclo[3.2.1]octane-8-carboxylate (PENT-3A & PENT-3B): A mixture of HETX-3A (140 mg, 0.27 mmol), 1-methyl-4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1H-pyrazole (85 mg, 0.41 mmol), X-phos-Pd 2nd G (36 mg, 0.05 mmol) and K.sub.3PO.sub.4 (114 mg, 0.54 mmol) in 4 mL of dioxane and 1 mL of H.sub.2O was degassed and stirred at 110 C. for 2 h. After cooling to room temperature, the mixture was concentrated and purified by silica gel column (10-90% EtOAc/petroleum ether) to give the title compound as PENT-3A (85 mg, 55.8% yield) as a yellow solid. LCMS: m/z 571.3 [M+H].sup.+; t.sub.R=1.90 min.

(400) Following the procedure above, but with HETX-3B (135 mg, 0.26 mmol) gave the title compound as PENT-3B (80 mg, 54.5% yield) as a yellow solid. LCMS: m/z 571.3 [M+H].sup.+; t.sub.R=1.90 min.

(401) Step 3: Synthesis of 2-(6-(((1S,3R,5R)-6,6-difluoro-8-azabicyclo[3.2.1]octan-3-yl)(methyl)amino)pyridazin-3-yl)-5-(1-methyl-1H-pyrazol-4-yl)phenol and 2-(6-(((1R,3S,5S)-6,6-difluoro-8-azabicyclo[3.2.1]octan-3-yl)(methyl)amino)pyridazin-3-yl)-5-(1-methyl-1H-pyrazol-4-yl)phenol (Compound 3A & Compound 3B): To a mixture of PENT-3A (85 mg, 0.15 mmol) in CH.sub.2Cl.sub.2 (5 mL) was added 4N HCl in dioxane (2.5 mL). The mixture was stirred at room temperature for 1 h and concentrated to dryness. The residue was dissolved in water and saturated NaHCO.sub.3 aqueous solution was added till pH to 8-9. The mixture was extracted with CH.sub.2Ch/MeOH (10 mL3, 10:1 v/v). The combined organic solvents were concentrated and dried by lyophilization to give the title compound as Compound 3A (40 mg, 62.8% yield) as a yellow solid. .sup.1H NMR (500 MHZ, DMSO-d.sub.6) 8.22 (d, J=10.1 Hz, 1H), 8.20 (s, 1H), 7.91 (s, 1H), 7.84 (d, J=8.3 Hz, 1H), 7.30 (d, J=9.9 Hz, 1H), 7.15 (s, 1H), 7.13 (d, 1H), 5.08 (s, 1H), 3.87 (s, 3H), 3.63 (s, 1H), 3.44 (d, J=13.1 Hz, 1H), 2.96 (d, J=17.8 Hz, 3H), 2.86 (d, J=26.5 Hz, 1H), 2.42-2.29 (m, 2H), 2.01-1.87 (m, 1H), 1.87-1.74 (m, 2H), 1.73-1.60 (m, 1H). LCMS: m/z 427.2 [M+H].sup.+; t.sub.R=1.64 min.

(402) Following the procedure above but with PENT-3B (80 mg, 0.088 mmol) gave the title compound as Compound 3B (33 mg, 55.1% yield) as a yellow solid. .sup.1H NMR (500 MHZ, DMSO-d.sub.6) 8.22 (d, J=10.0 Hz, 1H), 8.20 (s, 1H), 7.91 (s, 1H), 7.84 (d, J=8.2 Hz, 1H), 7.30 (d, J=9.9 Hz, 1H), 7.17-7.10 (m, 2H), 5.08 (s, 1H), 3.87 (s, 3H), 3.63 (s, 1H), 3.44 (d, J=12.5 Hz, 1H), 3.30 (s, 1H), 2.97 (s, 3H), 2.38-2.30 (m, 2H), 1.97-1.87 (m, 1H), 1.86-1.74 (m, 2H), 1.74-1.65 (m, 1H). LCMS: m/z 427.2 [M+H].sup.+; t.sub.R=1.64 min.

(403) The examples in Table 5A and Table 5B were synthesized using a sequence analogous to that used to synthesize Compound 3A and Compound 3B by general Method G.

(404) TABLE-US-00038 TABLE 5A Intermediates Prepared by General Method G. Chiral Chiral Intermediate HPLC or SFC Purification Retention Time Intermediate Structure Method (min) HETX-3A HETX-3B Instrument: SFC-80 (Thar, Waters) Column: OJ 20*250 mm, 10 um (Daicel) Colmnn temperature: 35 C. Mobile phase: CO2/ MeOH(0.2% Methanol Ammonia) = 75/25 Flow rate: 80 g/min Backpressure: 100 bar Detection wavelength: 285 nm Cycle time: 4.5 min Sample solution: 460 mg dissolved in 25 ml Methanol Injection volume: 1.0 ml 1.63 1.94 HETX-30A HETX-30B Instrument: SFC-150 (Thar, Waters) Column: SC 20*250 mm, 10 um (Regis) Column temperature: 35 C. Mobile phase: CO2/MEOH(0.2% Methanol Ammonia) = 60/40 Flow rate: 100 g/min Backpressure: 100 bar Detection wavelength: 214 nm Cycle time: 3 min Sample solution: 3000 mg dissolved in 100 ml Methanol Injection volume: 1 mL 1.05 2.07

(405) TABLE-US-00039 TABLE 5B Additional examples prepared by General method G. SMSM# Structure Chiral Intermediate 30A HETX-30A or 30B 0 HETX-30B 31A HETX-30A or 31B HETX-30B 32A HETX-30A or 32B HETX-30B 33A HETX-30A or 33B HETX-30B 34A HETX-30A or 34B HETX-30B 35A HETX-30A or 35B 0 HETX-30B 36A HETX-30A or 36B HETX-30B 37A HETX-3A or 37B HETX-3B

Example B7. General Synthesis Method L. Convergent Suzuki and Chiral Purification of Penultimate Intermediates

(406) ##STR00435##

(407) Specific Example of General Method L, Compound 4A & 4B: Synthesis of 2-(6-(((1S,2S,3R,5R)-2-fluoro-8-azabicyclo[3.2.1]octan-3-yl)(methyl)amino)pyridazin-3-yl)-5-(1H-imidazol-1-yl)phenol and 2-(6-(((1R,2R,3S,5S)-2-fluoro-8-azabicyclo[3.2.1]octan-3-yl)(methyl)amino)pyridazin-3-yl)-5-(1H-imidazol-1-yl)phenol

(408) ##STR00436##

(409) Step 1: Synthesis of 1-bromo-4-iodo-2-(methoxymethoxy)benzene. MOMBr (1.25 g, 10 mmol) was added to a stirred solution of 2-bromo-5-iodophenol (1.5 g, 5 mmol) and K.sub.2CO.sub.3 (1.38 g, 10 mmol) in 20 mL of DMF at 0 C. The mixture was then stirred at room temperature for 16 h, quenched with 20 mL of water, extracted with EtOAc (320 mL). The combined organic solvents were dried over anhydrous Na.sub.2SO.sub.4, concentrated, and purified by silica gel column (0-5% EtOAc/petroleum ether) to give the title compound (1.45 g, 79% yield) as a colorless liquid. LCMS: m/z 343.1 [M+H].sup.+; t.sub.R=1.50 min.

(410) Step 2: Synthesis of 1-(4-bromo-3-(methoxymethoxy)phenyl)-1H-imidazole. A mixture of 1-bromo-4-iodo-2-(methoxymethoxy)benzene (3.42 g, 10 mmol), 1H-imidazole (1.36 g, 20 mmol), CuI (380 mg, 2 mmol) and Cs.sub.2CO.sub.3 (6.52 g, 20 mmol) in 50 mL of DMF was stirred at 100 C. for 16 h. Water (300 mL) was added to the reaction, then the mixture was extracted with ethyl acetate (3100 mL). The combined organic phases were dried and concentrated, then purified by silica gel chromatography (80% EtOAc/petroleum ether) to give the title compound (2.5 g, 88% yield). LCMS: m/z 283.2 [M+H].sup.+; t.sub.R=1.03 min.

(411) Step 3: Synthesis of () tert-butyl (1S,2R,3R,5R)-3-((6-(4-(1H-imidazol-1-yl)-2-(methoxymethoxy)phenyl)pyridazin-3-yl)(methyl)amino)-2-fluoro-8-azabicyclo[3.2.1]octane-8-carboxylate. A mixture of 1-(4-bromo-3-(methoxymethoxy)phenyl)-1H-imidazole (282 mg, 1.0 mmol), bis(pinacolato)diboron (380 mg, 1.5 mmol), Pd(dppf)Cl.sub.2 (73 mg, 0.1 mmol) and KOAc (294 mg, 3.0 mmol) in 10 mL of dioxane was degassed and stirred at 110 C. for 2 h. The mixture was cooled to room temperature, and () tert-butyl (1S,2R,3R,5R)-3-((6-chloropyridazin-3-yl)(methyl)amino)-2-fluoro-8-azabicyclo[3.2.1]octane-8-carboxylate INT-1 (250 mg, 0.7 mmol), Pd(dppf)Cl.sub.2 (73 mg, 0.1 mmol), K.sub.2CO.sub.3 (194 mg, 1.4 mmol) and water (2 mL) were added. The mixture was degassed and stirred at 110 C. for 2 h, then cooled to rt, concentrated, and purified by silica gel column (80% EtOAc/petroleum ether), to give the title compound (240 mg, 45% yield) as a yellow oil (240 mg, 45% yield). LCMS: m/z 540.2 [M+H].sup.+; t.sub.R=1.89 min.

(412) Step 4: Chiral purification to isolate tert-butyl (1S,2R,3R,5R)-3-((6-(4-(1H-imidazol-1-yl)-2-(methoxymethoxy)phenyl)pyridazin-3-yl)(methyl)amino)-2-fluoro-8-azabicyclo[3.2.1]octane-8-carboxylate and tert-butyl (1R,2S,3S,5S)-3-((6-(4-(1H-imidazol-1-yl)-2-(methoxymethoxy)phenyl)pyridazin-3-yl)(methyl)amino)-2-fluoro-8-azabicyclo[3.2.1]octane-8-carboxylate (PENT-4A & PENT-4B). () tert-butyl (1S,2R,3R,5R)-3-((6-(4-(1H-imidazol-1-yl)-2-(methoxymethoxy)phenyl)pyridazin-3-yl)(methyl)amino)-2-fluoro-8-azabicyclo[3.2.1]octane-8-carboxylate, 240 mg, was purified by chiral SFC purification by the following method to give the two title compounds (PENT-4A, t.sub.R=1.16 min, 80 mg) and (PENT-4B, t.sub.R=2.15 min, 70 mg). Instrument: SFC-80 (Thar, Waters); Column: AD 20*250 mm, 10 um (Daicel); Column temperature: 35 C.; Mobile phase: CO.sub.2/MeOH (0.2% Methanol Ammonia)=45/55; Flow rate: 80 g/min; Back pressure: 100 bar; Detection wavelength: 214 nm; Cycle time: 4.5 min; Sample solution: 240 mg dissolved in 20 mL methanol; Injection volume: 1.9 mL.

(413) Step 5: Synthesis of 2-(6-(((1S,2S,3R,5R)-2-fluoro-8-azabicyclo[3.2.1]octan-3-yl)(methyl)amino)pyridazin-3-yl)-5-(1H-imidazol-1-yl)phenol and 2-(6-(((1R,2R,3S,5S)-2-fluoro-8-azabicyclo[3.2.1]octan-3-yl)(methyl)amino)pyridazin-3-yl)-5-(1H-imidazol-1-yl)phenol (Compound 4A & Compound 4B). 2 mL of HCl in dioxane (4 N) was added to a stirred solution of PENT-4A (80 mg, 0.15 mmol) in 1 mL of CH.sub.2Cl.sub.2. The mixture was stirred at room temperature for 2 h, and concentrated under reduced pressure. The residue was dissolved in water, the pH value was adjusted to 9 by using K.sub.2CO.sub.3 aqueous solution, the solid was collected by filtration, and dried under reduced pressure to give the title compound as Compound 4A (32 mg, 54% yield) as a yellow solid 1H NMR (500 MHZ, DMSO-d.sub.6) 8.38 (d, J=9.1 Hz, 1H), 8.30 (s, 1H), 8.00 (d, J=8.3 Hz, 1H), 7.78 (s, 1H), 7.33 (d, J=8.7 Hz, 1H), 7.19 (s, 1H), 7.09 (s, 2H), 5.18-4.95 (m, 1H), 4.74-4.51 (m, 1H), 3.52 (s, 2H), 3.03 (s, 3H), 2.37 (s, 1H), 2.28-2.16 (m, 1H), 1.85-1.59 (m, 4H), 1.58-1.46 (m, 1H). LCMS: m/z 395.2 [M+H].sup.+; t.sub.R=1.53 min.

(414) Following the procedure above, but with PENT-4B (70 mg, 0.13 mmol) gave the title compound as Compound 4B (27 mg, 54% yield) as a yellow solid. .sup.1H NMR (500 MHZ, DMSO-d.sub.6) 8.38 (d, J=9.1 Hz, 1H), 8.30 (s, 1H), 8.00 (d, J=8.3 Hz, 1H), 7.78 (s, 1H), 7.33 (d, J=8.7 Hz, 1H), 7.19 (s, 1H), 7.09 (s, 2H), 5.18-4.95 (m, 1H), 4.74-4.51 (m, 1H), 3.52 (s, 2H), 3.03 (s, 3H), 2.37 (s, 1H), 2.28-2.16 (m, 1H), 1.85-1.59 (m, 4H), 1.58-1.46 (m, 1H). LCMS: m/z 395.2 [M+H].sup.+; t.sub.R=1.53 min.

(415) The examples in Table 6 were synthesized using a sequence analogous to that used to synthesize Compound 4A and Compound 4B by general Method L.

(416) TABLE-US-00040 TABLE 6 Examples Prepared by General Method L. Chiral Intermediate Chiral HPLC or SFC Retention SMSM# Structure Purification Method Time (min) 38A 38B Instrument: SFC-80 (Thar, Waters) Column: AD 20 * 250 mM, 10 um (Daicel) Column temperature: 35 C. Mobile phase: CO2/MeOH (0.2% Methanol Ammonia) = 45/55 Flow rate: 75 g/min Back pressure: 100 bar Detection wavelength: 214 nm Cycle time: 18.0 min Sample solution: 350 mg dissolved 1.11 2.49 in 20 mL Methanol Injection volume: 1.9 mL 39A 39B Instrument: SFC-80 (Thar, Waters) Column: IC 20 * 250 mM, 10 um (Daicel) Column temperature: 35 C. Mobile phase: CO2/MeOH (0.2% Methanol Ammonia) = 45/55 Flow rate: 80 g/min Back pressure: 100 bar Detection wavelength: 214 nm Cycle time: 5.3 min Sample solution: 300 mg dissolved 2.09 3.53 in 15 mL Methanol Injection volume: 1.0 mL 0 40A 40B Instrument: SFC-80 (Thar, Waters) Column: OD 20 * 250 mM, 10 um (Daicel) Column temperature: 35 C. Mobile phase: CO2/MeOH (0.2% Methanol Ammonia) = 75/25 Flow rate: 80 g/min Back pressure: 100 bar Detection wavelength: 214 nm Cycle time: 3.0 min 1.72 2.32 Sample solution: 300 mg dissolved in 25 mL Methanol Injection volume: 0.6 mL 41A 41B Instrument: SFC-150 (Waters) Column. AD 20 * 250 mM, 10 um (Daicel) Column temperature: 35 C. Mobile phase: CO2/(MeOH/ACN (0.2% Methanol Ammonia) = 1:1) = 40/60 Flow rate: 120 g/min Back pressure: 100 bar Detection wavelength: 214 nm 3.19 3.52 Cycle time: 3 min Sample solution: 450 mg dissolved in 40 mL Methanol Injection volume: 1.9 mL 42A 42B Instrument: Gilson-281 Column: IG 20 * 250, 10 um Mobile Phase: n-ACN (0.2% MEA):MEOH (0.2% MEA):DCM (0.2% MEA) = 70:25:5 Flow Rate: 45 ml/min Run time per injection: 30 min Injection: 0.7 ml Sample solution: 420 mg in 19 mL MEOH 3.1 3.91 43A 43B Column: CHIRALPAK IF, 2 * 25 cm, 5 um; Mobile Phase A: MTBE (10 mM NH3MEOH)HPLC, Mobile Phase B: EtOHHPLC; Flow rate: 18 mL/min; Gradient: 25 B to 25 B in 10 min; 254\220 nm 6.5 7.8 44A 44B Instrument: SFC-80 (Thar, Waters) Column: AD 20 * 250 mM, 10 um (Daicel) Column temperature: 35 C. Mobile phase: CO2/MeOH (0.2% Methanol Ammonia) = 70/30 Flow rate: 80 g/min Back pressure: 100 bar Detection wavelength: 214 nm Cycle time: 3.5 min Sample solution: 10 mg dissolved in 210 mL Methanol Injection volume: 1.9 mL 1.05 2.07 0 45A 45B Instrument: SFC-150 (Thar, Waters) Column: IC 20 * 250 mM, 10 um (Daicel) Column temperature: 35 C. Mobile phase: CO2/MEOH (0.2% Methanol Ammonia) = 50/50 Flow rate: 120 g/min Back pressure: 100 bar Detection wavelength: 214 nm Cycle time: 6 min 2.47 2.94 Sample solution: 180 mg dissolved in 30 mL Methanol and Dichloromethane Injection volume: 1.9 mL 46A 46B Instrument: SFC-150 (Thar, Waters) Column: RR WHELK 20 * 250 mM, 10 um (Daicel) Column temperature: 35 C. Mobile phase: CO2/MEOH (0.2% Methanol Ammonia) = 60/40 Flow rate: 100 g/min Back pressure: 100 bar Detection wavelength: 214 nm Cycle time: 9 min 2.94 3.46 Sample solution: 150 mg dissolved in 20 mL Methanol Injection volume: 1.9 mL 47A 47B Column: Chiralpak AD-H, 2 * 25 cm (5 um) Mobile Phase A: Hex (10 mM NH3MeOH), Mobile Phase B: IPAHPLC Flow rate: 20 mL/min; Gradient: 40 B to 40 B in 16.5 min; Detection wavelength: 306/254 nm 6.0 9.9 48A 48B Instrument: SFC-150 (Thar, Waters) Column: AD 20 * 250 mM, 10 um (Daicel) Column temperature: 35 C. Mobile phase: CO2/MeOH (0.2% Methanol Ammonia) = 40/60 Flow rate: 100 g/min Back pressure: 100 bar Detection wavelength: 214 nm Cycle time: 8.3 min Sample solution: 200 mg dissolved in 12 ml Methanol Injection volume: 1.9 mL 1.14 3.97 49A 49B Column: CHIRALPAK IA, 2 * 25 cm, 5 m Mobile Phase A: CO.sub.2, Mobile Phase B: MeOH:DCM = 4:1; Flow rate: 40 mL/min; Gradient: 40% B; Detection wavelength: 240 nm 4.0 5.3 0 50A 50B Column: CHIRALPAK IA, 2 * 25 cm, 5 m Mobile Phase A: CO2, Mobile Phase B: EtOHHPLC Flow rate: 40 mL/min; Gradient: 50% B Detection wavelength: 270 nm 4.0 6.2 51A 51B Column: CHIRAL ART Cellulose-SB, 2 * 25 cm, 5 m Mobile Phase A: MTBE (10 mM NH3MEOH)HPLC, Mobile Phase B: EtOHHPLC Flow rate: 18 mL/min Gradient: 50 B to 50 B in 21 min Detection wavelength: 240/280 nm 10.8 13.5 52A 52B Column: CHIRALPAK IF, 2 * 25 cm, 5 um Mobile Phase A: Hex (10 mM NH3MeOH), Mobile Phase B: IPAHPLC Flow rate: 18 mL/min Gradient: 50 B to 50 B in 13 min Detection wavelength: 312/220 nm 10.3 15.3 53A 53B Column: XBridge Shield RP18 OBD Column, 5 m, 19 * 150 mM Mobile Phase A: Water (10 MMOL/L NH4HCO3 + 0.1% NH3H2O), Mobile Phase B: CAN Flow rate: 20 mL/min Gradient: 47% B to 77% B in 8 min Detection wavelength: 254 nm 2.4 2.8 54A 54B CHIRALPAK IF, 2 * 25 cm, 5 m Mobile Phase A: MTBE (10 mM NH3MEOH)HPLC, Mobile Phase B: EtOHHPLC Flow rate: 20 mL/min Gradient: 30 B to 30 B in 12.5 min Detection wavelength: 290/254 nm 7.5 9.2 0 56A 56B Column: CHIRALPAK IA, 2 * 25 cm, 5 m Mobile Phase A: Hex (10 mM NH3MeOH), Mobile Phase B: IPA Flow rate: 18 mL/min Gradient: 50 B to 50 B in 26 min Detection wavelength: 243/276 nm 8.5 16.8 57A 57B Column: CHIRALPAK IF, 2 * 25 cm, 5 m Mobile Phase A: MTBE (10 mM NH3MEOH)HPLC, Mobile Phase B: EtOHHPLC Flow rate: 20 mL/min Gradient: 50 B to 50 B in 14 min Detection wavelength: 300/254 nm 7.3 9.3 58A 58B Instrument: SFC-80 (Thar, Waters) Column: AD 20 * 250 mM, 10 um (Daicel) Column temperature: 35 C. Mobile phase: CO2/MeOH (0.2% Methanol Ammonia) = 50/50 Flow rate: 80 g/min Back pressure: 100 bar Detection wavelength: 214 nm Cycle time: 5.0 min Sample solution: 500 mg dissolved in 25 mL Methanol Injection volume: 1.9 mL 0.87 1.81 59A 59B Instrument: SFC-80 (Thar, Waters) Column: WHELK 20 * 250 mM, 10 um (Daicel) Column temperature: 35 C. Mobile phase: CO2/MeOH (0.2% Methanol Ammonia) = 60/40 Flow rate: 80 g/min Back pressure: 100 bar Detection wavelength: 214 nm Cycle time: 3.0 min Sample solution: 400 mg dissolved in 35 mL Methanol 3.15 3.56 60A 60B Column: CHIRALPAK IE, 2 * 25 cm, 5 um Mobile Phase A: MTBE (10 mM NH3MEOH)HPLC, Mobile Phase B: MeOHHPLC Flow rate: 20 mL/min Gradient: 40 B to 40 B in 8 min Detection wavelength: 250/220 nm 4.3 5.5 0 113A 113B Column: CHIRAL ART Cellulose-SB, 2 * 25 cm, 5 um Mobile Phase A: MTBE (10 mM NH3MEOH)HPLC, Mobile Phase B: EtOHHPLC Flow rate: 20 mL/min Gradient: 10 B to 10 B in 13 min Detection wavelength: 250/220 nm 7.1 9.3 114A 114B Column: CHIRAL ART Cellulose-SB, 2 * 25 cm, 5 um Mobile Phase A: MTBE (10 mM NH3MEOH)HPLC, Mobile Phase B: EtOHHPLC Flow rate: 20 mL/min Gradient: 30 B to 30 B in 6.5 min Detection wavelength: 240/220 nm 7.3 8.3

Example B8. General Synthesis Method J. Convergent Suzuki and Chiral Purification of Penultimate Intermediates, No Phenol Protecting Group

(417) ##STR00485##

(418) Specific Example of General Method J, Compound 5A & 5B: Synthesis of 2-(6-(((1S,2S,3R,5R)-2-fluoro-8-azabicyclo[3.2.1]octan-3-yl)(methyl)amino)pyridazin-3-yl)-5-(1H-imidazol-1-yl)phenol and 2-(6-(((1R,2R,3S,5S)-2-fluoro-8-azabicyclo[3.2.1]octan-3-yl)(methyl)amino)pyridazin-3-yl)-5-(1H-imidazol-1-yl)phenol

(419) ##STR00486## ##STR00487##

(420) Step 1: Synthesis of 4,5-dibromo-2-(3-methoxy-4-nitrophenyl)-2H-1,2,3-triazole. K.sub.2CO.sub.3 (4.04 g, 29.2 mmol) was added to a solution of 4-fluoro-2-methoxy-1-nitrobenzene (5 g, 29.2 mmol) and 4,5-dibromo-2H-1,2,3-triazole (6.63 g, 29.2 mmol) in DMF (100 mL). The resulting mixture was stirred at 80 C. for 16 h. After cooling to room temperature, the mixture was poured into ice-water (100 mL) and extracted with EtOAc. The organic layers were washed with water (100 mL), dried over anhydrous MgSO.sub.4, and concentrated in vacuum to give the title compound (10 g, 97%) as a white solid. LCMS: m/z 378.9 [M+H].sup.+; t.sub.R=1.250 min.

(421) Step 2: Synthesis of 2-methoxy-4-(2H-1,2,3-triazol-2-yl) aniline. Pd/C (1 g, 10 wt % on activated carbon) was added to a solution of 4,5-dibromo-2-(3-methoxy-4-nitrophenyl)-2H-1,2,3-triazole (10 g, 26.5 mmol) in MeOH (150 mL). The mixture was stirred under hydrogen atmosphere for 5 h and filtered. The filtrate was concentrated in vacuum to give the title compound (5 g, yield 98%) as a white solid. LCMS: m/z 191 [M+H].sup.+; t.sub.R=0.574 min.

(422) Step 3: Synthesis of (2-methoxy-4-(2H-1,2,3-triazol-2-yl)phenyl)boronic acid. A pre-cooled (15 C.) solution of t-BuONO (2.61 g, 25.3 mmol) and 2-methoxy-4-(2H-1,2,3-triazol-2-yl) aniline (4.0 g, 21 mmol) in AcOH (80 mL) was added dropwise to a precooled solution of TfOH (3.79 g, 25.3 mmol) in AcOH (80 mL). The reaction was stirred for 1020 min at 10-15 C., then poured into cold Et.sub.2O (1000 mL). The precipitated diazonium salt was collected by filtration and dried in vacuum to give 2-methoxy-4-(2H-1,2,3-triazol-2-yl)benzenediazonium, trifluoromethanesulfonic salt (7.4 g, 95% yield) as a white solid. LCMS: m/z 202.2 [M+].sup.+; t.sub.R=0.737 min. The 2-methoxy-4-(2H-1,2,3-triazol-2-yl)benzenediazonium, trifluoromethanesulfonic salt (7.4 g, 21 mmol) was dissolved in water (150 mL). Hypodiboric acid (4.74 g, 52.7 mmol) was added, and the reaction mixture was stirred at 25 C. for 3 h. The precipitate was collected by filtration and dried in vacuum to give the title compound (4.6 g, yield 99%) as a white solid. LCMS: m/z 220.2 [M+H].sup.+; t.sub.R=1.127 min.

(423) Step 4: Synthesis of (2-hydroxy-4-(2H-1,2,3-triazol-2-yl)phenyl)boronic acid. BBr.sub.3 (4.6 mL, 18.26 mmol, 4M) was added to a solution of (2-methoxy-4-(2H-1,2,3-triazol-2-yl)phenyl)boronic acid (1000 mg, 4.57 mmol) in DCM (4 mL). The reaction mixture was stirred at 20 C. for 18 h under N.sub.2 atmosphere, concentrated in vacuum, and purified by silica gel column (10-25% EtOAc/petroleum ether) to give the title compound (450 mg, 59% yield) as a yellow solid. LCMS: m/z 206.2 [M+H].sup.+; t.sub.R=0.898 min.

(424) Step 5: Synthesis of () tert-butyl (1R,2S,3S,5S)-2-fluoro-3-((6-(2-hydroxy-4-(2H-1,2,3-triazol-2-yl)phenyl)pyridazin-3-yl)(methyl)amino)-9-azabicyclo[3.3.1]nonane-9-carboxylate. A mixture of () tert-butyl (1R,2S,3S,5S)-3-((6-chloropyridazin-3-yl)(methyl)amino)-2-fluoro-9-azabicyclo[3.3.1]nonane-9-carboxylate (INT-3, 639 mg, 1.83 mmol), (2-methoxy-4-(2H-1,2,3-triazol-2-yl)phenyl)boronic acid (450 mg, 2.20 mmol), K.sub.2CO.sub.3 (505 mg, 3.67 mmol) and Pd(dppf)Cl.sub.2 (201 mg, 0.275 mmol) in dioxane (8 mL) and water (2 mL) was degassed and stirred at 100 C. for 2 h under N.sub.2 atmosphere. The reaction mixture was concentrated in vacuum and the residue was purified by silica gel column (20-50% EtOAc/petroleum ether) to give the title compound (450 mg, 42% yield) as a white solid.

(425) Step 6: Chiral separation to isolate tert-butyl (1S,2R,3R,5R)-2-fluoro-3-((6-(2-hydroxy-4-(2H-1,2,3-triazol-2-yl)phenyl)pyridazin-3-yl)(methyl)amino)-9-azabicyclo[3.3.1]nonane-9-carboxylate and tert-butyl (1R,2S,3S,5S)-2-fluoro-3-((6-(2-hydroxy-4-(2H-1,2,3-triazol-2-yl)phenyl)pyridazin-3-yl)(methyl)amino)-9-azabicyclo[3.3.1]nonane-9-carboxylate (PENT-5A & PENT-5B). () tert-butyl (1R,2S,3S,5S)-2-fluoro-3-((6-(2-hydroxy-4-(2H-1,2,3-triazol-2-yl)phenyl)pyridazin-3-yl)(methyl)amino)-9-azabicyclo[3.3.1]nonane-9-carboxylate, 450 mg, was purified by chiral SFC purification to give the two title compounds as (PENT-5A, t.sub.R=1.55 min, 150 mg) and (PENT-5B, t.sub.R=1.87 min, 130 mg) as white solids. LCMS: m/z 510.3 [M+H].sup.+; t.sub.R=1.51 min. Instrument: SFC-150 (Thar, Waters); Column: IC 20*250 mm, 10 m (Daicel); Column temperature: 35 C.; Mobile phase: CO.sub.2/MeOH (0.2% methanol ammonia)=40/60; Flow rate: 120 g/min; Back pressure: 100 bar; Detection wavelength: 214 nm; Cycle time: 5 min; Sample solution: 450 mg dissolved in 50 mL methanol and DCM; Injection volume: 1.9 mL.

(426) Step 7: Synthesis of 2-(6-(((1S,2S,3R,5R)-2-fluoro-9-azabicyclo[3.3.1]nonan-3-yl)(methyl) amino)pyridazin-3-yl)-5-(2H-1,2,3-triazol-2-yl)phenol and 2-(6-(((1R,2R,3S,5S)-2-fluoro-9-azabicyclo[3.3.1]nonan-3-yl)(methyl)amino)pyridazin-3-yl)-5-(2H-1,2,3-triazol-2-yl)phenol (Compound 5A & Compound 5B). HCl/dioxane (10 mL, 4N) was added to a mixture of PENT-5A (80 mg, 0.157 mmol) in CH.sub.2Cl.sub.2 (2 mL) and MeOH (2 mL). The mixture was stirred at 25 C. for 2 h and concentrated. The residue was dissolved in water (2 mL), and aqueous K.sub.2CO.sub.3 solution was added to adjust to pH=10. The resulting solid was collected by filtration and dried under reduced pressure to give the title compound as Compound 5A (40 mg, 62% yield) as a yellow solid. .sup.1H NMR (500 MHz, DMSO-d.sub.6) 8.30 (d, J=10.5 Hz, 1H), 8.14 (s, 2H), 8.09 (d, J=9.0 Hz, 1H), 7.59-7.57 (m, 2H), 7.38 (d, J=9.5 Hz, 1H), 5.78-5.68 (m, 1H), 4.77 (d, J=54.0 Hz, 1H), 3.23-3.16 (m, 2H), 3.06 (d, J=1.5 Hz, 3H), 2.43-2.36 (m, 2H), 1.91-1.84 (m, 3H), 1.73-1.58 (m, 4H). LCMS: m/z 410.2 [M+H].sup.+; t.sub.R=1.77 min.

(427) Following the procedure above, but starting with PENT-5B (80 mg, 0.157 mmol) gave the title compound as Compound 5B (48 mg, 75% yield) as a yellow solid. .sup.1H NMR (500 MHZ, DMSO-d.sub.6) 8.30 (d, J=10.0 Hz, 1H), 8.14 (s, 2H), 8.09 (d, J=9.5 Hz, 1H), 7.59-7.57 (m, 2H), 7.38 (d, J=10.0 Hz, 1H), 5.80-5.65 (m, 1H), 4.77 (d, J=51.0 Hz, 1H), 3.23-3.16 (m, 2H), 3.06 (d, J=1.5 Hz, 3H), 2.40-2.37 (m, 2H), 1.91-1.85 (m, 3H), 1.71-1.58 (m, 4H). LCMS: m/z 410.2 [M+H].sup.+; t.sub.R=1.84 min.

(428) The examples in Table 7 were synthesized using a sequence analogous to that used to synthesize Compound 5A and Compound 5B by general Method J.

(429) TABLE-US-00041 TABLE 7 Examples prepared by General Method J. Chiral Intermediate Chiral Retention HPLC or SFC Purification Time SMSM# Structure Method (min) 61A 61B or Instrument: SFC-150 (Thar, Waters) Column: AD 20 * 250 mm, 10 um (Daicel) Column temperature: 35 C. Mobile phase: CO2/ MeOH/ACN = 1:1 (0.2% Methanol Ammonia) = 50/50 Flow rate: 100 g/min Back pressure: 100 bar Detection wavelength: 214 nm Cycle time: 7.3 min Sample solution: 160 mg dissolved in 10 mL Methanol Injection volume: 1.5 mL 1.36 3.43 62A 62B 0 or Instrument: SFC-150 (Waters) Column: AD 20 * 250 mm, 10 um (Daicel) Column temperature: 35 C. Mobile phase: CO2/ MeOH/ACN (0.2% Methanol Ammonia) = 30/70 Flow rate: 100 g/min Back pressure: 100 bar Detection wavelength: 214 nm Cycle time: 9 min Sample solution: 170 mg dissolved in 25 mL Methanol Injection volume: 5 mL 108 3.75 63A 63B or Instrument: Gilson-281 Column: IG 20*250, 10 m Mobile Phase: ACN (0.1% DEA): MEOH (0.1% DEA) = 70:30 FlowRate: 50 mL/min Injection: 3 mL Sample solution: 200 mg in 21 mL MeOH 10.2 27.2 64A 64B or Instrument: SFC-80 (Thar, Waters) Column: OJ 20 * 250 mm, 10 um (Daicel) Column temperature: 35 C. Mobile phase: CO2/ MeOH (0.2% Methanol Ammonia) = 65/35 Flow rate: 80 g/min Back pressure: 100 bar Detection wavelength: 214 nm Cycle time: 3.5 min Sample solution: 180 mg dissolved in 20 mL Methanol Injection volume: 1.0 mL 2.53 3.23

Example B9. General Synthesis Method R. Convergent Suzuki and Chiral Purification of Aryl Halide Intermediates, No Phenol

(430) ##STR00496##

Specific Example of General Method R, Compound 6A & 6B: Synthesis of 2-(6-(((1S,2S,3R,5R)-2-fluoro-8-azabicyclo[3.2.1]octan-3-yl)(methyl)amino)pyridazin-3-yl)thieno[3,2-c]pyridin-4(5H)-one and 2-(6-(((1R,2R,3S,5S)-2-fluoro-8-azabicyclo[3.2.1]octan-3-yl)(methyl)amino)pyridazin-3-yl)thieno[3,2-c]pyridin-4(5H)-one

(431) ##STR00497##

(432) Step 1. Chiral separation to isolate tert-butyl (1S,2R,3R,5R)-3-((6-chloropyridazin-3-yl)(methyl)amino)-2-fluoro-8-azabicyclo[3.2.1]octane-8-carboxylate and tert-butyl (1R,2S,3S,5S)-3-((6-chloropyridazin-3-yl)(methyl)amino)-2-fluoro-8-azabicyclo[3.2.1]octane-8-carboxylate (HETX-6A & HETX-6B). Racemic intermediate, () tert-butyl (1S,2R,3R,5R)-3-((6-chloropyridazin-3-yl)(methyl)amino)-2-fluoro-8-azabicyclo[3.2.1]octane-8-carboxylate, (INT-1, 6.2 g) was purified by chiral SFC purification to give the two title compounds as (HETX-6A, t.sub.R=1.05 min, 2.6 g) and (HETX-6B, t.sub.R=2.07 min, 2.6 g). Instrument: SFC-200 (Thar, Waters); Column: AD 20*250 mm, 10 um (Daicel); Column temperature: 35 C.; Mobile phase: CO.sub.2/MeOH (0.2% Methanol Ammonia)=80/20; Flow rate: 120 g/min; Back pressure: 100 bar; Detection wavelength: 214 nm; Cycle time: 4.1 min; Sample solution: 6000 mg dissolved in 110 mL MeOH; Injection volume: 2 mL.

(433) Step 2. Synthesis of tert-butyl (1S,2R,3R,5R)-2-fluoro-3-(methyl(6-(4-oxo-4,5-dihydrothieno[3,2-c]pyridin-2-yl)pyridazin-3-yl)amino)-8-azabicyclo[3.2.1]octane-8-carboxylate and tert-butyl (1R,2S,3S,5S)-2-fluoro-3-(methyl(6-(4-oxo-4,5-dihydrothieno[3,2-c]pyridin-2-yl)pyridazin-3-yl)amino)-8-azabicyclo[3.2.1]octane-8-carboxylate (PENT-6A & PENT-6B). A mixture of HETX-6A (150 mg, 0.40 mmol), (4-oxo-4,5-dihydrothieno[3,2-c]pyridin-2-yl) boronic acid (B1, 255 mg, 1.31 mmol), X-phos-Pd 2nd G (79 mg, 0.10 mmol) and K.sub.3PO.sub.4 (171 mg, 0.81 mmol) in DMF (10 mL) was degassed with nitrogen and then stirred at 100 C. for 2 h. The mixture was filtered, poured into 50 ml of water and extracted with EtOAc (5 mL3). The combined organic layers were washed with brine, dried over Na.sub.2SO.sub.4, and concentrated. The crude product was purified by silica gel chromatography (25% MeOH in DCM) to give the title compound as PENT-6A (110 mg, 0.22 mmol, 55% yield) as a yellow solid. LCMS: m/z 486.1 [M+H].sup.+; t.sub.R=1.67 min.

(434) Following the procedure above, but starting with HETX-6B (150 mg, 0.40 mmol), gave the title compound as PENT-6B (120 mg, 61% yield) as a yellow solid. LCMS: m/z 486.1 [M+H].sup.+; t.sub.R=1.67 min.

(435) Step 3. Synthesis of 2-(6-(((1S,2S,3R,5R)-2-fluoro-8-azabicyclo[3.2.1]octan-3-yl)(methyl)amino)pyridazin-3-yl)thieno[3,2-c]pyridin-4(5H)-one and 2-(6-(((1R,2R,3S,5S)-2-fluoro-8-azabicyclo[3.2.1]octan-3-yl)(methyl)amino)pyridazin-3-yl)thieno[3,2-c]pyridin-4(5H)-one (Compound 6A & Compound 6B). A mixture of PENT-6A (100 mg, 0.20 mmol) in HCl/dioxane (10 mL) was stirred at 25 C. for 3 h. The solvent was concentrated, the residue was basified by NH.sub.3/MeOH, and concentrated. The residue was purified by silica gel chromatography (4% MeOH in DCM) to obtain the title compound as Compound-6A (47.1 mg, 0.12 mmol, Yield: 59%). .sup.1H NMR (400 MHZ, DMSO-d.sub.6) 8.20 (d, J=9.6 Hz, 1H), 8.07 (s, 1H), 7.59 (d, J=7.2 Hz, 1H), 7.17 (d, J=8.0 Hz, 1H), 6.90 (d, J=7.8 Hz, 1H), 5.23-5.10 (m, 1H), 4.67-4.47 (m, 1H), 4.45 (t, J=5.2 Hz, 1H), 3.52 (s, 3H), 3.39-3.37 (m, 2H), 3.00 (s, 3H), 2.25-2.18 (m, 1H), 1.75-1.51 (m, 2H), 1.70-1.65 (m, 2H), 1.58-1.25 (m, 1H); LCMS: m/z 385.9 [M+H].sup.+; t.sub.R=1.38 min.

(436) Following the procedure above, but starting with PENT-6B (110 mg, 0.22 mmol), gave the title compound as Compound-6B (58.3 mg, 0.15 mmol, 66% yield). .sup.1H NMR (400 MHz, DMSO-d.sub.6) 8.20 (d, J=9.6 Hz, 1H), 8.07 (s, 1H), 7.59 (d, J=7.2 Hz, 1H), 7.17 (d, J=8.0 Hz, 1H), 6.90 (d, J=7.8 Hz, 1H), 5.23-5.10 (m, 1H), 4.67-4.47 (m, 1H), 4.45 (t, J=5.2 Hz, 1H), 3.52 (s, 3H), 3.39-3.37 (m, 2H), 3.00 (s, 3H), 2.25-2.18 (m, 1H), 1.75-1.51 (m, 2H), 1.70-1.65 (m, 2H), 1.58-1.25 (m, 1H); LCMS: m/z 385.9 [M+H].sup.+; t.sub.R=1.38 min.

(437) The examples in Table 8 were synthesized using a sequence analogous to that used to synthesize Compound 6A and Compound 6B by general Method R.

(438) TABLE-US-00042 TABLE 8 Additional examples prepared by general method G. SMSM# Structure Chiral Intermediate 65A HETX-6A or 65B HETX-6B 66A 00 HETX-6A or 66B 01 HETX-6B 67A 02 HETX-6A or 67B 03 HETX-6B 68A 04 HETX-6A or 68B 05 HETX-6B 69A 06 HETX-6A or 69B 07 HETX-6B

Example B10. General Synthesis Method Q: Convergent Suzuki, OMOM Deprotection, ArylChloride Intermediate Chiral Purification

(439) ##STR00508##

Specific Example of General Method Q, Compounds 8A & 8B: Synthesis of 2-(6-(((1S,5S,6S,7R)-6-fluoro-3-oxa-9-azabicyclo[3.3.1]nonan-7-yl)(methyl)amino)pyridazin-3-yl)-5-(1H-pyrazol-3-yl)phenol and 2-(6-(((1R,5R,6R,7S)-6-fluoro-3-oxa-9-azabicyclo[3.3.1]nonan-7-yl)(methyl)amino)pyridazin-3-yl)-5-(1H-pyrazol-3-yl)phenol

(440) ##STR00509##

(441) Step 2: Chiral purification to isolate tert-butyl (1S,5S,6R,7R)-7-((6-chloropyridazin-3-yl)(methyl)amino)-6-fluoro-3-oxa-9-azabicyclo[3.3.1]nonane-9-carboxylate and tert-butyl (1S,5S,6R,7R)-7-((6-chloropyridazin-3-yl)(methyl)amino)-6-fluoro-3-oxa-9-azabicyclo[3.3.1]nonane-9-carboxylate (HETX-8A & HETX-8B). Racemic intermediate, () tert-butyl (1S,5S,6R,7R)-7-((6-chloropyridazin-3-yl)(methyl)amino)-6-fluoro-3-oxa-9-azabicyclo[3.3.1]nonane-9-carboxylate, INT-4, 360 mg, was purified by chiral SFC purification to give the two title compounds as HETX-8A (t.sub.R=0.77 min, 160 mg, >99.5% ee) and HETX-8B (t.sub.R=2.17 min, 110 mg, 98% ee) as white solids. Instrument: SFC-80 (Thar, Waters); Column: AD 20*250 mm, 10 um (Daicel); Column temperature: 35 C.; Mobile phase: CO.sub.2/MeOH (0.2% Methanol Ammonia)=50/50; Flow rate: 80 g/min; Back pressure: 100 bar; Detection wavelength: 214 nm; Cycle time: 5.0 min; Sample solution: 360 mg; dissolved in 30 mL methanol; Injection volume: 1.9 mL.

(442) Step 3: Synthesis of tert-butyl (1S,5S,6R,7R)-6-fluoro-7-((6-(2-(methoxymethoxy)-4-(1-(tetrahydro-2H-pyran-2-yl)-1H-pyrazol-3-yl)phenyl)pyridazin-3-yl)(methyl)amino)-3-oxa-9-azabicyclo[3.3.1]nonane-9-carboxylate and of tert-butyl (1S,5S,6R,7R)-6-fluoro-7-((6-(2-(methoxymethoxy)-4-(1-(tetrahydro-2H-pyran-2-yl)-1H-pyrazol-3-yl)phenyl)pyridazin-3-yl)(methyl)amino)-3-oxa-9-azabicyclo[3.3.1]nonane-9-carboxylate (PENT-8A & PENT-8B). A mixture of HETX-8A (80 mg, 0.207 mmol), 4-(3-(methoxymethoxy)-4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenyl)-1-(tetrahydro-2H-pyran-2-yl)-1H-pyrazole (107 mg, 0.259 mmol), K.sub.2CO.sub.3 (57.2 mg, 0.414 mmol) and Pd(dppf)Cl.sub.2 (22.7 mg, 0.03 mmol) in a solution of dioxane (2 mL) and water (0.5 mL) was degassed and stirred at 100 C. for 2 h under N.sub.2 atmosphere. The reaction mixture was concentrated in vacuum and the residue was purified by silica gel column (20-80% EtOAc/petroleum ether) to give the title compound as PENT-8A (110 mg, 83% yield) as a white solid. LCMS: m/z 639.3 [M+1].sup.+; t.sub.R=1.56 min.

(443) A mixture of HETX-8B (55 mg, 0.143 mmol), 4-(3-(methoxymethoxy)-4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenyl)-1-(tetrahydro-2H-pyran-2-yl)-1H-pyrazole (74 mg, 0.178 mmol), K.sub.2CO.sub.3 (39.5 mg, 0.286 mmol) and Pd(dppf)Cl.sub.2 (15.7 mg, 0.02 mmol) in a solution of dioxane (2 mL) and water (0.5 mL) was degassed and stirred at 100 C. for 2 h under N.sub.2 atmosphere. The reaction mixture was concentrated in vacuum and the residue was purified by silica gel column (20-80% EtOAc/petroleum ether) to give the title compound as PENT-8B (65 mg, 71% yield) as a white solid. LCMS: m/z 639.3 [M+1].sup.+; t.sub.R=1.56 min.

(444) Step 4: Synthesis of 2-(6-(((1S,5S,6S,7R)-6-fluoro-3-oxa-9-azabicyclo[3.3.1]nonan-7-yl)(methyl)amino)pyridazin-3-yl)-5-(1H-pyrazol-3-yl)phenol and 2-(6-(((1R,5R,6R,7S)-6-fluoro-3-oxa-9-azabicyclo[3.3.1]nonan-7-yl)(methyl)amino)pyridazin-3-yl)-5-(1H-pyrazol-3-yl)phenol (Compound 8A & Compound 8B). To a flask with PENT-8A (110 mg, 0.172 mmol) in DCM (1 mL) was added 4M HCl in dioxane (2 mL). The reaction mixture was stirred at 20 C. for 1 h, concentrated in vacuo, basified 7M ammonia in MeOH and purified by Prep-TLC (DCM: 7M ammonia MeOH 30:1) to give the title compound as Compound 8A (21 mg, 30% yield) as a yellow solid. .sup.1H NMR (400 MHZ, Methanol-d.sub.4) 8.38-8.26 (m, 1H), 8.04 (s, 2H), 7.76 (d, J=8.3 Hz, 1H), 7.63 (d, J=9.8 Hz, 1H), 7.28 (dd, J=8.2, 1.7 Hz, 1H), 7.23 (d, J=1.6 Hz, 1H), 6.26-6.09 (m, 1H), 5.47-5.32 (m, 1H), 4.32-4.03 (m, 4H), 4.02-3.93 (m, 1H), 3.84-3.77 (m, 1H), 3.20 (s, 3H), 2.97-2.84 (m, 1H), 2.33-2.23 (m, 1H). LCMS: m/z 411.2 [M+1].sup.+; t.sub.R=1.47 min.

(445) Following the procedure above, but starting with PENT-8B (65 mg, 0.102 mmol) gave the title compound as Compound 8B (25 mg, 60% yield) as a yellow solid. .sup.1H NMR (400 MHZ, Methanol-d.sub.4) 8.12 (d, J=9.9 Hz, 1H), 8.02 (s, 2H), 7.76 (d, J=8.8 Hz, 1H), 7.32 (d, J=9.9 Hz, 1H), 7.20 (dd, J=6.1, 1.7 Hz, 2H), 6.11-5.87 (m, 1H), 5.15-4.94 (m, 1H), 4.22-3.74 (m, 4H), 3.24-3.04 (m, 4H), 2.75-2.60 (m, 1H), 1.95-1.83 (m, 1H). LCMS: m/z 411.2 [M+1].sup.+; t.sub.R=1.47 min.

(446) The examples in Table 9A and Table 9B were synthesized using a sequence analogous to that used to synthesize Compound 8A and Compound 8B by general Method Q.

(447) TABLE-US-00043 TABLE 9A Intermediates Prepared by General Method Q. Chiral Intermediate Chiral Retention Intermediate Structure HPLC or SFC Purification Method Time (min) HETX-8A HETX-8B 0 or Instrument: SFC-80 (Thar, Waters) Column: AD 20 * 250mm, 10 um (Daicel); Column temperature: 35 C. Mobile phase: CO.sub.2/MeOH (0.2% Methanol Ammonia) = 50/50 Flow rate: 80 g/min Back pressure: 100 bar Detection wavelength: 214 nm Cycle time: 5.0 min Sample solution: 360 mg dissolved in 30 mL methanol Injection volume: 1.9 mL. 0.77 2.17 HETX-6A HETX-6B or Instrument: SFC-200 (Thar, Waters) Column: AD 20 * 250 mm, 10 um (Daicel) Column temperature: 35 C. Mobile phase: CO.sub.2/MeOH (0.2% Methanol Ammonia) = 80/20 Flow rate: 120 g/min Back pressure: 100 bar Detection wavelength: 214 nm Cycle time: 4.1 min Sample solution: 6000 mg dissolved in 110 mL methanol Injection volume: 2 mL. 1.05 2.07 HETX-78A HETX-78B or Instrument: SFC-80 (Thar, Waters) Column: AD 20 * 250 mm, 10 um (Daicel) Column temperature: 35 C. Mobile phase: CO2/MeOH (0.2% Methanol Ammonia) = = 70/30 Flow rate: 80 g/min Back pressure: 100 bar Detection wavelength: 214 nm Cycle time: 4.0 min Sample solution: 400 mg dissolved in 25 mL methanol Injection volume: 1.9 mL 1.6 4.81

(448) TABLE-US-00044 TABLE 9B Additional Examples Prepared by General Method Q. SMSM# Structure Chiral Intermediate 70A 70B or HETX-6A HETX-6B 71A 71B or HETX-6A HETX-6B 72A 72B 0 or HETX-6A HETX-6B 73A 73B or HETX-6A HETX-6B 74A 74B or HETX-6A HETX-6B 75A 75B or HETX-6A HETX-6B 76A 76B or HETX-6A HETX-6B 77A 77B 0 or HETX-6A HETX-6B 78A 78B or HETX-78A HETX-78B 79A 79B or HETX-6A HETX-6B 80A 80B or HETX-8A HETX-8A 81A 81B or HETX-6A HETX-6B 116A 116B 0 or HETX-6A HETX-6B 117A 117B or HETX-6A HETX-6B 118A 118B or HETX-6A HETX-6B

Example B11. General Synthesis Method S: Convergent Suzuki, OMe Deprotection, Penultimate Chiral Purification

(449) ##STR00546##

Specific Example of General Synthesis Method S, Compound 9A & 9B: Synthesis of 6-(6-(((1S,2S,3R,5R)-2-fluoro-8-azabicyclo[3.2.1]octan-3-yl)(methyl)amino)pyridazin-3-yl)-5-hydroxy-N,N-dimethylbenzofuran-2-carboxamide and 6-(6-(((1R,2R,3S,5S)-2-fluoro-8-azabicyclo[3.2.1]octan-3-yl)(methyl)amino)pyridazin-3-yl)-5-hydroxy-N,N-dimethylbenzofuran-2-carboxamide

(450) ##STR00547##

(451) Step 1: Synthesis of () tert-butyl (1S,2R,3R,5R)-3-((6-(2-(dimethylcarbamoyl)-5-methoxybenzofuran-6-yl)pyridazin-3-yl)(methyl)amino)-2-fluoro-8-azabicyclo[3.2.1]octane-8-carboxylate. To a solution of 5-methoxy-N,N-dimethyl-6-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1-benzofuran-2-carboxamide (B4, 1.40 g, 4.06 mmol, 1.00 equiv) and () tert-butyl (1S,2R,3R,5R)-3-[(6-chloropyridazin-3-yl)(methyl)amino]-2-fluoro-8-azabicyclo[3.2.1]octane-8-carboxylate (1.203 mg, 3.24 mmol, 0.80 equiv) in dioxane (15 mL) and water (1.5 mL) were added Pd(dppf)Cl.sub.2 (298 mg, 0.406 mmol, 0.10 equiv) and K.sub.3PO.sub.4 (2.58 g, 12.17 mmol, 3.00 equiv). After stirring for 12 h at 100 C. under nitrogen atmosphere, the resulting mixture was concentrated under reduced pressure. The residue was purified by silica gel column chromatography, eluting with ethyl acetate/petroleum ether (2:1) to afford the crude product as a white solid. The crude product was further purified by reverse phase flash chromatography with the following conditions: column, C18 silica gel; mobile phase, MeCN in water, 20% to 60% gradient in 30 min; detector, UV 254 nm to afford the title compound (600 mg, 33% yield).

(452) Step 2: Chiral purification to isolate tert-butyl (1S,2R,3R,5R)-3-((6-(2-(dimethylcarbamoyl)-5-methoxybenzofuran-6-yl)pyridazin-3-yl)(methyl)amino)-2-fluoro-8-azabicyclo[3.2.1]octane-8-carboxylate and tert-butyl (1R,2S,3S,5S)-3-((6-(2-(dimethylcarbamoyl)-5-methoxybenzofuran-6-yl)pyridazin-3-yl)(methyl)amino)-2-fluoro-8-azabicyclo[3.2.1]octane-8-carboxylate (PENT-9A & PENT-9B). Racemic intermediate, () tert-butyl (1S,2R,3R,5R)-3-((6-(2-(dimethylcarbamoyl)-5-methoxybenzofuran-6-yl)pyridazin-3-yl)(methyl)amino)-2-fluoro-8-azabicyclo[3.2.1]octane-8-carboxylate (600 mg), was purified by chiral SFC purification to give the two title compounds as PENT-9A (t.sub.R=3.12 min, 120 mg) and PENT-9B (t.sub.R=4.91 min, 140 mg). Column: CHIRALPAK IA, 2*25 cm, 5 m; Mobile Phase A: Hex (10 mM NH.sub.3-MeOH), Mobile Phase B: IPA; Flow rate: 20 mL/min; Gradient: 30 A to 30 B in 50 min; wavelength: 254/220 nm.

(453) Step 3:6-(6-(((1S,2S,3R,5R)-2-fluoro-8-azabicyclo[3.2.1]octan-3-yl)(methyl)amino)pyridazin-3-yl)-5-hydroxy-N,N-dimethylbenzofuran-2-carboxamide and 6-(6-(((1R,2R,3S,5S)-2-fluoro-8-azabicyclo[3.2.1]octan-3-yl)(methyl)amino)pyridazin-3-yl)-5-hydroxy-N,N-dimethylbenzofuran-2-carboxamide (Compound 9A & Compound 9B). To a stirred solution of PENT-9A (120 mg, 0.217 mmol, 1.00 equiv) in DCM (4.0 mL) was added BBr.sub.3 (163 mg, 0.650 mmol, 3.00 equiv) dropwise in portions at 0 C. Then the reaction mixture was warmed to 25 C. and stirred for 12 h. The reaction was then quenched by the slow addition of 10 mL of water/ice and the pH value of the mixture was adjusted to 9 with the saturated NaHCO.sub.3 solution. Then the resulting solution was extracted with dichloromethane (15 mL3). The combined organic layers were dried over anhydrous sodium sulfate and concentrated under vacuum. The residue was purified by reverse phase flash chromatography with the following conditions: Column, C18 silica gel; mobile phase, MeOH in water, 10% to 0% gradient in 30 min; detector, UV 254 nm to afford the title compound as Compound 9A (20 mg, 21% yield) as a yellow solid. .sup.1H NMR (300 MHZ, Methanol-d4) 8.238.20 (d, J=9.9 Hz, 1H), 8.04 (s, 1H), 7.367.29 (m, 2H), 7.20 (s, 1H), 5.405.19 (m, 1H), 4.684.58 (m, 1H), 3.69 (s, 2H), 3.39 (s, 3H), 3.193.10 (m, 6H), 2.482.34 (td, J=12.8, 3.2 Hz, 1H), 2.081.86 (m, 4H), 1.741.63 (m, 1H). LCMS: m/z 440.4 [M+H].sup.+.

(454) Following the procedure above, but starting with PENT-9B (140 mg, 0.253 mmol) gave the title compound as Compound 9B (18 mg, 16% overall yield) as a yellow solid. .sup.1H NMR (300 MHz, Methanol-d4) 8.238.20 (d, J=10.0 Hz, 1H), 8.03 (s, 1H), 7.367.28 (m, 2H), 7.19 (s, 1H), 5.395.20 (m, 1H), 4.674.62 (m, 1H), 3.69 (s, 2H), 3.39 (s, 3H), 3.213.09 (m, 6H), 2.41 (td, J=12.9, 3.1 Hz, 1H), 2.051.86 (m, 4H), 1.731.63 (m, 1H). LCMS: m/z 440.4 [M+H].sup.+.

(455) The examples in Table 10 were synthesized using a sequence analogous to that used to synthesize Compound 9A and Compound 9B by general Method S.

(456) TABLE-US-00045 TABLE 10 Examples Prepared by General Method S. Chiral Chiral Intermediate Intermediate HPLC or SFC Retention SMSM# Structure Purification Method Time (min) 82A 82B Column: CHIRALPAK ID, 2 * 25 cm (5 um) Mobile Phase A: MTBE (10 mM NH3MEOH, Mobile Phase B: EtOH Flow rate: 20 mL/min Gradient: 50 B to 50 B Detection wavelength 220/254 nm 10.0 12.5 83A 83B 0 Column: CHIRALPAK IF, 2 * 25 cm, 5 um Mobile Phase A: MTBE (10 mM NH3MEOH)HPLC, Mobile Phase B: EtOHHPLC Flow rate: 18 mL/min Gradient: 50 B to 50 B Detection wavelength: 15.5 18.5 220/254 nm; 84A 84B Column: CHIRALPAK IA, 2 * 25 cm, 5 um Mobile Phase A: CO2, Mobile Phase B: IPA Flow rate: 40 mL/min Gradient: 45% B Detection wavelength 254 nm 5.3 7.3 85A 85B Column: CHIRALPAK AD-H-TC001 SFC, 2 * 25 cm, 5 um Mobile Phase A: Hex (10 mM NH3), Mobile Phase B: IPAHPLC Flow rate: 18 mL/min; Gradient: 40 B to 40 B in 19 min 11.0 15.0 Detection wavelength: 230/254 nm 86A 86B Column: CHIRALPAK IA, 2 * 25 cm, 5 um Mobile Phase A: CO2, Mobile Phase B: IPAHPLC Flow rate: 40 mL/min Gradient: 50% B Detection wavelength: 220 nm 2.72 4.18

Example B12. General Synthesis Method N: Convergent Suzuki with Chiral Halo-Pyridazines, Methyl Ether Deprotection

(457) ##STR00558##

Specific Example of General Method N, Compound 7A & 7B: Synthesis of 7-(6-(((1S,2S,3R,5R)-2-fluoro-8-azabicyclo[3.2.1]octan-3-yl)(methyl)amino)pyridazin-3-yl) isoquinolin-6-ol and 7-(6-(((1S,2S,3R,5R)-2-fluoro-8-azabicyclo[3.2.1]octan-3-yl)(methyl)amino)pyridazin-3-yl) isoquinolin-6-ol

(458) ##STR00559##

(459) Step 1a: Synthesis of 7-bromo-6-methoxyisoquinoline. 2,2-dimethoxyethanamine (3.7 g, 34.877 mmol) and Na.sub.2SO.sub.4 (3.3 g, 23.251 mmol) were added to a stirred solution of 3-bromo-4-methoxybenzaldehyde (5 g, 23.251 mmol) in 50 mL of toluene. The reaction mixture was heated to reflux for 6 h using a Dean-stark apparatus. Solvent and excess reagents were distilled off. The crude product was dissolved in THF (50 mL). ClCOOCH.sub.3 (2.2 g, 23.251 mmol) was added dropwise at 0 C. After stirring for 5 min, P(OEt).sub.3 (4.6 g, 27.901 mmol) was added dropwise. The mixture was stirred for 18 h at room temperature. Then the solvents were distilled off. Excess reagents were removed by repeated addition of toluene and evaporation of the solvents. TiCl.sub.4 (17.6 g, 93.004 mmol) and CHCl.sub.3 (25 mL) were added. The mixture was heated to reflux for 48 h. The mixture was poured on ice and the pH was adjusted to 9 by using aqueous ammonia. The resulting mixture was extracted with EtOAc followed by removal off the solvents. The residue was purified by flash silica gel column chromatography (0-70% EtOAc/petroleum ether) to give 1.3 g 7-bromo-6-methoxyisoquinoline (16% yield) as a white solid. LCMS: m/z 240.0 [M+H].sup.+; t.sub.R=1.38 min.

(460) Step 1b: Synthesis of 6-methoxy-7-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl) isoquinoline (B2). A mixture of 7-bromo-6-methoxyisoquinoline (200 mg, 0.844 mmol), 4,4,4,4,5,5,5,5-octamethyl-2,2-bi(1,3,2-dioxaborolane) (321 mg, 1.266 mmol), Pd(dppf)Cl.sub.2 (124 mg, 0.169 mmol) and KOAc (166 mg, 1.69 mmol) in 1,4-dioxane (7 mL) was degassed and stirred at 105 C. for 8 h under N.sub.2 protection. The reaction was cooled to room temperature and used in the next step without any work-up. LCMS: m/z 286.0 [M+H].sup.+; t.sub.R=1.80 min.

(461) Step 2: Synthesis of tert-butyl (1S,2R,3R,5R)-2-fluoro-3-(methyl(6-(4-oxo-4,5-dihydrothieno[3,2-c]pyridin-2-yl)pyridazin-3-yl)amino)-8-azabicyclo[3.2.1]octane-8-carboxylate and tert-butyl (1R,2S,3S,5S)-2-fluoro-3-(methyl(6-(4-oxo-4,5-dihydrothieno[3,2-c]pyridin-2-yl)pyridazin-3-yl)amino)-8-azabicyclo[3.2.1]octane-8-carboxylate (PENT-7A & PENT-7B). To the crude solution of 6-methoxy-7-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl) isoquinoline (B2, 240 mg, 0.844 mmol) in 1,4-dioxane (7 mL) and HETX-6A (180 mg, 0.485 mmol) was added Pd(dppf)Cl.sub.2 (100 mg, 0.136 mmol), K.sub.2CO.sub.3 (200 mg, 1.45 mmol) and water (1.5 mL). The mixture was degassed and heated at 100 C. for 2 h under nitrogen atmosphere. After cooling to room temperature, the mixture was concentrated and purified by silica gel chromatography (0100% EtOAc/petroleum ether) to give the title compound as PENT-7A (180 mg, 69% yield for 2 steps) as a brown oil. LCMS: m/z 494.3 [M+H].sup.+; t.sub.R=1.90 min.

(462) Following the procedure above, but starting with HETX-6B (180 mg, 0.485 mmol), gave the title compound as PENT-7B (200 mg, 75% yield for 2 steps) as a brown oil. LCMS: m/z 494.3 [M+H].sup.+; t.sub.R=1.92 min.

(463) Step 3: Synthesis of 7-(6-(((1S,2S,3R,5R)-2-fluoro-8-azabicyclo[3.2.1]octan-3-yl)(methyl)amino)pyridazin-3-yl) isoquinolin-6-ol and 7-(6-(((1S,2S,3R,5R)-2-fluoro-8-azabicyclo[3.2.1]octan-3-yl)(methyl)amino)pyridazin-3-yl) isoquinolin-6-ol (Compound 7A & Compound 7B). BBr.sub.3 (5 mL, 1N in CH.sub.2Cl.sub.2) was added to the mixture of PENT-7A (180 mg, 0.365 mmol) in DCM (2 mL). The mixture was stirred at room temperature for 8 h. The reaction was quenched with MeOH (2 mL) and concentrated. The residue was treated with NH.sub.3/MeOH (7.0 M, 3 mL) and purified by silica gel chromatography (0100% MeOH/CH.sub.2Cl.sub.2) to give the title compound as Compound 7A (20 mg, 14.5% yield) as a yellow solid. .sup.1H NMR (400 MHZ, DMSO-d.sub.6) 9.18 (s, 1H), 8.72 (s, 1H), 8.40 (d, J=9.9 Hz, 1H), 8.34 (d, J=5.8 Hz, 1H), 7.60 (d, J=5.8 Hz, 1H), 7.44 (d, J=9.9 Hz, 1H), 7.28 (s, 1H), 5.27-4.99 (m, 1H), 4.65 (d, J=52.0 Hz, 1H), 3.61-3.48 (m, 2H), 3.07 (s, 3H), 2.30-2.20 (m, 1H), 1.90-1.49 (m, 5H). LCMS: m/z 380.3; [M+H].sup.+; t.sub.R=1.17 min.

(464) Following the procedure above, but with PENT-7B, (200 mg, 0.405 mmol) and BBr.sub.3 (7 mL, 1N in DCM) gave the title compound as Compound 7B (30 mg, 19% yield) as a yellow solid. .sup.1H NMR (500 MHZ, DMSO-d.sub.6) 13.62 (s, 1H), 9.19 (s, 1H), 8.74 (s, 1H), 8.41 (d, J=9.8 Hz, 1H), 8.35 (d, J=5.8 Hz, 1H), 7.62 (d, J=5.8 Hz, 1H), 7.48 (d, J=9.9 Hz, 1H), 7.31 (s, 1H), 5.27-5.03 (m, 1H), 4.77 (d, J=51.3 Hz, 1H), 3.78-3.65 (m, 2H), 3.08 (s, 3H), 2.41-2.29 (m, 1H), 1.95-1.62 (m, 5H). LCMS: m/z 380.3; [M+H].sup.+; t.sub.R=1.60 min.

(465) The examples in Table 11 were synthesized using a sequence analogous to that used to synthesize Compound 7A and Compound 7B by general Method N.

(466) TABLE-US-00046 TABLE 11 Additional Examples Prepared by General Method N. SMSM# Structure Chiral Intermediate 87A 87B 0 HETX-6A HETX-6B 88A 88B HETX-6A HETX-6B 89A HETX-6A 90A 90B HETX-6A HETX-6B 91A 91B HETX-6A HETX-6B 115A 115B 0 HETX-6A HETX-6B 129A 129B HETX-6A HETX-6B

Example B13. General Synthesis Method X: N-Methylation of Final Products

(467) ##STR00574##

Specific Example of General Method X, Compounds 92A & 92B: Synthesis of azetidin-1-yl(6-(6-(cyclopropyl((1S,2S,3R,5R)-2-fluoro-8-methyl-8-azabicyclo[3.2.1]octan-3-yl)amino)pyridazin-3-yl)-5-hydroxybenzofuran-2-yl)methanone and azetidin-1-yl(6-(6-(cyclopropyl((1R,2R,3S,5S)-2-fluoro-8-methyl-8-azabicyclo[3.2.1]octan-3-yl)amino)pyridazin-3-yl)-5-hydroxybenzofuran-2-yl)methanone

(468) ##STR00575##

(469) Step 1: Synthesis of azetidin-1-yl(6-(6-(cyclopropyl((1S,2S,3R,5R)-2-fluoro-8-methyl-8-azabicyclo[3.2.1]octan-3-yl)amino)pyridazin-3-yl)-5-hydroxybenzofuran-2-yl)methanone and azetidin-1-yl(6-(6-(cyclopropyl((1R,2R,3S,5S)-2-fluoro-8-methyl-8-azabicyclo[3.2.1]octan-3-yl)amino)pyridazin-3-yl)-5-hydroxybenzofuran-2-yl)methanone. Into a 50-mL 4-necked round-bottom flask purged and maintained with an inert atmosphere of nitrogen, was placed Compound 57A (150 mg, 0.314 mmol, 1.0 equiv), DCM (3 mL), and HCHO (18.9 mg, 0.628 mmol, 2.0 equiv), NaBH.sub.3CN (39.5 mg, 0.628 mmol, 2.0 equiv). The resulting solution was stirred for 3 h at room temperature. The reaction was then quenched by the addition of 20 mL of water. The resulting solution was extracted with 320 mL of dichloromethane and the organic layers combined. The resulting mixture was washed with 120 ml of brine. The mixture was dried over anhydrous sodium sulfate and concentrated under vacuum. The crude product was purified by Flash-Prep-HPLC with the following conditions: Column, XB-C18; mobile phase, 0.1% NH.sub.4HCO.sub.3/H.sub.2O: ACN=10-60%; Detector, 254 nm. This resulted in the title compound as Compound 92A (28 mg, 18.1% yield) as a yellow solid. .sup.1H-NMR (300 MHz, DMSO-d.sub.6) 13.12 (s, 1H), 8.37 (d, J=9.9 Hz, 1H), 8.22 (s, 1H), 7.68 (d, J=9.8 Hz, 1H), 7.34 (s, 1H), 7.21 (s, 1H), 4.81 (s, 1H), 4.59 (s, 3H), 4.08 (s, 2H), 3.27 (s, 2H), 2.66 (t, J=12.5 Hz, 1H), 2.41-2.30 (m, 3H), 2.23 (s, 3H), 2.01 (s, 2H), 1.82-1.49 (m, 3H), 1.02 (s, 3H), 0.44 (s, 1H). LCMS: m/z 492.4 [M+H].sup.+.

(470) Following the procedure above with Compound 57B (150 mg, 0.314 mmol), gave the title compound as Compound 92B (26 mg, 16.8% yield) as a yellow solid. .sup.1H-NMR (300 MHz, DMSO-d6) 13.12 (s, 1H), 8.38 (d, J=9.9 Hz, 1H), 8.22 (s, 1H), 7.68 (d, J=9.8 Hz, 1H), 7.34 (d, J=0.8 Hz, 1H), 7.21 (s, 1H), 4.81 (s, 1H), 4.67-4.53 (m, 3H), 4.09 (t, J=7.7 Hz, 2H), 3.30 (d, J=12.9 Hz, 2H), 2.66 (t, J=12.4 Hz, 1H), 2.36 (p, J=7.5 Hz, 3H), 2.23 (s, 3H), 2.01 (s, 2H), 1.81-1.52 (m, 3H), 1.08-0.97 (m, 3H), 0.45 (d, J=9.1 Hz, 1H). (ES, m/z)). LCMS: m/z 492.5 [M+H].sup.+.

(471) The examples in Table 12 were synthesized using a sequence analogous to that used to synthesize Compound 57A and Compound 57B by general Method X.

(472) TABLE-US-00047 TABLE 12 Additional Examples Prepared by General Method X SMSM# Structure Starting Material 93A 93B Compound 7A Compound 7B 94A 94B Compound 43A Compound 43B 95A 0 Compound 82A 96A 96B Compound 47A Compound 47B 97A 97B Compound 84A Compound 84B 98A 98B Compound 83A Compound 83B 99A 99B Compound 49A Compound 49B 100A 101A 0 Compound 50A Compound 50B 101A 101B Compound 51A Compound 51B 102A 102B Compound 85A Compound 85B 103A 103B Compound 52A Compound 52B 104A 104B Compound 53A Compound 53B 105A 105B 00 Compound 114A Compound 114B 01 106A 106B 02 Compound 9A Compound 9B 03 107A 107B 04 Compound 112A Compound 112B 05 108A 108B 06 Compound 81A Compound 81B 07 109A 109B 08 Compound 58A Compound 58B 09 110A 110B 0 Compound 59A Compound 59B 111A 111B Compound 60A Compound 60B 130A 130B Compound 113A Compound 113B

Example B14. General Procedure Y: Convergent Suzuki, OSEM protecting group, Penultimate Separation

(473) ##STR00616##

Selected Example of General Method Y, Compounds 121A & 121B: Synthesis of 7-(6-(((1S,2S,3R,5R)-2-fluoro-9-azabicyclo[3.3.1]nonan-3-yl)(methyl)amino)pyridazin-3-yl) isoquinolin-6-ol and 7-(6-(((1S,2S,3R,5R)-2-fluoro-9-azabicyclo[3.3.1]nonan-3-yl)(methyl)amino)pyridazin-3-yl) isoquinolin-6-ol

(474) ##STR00617##

(475) Step 1: Synthesis of 7-bromo-6-((2-(trimethylsilyl) ethoxy) methoxy) isoquinoline. NaH (134 mg, 3.35 mmol, 60 wt % in mineral oil) was added to a stirred solution of 7-bromoisoquinolin-6-ol (500 mg, 2.23 mmol) in DMF (20 mL) and THF (45 mL) at rt. After stirring at rt for 30 min, SEMCl (373 mg, 2.23 mmol) was added. The mixture was stirred at room temperature for 1 h, quenched with NH.sub.4Cl aqueous solution (20 mL), extracted with EtOAc (60 mL3). The combined organic solvents were dried over anhydrous Na.sub.2SO.sub.4, concentrated, and purified by silica gel chromatography (0-20% EtOAc/petroleum ether) to give 7-bromo-6-((2-(trimethylsilyl) ethoxy) methoxy) isoquinoline as colorless oil (619 mg, 84% yield), LCMS: LCMS: m/z 354.0 [M+H].sup.+; t.sub.R=2.21 min.

(476) Step 2: Synthesis of () (1S,2R,3R,5R)-tert-butyl 2-fluoro-3-(methyl(6-(6-((2-(trimethylsilyl) ethoxy) methoxy) isoquinolin-7-yl)pyridazin-3-yl)amino)-9-azabicyclo[3.3.1]nonane-9-carboxylate. A mixture of 7-bromo-6-((2-(trimethylsilyl) ethoxy) methoxy) isoquinoline (240 mg, 0.678 mmol), 4,4,4,4,5,5,5,5-octamethyl-2,2-bi(1,3,2-dioxaborolane) (258 mg 1.016 mmol), Pd(dppf)Cl.sub.2 (99 mg, 0.135 mmol) and KOAc (133 mg, 1.35 mmol) in 4 mL of dioxane was degassed and stirred at 100 C. for 2 h. The mixture was cooled to room temperature, () (1S,2R,3R,5R)-tert-butyl 3-((6-chloropyridazin-3-yl)(methyl)amino)-2-fluoro-9-azabicyclo[3.3.1]nonane-9-carboxylate (INT-3, 182 mg, 0.474 mmol), Pd(dppf)Cl.sub.2 (69 mg, 0.0948 mmol), K.sub.2CO.sub.3 (131 mg, 0.948 mmol), 6 mL of dioxane and 1 mL of H.sub.2O were added. The mixture was degassed and stirred at 100 C. for 2 h, concentrated and purified by silica gel column (100% EtOAc/petroleum ether) to give the title compound as a white solid (181 mg, 51% yield). LCMS: m/z 624.3 [M+H].sup.+; t.sub.R=2.35 min.

(477) Step 3: Synthesis of () 7-(6-(((1S,2S,3R,5R)-2-fluoro-9-azabicyclo[3.3.1]nonan-3-yl)(methyl)amino)pyridazin-3-yl) isoquinolin-6-ol. To the mixture of () (1S,2R,3R,5R)-tert-butyl 2-fluoro-3-(methyl(6-(6-((2-(trimethylsilyl) ethoxy) methoxy) isoquinolin-7-yl)pyridazin-3-yl)amino)-9-azabicyclo[3.3.1]nonane-9-carboxylate (201 mg, 0.323 mmol) in CH.sub.2Cl.sub.2 (2 mL) and MeOH (1 mL), was added 4N HCl in dioxane (5 mL). The mixture was stirred at 25 C. for 2 h. The mixture was concentrated to dryness, then dissolved in water and saturated K.sub.2CO.sub.3 aqueous solution was added till pH to 8-9. The mixture was extracted with CH.sub.2Cl.sub.2/MeOH 10:1 (v/v, 100 mL3). The combined organic solvents were concentrated and purified by silica gel column (15% MeOH/CH.sub.2Cl.sub.2) to give the title compound as a yellow solid (95 mg, 75% yield). .sup.1H NMR (400 MHZ, DMSO-d6) 13.60 (s, 1H), 9.19 (s, 1H), 8.74 (s, 1H), 8.41 (d, J=9.9 Hz, 1H), 8.35 (d, J=5.8 Hz, 1H), 7.62 (d, J=5.8 Hz, 1H), 7.44 (d, J=9.9 Hz, 1H), 7.31 (s, 1H), 5.88-5.69 (m, 1H), 4.77 (d, J=50.8 Hz, 1H), 3.30-3.20 (m, 2H), 3.08 (d, J=1.5 Hz, 3H), 2.46-2.36 (m, 1H), 2.00-1.56 (m, 7H). LCMS: m/z 394.1 [M+H].sup.+; t.sub.R=1.43 min.

(478) Step 4: Chiral purification to isolate 7-(6-(((1S,2S,3R,5R)-2-fluoro-9-azabicyclo[3.3.1]nonan-3-yl)(methyl)amino)pyridazin-3-yl) isoquinolin-6-ol and 7-(6-(((1S,2S,3R,5R)-2-fluoro-9-azabicyclo[3.3.1]nonan-3-yl)(methyl)amino)pyridazin-3-yl) isoquinolin-6-ol (Compound 121A & Compound 121B). Racemic intermediate, () 7-(6-(((1S,2S,3R,5R)-2-fluoro-9-azabicyclo[3.3.1]nonan-3-yl)(methyl)amino)pyridazin-3-yl) isoquinolin-6-ol, 95 mg, was purified by chiral chromatography under the following conditions to provide the title compounds as Compound 121A (27 mg, t.sub.R=2.42 min) and Compound 121B (19 mg, t.sub.R=3.77 min) as yellow solids. Instrument: SFC-150 (Waters); Column: AD 20*250 mm, 10 um (Daicel); Column temperature: 35 C.; Mobile phase: CO.sub.2/(MeOH/ACN (0.2% Methanol Ammonia)=1:1)=40/60; Flow rate: 120 g/min; Back pressure: 100 bar; Detection wavelength: 214 nm; Cycle time: 4 min; Sample solution: 60 mg dissolved in 20 mL methanol; Injection volume: 1.9 mL Compound 121A: 1H NMR (400 MHZ, DMSO-d6) 13.60 (s, 1H), 9.19 (s, 1H), 8.74 (s, 1H), 8.41 (d, J=9.9 Hz, 1H), 8.35 (d, J=5.8 Hz, 1H), 7.62 (d, J=5.8 Hz, 1H), 7.44 (d, J=9.9 Hz, 1H), 7.31 (s, 1H), 5.88-5.69 (m, 1H), 4.77 (d, J=50.8 Hz, 1H), 3.30-3.20 (m, 2H), 3.08 (d, J=1.5 Hz, 3H), 2.46-2.36 (m, 1H), 2.00-1.56 (m, 7H). LCMS: m/z 394.1 [M+H].sup.+; t.sub.R=1.43 min. Compound 121B: .sup.1H NMR (400 MHz, DMSO-d6) 13.60 (s, 1H), 9.19 (s, 1H), 8.74 (s, 1H), 8.41 (d, J=9.9 Hz, 1H), 8.35 (d, J=5.8 Hz, 1H), 7.62 (d, J=5.8 Hz, 1H), 7.44 (d, J=9.9 Hz, 1H), 7.31 (s, 1H), 5.88-5.69 (m, 1H), 4.77 (d, J=50.8 Hz, 1H), 3.30-3.20 (m, 2H), 3.08 (d, J=1.5 Hz, 3H), 2.46-2.36 (m, 1H), 2.00-1.56 (m, 7H). LCMS: m/z 394.1 [M+H].sup.+; t.sub.R=1.60 min.

(479) The examples in Table 13 were synthesized using a sequence analogous to that used to synthesize Compound 121A and Compound 121B by general Method Y.

(480) TABLE-US-00048 TABLE 13 Additional Examples Prepared by General Method Y. Chiral Chiral Intermediate Intermediate Halide HPLC or SFC Retention SMSM# Structure Intermediate Purification Method Time (min) 125A 125B INT-2 Instrument: SFC-80 (Thar, Waters) Column: AD 20 * 250 mM, 10 um (Daicel) Column temperature: 35 C. Mobile phase: CO2/MeOH (0.2% Methanol Ammonia) = 80/20 Flow rate: 80 g/min Back pressure: 100 bar Detection wavelength: 214 nm Cycle time: 4.8 min Sample solution: 240 mg dissolved in 25 ml methanol 2.19 3.16 126A 126B 0 INT-2 Instrument: SFC-150 (Thar, Waters) Column: RR WHELK 20 * 250 mM, 10 um (Daicel) Column temperature: 35 C. Mobile phase: CO2/ETOH (0.5% Methanol Ammonia) = 50/50 Flow rate: 120 g/min Back pressure: 100 bar Detection wavelength: 214 nm Cycle time: 5 min Sample solution: 260 mg dissolved in 40 ml Methanol Injection volume: 1.5 ml 3.16 3.72

Example B15. Compound 10A & 10B: Synthesis of 5-ethynyl-2-(6-(((1S,2S,3R,5R)-2-fluoro-8-azabicyclo[3.2.1]octan-3-yl)(methyl)amino)pyridazin-3-yl)phenol and 5-ethynyl-2-(6-(((1R,2R,3S,5S)-2-fluoro-8-azabicyclo[3.2.1]octan-3-yl)(methyl)amino)pyridazin-3-yl)phenol

(481) ##STR00622## ##STR00623##

(482) Step 1: Synthesis of () tert-butyl (1S,2R,3R,5R)-3-((6-(4-chloro-2-(methoxymethoxy)phenyl)pyridazin-3-yl)(methyl)amino)-2-fluoro-8-azabicyclo[3.2.1]octane-8-carboxylate. A mixture of () tert-butyl (1R,2S,3S,5S)-3-((6-chloropyridazin-3-yl)(methyl)amino)-2-fluoro-8-azabicyclo[3.2.1]octane-8-carboxylate (INT-1, 2.4 g, 6.47 mmol), (4-chloro-2-(methoxymethoxy)phenyl)boronic acid (2.80 g, 12.9 mmol), Pd(dppf)Cl.sub.2 (1.18 g, 1.62 mmol) and K.sub.2CO.sub.3 (1.79 g, 12.94 mmol) in dioxane (30 mL) and water (10 mL) was degassed and stirred at 100 C. under nitrogen for 3 h. After cooling to the ambient temperature, the mixture was diluted with water (20 mL) and extracted with ethyl acetate (30 mL2). The combined organic layers were dried over anhydrous sodium sulfate, filtered, and concentrated under reduced pressure. The residue was purified with silica gel chromatography (40% of ethyl acetate in petroleum ether) to give the title compound (2.0 g, 61% yield) as a white solid. LCMS: m/z 507.2 [M+H].sup.+; t.sub.R=2.03 min.

(483) Step 2: Chiral purification to isolate tert-butyl (1S,2R,3R,5R)-3-((6-(4-chloro-2-(methoxymethoxy)phenyl)pyridazin-3-yl)(methyl)amino)-2-fluoro-8-azabicyclo[3.2.1]octane-8-carboxylate and tert-butyl (1R,2S,3S,5S)-3-((6-(4-chloro-2-(methoxymethoxy)phenyl)pyridazin-3-yl)(methyl)amino)-2-fluoro-8-azabicyclo[3.2.1]octane-8-carboxylate (HETX-10A & HETX-10B). Racemic intermediate, () tert-butyl (1S,2R,3R,5R)-3-((6-(4-chloro-2-(methoxymethoxy)phenyl)pyridazin-3-yl)(methyl)amino)-2-fluoro-8-azabicyclo[3.2.1]octane-8-carboxylate, 3 g, was purified by chiral SFC purification to give the two title compounds as HETX-10A (t.sub.R=1.55 min, 1.4 g) and HETX-10B (t.sub.R=2.30 min, 1.4 mg). Instrument: SFC-150 (Thar, Waters); Column: SC 20*250 mm, 10 um (Regis); Column temperature: 35 C.; Mobile phase: CO.sub.2/MeOH (0.2% methanol ammonia)=60/40; Flow rate: 100 g/min; Back pressure: 100 bar; Detection wavelength: 214 nm; Cycle time: 3 min; Sample solution: 3000 mg dissolved in 100 ml nethanol; Injection volume: 1 mL.

(484) Step 3: Synthesis of tert-butyl (1S,2R,3R,5R)-2-fluoro-3-((6-(2-(methoxymethoxy)-4-((triisopropylsilyl) ethynyl)phenyl)pyridazin-3-yl)(methyl)amino)-8-azabicyclo[3.2.1]octane-8-carboxylate and tert-butyl (1R,2S,3S,5S)-2-fluoro-3-((6-(2-(methoxymethoxy)-4-((triisopropylsilyl) ethynyl)phenyl)pyridazin-3-yl)(methyl)amino)-8-azabicyclo[3.2.1]octane-8-carboxylate (HET-10A & HET-10B). To a solution of HETX-10A (200 mg, 0.395 mmol) in ACN (5 mL) was added ethynyltriisopropylsilane (360 mg, 1.98 mmol), (MeCN).sub.2PdCl.sub.2 (21 mg, 0.08 mmol), X-Phos (76 mg, 0.16 mmol) and Cs.sub.2CO.sub.3 (258 mg, 0.79 mmol). The reaction was stirred at 95 C. in sealed tube for 3 h under nitrogen atmosphere. The mixture was concentrated in vacuo, and the residue was purified by silica gel chromatography (0-25% EtOAc/petroleum ether) to give the title compound as HET-10A (220 mg, 86% yield). LCMS: m/z 653.4 [M+H].sup.+; t.sub.R=3.46 min.

(485) Following the procedure above, but starting with HETX-10B (150 mg, 0.296 mmol), gave the title compound as HET-10B (170 mg, 88% yield). LCMS: m/z 653.0 [M+H].sup.+; t.sub.R=3.77 min.

(486) Step 4: Synthesis of tert-butyl (1S,2R,3R,5R)-3-((6-(4-ethynyl-2-(methoxymethoxy)phenyl)pyridazin-3-yl)(methyl)amino)-2-fluoro-8-azabicyclo[3.2.1]octane-8-carboxylate and tert-butyl (1R,2S,3S,5S)-3-((6-(4-ethynyl-2-(methoxymethoxy)phenyl)pyridazin-3-yl)(methyl)amino)-2-fluoro-8-azabicyclo[3.2.1]octane-8-carboxylate (PENT-10A & PENT-10B). To a stirred solution of HET-10A (170 mg, 0.261 mmol) in THF (5 mL) was added TBAF (2 mL, 1 N in THF). The reaction was stirred at 25 C. for 2 h, and diluted with H.sub.2O (20 mL), and the aqueous phase was extracted with EtOAc (20 mL3). The combined organic layers were washed with brine (20 mL), dried over anhydrous Na.sub.2SO.sub.4 and concentrated in vacuo. The residue was purified by silica gel chromatography (0-40% EtOAc/petroleum ether) to give the title compound as PENT-10A (80 mg, 62% yield). LCMS: m/z 497.3 [M+H].sup.+; t.sub.R=2.06 min.

(487) Following the procedure above, but starting with HET-10B (170 mg, 0.296 mmol), gave the title compound as PENT-10B (30 mg, 23% yield). LCMS: m/z 497.3 [M+H].sup.+; t.sub.R=2.79 min.

(488) Step 5: Synthesis of 5-ethynyl-2-(6-(((1S,2S,3R,5R)-2-fluoro-8-azabicyclo[3.2.1]octan-3-yl)(methyl)amino)pyridazin-3-yl)phenol and 5-ethynyl-2-(6-(((1R,2R,3S,5S)-2-fluoro-8-azabicyclo[3.2.1]octan-3-yl)(methyl)amino)pyridazin-3-yl)phenol (Compound 10A & Compound 10B). To the mixture of PENT-10A (80 mg, 0.04 mmol) in CH.sub.2Cl.sub.2 (10 mL) was added HCl (4N in dioxane, 5 mL). The mixture was stirred at room temperature for 2 h and concentrated to dryness. The residue was dissolved in MeOH and 7N NH.sub.3/MeOH was added till pH to 8-9. The mixture was concentrated and purified by silica gel chromatography (0-10% MeOH/dichloromethane) to afford the title compound as Compound 10A (31 mg, 54% yield) as a yellow solid. .sup.1H NMR (500 MHz, DMSO-d.sub.6) 13.58 (s, 1H), 8.24 (d, J=10.0 Hz, 1H), 7.90 (d, J=8.5 Hz, 1H), 7.38 (d, J=9.5 Hz, 1H), 7.04-7.01 (m, 2H), 5.09-4.99 (m, 1H), 4.70-4.56 (m, 1H), 4.25 (s, 1H), 3.52 (s, 2H), 3.04 (d, J=1.2 Hz, 3H), 2.27-2.20 (m, 1H), 1.81-7.75 (m, 2H), 1.73-1.62 (m, 2H), 1.57-1.51 (m, 1H). LCMS: m/z 353.2 [M+H].sup.+, t.sub.R=1.78 min.

(489) Following the procedure above, but starting with PENT-10B (60 mg, 0.33 mmol) gave the title compound as Compound 10B (30 mg, 70% overall yield) as a yellow solid. .sup.1H NMR (500 MHZ, DMSO-d.sub.6) 13.57 (s, 1H), 8.24 (d, J=10.0 Hz, 1H), 7.90 (d, J=8.5 Hz, 1H), 7.39 (d, J=10.2 Hz, 1H), 7.02 (d, J=7.5 Hz, 2H), 5.10-5.0 (m, 1H), 4.66 (d, J=52.0 Hz, 1H), 4.26 (s, 1H), 3.57 (s, 2H), 3.04 (d, J=1.5 Hz, 3H), 2.29-2.21 (m, 1H), 1.88-1.64 (m, 4H), 1.61-1.52 (m, 1H). LCMS: m/z 353.2 [M+H] *, t.sub.R-1.79 min.

Example 119B: Synthesis of 2-(6-(((1R,2R,3S,5S)-2-fluoro-8-azabicyclo[3.2.1]octan-3-yl)(methyl)amino)pyridazin-3-yl)phenol or 2-(6-(((1S,2S,3R,5R)-2-fluoro-8-azabicyclo[3.2.1]octan-3-yl)(methyl)amino)pyridazin-3-yl)phenol

(490) Step 1: Synthesis of tert-butyl (1R,2S,3S,5S)-2-fluoro-3-((6-(2-(methoxymethoxy)phenyl)pyridazin-3-yl)(methyl)amino)-8-azabicyclo[3.2.1]octane-8-carboxylate or of tert-butyl (1S,2R,3R,5R)-2-fluoro-3-((6-(2-(methoxymethoxy)phenyl)pyridazin-3-yl)(methyl)amino)-8-azabicyclo[3.2.1]octane-8-carboxylate. To a flask with HETX-10B (100 mg, 0.197 mmol) and oxetan-3-ylboronic acid (60 mg, 0.592 mmol) in a mixture solution of dioxane (2 mL) and water (1 mL), K.sub.3PO.sub.4 (84 mg, 0.394 mmol) and XPhos Pd G2 (23 mg, 0.03 mmol) were added. The reaction mixture was stirred at 100 C. for 2 h under N.sub.2 atmosphere, concentrated in vacuum and the residue was purified by silica gel chromatography (5-25% of ethyl acetate in petroleum ether) to give the title compound as PENT-119B (67 mg, 72% yield) as a white solid. LCMS: m/z 473.3 [M+1].sup.+; t.sub.R=1.59 min.

(491) Step 2: Synthesis of 2-(6-(((1R,2R,3S,5S)-2-fluoro-8-azabicyclo[3.2.1]octan-3-yl)(methyl)amino)pyridazin-3-yl)phenol or 2-(6-(((1S,2S,3R,5R)-2-fluoro-8-azabicyclo[3.2.1]octan-3-yl)(methyl)amino)pyridazin-3-yl)phenol (Compound 119B). To a flask with PENT-119B in DCM (1 mL) was added TFA (1 mL) at 0 C. The reaction mixture was stirred at 20 C. for 30 min, concentrated under vacuum, then basified with 7M ammonia in MeOH. The mixture was concentrated an purified by Prep-TLC (DCM: 7M ammonia MeOH 20:1, v/v) to the title compound as Compound 119B (25.2 mg, 36.2% yield) as a yellow solid. .sup.1H NMR (500 MHZ, DMSO-d.sub.6) 13.44 (s, 1H), 8.24 (s, 1H), 7.89 (s, 1H), 7.33 (d, J=59.8 Hz, 2H), 6.94 (s, 2H), 5.37-4.90 (m, 1H), 4.83-4.46 (m, 1H), 3.62-3.47 (m, 2H), 3.04 (s, 3H), 2.33-2.12 (m, 1H), 2.02-1.53 (m, 5H). LCMS: m/z 329.2 [M+1].sup.+; t.sub.R=0.845 min.

Compound 120A & 120B: Synthesis of 5-(difluoromethyl)-2-(6-(((1S,2S,3R,5R)-2-fluoro-8-azabicyclo[3.2.1]octan-3-yl)(methyl)amino)pyridazin-3-yl)phenol and of 5-(difluoromethyl)-2-(6-(((1R,2R,3S,5S)-2-fluoro-8-azabicyclo[3.2.1]octan-3-yl)(methyl)amino)pyridazin-3-yl)phenol

(492) Step 1. Synthesis of () (1R,2S,3S,5S)-tert-butyl 2-fluoro-3-((6-(4-formyl-2-methoxyphenyl) pyridazin-3-yl)(methyl)amino)-8-azabicyclo[3.2.1]octane-8-carboxylate. 4-formyl-2-methoxyphenylboronic acid (480 mg, 2.67 mmol), Pd(dppf)Cl.sub.2 (178 mg, 0.243 mmol) and K.sub.2CO.sub.3 (670 mg, 4.86 mmol) were added to a mixture of () (1R,2S,3S,5S)-tert-butyl 3-((6-chloropyridazin-3-yl)(methyl)amino)-2-fluoro-8-azabicyclo[3.2.1]octane-8-carboxylate (INT-1, 900 mg, 2.43 mmol) in 8 mL of dioxane and 1 mL of H.sub.2O. The resulting mixture was stirred at 110 C. for 2 h under N.sub.2. After cooling to room temperature, the mixture was poured into water (60 mL) and extracted with EtOAc (30 mL3). The combined extracts were washed with brine (30 mL3), dried over anhydrous Na.sub.2SO.sub.4, filtered, and concentrated. The residue was purified by silica gel chromatography (0-50% EtOAc/petroleum ether) to give the title compound (800 mg, 70.05%) as a yellow solid. LCMS: m/z 471.3 [M+H].sup.+; t.sub.R=1.29 min.

(493) Step 2: Synthesis of () (1S,2R,3R,5R)-tert-butyl 3-((6-(4-(difluoromethyl)-2-methoxyphenyl) pyridazin-3-yl)(methyl)amino)-2-fluoro-8-azabicyclo[3.2.1]octane-8-carboxylate. Diethylaminosulphur trifluoride (4.1 g, 25.5 mmol) was added slowly to a solution of () (1R,2S,3S,5S)-tert-butyl 2-fluoro-3-((6-(4-formyl-2-methoxyphenyl)pyridazin-3-yl)(methyl)amino)-8-azabicyclo[3.2.1]octane-8-carboxylate (800 mg, 1.70 mmol) in dry DCM (20 mL) at 0 C. The resulting mixture was stirred at room temperature for 24 h, then was poured into ice water (100 mL) and extracted with EtOAc (30 mL3). The combined extracts were washed with brine (30 mL3), dried over Na.sub.2SO.sub.4, filtered, and concentrated. The residue was purified by silica flash chromatography (0-50% EtOAc/petroleum ether) to give the title compound (600 mg, 71.77%) as a yellow solid.

(494) Step 3: Chiral purification to isolate (1S,2R,3R,5R)-tert-butyl 3-((6-(4-(difluoromethyl)-2-methoxyphenyl)pyridazin-3-yl)(methyl)amino)-2-fluoro-8-azabicyclo[3.2.1]octane-8-carboxylate and (1R,2S,3S,5S)-tert-butyl 3-((6-(4-(difluoromethyl)-2-methoxyphenyl)pyridazin-3-yl)(methyl)amino)-2-fluoro-8-azabicyclo[3.2.1]octane-8-carboxylate (NPENT-120A & NPENT-120B). Racemic intermediate, () (1S,2R,3R,5R)-tert-butyl 3-((6-(4-(difluoromethyl)-2-methoxyphenyl)pyridazin-3-yl)(methyl)amino)-2-fluoro-8-azabicyclo[3.2.1]octane-8-carboxylate, 600 mg, was purified by chiral-HPLC to give the title compound NPENT-120A (266 mg, t.sub.R=1.74 min) and NPENT-120B (274 mg, t.sub.R=2.53 min) as a colorless oils. LCMS: m/z 493.3 [M+H].sup.+.

(495) Chiral HPLC condition: Instrument: SFC-80 (Thar, Waters); Column: OJ 20*250 mm, 10 um (Daicel); Column temperature: 35 C.; Mobile phase: CO.sub.2/MeOH (0.2% Methanol Ammonia)=85/15; Flow rate: 80 g/min; Back pressure: 100 bar; Detection wavelength: 214 nm; Cycle time: 3.8 min; Sample solution: 840 mg dissolved in 25 ml methanol; Injection volume: 0.6 ml

(496) Step 4: Synthesis of (1S,2R,3R,5R)-tert-butyl 3-((6-(4-(difluoromethyl)-2-hydroxyphenyl)pyridazin-3-yl)(methyl)amino)-2-fluoro-8-azabicyclo[3.2.1]octane-8-carboxylate and (1R,2S,3S,5S)-tert-butyl 3-((6-(4-(difluoromethyl)-2-hydroxyphenyl)pyridazin-3-yl)(methyl)amino)-2-fluoro-8-azabicyclo[3.2.1]octane-8-carboxylate (PENT-120A & PENT-120B).

(497) A mixture of NPENT-120A (150 mg, 0.3 mmol), 1-decanethiol (261 mg, 1.5 mmol) and K.sub.2CO.sub.3 (83 mg, 0.6 mmol) in NMP (2 mL) was stirred at 150 C. for 8 h in a sealed tube. The resulting mixture was poured into ice water (20 mL) and extracted with EtOAc (15 mL3). The combined extracts were washed with brine (30 mL3), dried over Na.sub.2SO.sub.4, filtered, and concentrated. The residue was purified by silica flash chromatography (0-50% EtOAc/petroleum ether) to give the title compound as PENT-120A (120 mg, 82.2%) as a yellow solid. LCMS: m/z 479.3 [M+H].sup.+; t.sub.R=2.11 min.

(498) Following the procedure above, but with NPENT-120B (150 mg, 0.3 mmol), gave the title compound as PENT-120B (120 mg, 82.2%) as a yellow solid. LCMS: m/z 479.3 [M+H].sup.+; t.sub.R=2.11 min.

(499) Step 5: Synthesis of 5-(difluoromethyl)-2-(6-(((1S,2S,3R,5R)-2-fluoro-8-azabicyclo[3.2.1]octan-3-yl)(methyl)amino)pyridazin-3-yl)phenol and 5-(difluoromethyl)-2-(6-(((1R,2R,3S,5S)-2-fluoro-8-azabicyclo[3.2.1]octan-3-yl)(methyl)amino)pyridazin-3-yl)phenol (Compound 120A and Compound 120B).

(500) TFA (1 mL) was added to a solution of PENT-120A (150 mg, 0.31 mmol) in CH.sub.2Cl.sub.2 (3 mL). The mixture was stirred at room temperature for 1 h. The mixture was adjusted to pH 7-8 by adding 8N NH.sub.3/Methanol. The residue was purified by Prep-HPLC (ACN and H.sub.2O with 0.05% NH.sub.4HCO.sub.3 as mobile phase) to give the title compound as Compound 120A (73.2 mg, 62.56%) as a white solid. .sup.1H NMR (400 MHz, MeOD) 8.15 (d, J=9.9 Hz, 1H), 7.88 (d, J=8.6 Hz, 1H), 7.32 (d, J=9.9 Hz, 1H), 7.11 (d, J=7.0 Hz, 2H), 6.89-6.60 (m, 1H), 5.41-5.19 (m, 1H), 4.81-4.66 (m, 1H), 3.68 (s, 2H), 3.13 (d, J=1.7 Hz, 3H), 2.44-2.37 (m, 1H), 2.09-1.82 (m, 4H), 1.73-1.57 (m, 1H). LCMS: m/z 379.2 [M+H].sup.+; t.sub.R=1.79 min.

(501) Following the procedure above, but with PENT-120B, gave the title compound as Compound 120B (71.7 mg, 61.28%) as a white solid. .sup.1H NMR (400 MHZ, MeOD) 8.15 (d, J=9.9 Hz, 1H), 7.88 (d, J=8.6 Hz, 1H), 7.32 (d, J=9.9 Hz, 1H), 7.11 (d, J=7.0 Hz, 2H), 6.89-6.60 (m, 1H), 5.41-5.19 (m, 1H), 4.81-4.66 (m, 1H), 3.68 (s, 2H), 3.13 (d, J=1.7 Hz, 3H), 2.44-2.37 (m, 1H), 2.09-1.82 (m, 4H), 1.73-1.57 (m, 1H). LCMS: m/z 379.2 [M+H].sup.+; t.sub.R=1.79 min.

Compound 122: Synthesis of 5-(6-(((1R,2R,3S,5S)-2-fluoro-8-azabicyclo[3.2.1]octan-3-yl)(methyl)amino)pyridazin-3-yl)-2-(1-methyl-1H-pyrazol-4-yl)pyrimidin-4-ol

(502) Step 1: Synthesis of 2-chloro-5-iodo-4-((4-methoxybenzyl)oxy)pyrimidine. To a solution of (4-methoxyphenyl)methanol (1.0 g, 7.24 mmol) and 2,4-dichloro-5-iodopyrimidine (2.39 g, 8.69 mmol) in THF (20 mL) at 0 C. was added NaH (434.2 mg, 10.86 mmol, 60 wt % in mineral oil). The mixture was stirred at room temperature for 16 h, quenched with water (5 mL) and extracted with ethyl acetate (40 mL2). The combined organic layers were washed with sodium chloride solution, dried, concentrated, purified by silica gel chromatography (0 to 5% ethyl acetate/petroleum ether) to give 2-chloro-5-iodo-4-((4-methoxybenzyl)oxy)pyrimidine (1.6 g, 58% yield) as a white solid. LCMS: t.sub.R=1.65 min.

(503) Step 2: Synthesis of () tert-butyl (1R,2S,3S,5S)-2-fluoro-3-(methyl(6-(tributylstannyl)pyridazin-3-yl)amino)-8-azabicyclo[3.2.1]octane-8-carboxylate. A mixture of tert-butyl (1R,2S,3S,5S)-3-((6-chloropyridazin-3-yl)(methyl)amino)-2-fluoro-8-azabicyclo[3.2.1]octane-8-carboxylate (INT-1, 600 mg, 1.62 mmol), Bu.sub.3SnSnBu.sub.3 (1.88 g, 3.24 mmol), Pd.sub.2 (dba); (148.2 mg, 0.16 mmol) and PCy.sub.3 (90.7 mg, 0.32 mmol) in toluene (10 mL) was stirred at 110 C. under N.sub.2 for 16 h. The mixture was filtered, the filtrate was concentrated in vacuum and purified by combiflash (Al.sub.2O.sub.3, basic) using ethyl acetate/petroleum ether from 0 to 10% to give the title compound (458 mg, 45% yield) as a light yellow oil. LCMS: m/z 627.0 [M+1].sup.+, t.sub.R=3.93 min.

(504) Step 3: Synthesis of () tert-butyl (1R,2S,3S,5S)-3-((6-(2-chloro-4-((4-methoxybenzyl)oxy)pyrimidin-5-yl)pyridazin-3-yl)(methyl)amino)-2-fluoro-8-azabicyclo[3.2.1]octane-8-carboxylate. A mixture of () tert-butyl (1R,2S,3S,5S)-2-fluoro-3-(methyl(6-(tributylstannyl)pyridazin-3-yl)amino)-8-azabicyclo[3.2.1]octane-8-carboxylate (130 mg, 0.35 mmol), 2-chloro-5-iodo-4-((4-methoxybenzyl)oxy)pyrimidine (370.1 mg, 0.41 mmol) and Pd(PPh.sub.3).sub.4 (39.9 mg, 0.03 mmol) in toluene (6 mL) was stirred under N.sub.2 at 110 C. for 16 h. The mixture was concentrated in vacuum and purified by prep-TLC (petroleum ether/ethyl acetate=2/1) to the title compound (80 mg, 39% yield) as brown solid. LCMS: m/z 585.0 [M+1].sup.+, t.sub.R=2.06 min.

(505) Step 4: Synthesis of () tert-butyl (1R,2S,3S,5S)-2-fluoro-3-((6-(4-hydroxy-2-(1-methyl-1H-pyrazol-4-yl)pyrimidin-5-yl)pyridazin-3-yl)(methyl)amino)-8-azabicyclo[3.2.1]octane-8-carboxylate. A mixture of () tert-butyl (1R,2S,3S,5S)-3-((6-(2-chloro-4-((4-methoxybenzyl)oxy)pyrimidin-5-yl)pyridazin-3-yl)(methyl)amino)-2-fluoro-8-azabicyclo[3.2.1]octane-8-carboxylate (323 mg, 0.552 mmol), 1-methyl-4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-1H-pyrazole (230 mg, 1.116 mmol), Pd(dppf)Cl.sub.2 (40.4 mg, 0.05 mmol) and K.sub.2CO.sub.3 (229 mg, 1.66 mmol) in dioxane (3 mL) and water (1 mL) was stirred at 100 C. for 16 h under N.sub.2. The reaction mixture was concentrated in vacuum, and purified by silica gel chromatography (0 to 4% MeOH/dichloromethane) to give the title compound (135 mg). LCMS: m/z 511.0 [M+1].sup.+, t.sub.R=1.62 min).

(506) Step 5: () Synthesis of 5-(6-(((1R,2R,3S,5S)-2-fluoro-8-azabicyclo[3.2.1]octan-3-yl)(methyl)amino)pyridazin-3-yl)-2-(1-methyl-1H-pyrazol-4-yl)pyrimidin-4-ol (Compound 122). A mixture of () tert-butyl (1R,2S,3S,5S)-2-fluoro-3-((6-(4-hydroxy-2-(1-methyl-1H-pyrazol-4-yl)pyrimidin-5-yl)pyridazin-3-yl)(methyl)amino)-8-azabicyclo[3.2.1]octane-8-carboxylate (143 mg, 0.28 mmol) and HCl/dioxane (10 mL) in DCM (5 mL) was stirred at room temperature for 2 h. The mixture was concentrated, and neutralized with 0.5 mL of 7M ammonia MeOH. The crude product was purified by silica gel column (1-10% MeOH/DCM) to give the title compound (82.5 mg, 63.9% yield) as pale yellow solid. .sup.1H NMR (400 MHz, DMSO-d.sub.6) 8.70 (s, 1H), 8.55 (s, 1H), 8.29-8.20 (m, 2H), 7.20 (d, J=9.6 Hz, 1H), 5.39-5.18 (m, 1H), 5.08-4.87 (m, 1H), 4.16-3.98 (m, 2H), 3.92 (s, 3H), 3.39 (s, 1H), 3.01 (s, 3H), 2.13-1.86 (m, 4H), 1.84-1.74 (m, 1H). LCMS: m/z 411.0 [M+1].sup.+; t.sub.R=1.26 min.

Compound 123A & 123B: Synthesis of 2-(6-(((1S,2S,3R,5R)-2-fluoro-8-azabicyclo[3.2.1]octan-3-yl)(methyl)amino)pyridazin-3-yl)-5-(1-methyl-1H-imidazol-2-yloxy) phenol and 2-(6-(((1R,2R,3S,5S)-2-fluoro-8-azabicyclo[3.2.1]octan-3-yl)(methyl)amino)pyridazin-3-yl)-5-(1-methyl-1H-imidazol-2-yloxy) phenol

(507) Step 1: Synthesis of 2-(4-bromo-3-methoxyphenoxy)-1-methyl-1H-imidazole. A mixture of 2-chloro-1-methyl-1H-imidazole (5.0 g, 48.2 mmol) and 4-bromo-3-methoxyphenol (6.0 g, 30.0 mmol) in DIPEA (120 mL) was sealed and heated to 150 C. for 8 h. The mixture was concentrated, and the residue was purified by Prep-HPLC (80% MeOH/H.sub.2O) to give 2-(4-bromo-3-methoxyphenoxy)-1-methyl-1H-imidazole (4.05 g, 43.1% yield) as an oil. LCMS: m/z 283.0 [M+H].sup.+; t.sub.R=1.65 min.

(508) Step 2: Synthesis of 2-bromo-5-(1-methyl-1H-imidazol-2-yloxy) phenol. BBr.sub.3 (25 mL, 25.0 mmol, 1N in CH.sub.2Cl.sub.2) was added to a solution of 2-(4-bromo-3-methoxyphenoxy)-1-methyl-1H-imidazole (2.5 g, 8.8 mmol) in CH.sub.2Cl.sub.2 (15 mL). Then the mixture was stirred at room temperature overnight. MeOH (10 mL) was added to quench the reaction. The resulting mixture was concentrated and purified by silica gel chromatography (5-10% MeOH in CH.sub.2Cl.sub.2) to yield 2-bromo-5-(1-methyl-1H-imidazol-2-yloxy) phenol (1.3 g, 52.3% yield) as solid. LCMS: m/z 269.0 [M+H].sup.+; t.sub.R=1.38 min.

(509) Step 3: Synthesis of 2-(4-bromo-3-((2-(trimethylsilyl) ethoxy) methoxy) phenoxy)-1-methyl-1H-imidazole. NaH (220 mg, 5.5 mmol, 60 wt % in mineral oil) was added to a solution of 2-bromo-5-(1-methyl-1H-imidazol-2-yloxy) phenol (1 g, 3.7 mmol) in DMF (20 mL). The mixture was stirred for another 30 min at 0 C., then SEMCl (900 mg, 5.5 mmol) was added. The mixture was stirred at room temperature for 3 h, quenched with 30 mL of water and extracted with ethyl acetate (40 mL3). The combined organic layers were washed with brine, dried over anhydrous Na.sub.2SO.sub.4, concentrated and purified by silica gel chromatography (10-25% ethyl acetate in petroleum ether) to give 2-(4-bromo-3-((2-(trimethylsilyl) ethoxy) methoxy) phenoxy)-1-methyl-1H-imidazole (700 mg, 47% yield). LCMS: m/z 399.1 [M+H].sup.+; t.sub.R=1.81 min.

(510) Step 4: Synthesis of 1-methyl-2-(4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-3-((2-(trimethylsilyl) ethoxy) methoxy) phenoxy)-1H-imidazole. A mixture of 2-(4-bromo-3-((2-(trimethylsilyl) ethoxy) methoxy) phenoxy)-1-methyl-1H-imidazole (500 mg, 1.25 mmol), 4,4,4,4,5,5,5,5-octamethyl-2,2-bi(1,3,2-dioxaborolane) (476 mg, 1.88 mmol), potassium acetate (246 mg, 2.5 mmol) and Pd(dppf)Cl.sub.2 (108 mg, 0.12 mmol) in 1,4-dioxane (20.0 mL) was degassed and stirred at 100 C. overnight. The mixture was concentrated and purified by silica gel chromatography (10-25% ethyl acetate in petroleum ether) to give 1-methyl-2-(4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-3-((2-(trimethylsilyl) ethoxy) methoxy) phenoxy)-1H-imidazole (375 mg, 58% yield). LCMS: m/z 447.3 [M+H].sup.+; t.sub.R=1.82 min.

(511) Step 5: Synthesis of (1S,2R,3R,5R)-tert-butyl 2-fluoro-3-(methyl(6-(4-(1-methyl-1H-imidazol-2-yloxy)-2-((2-(trimethylsilyl) ethoxy) methoxy)phenyl)pyridazin-3-yl)amino)-8-azabicyclo[3.2.1]octane-8-carboxylate and (1R,2S,3S,5S)-tert-butyl 2-fluoro-3-(methyl(6-(4-(1-methyl-1H-imidazol-2-yloxy)-2-((2-(trimethylsilyl) ethoxy) methoxy)phenyl)pyridazin-3-yl)amino)-8-azabicyclo[3.2.1]octane-8-carboxylate. A mixture of 1-methyl-2-(4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)-3-((2-(trimethylsilyl) ethoxy) methoxy) phenoxy)-1H-imidazole (100 mg, 0.27 mmol), HETX-6A (144 mg, 0.32 mmol), potassium carbonate (93 mg, 0.67 mmol) and Pd(dppf)Cl.sub.2 (23 mg, 0.03 mmol) in 5 mL of 1,4-dioxane and 1 mL of H.sub.2O was degassed and stirred at 110 C. for 2 h. The mixture was concentrated and purified by silica gel chromatography (5-10% methanol in CH.sub.2Cl.sub.2) to yield the title compound as PENT-123A (100 mg, 57% yield). LCMS: m/z 655.3 [M+H].sup.+; t.sub.R=1.83 min.

(512) Following the procedure above, but with HETX-6B (100 mg, 0.27 mmol), gave the title compound as PENT-123B (100 mg, 57% yield). LCMS: m/z 655.0 [M+H].sup.+; t.sub.R=2.10 min.

(513) Step 6: Synthesis of 2-(6-(((1S,2S,3R,5R)-2-fluoro-8-azabicyclo[3.2.1]octan-3-yl) (methyl)amino)pyridazin-3-yl)-5-(1-methyl-1H-imidazol-2-yloxy) phenol and 2-(6-(((1R,2R,3S,5S)-2-fluoro-8-azabicyclo[3.2.1]octan-3-yl)(methyl)amino)pyridazin-3-yl)-5-(1-methyl-1H-imidazol-2-yloxy) phenol (Compound 123A & Compound 123B). To the solution of PENT-123A (100 mg, 0.15 mmol) in CH.sub.2Cl.sub.2 (2.0 mL) was added HCl (3 mL, 4.0 N in 1,4-dioxane). The mixture was stirred for 1 h and concentrated and the residue was dissolved into water (2.0 mL) and neutralized till pH9 with K.sub.2CO.sub.3. The resulting mixture was extracted with CH.sub.2Cl.sub.2 (10 mL2) and the organic layers were concentrated and purified by silica gel chromatography (5-20% methanol in CH.sub.2Cl.sub.2) to give the title compound as Compound 123A (41 mg, 63% yield). .sup.1H NMR (400 MHZ, DMSO-d.sub.6) 13.78 (s, 1H), 8.20 (d, J=10.0 Hz, 1H), 7.91 (d, J=10.0 Hz, 1H), 7.40 (d, J=9.9 Hz, 1H), 7.00 (d, J=1.5 Hz, 1H), 6.78-6.61 (m, 3H), 5.06 (d, J=23.9 Hz, 1H), 4.75 (d, J=51.3 Hz, 1H), 3.66-3.64 (m, 2H), 3.49 (s, 3H), 3.03 (s, 3H), 2.32-2.25 (m, 1H), 1.91-1.67 (m, 4H), 1.62-1.58 (m, 1H). LCMS: m/z 425.1 [M+H].sup.+; t.sub.R=1.14 min.

(514) Following the procedure above, but with PENT-123B (100 mg, 0.27 mmol), gave the title compound as Compound 123B (36.5 mg, 57.2% yield). .sup.1H NMR (400 MHZ, DMSO-d.sub.6) 13.78 (s, 1H), 8.20 (d, J=10.0 Hz, 1H), 7.91 (d, J=10.0 Hz, 1H), 7.40 (d, J=9.9 Hz, 1H), 7.00 (d, J=1.5 Hz, 1H), 6.78-6.61 (m, 3H), 5.06 (d, J=23.9 Hz, 1H), 4.75 (d, J=51.3 Hz, 1H), 3.66-3.64 (m, 2H), 3.49 (s, 3H), 3.03 (s, 3H), 2.32-2.25 (m, 1H), 1.91-1.67 (m, 4H), 1.62-1.58 (m, 1H). LCMS: m/z 425.1 [M+H].sup.+; t.sub.R=1.14 min. Compound 124A: Synthesis of N-(tert-butyl)-1-(4-(6-(((1S,2S,3R,5R)-2-fluoro-8-azabicyclo[3.2.1]octan-3-yl)(methyl)amino)pyridazin-3-yl)-3-hydroxyphenyl)-1H-imidazole-4-carboxamide or N-(tert-butyl)-1-(4-(6-(((1R,2R,3S,5S)-2-fluoro-8-azabicyclo[3.2.1]octan-3-yl)(methyl)amino)pyridazin-3-yl)-3-hydroxyphenyl)-1H-imidazole-4-carboxamide.

(515) Step 1: Synthesis of (1S,2R,3R,5R)-tert-butyl 3-((6-(4-(4-cyano-1H-imidazol-1-yl)-2-hydroxyphenyl)pyridazin-3-yl)(methyl)amino)-2-fluoro-8-azabicyclo[3.2.1]octane-8-carboxylate or (1R,2S,3S,5S)-tert-butyl 3-((6-(4-(4-cyano-1H-imidazol-1-yl)-2-hydroxyphenyl)pyridazin-3-yl)(methyl)amino)-2-fluoro-8-azabicyclo[3.2.1]octane-8-carboxylate (PENT-69A). A mixture of HETX-6A (100 mg, 0.27 mmol), (1-(3-hydroxy-4-(4,4,5,5-tetramethyl-1,3,2-dioxaborolan-2-yl)phenyl)-1H-imidazole-4-carbonitrile (B6, 168 mg, 0.54 mmol), Pd(dppf)Cl.sub.2 (23 mg, 0.03 mmol) and K.sub.2CO.sub.3 (76 mg, 0.54 mmol) in dioxane (8 mL) and water (2 mL) was degassed and stirred at 110 C. for 2 h. The mixture was concentrated and purified by silica gel column (80% EtOAc/petroleum ether) to give 100 mg of the title compound as PENT-69A as a yellow solid (71% yield). LCMS: m/z 520.2 [M+H].sup.+; t.sub.R=1.95 min.

(516) Step 2: Synthesis of N-(tert-butyl)-1-(4-(6-(((1S,2S,3R,5R)-2-fluoro-8-azabicyclo[3.2.1]octan-3-yl)(methyl)amino)pyridazin-3-yl)-3-hydroxyphenyl)-1H-imidazole-4-carboxamide or N-(tert-butyl)-1-(4-(6-(((1R,2R,3S,5S)-2-fluoro-8-azabicyclo[3.2.1]octan-3-yl)(methyl)amino)pyridazin-3-yl)-3-hydroxyphenyl)-1H-imidazole-4-carboxamide (Compound 123). 1 mL of TFA was added to a stirred solution of PENT-69A (100 mg, 0.193 mmol) in 1 mL of CH.sub.2Cl.sub.2. The mixture was stirred at room temperature for 2 h and concentrated under reduced pressure. The residue was dissolved in water. pH value was adjusted to 9 by using K.sub.2CO.sub.3 aqueous solution. The mixture was extracted with 10% MeOH/CH.sub.2C12 (20 mL3). The combined organic phases were dried and purified by reverse HPLC, to give Compound 69A (28 mg, 35% yield). .sup.1H NMR (400 MHZ, DMSO-d.sub.6) 14.23 (s, 1H), 8.83 (d, J=1.2 Hz, 1H), 8.62 (d, J=1.2 Hz, 1H), 8.33 (d, J=10.0 Hz, 1H), 8.10 (d, J=8.7 Hz, 1H), 7.43 (d, J=10.0 Hz, 1H), 7.37 (d, J=2.3 Hz, 1H), 7.30 (dd, J=8.6, 2.3 Hz, 1H), 5.13-4.90 (m, 1H), 4.66-4.62 (m, 1H), 3.53 (s, 2H), 3.04 (s, 3H), 2.32-2.19 (m, 2H), 1.82-1.50 (m, 4H). LCMS: m/z 420.2 [M+H].sup.+; t.sub.R=1.64 min.

(517) The title compound was also isolated as Compound 123 (15 mg, 18% yield). .sup.1H NMR (400 MHz, DMSO-d.sub.6) 14.14 (s, 1H), 8.45-8.38 (m, 1H), 8.32 (d, J=10.0 Hz, 1H), 8.25 (s, 1H), 8.05 (d, J=8.6 Hz, 1H), 7.42 (d, J=9.7 Hz, 1H), 7.36 (s, 1H), 7.32 (d, J=8.5 Hz, 1H), 7.19 (s, 1H), 5.16-4.93 (m, 1H), 4.75-4.54 (m, 1H), 3.54 (s, 2H), 3.05 (s, 3H), 2.25 (t, J=11.6 Hz, 1H), 1.88-1.62 (m, 4H), 1.62-1.50 (m, 1H), 1.40 (s, 9H). LCMS: m/z 494.2 [M+H].sup.+; t.sub.R=1.75 min.

Compound 127A & 127B: Synthesis of (R)-4-(4-(6-(((1R,3S,5S)-6,6-difluoro-8-azabicyclo[3.2.1]octan-3-yl)(methyl)amino)pyridazin-3-yl)-3-hydroxyphenyl) piperidin-2-one and(S)-4-(4-(6-(((1R,3S,5S)-6,6-difluoro-8-azabicyclo[3.2.1]octan-3-yl)(methyl)amino)pyridazin-3-yl)-3-hydroxyphenyl) piperidin-2-one and(S)-4-(4-(6-(((1S,3R,5R)-6,6-difluoro-8-azabicyclo[3.2.1]octan-3-yl)(methyl)amino)pyridazin-3-yl)-3-hydroxyphenyl) piperidin-2-one and (R)-4-(4-(6-(((1S,3R,5R)-6,6-difluoro-8-azabicyclo[3.2.1]octan-3-yl)(methyl)amino)pyridazin-3-yl)-3-hydroxyphenyl) piperidin-2-one (Compounds 127A, Compound 127B, Compound 128A, and Compound 128B)

(518) Step 1: Synthesis of () tert-butyl (1S,3R,5R)-3-((6-(4-chloro-5-fluoro-2-(methoxymethoxy)phenyl)pyridazin-3-yl)(methyl)amino)-6,6-difluoro-8-azabicyclo[3.2.1]octane-8-carboxylate. Into a 50-mL 3-necked round-bottom flask, was placed a solution of INT-2 (3.80 g, 9.773 mmol, 1.00 equiv) in dioxane (4 mL), and H.sub.2O (1 mL), 2-[4-chloro-5-fluoro-2-(methoxymethoxy)phenyl]-4,4,5,5-tetramethyl-1,3,2-dioxaborolane (B7, 3.09 g, 9.76 mmol, 1.0 equiv), Pd(dppf)Cl.sub.2 (0.36 g, 0.49 mmol, 0.05 equiv), K.sub.2CO.sub.3 (2.70 g, 19.5 mmol, 2 equiv). The resulting solution was stirred for 3 h at 100 C. The resulting mixture was concentrated. The residue was applied onto a silica gel column with ethyl acetate/petroleum ether (15:100). To give the title compound (3.0 g, 57% yield) as a yellow oil.

(519) Step 2: Synthesis of tert-butyl (1S,3R,5R)-6,6-difluoro-3-((6-(2-(methoxymethoxy)-4-(2-oxo-1,2-dihydropyridin-4-yl)phenyl)pyridazin-3-yl)(methyl)amino)-8-azabicyclo[3.2.1]octane-8-carboxylate and tert-butyl (1S,3R,5R)-6,6-difluoro-3-((6-(2-(methoxymethoxy)-4-(2-oxo-1,2-dihydropyridin-4-yl)phenyl)pyridazin-3-yl)(methyl)amino)-8-azabicyclo[3.2.1]octane-8-carboxylate. Into a 100-mL 3-necked round-bottom flask, was placed a solution of () tert-butyl (1S,3R,5R)-3-([6-[4-chloro-5-fluoro-2-(methoxymethoxy)phenyl]pyridazin-3-yl] (methyl)amino)-6,6-difluoro-8-azabicyclo[3.2.1]octane-8-carboxylate (2.80 g, 5.16 mmol, 1.0 equiv) in dioxane (20 mL), and H.sub.2O (4 mL), 1-methyl-2-oxopyridin-4-ylboronic acid (2.50 g, 16.3 mmol, 3.2 equiv), K.sub.2CO.sub.3 (2.12 g, 15.3 mmol, 3 equiv), Pd(dppf)Cl.sub.2 (0.338 g, 0.463 mmol, 0.09 equiv). The resulting solution was stirred for 3 h at 100 C. The resulting solution was extracted with 210 mL of ethyl acetate dried over anhydrous sodium sulfate and concentrated. The residue was applied onto a silica gel column with ethyl acetate/petroleum ether (7:3) to provide the crude product, which was further purified by prep-SFC. This resulted in isolation of the title compounds as PENT-22A (750 mg, t.sub.R=4.05 min) and PENT-22B (700 mg, 28%, t.sub.R=5.66 min).

(520) Column: CHIRALPAK AD-H, 2.0 cm I.D.*25 cm L; Mobile Phase A: CO.sub.2, Mobile Phase B: IPA; Flow rate: 45 mL/min; Gradient: 35% B; 220 nm; RT1: 4.05 min; RT2: 5.66 min.

(521) Step 3: Synthesis of () tert-butyl (1S,3R,5R)-6,6-difluoro-3-((6-(2-hydroxy-4-((R)-2-oxopiperidin-4-yl)phenyl)pyridazin-3-yl)(methyl)amino)-8-azabicyclo[3.2.1]octane-8-carboxylate and () tert-butyl (1S,3R,5R)-6,6-difluoro-3-((6-(2-hydroxy-4-((S)-2-oxopiperidin-4-yl)phenyl)pyridazin-3-yl)(methyl)amino)-8-azabicyclo[3.2.1]octane-8-carboxylate. Into a 25-mL round-bottom flask purged and maintained with an inert atmosphere of H2, was placed PENT-22A (700 mg, 1 equiv), MeOH (10 ml), PtO.sub.2 (250 mg). The resulting solution was stirred for 2 days at 45 C., and concentrated. This resulted in 600 mg (85.05%) of the title compound as a colorless oil. The residue was purified by Chiral-Prep-HPLC with the following conditions to provide the two title compounds as PENT-127A (110 mg, t.sub.R=9.2 min) and PENT-127B (100 mg, t.sub.R=13.2 min) as colorless oils. Chiral HPLC Purification Conditions: CHIRAL ART Cellulose-SB, 2*25 cm, 5 um; Mobile Phase A: Hexane-HPLC, Mobile Phase B: EtOH-HPLC; Flow rate: 25 mL/min; Gradient: 20% B to 20% B in 18 min; Detection wavelength 300/210 nm.

(522) Following the procedure above, but with PENT-22B (700 mg), gave the two title compounds as PENT-128A (110 mg, t.sub.R=8.0 min) and PENT-128B (100 mg, t.sub.R=9.0 min) as colorless oils.

(523) Step 4: Synthesis of (R)-4-(4-(6-(((1R,3S,5S)-6,6-difluoro-8-azabicyclo[3.2.1]octan-3-yl)(methyl)amino)pyridazin-3-yl)-3-hydroxyphenyl) piperidin-2-one and(S)-4-(4-(6-(((1R,3S,5S)-6,6-difluoro-8-azabicyclo[3.2.1]octan-3-yl)(methyl)amino)pyridazin-3-yl)-3-hydroxyphenyl) piperidin-2-one and(S)-4-(4-(6-(((1S,3R,5R)-6,6-difluoro-8-azabicyclo[3.2.1]octan-3-yl)(methyl)amino)pyridazin-3-yl)-3-hydroxyphenyl) piperidin-2-one and (R)-4-(4-(6-(((1S,3R,5R)-6,6-difluoro-8-azabicyclo[3.2.1]octan-3-yl)(methyl)amino)pyridazin-3-yl)-3-hydroxyphenyl) piperidin-2-one (Compounds 127A, Compound 127B, Compound 128A, and Compound 128B). Into a 8-mL vial, was placed PENT-127A (110 mg), HCl (gas) in 1,4-dioxane (5.0 mL). The resulting solution was stirred overnight at room temperature. The residue was dissolved in 5 mL of MeOH. The crude product was purified by Flash-Prep-HPLC with the following conditions (IntelFlash-1): Column, C18 silica gel; mobile phase, 5MMNH.sub.4HCO.sub.3/ACN=25 increasing to 5MMNH.sub.4HCO.sub.3/ACN=45 within 25 min; Detector, 254. This resulted in isolation of one of the 4 possible diastereomeric title compounds as a pure enantiomer as Compound 127A (58.2 mg) as an off-white solid. .sup.1H-NMR (400 MHZ, DMSO-d.sub.6) 13.36 (s, 1H), 8.21 (d, J=10.0 Hz, 1H), 7.73 (d, J=11.9 Hz, 1H), 7.29 (d, J=9.8 Hz, 1H), 5.09 (s, 1H), 3.62 (s, 1H), 3.50-3.36 (m, 2H), 3.30 (s, 1H), 2.97 (s, 3H), 2.86 (s, 4H), 2.46-2.37 (m, 2H), 2.37-2.27 (m, 2H), 2.00 (d, J=5.0 Hz, 3H), 1.81 (d, J=13.5 Hz, 2H), 1.68 (dd, J=11.8, 5.6 Hz, 1H). LCMS: m/z 620.

(524) Following the procedure above with PENT-127B (100 mg), gave Compound 127B (35.6 mg) as an off white solid. 1H-NMR (400 MHZ, DMSO-d.sub.6) 13.36 (s, 1H), 8.21 (d, J=10.0 Hz, 1H), 7.73 (d, J=11.9 Hz, 1H), 7.29 (d, J=9.8 Hz, 1H), 5.09 (s, 1H), 3.62 (s, 1H), 3.50-3.36 (m, 2H), 3.30 (s, 1H), 2.97 (s, 3H), 2.86 (s, 4H), 2.46-2.37 (m, 2H), 2.37-2.27 (m, 2H), 2.00 (d, J=5.0 Hz, 3H), 1.81 (d, J=13.5 Hz, 2H), 1.68 (dd, J=11.8, 5.6 Hz, 1H). LCMS: m/z 620.

(525) Following the procedure above with PENT-128A (110 mg), gave Compound 128A (53.2 mg) as an off white solid. 1H-NMR (400 MHZ, DMSO-d.sub.6) 13.36 (s, 1H), 8.21 (d, J=10.0 Hz, 1H), 7.73 (d, J=11.9 Hz, 1H), 7.29 (d, J=9.8 Hz, 1H), 5.09 (s, 1H), 3.62 (s, 1H), 3.50-3.36 (m, 2H), 3.30 (s, 1H), 2.97 (s, 3H), 2.86 (s, 4H), 2.46-2.37 (m, 2H), 2.37-2.27 (m, 2H), 2.00 (d, J=5.0 Hz, 3H), 1.81 (d, J=13.5 Hz, 2H), 1.68 (dd, J=11.8, 5.6 Hz, 1H). LCMS: m/z 620.

(526) Following the procedure above with PENT-128B (100 mg), gave Compound 128B (47.2 mg) as an off white solid. .sup.1H-NMR (400 MHZ, DMSO-d.sub.6) 13.36 (s, 1H), 8.21 (d, J=10.0 Hz, 1H), 7.73 (d, J=11.9 Hz, 1H), 7.29 (d, J=9.8 Hz, 1H), 5.09 (s, 1H), 3.62 (s, 1H), 3.50-3.36 (m, 2H), 3.30 (s, 1H), 2.97 (s, 3H), 2.86 (s, 4H), 2.46-2.37 (m, 2H), 2.37-2.27 (m, 2H), 2.00 (d, J=5.0 Hz, 3H), 1.81 (d, J=13.5 Hz, 2H), 1.68 (dd, J=11.8, 5.6 Hz, 1H). LCMS: m/z 620.

Example B16. Compounds of the Disclosure

(527) Table 14 shows additional compounds that were synthesized using the methods described above. In some cases, an SMSM provided herein can be designated by more than one SMSM # in different parts of the application; for example, the same compound can appear more than once in and Table 1A, Table 1C, Table 1E, Table 1G, or Table 1H, and Table 14, in the examples, and in the schemes.

(528) TABLE-US-00049 TABLE 14 List of compounds Chiral Re- tention time Syn- Inter- SM thesis MS med- SM Meth- (M + Chiral SFC iate (+)# Racemic Mixture od .sup.1H NMR H) Conditions (min) 1A/ 1B Compound 1A & Compound 1B F 1H NMR (300 MHz, DMSO-d6) 13.32 (s, 1H), 8.32 (d, J = 9.9 Hz, 1H), 7.94 (d, J = 12.4 Hz, 1H), 7.79 (d, J = 7.1 Hz, 1H), 7.41 (d, J = 9.9 Hz, 1H), 7.09 (d, J = 6.8 Hz, 1H), 6.59 (s, 1H), 6.46 (dd, J = 6.9, 2.1 Hz, 1H), 5.12 (s, 1H), 4.66 (d, J = 52.1 Hz, 1H), 3.56 (s, 2H), 3.47 (s, 3H), 3.06 (d, J = 1.8 Hz, 3H), 2.26 (t, J = 12.3 Hz, 1H), 1.79 (s, 2H), 1.70 (d, J = 12.6 Hz, 2H), 1.56 (d, J = 8.6 Hz, 1H). 454 Column: CHIRALPAK IA, 2 * 25 cm, 5 um; Mobile Phase A: CO2, Mobile Phase B: MeOH: DCM = 8:1; Flow rate: 40 mL/min; Gradient: 50% B; 220 nm; 4.01 4-(2-fluoro-4-(6- (((1S,2S,3R,5R)-2-fluoro-8- 1H NMR (300 MHz, 454 5.65 azabicyclo[3.2.1]octan-3- DMSO-d6) 13.33 (s, yl)(methyl)amino)pyridazin-3- 1H), 8.31 (d, J = 10.0 yl)-5-hydroxyphenyl)-1- Hz, 1H), 7.94 (d, J = methylpyridin-2(1H)-one 12.4 Hz, 1H), 7.79 (d, 4-(2-fluoro-4-(6- J = 7.1 Hz, 1H), 7.40 (((1R,2R,3S,5S)-2-fluoro-8- (d, J = 9.9 Hz, 1H), azabicyclo[3.2.1]octan-3- 7.09 (d, J = 6.9 Hz, yl)(methyl)amino)pyridazin-3- 1H), 6.59 (t, J = 1.7 yl)-5-hydroxyphenyl)-1- Hz, 1H), 6.45 (dt, methylpyridin-2(1H)-one J = 7.1, 1.9 Hz, 1H), 5.00 (s, 1H), 4.64 (d, J = 52.2 Hz, 1H), 3.53 (s, 2H), 3.47 (s, 3H), 3.05 (d, J = 1.8 Hz, 3H), 2.31-2.17 (m, 1H), 1.79 (s, 2H), 1.68 (d, J = 12.3 Hz, 2H), 1.55 (s, 1H). 2A/ 2B Compound 2A & 2B 2-(6-(((1S,3R,5R)-6,6-difluoro- T 1H NMR (400 MHz, DMSO-d6) 9.35 (s, 1H), 8.33 (d, J = 10.0 Hz, 1H), 8.05 (d, J = 8.3 Hz, 1H), 7.56 (s, 1H), 7.49 (d, 2H), 7.34 (d, J = 9.9 Hz, 1H), 5.12 (s, 2H), 4.08 (s, 3H), 3.64 (s, 1H), 3.46 (d, J = 13.7 Hz, 2H), 3.00 (s, 4H), 2.42-2.28 (m, 2H), 1.98-1.91 (m, 1H), 1.85-1.73 (m, 2H), 1.75-1.61 (m, 1H). 455 Instrument: SFC-80 (Thar, Waters) Column: OJ 20 * 250 mm, 10 um (Daicel) Column temperature: 35 C. Mobile phase: CO2/ MeOH (0.2% Methanol Ammonia) = 75/25 Flow rate: 80 g/min Back pressure: 100 bar 1.42 8-azabicyclo[3.2.1]octan-3- 1H NMR (400 MHz, 455 Detection 1.81 yl)(methyl)amino)pyridazin-3- DMSO-d6) 9.33 (s, wavelength: yl)-5-(6-methoxypyridazin-4- 1H), 8.36 (d, J = 9.7 214 nm yl)phenol Hz, 1H), 8.04 (d, J = Cycle time: 2-(6-(((1R,3S,5S)-6,6-difluoro- 8.5 Hz, 1H), 7.53 (s, 3.0 min 8-azabicyclo[3.2.1]octan-3- 1H), 7.45 (d, J = 15.0 Sample yl)(methyl)amino)pyridazin-3- Hz, 2H), 7.31 (d, J = solution: yl)-5-(6-methoxypyridazin-4- 9.6 Hz, 1H), 5.12 (s, 100 mg yl)phenol 1H), 4.08 (s, 3H), 3.63 dissolved in (s, 1H), 3.46-3.42 15 ml (m, 1H), 2.99 (s, 3H), Methanol 2.89 (s, 1H), 2.44- Injection 2.35 (m, 1H), 2.34- volume: 2.31 (m, 1H), 1.98- 1.0 ml 1.89 (m, 1H), 1.84- 1.72 (m, 2H), 1.75- 1.63 (m, 1H). 3A/ 3B Compound 3A & Compound 3B G 1H NMR (500 MHz, DMSO-d6) 8.22 (d, J = 10.1 Hz, 1H), 8.20 (s, 1H), 7.91 (s, 1H), 7.84 (d, J = 8.3 Hz, 1H), 7.30 (d, J = 9.9 Hz, 1H), 7.15-7.12 (m, 2H), 5.08-5.06 (m, 1H), 3.87 (s, 3H), 3.64-3.62 (m, 1H), 3.45-3.42 (m, 1H), 2.96 (s, 3H), 2.86 (s, 1H), 2.42-2.29 (m, 2H), 2.01-1.87 (m, 1H), 1.87-1.74 (m, 2H), 1.73-1.60 (m, 1H). 427 Instrument: SFC-80 (Thar, Waters) Column: OJ 20 * 250 mm, 10 um (Daicel) Column temperature: 35 C. Mobile phase: CO2/MeOH (0.2% Methanol Ammonia) = 75/25 Flow rate: 80 g/min Back pressure: 100 bar Detection wavelength: 1.63 2-(6-(((1S,3R,5R)-6,6-difluoro- 1H NMR (500 MHz, 427 285 nm 1.94 8-azabicyclo[3.2.1]octan-3- DMSO-d6) 8.22 (d, Cycle time: yl)(methyl)amino)pyridazin-3- J = 10.1 Hz, 1H), 8.20 4.5 min yl)-5-(1-methyl-1H-pyrazol-4- (s, 1H), 7.91 (s, 1H), Sample yl)phenol 7.84 (d, J = 8.3 Hz, solution: 2-(6-(((1R,3S,5S)-6,6-difluoro- 1H), 7.30 (d, J = 9.9 460 mg 8-azabicyclo[3.2.1]octan-3- Hz, 1H), 7.15-7.12 dissolved in yl)(methyl)amino)pyridazin-3- (m, 2H), 5.08-5.06 25 ml yl)-5-(1-methyl-1H-pyrazol-4- (m, 1H), 3.87 (s, 3H), Methanol yl)phenol 3.64-3.62 (m, 1H), Injection 3.45-3.42 (m, 1H), volume: 2.96 (s, 3H), 2.86 1.0 ml (s, 1H), 2.42-2.29 (m, 2H), 2.01-1.87 (m, 1H), 1.87-1.74 (m, 2H), 1.73-1.60 (m, 1H). 4A/ 4B 2-(6-(((1S,2S,3R,5R)-2-fluoro- L 1H NMR (500 MHz, DMSO-d6) 8.38 (d, J = 9.1 Hz, 1H), 8.30 (s, 1H), 8.00 (d, J = 8.3 Hz, 1H), 7.78 (s, 1H), 7.33 (d, J = 8.7 Hz, 1H), 7.19 (s, 1H), 7.09 (s, 2H), 5.18-4.95 (m, 1H), 4.74-4.51 (m, 1H), 3.52 (s, 2H), 3.03 (s, 3H), 2.37 (s, 1H), 2.28-2.16 (m, 1H), 1.85-1.59 (m, 4H), 1.58-1.46 (m, 1H). 395 Instrument: SFC-80 (Thar, Waters) Column: AD 20 * 250 mm, 10 um (Daicel) Column temperature: 35 C. Mobile phase: CO2/MEOH (0.2% Methanol Ammonia = 45/55 Flow rate: 80 g/min Back pressure: 1.16 8-azabicyclo[3.2.1]octan-3- 1H NMR (500 MHz, 395 100 bar 2.15 yl)(methyl)amino)pyridazin-3- DMSO-d6) 8.38 (d, Detection yl)-5-(1H-imidazol-1-yl)phenol J = 9.1 Hz, 1H), 8.30 wavelength: 2-(6-(((1R,2R,3S,5S)-2-fluoro- (s, 1H), 8.00 (d, J = 214 nm 8-azabicyclo[3.2.1]octan-3- 8.3 Hz, 1H), 7.78 (s, Cycle time: yl)(methyl)amino)pyridazin-3- 1H), 7.33 (d, J = 8.7 4.5 min yl)-5-(1H-imidazol-1-yl)phenol Hz, 1H), 7.19 (s, 1H), Sample 7.09 (s, 2H), 5.18- solution: 240 4.95 (m, 1H), 4.74- mg dissolved 4.51 (m, 1H), 3.52 in 20 ml (s, 2H), 3.03 (s, 3H), Methanol 2.37 (s, 1H), 2.28- Injection 2.16 (m, 1H), volume: 1.85-1.59 (m, 4H), 1.9 ml 1.58-1.46 (m, 1H). 5A/ 5B 2-(6-(((1S,2S,3R,5R)-2-fluoro- J 1H NMR (500 MHz, DMSO-d6) 8.30 (d, J = 10.5 Hz, 1H), 8.14 (s, 2H), 8.09 (d, J = 9.0 Hz, 1H), 7.59- 7.57 (m, 2H), 7.38 (d, J = 9.5 Hz, 1H), 5.78-5.68 (m, 1H), 4.77 (d, J = 54.0 Hz, 1H), 3.23-3.16 (m, 2H), 3.06 (d, J = 1.5 Hz, 3H), 2.43-2.36 (m, 2H), 1.91-1.84 (m, 3H), 1.73-1.58 (m, 4H). 410 nstrument: SFC-80 (Thar, Waters) Column: AD 20 * 250 mm, 10 um (Daicel) Column temperature: 35 C. Mobile phase: CO2/ MeOH (0.2% Methanol Ammonia) = 70/30 Flow rate: 80 g/min Back pressure: 1.6 9-azabicyclo[3.3.1]nonan-3- 1H NMR (500 MHz, 410 100 bar 4.81 yl)(methyl)amino)pyridazin-3- DMSO-d6) 8.30 (d, Detection yl)-5-(2H-1,2,3-triazol-2- J = 10.0 Hz, 1H), 8.14 wavelength: yl)phenol (s, 2H), 8.09 (d, J = 214 nm 2-(6-(((1R,2R,3S,5S)-2-fluoro- 9.5 Hz, 1H), 7.59- Cycle time: 9-azabicyclo[3.3.1]nonan-3- 7.57 (m, 2H), 7.38 4.5 min yl)(methyl)amino)pyridazin-3- (d, J = 10.0 Hz, Sample yl)-5-(2H-1,2,3-triazol-2- 1H), 5.80-5.65 (m, solution: 500 yl)phenol 1H), 4.77 (d, J = 51.0 mg dissolved Hz, 1H), 3.23-3.16 in 15 ml (m, 2H), 3.06 (s, 3H), Methanol 2.40-2.37 (m, 2H), Injection 1.91-1.85 (m, 3H), volume: 1.71-1.58 (m, 4H). 1.9 ml 6A/ 6A Compound 6A & 6B 2-(6-(((1S,2S,3R,5R)-2-fluoro- R 1H NMR (400 MHz, DMSO-d6) 11.45- 11.44 (m, 1H), 8.20 (d, J = 9.6 Hz, 1H), 8.07 (s, 1H), 7.59 (d, J = 7.2 Hz, 1H), 7.17 (d, J = 8.0 Hz, 1H), 6.90 (d, J = 7.8 Hz, 1H), 5.23-5.10 (m, 1H), 4.67-4.47 (m, 1H), 4.45 (t, J = 5.2 Hz, 1H), 3.52 (s, 3H), 3.39-3.37 (m, 2H), 3.00 (s, 3H), 2.25-2.18 (m, 1H), 1.75-1.51 (m, 2H), 1.70-1.65 (m, 2H), 1.58-1.25 (m, 1H) 386 Instrument: SFC-80 (Thar, Waters) Column: AD 20 * 250 mm, 10 um (Daicel) Column temperature: 35 C. Mobile phase: CO2/ MeOH (0.2% Methanol Ammonia) = 70/30 Flow rate: 80 g/min Back 2.07 8-azabicyclo[3.2.1]octan-3- pressure: yl)(methyl)amino)pyridazin-3- 1H NMR (400 MHz, 386 100 bar 1.05 yl)thieno[3,2-c]pyridin-4(5H)- DMSO-d6) 11.45- Detection one 11.44 (m, 1H), 8.20 wavelength: 2-(6-(((1R,2R,3S,5S)-2-fluoro- (d, J = 9.6 Hz, 1H), 214 nm 8-azabicyclo[3.2.1]octan-3- 8.07 (s, 1H), 7.59 (d, Cycle time: yl)(methyl)amino)pyridazin-3- J = 7.2 Hz, 1H), 7.17 3.5 min yl)thieno[3,2-c]pyridin-4(5H)- (d, J = 8.0 Hz, 1H), Sample one 6.90 (d, J = 7.8 Hz, solution: 1H), 5.23-5.10 (m, 10000 1H), 4.67-4.47 (m, mg 1H), 4.45 (t, J = 5.2 dissolved in Hz, 1H), 3.52 (s, 3H), 210 ml 3.39-3.37 (m, 2H), Methanol 3.00 (s, 3H), 2.25-2.18 Injection (m, 1H), 1.75-1.51 (m, volume: 2H), 1.70-1.65 (m, 1.9 ml 2H), 1.58-1.25 (m, 1H) 7A/ 7B 0 7-(6-(((1S,2S,3R,5R)-2-fluoro- N 1H NMR (500 MHz, DMSO-d6) 13.62 (s, 1H), 9.19 (s, 1H), 8.74 (s, 1H), 8.41 (d, J = 9.8 Hz, 1H), 8.35 (d, J = 5.8 Hz, 1H), 7.62 (d, J = 5.8 Hz, 1H), 7.48 (d, J = 9.9 Hz, 1H), 7.31 (s, 1H), 5.27-5.03 (m, 1H), 4.80-4.60 (m, 1H), 3.78-3.65 (m, 2H), 3.08 (s, 3H), 2.41- 2.29 (m, 1H), 1.95- 1.62 (m, 5H). 380 Instrument: SFC-200 (Thar, Waters) Column: AD 20 * 250 mm, 10 um (Daicel) Column temperature: 35 C. Mobile phase: CO2/MEOH (0.2% Methanol Ammonia) = 80/20 Flow rate: 2.07 8-azabicyclo[3.2.1]octan-3- 1H NMR (400 MHz, 380 120 1.05 yl)(methyl)amino)pyridazin-3- DMSO-d6) 9.18 (s, g/min yl)isoquinolin-6-ol 1H), 8.72 (s, 1H), 8.40 Back pressure: 7-(6-(((1R,2R,3S,5S)-2-fluoro- (d, J = 9.9 Hz, 1H), 100 bar 8-azabicyclo[3.2.1]octan-3- 8.34 (d, J = 5.8 Hz, Detection yl)(methyl)amino)pyridazin-3- 1H), 7.60 (d, J = 5.8 wavelength: yl)isoquinolin-6-ol Hz, 1H), 7.44 (d, J = 214 nm 9.9 Hz, 1H), 7.28 (s, Cycle time: 1H), 5.27-4.99 (m, 4.1 min 1H), 4.75-4.60 (m, Sample 1H), 3.61-3.48 (m, solution: 2H), 3.07 (s, 3H), 6000 mg 2.30-2.20 (m, 1H), dissolved in 1.90-1.49 (m, 5H). 110 ml MEOH Injection volume: 2 ml, 8A/ 8B 2-(6-(((1S,5S,6S,7R)-6-fluoro- Q 1H NMR (400 MHz, Methanol-d4) 8.38- 8.26 (m, 1H), 8.04 (s, 2H), 7.76 (d, J = 8.8 Hz, 1H), 7.63 (d, J = 10.0 Hz, 1H), 7.29- 7.26 (m, 1H), 7.23 (d, J = 1.6 Hz, 1H), 6.26- 6.09 (m, 1H), 5.47- 5.32 (m, 1H), 4.32 4.03 (m, 4H), 4.02- 3.93 (m, 1H), 3.84- 3.77 (m, 1H), 3.20 (s, 3H), 2.97-2.84 (m, 1H), 2.33-2.23 (m, 1H). 411 Instrument: SFC-80 (Thar, Waters) Column: IE 20 * 250 mm, 10 um (Daicel) Column temperature: 35 C. Mobile phase: CO2/IPA (0.2% Methanol Ammonia) = 75/25 Flow rate: 80 g/min Back pressure: 100 bar 0.774 3-oxa-9- 1H NMR (400 MHz, 411 Detection 2.17 azabicyclo[3.3.1]nonan-7- Methanol-d4) 8.38- wavelength: yl)(methyl)amino)pyridazin-3- 8.26 (m, 1H), 8.04 (s, 214 nm yl)-5-(1H-pyrazol-4-yl)phenol 2H), 7.76 (d, J = 8.8 Cycle time: 2-(6-(((1R,5R,6R,7S)-6-fluoro- Hz, 1H), 7.63 (d, J = 3.8 min 3-oxa-9- 10.0 Hz, 1H), 7.29- Sample azabicyclo[3.3.1]nonan-7- 7.26 (m, 1H), 7.23 (d, solution: 740 yl)(methyl)amino)pyridazin-3- J = 1.6 Hz, 1H), 6.26- mg dissolved yl)-5-(1H-pyrazol-4-yl)phenol 6.09 (m, 1H), 5.47- in 25 ml 5.32 (m, 1H), 4.32- Methanol 4.03 (m, 4H), 4.02- Injection 3.93 (m, 1H), 3.84- volume: 3.77 (m, 1H), 3.20 0.6 ml (s, 3H), 2.97-2.84 (m, 1H), 2.33-2.23 (m, 1H). 9A/ 9B 6-(6-(((1R,2R,3S,5S)-2-fluoro- S 1H NMR (300 MHz, Methanol-d4) 8.23~ 8.20 (d, J = 10.0 Hz, 1H), 8.03 (s, 1H), 7.36~7.28 (m, 2H), 7.19 (s, 1H), 5.39~ 5.20 (m, 1H), 4.67~ 4.62 (m, 1H), 3.69 (s, 2H), 3.39 (s, 3H), 3.21~3.09 (m, 6H), 2.41 (td, J = 12.9, 3.1 Hz, 1H), 2.05~ 1.86 (m, 4H), 1.73~ 1.63 (m, 1H). 440 CHIRALPAK IA, 2 * 25 cm, 5 um; Mobile Phase A: Hex (10 mM NH3-MeOH), Mobile Phase B: IPA- HPLC; Flow rate: 20 mL/min; Gradient: 30 B to 30 B in 50 min; 254/220 nm 18 8-azabicyclo[3.2.1]octan-3- 1H NMR (300 MHz, 440 10 yl)(methyl)amino)pyridazin-3- Methanol-d4) 8.23~ yl)-5-hydroxy-N,N- 8.20 (d, J = 9.9 Hz, dimethylbenzofuran-2- 1H), 8.04 (s, 1H), carboxamide 7.36~7.29 (m, 2H), 6-(6-(((1S,2S,3R,5R)-2-fluoro- 7.20 (s, 1H), 5.40~ 8-azabicyclo[3.2.1]octan-3- 5.19 (m, 1H), 4.68~ yl)(methyl)amino)pyridazin-3- 4.58 (m, 1H), 3.69 yl)-5-hydroxy-N,N- (s, 2H), 3.39 (s, 3H), dimethylbenzofuran-2- 3.19~3.10 (m, 6H), carboxamide 2.48~2.34 (td, J = 12.8, 3.2 Hz, 1H), 2.08~1.86 (m, 4H), 1.74~1.63 (m, 1H) 10A/ 10B 5-ethynyl-2-(6- Z 1H NMR (500 MHz, DMSO-d6) 13.58 (s, 1H), 8.24 (d, J = 10.0 Hz, 1H), 7.90 (d, J = 8.5 Hz, 1H), 7.38 (d, J = 9.5 Hz, 1H), 7.04- 7.01 (m, 2H), 5.09- 4.99 (m, 1H), 4.70- 4.56 (m, 1H), 4.25 (s, 1H), 3.52 (s, 2H), 3.04 (d, J = 1.2 Hz, 3H), 2.27-2.20 (m, 1H), 1.81-7.75 (m, 2H), 1.73-1.62 (m, 2H), 1.57-1.51 (m, 1H) 353 Instrument: SFC-150 (Thar, Waters) Column: SC 20 * 250 mm, 10 um (Regis) Column temperature: 35 C. Mobile phase: CO2/MEOH (0.2% Methanol Ammonia) = 60/40 Flow rate: 100 g/min 1.55 (((1S,2S,3R,5R)-2-fluoro-8- 1H NMR (500 MHz, 353 Back pressure: 2.3 azabicyclo[3.2.1]octan-3- DMSO-d6) 13.57 100 bar yl)(methyl)amino)pyridazin-3- (s, 1H), 8.24 (d, J = Detection yl)phenol 10.0 Hz, 1H), 7.90 (d, wavelength: 5-ethynyl-2-(6- J = 8.5 Hz, 1H), 7.39 214 nm (((1R,2R,3S,5S)-2-fluoro-8- (d, J = 10.2 Hz, 1H), Cycle time: azabicyclo[3.2.1]octan-3- 7.02 (d, J = 7.5 Hz, 3 min yl)(methyl)amino)pyridazin-3- 2H), 5.10-5.0 (m, 1H), Sample yl)phenol 4.71-4.61 (m, 1H), solution: 4.26 (s, 1H), 3.57 (s, 3000 mg 2H), 3.04 (d, J = 1.5 dissolved in Hz, 3H), 2.29-2.21 100 ml (m, 1H), 1.88-1.64 Methanol (m, 4H), 1.61-1.52 Injection (m, 1H). volume: 1 ml 11A/ 11B 2-(6-(((1S,2S,3R,5R)-2-fluoro- F 1H NMR (400 MHz, DMSO-d6) 8.40- 8.26 (m, 2H), 8.03 (d, J = 8.6 Hz, 1H), 7.85 (s, 1H), 7.39 (d, J = 9.9 Hz, 1H), 7.30 (d, J = 2.2 Hz, 1H), 7.28-7.24 (m, 1H), 7.11 (s, 1H), 5.93-5.53 (m, 1H), 4.90-4.41 (m, 1H), 3.24-3.13 (m, 2H), 3.06 (s, 3H), 2.42-2.37 (m, 1H), 1.94-1.57 (m, 7H). 409 Instrument: SFC-80 (Thar, Waters) Column: AD 20 * 250 mm, 10 um (Daicel) Column temperature: 35 C. Mobile phase: CO2/MEOH (0.2% Methanol Ammonia) = 50/50 Flow rate: 80 g/min Back pressure: 100 bar 1.19 9-azabicyclo[3.3.1]nonan-3- 1H NMR (400 MHz, 409 Detection 2.02 yl)(methyl)amino)pyridazin-3- DMSO-d6) 8.38- wavelength: yl)-5-(1H-imidazol-1-yl)phenol 8.27 (m, 2H), 8.03 214 nm 2-(6-(((1R,2R,3S,5S)-2-fluoro- (d, J = 8.6 Hz, 1H), Cycle time: 9-azabicyclo[3.3.1]nonan-3- 7.85 (s, 1H), 7.39 6 min yl)(methyl)amino)pyridazin-3- (d, J = 9.9 Hz, 1H), Sample yl)-5-(1H-imidazol-1-yl)phenol 7.31-7.24 (m, 2H), solution: 7.11 (s, 1H), 5.85- 200 mg 5.53 (m, 1H), 4.81- dissolved in 4.60 (m, 1H), 3.24- 25 ml 3.12 (m, 2H), 3.06 Methanol (s, 3H), 2.43-2.37 Injection (m, 1H), 1.97-1.48 volume: (m, 8H). 1.2 ml 12A/ 12B 2-(6-(ethyl((1S,2S,3R,5R)-2- F 1H NMR (500 MHz, DMSO-d6) 8.24 (s, 1H), 8.18 (d, J = 10.1 Hz, 1H), 7.99 (s, 1H), 7.82 (d, J = 8.1 Hz, 1H), 7.34 (d, J = 9.9 Hz, 1H), 7.23 (s, 1H), 7.21 (s, 1H), 5.06 (d, J = 25.3 Hz, 1H), 4.67 (d, J = 51.2 Hz, 1H), 3.67-3.49 (m, 4H), 2.32-2.19 (m, 1H), 1.92-1.79 (m, 2H), 1.81-1.60 (m, 3H), 1.17-1.07 (m, 3H). 409 Instrument: SFC-80 (Thar, Waters) Column: AD 20 * 250 mm, 10 um (Daicel) Column temperature: 35 C. Mobile phase: CO2/MeOH (0.2% Methanol Ammonia) = 60/40 Flow rate: 80 g/min Back pressure: 100 bar Detection wavelength: 1.66 fluoro-8- 1H NMR (500 MHz, 409 214 nm 3.18 azabicyclo[3.2.1]octan-3- DMSO-d6) 8.24 (s, Cycle time: yl)amino)pyridazin-3-yl)-5- 1H), 8.18 (d, J = 10.1 6.5 min (1H-pyrazol-4-yl)phenol Hz, 1H), 7.99 (s, 1H), Sample 2-(6-(ethyl((1R,2R,3S,5S)-2- 7.82 (d, J = 8.1 Hz, solution: 160 fluoro-8- 1H), 7.34 (d, J = 9.9 mg dissolved azabicyclo[3.2.1]octan-3- Hz, 1H), 7.23 (s, 1H), in 20 ml yl)amino)pyridazin-3-yl)-5- 7.21 (s, 1H), 5.06 (d, Methanol (1H-pyrazol-4-yl)phenol J = 25.3 Hz, 1H), Injection 4.67 (d, J = 51.2 Hz, volume: 1H), 3.67-3.49 (m, 1.9 ml 4H), 2.32-2.19 (m, 1H), 1.92-1.79 (m, 2H), 1.81-1.60 (m, 3H), 1.17-1.07 (m, 3H). 13A/ 13B 2-(6-(((1S,3R,5R)-6,6-difluoro- F 1H NMR (500 MHz, DMSO-d6) 8.36 (s, 1H), 8.29 (d, J = 10.0 Hz, 1H), 8.01 (d, J = 8.7 Hz, 1H), 7.84 (s, 1H), 7.34 (d, J = 9.9 Hz, 1H), 7.29 (d, J = 2.3 Hz, 1H), 7.25-7.22 (m, 1H), 7.11 (s, 1H), 5.10 (s, 1H), 3.64 (s, 1H), 3.46-3.43 (m, 1H), 2.99 (s, 3H), 2.89 (s, 1H), 2.45- 2.28 (m, 2H), 2.01- 1.89 (m, 1H), 1.87- 1.72 (m, 2H), 1.72- 1.62 (m, 1H). 413 Instrument: SFC-80 (Thar, Waters) Column: OJ 20 * 250 mm, 10 um (Daicel) Column temperature: 35 C. Mobile phase: CO2/MeOH (0.2% Methanol Ammonia) = 75/25 Flow rate: 100 g/min Back pressure: 100 bar 1.49 8-azabicyclo[3.2.1]octan-3- 1H NMR (500 MHz, 413 Detection 2.13 yl)(methyl)amino)pyridazin-3- DMSO-d6) 8.36 (s, wavelength: yl)-5-(1H-imidazol-1-yl)phenol 1H), 8.29 (d, J = 10.0 285 nm 2-(6-(((1R,3S,5S)-6,6-difluoro- Hz, 1H), 8.01 (d, J = Cycle time: 8-azabicyclo[3.2.1]octan-3- 8.7 Hz, 1H), 7.84 (s, 4.0 min yl)(methyl)amino)pyridazin-3- 1H), 7.34 (d, J = 9.9 Sample yl)-5-(1H-imidazol-1-yl)phenol Hz, 1H), 7.29 (d, J = solution: 2.3 Hz, 1H), 7.25- 390 mg 7.22 (m, 1H), 7.11 dissolved in (s, 1H), 5.10 (s, 1H), 28 ml 3.64 (s, 1H), 3.46-3.43 Methanol (m, 1H), 2.99 (s, 3H), Injection 2.89 (s, 1H), 2.45-2.28 volume: (m, 2H), 2.01-1.89 1.0 ml (m, 1H), 1.87-1.72 (m, 2H), 1.72-1.62 (m, 1H). 14A/ 14B 2-(6-(((1S,2R,3R,5R)-2-fluoro- F 1H NMR (400 MHz, Methanol-d4) 8.14 (d, J = 10.0 Hz, 1H), 8.02 (s, 1H), 7.86 (s, 1H), 7.77 (d, J = 8.9 Hz, 1H), 7.37 (d, J = 9.9 Hz, 1H), 7.26- 7.05 (m, 2H), 5.79 (s, 1H), 5.35-5.05 (m, 1H), 3.96 (s, 3H), 3.76-3.60 (m, 1H), 3.58-3.44 (m, 1H), 3.11 (s, 3H), 2.37- 2.24 (m, 1H), 2.22- 2.12 (m, 2H), 2.08- 2.02 (m, 1H), 2.05- 1.79 (m, 4H). 423 Instrument: SFC-80 (Thar, Waters) Column: OD 20 * 250 mm, 10 um (Daicel) Column temperature: 35 C. Mobile phase: CO2/MEOH (0.2% Methanol Ammonia) = 65/35 Flow rate: 80 g/min Back pressure: 100 bar Detection 1.36 9-azabicyclo[3.3.1]nonan-3- 1H NMR (400 MHz, 423 wavelength: 1.82 yl)(methyl)amino)pyridazin-3- Methanol-d4) 8.11 214 nm yl)-5-(1-methyl-1H-pyrazol-4- (d, J = 10.0 Hz, 1H), Cycle time: yl)phenol 8.01 (s, 1H), 7.86 (d, 8 min 2-(6-(((1R,2S,3S,5S)-2-fluoro- J = 0.6 Hz, 1H), 7.75 Sample 9-azabicyclo[3.3.1]nonan-3- (d, 1H), 7.34 (d, J = solution: yl)(methyl)amino)pyridazin-3- 9.9 Hz, 1H), 7.19-7.10 200 mg yl)-5-(1-methyl-1H-pyrazol-4- (m, 2H), 5.84-5.57 dissolved in yl)phenol (m, 1H), 5.16-4.96 25 ml (m, 1H), 3.95 (s, 3H), Methanol 3.49-3.40 (m, 1H), Injection 3.29-3.19 (m, 1H), volume: 3.10 (s, 3H), 2.26- 4.5 ml 2.15 (m, 1H), 2.13- 2.04 (m, 2H), 2.04- 1.92 (m, 2H), 1.91- 1.74 (m, 3H). 15A/ 15B 2-(6-(((1S,2S,3R,5R)-2-fluoro- F 1H NMR (400 MHz, DMSO-d6) 13.70 (s, 1H), 8.30-8.16 (m, 2H), 7.98-7.82 (m, 2H), 7.35 (d, J = 9.9 Hz, 1H), 7.22-7.08 (m, 2H), 5.83-5.60 (m, 1H), 4.81-4.59 (m, 1H), 3.87 (s, 3H), 3.25-3.13 (m, 2H), 3.03 (s, 3H), 2.42- 2.31 (m, 1H), 1.93- 1.54 (m, 8H). 423 Instrument: SFC-80 (Thar, Waters) Column: AD 20 * 250 mm, 10 um (Daicel) Column temperature: 35 C. Mobile phase: CO2/ MeOH (0.2% Methanol Ammonia) = 30/70 Flow rate: 80 g/min Back pressure: 100 bar Detection 1.54 9-azabicyclo[3.3.1]nonan-3- 1H NMR (400 MHz, 423 wavelength: 3.76 yl)(methyl)amino)pyridazin-3- DMSO-d6) 13.69 214 nm yl)-5-(1-methyl-1H-pyrazol-4- (s, 1H), 8.32-8.15 (m, Cycle time: yl)phenol 2H), 7.96-7.81 (m, 8 min 2-(6-(((1R,2R,3S,5S)-2-fluoro- 2H), 7.40-7.30 (m, Sample 9-azabicyclo[3.3.1]nonan-3- 1H), 7.20-7.07 (m, solution: yl)(methyl)amino)pyridazin-3- 2H), 5.81-5.55 (m, 400 mg yl)-5-(1-methyl-1H-pyrazol-4- 1H), 4.85-4.57 (m, dissolved in yl)phenol 1H), 3.87 (s, 3H), 20 ml 3.25-3.13 (m, 2H), Methanol 3.05 (s, 3H), 2.42- Injection 2.32 (m, 1H), 1.93- volume: 1.58 (m, 8H). 4.5 ml 16A/ 16B 2-(6-(((1S,2S,3R,5R)-2-fluoro- F 1H NMR (400 MHz, DMSO-d6) 13.53 (s, 1H), 8.29 (d, J = 9.9 Hz, 1H), 8.03 (d, J = 8.3 Hz, 1H), 7.50-7.43 (m, 2H), 7.37 (d, J = 9.9 Hz, 1H), 7.02 (d, J = 1.0 Hz, 1H), 5.79-5.72 (m, 1H), 4.82-4.64 (m, 1H), 3.57 (s, 1H), 3.20 (d, J = 28.2 Hz, 2H), 3.06 (s, 3H), 2.42 (d, J = 13.9 Hz, 4H), 1.96-1.56 (m, 7H). 424 Instrument: SFC-80 (Thar, Waters) Column: AD 20 * 250 mm, 10 um (Daicel) Column temperature: 35 C. Mobile phase: CO2/MeOH (0.2% Methanol Ammonia) = 45/55 Flow rate: 75 g/min Back pressure: 100 bar Detection wavelength: 214 nm 0.829 9-azabicyclo[3.3.1]nonan-3- 1H NMR (400 MHz, 424 Cycle time: 2.9 yl)(methyl)amino)pyridazin-3- DMSO-d6) 13.53 12.5 min yl)-5-(5-methyloxazol-2- (s, 1H), 8.29 Sample yl)phenol (d, J = 9.9 Hz, 1H), solution: 2-(6-(((1R,2R,3S,5S)-2-fluoro- 8.03 (d, J = 8.3 Hz, 450 mg 9-azabicyclo[3.3.1]nonan-3- 1H), 7.53-7.42 (m, dissolved in yl)(methyl)amino)pyridazin-3- 2H), 7.37 (d, J = 9.9 15 ml yl)-5-(5-methyloxazol-2- Hz, 1H), 7.02 (d, J = Methanol yl)phenol 1.1 Hz, 1H), 5.81-5.70 Injection (m, 1H), 4.82-4.62 volume: (m, 1H), 3.57 (s, 1H), 1.9 ml 3.20 (d, J = 27.4 Hz, 2H), 3.06 (s, 3H), 2.40 (d, J = 0.9 Hz, 3H), 1.95-1.52 (m, 7H). 17A/ 17B 0 4-(2-fluoro-4-(6- (((1S,2S,3R,5R)-2-fluoro-8- azabicyclo[3.2.1]octan-3- F 1H NMR (400 MHz, DMSO-d6) 13.44 (s, 1H), 8.33 (d, J = 9.7 Hz, 1H), 8.00 (d, J = 12.6 Hz, 1H), 7.88 (d, J = 5.2 Hz, 1H), 7.41 (d, J = 9.9 Hz, 1H), 7.21 (d, J = 6.5 Hz, 1H), 6.75 (d, J = 4.3 Hz, 1H), 6.60 (s, 1H), 5.18-4.97 (m, 1H), 4.71-4.58 (m, 1H), 3.58-3.51 (m, 2H), 3.05 (s, 3H), 2.30- 2.18 (m, 1H), 1.87- 1.61 (m, 4H), 1.59- 1.50 (m, 1H). 441 Instrument: Gilson-281 Column: IE 20 * 250, 10 um Mobile Phase: ACN (0.1% DEA):MEOH (0.1% DEA) = 6:4 Flow Rate: 50 ml/min Run time per injection: 35 min Injection: 4 ml Sample solution: 82 mg in 20 mL DCM 5.99 yl)(methyl)amino)pyridazin-3- 1H NMR (400 MHz, 441 9.05 yl)-5-hydroxyphenyl)-2H- DMSO-d6) 13.44 (s, pyran-2-one 1H), 8.33 (d, J = 9.7 4-(2-fluoro-4-(6- Hz, 1H), 8.00 (d, J = (((1R,2R,3S,5S)-2-fluoro-8- 12.6 Hz, 1H), 7.88 (d, azabicyclo[3.2.1]octan-3- J = 5.2 Hz, 1H), 7.41 yl)(methyl)amino)pyridazin-3- (d, J = 9.9 Hz, 1H), yl)-5-hydroxyphenyl)-2H- 7.21 (d, J = 6.5 Hz, pyran-2-one 1H), 6.75 (d, J = 4.3 Hz, 1H), 6.60 (s, 1H), 5.18-4.97 (m, 1H), 4.71-4.58 (m, 1H), 3.58-3.51 (m, 2H), 3.05 (s, 3H), 2.30- 2.18 (m, 1H), 1.87- 1.61 (m, 4H), 1.59-1.50 (m, 1H). 18A/ 18B 2-(6-(((1S,3R,5R)-6,6-difluoro- F 1H NMR (400 MHz, DMSO-d6) 14.17 (s, 1H), 8.41-8.13 (m, 2H), 7.98 (d, J = 8.7 Hz, 1H), 7.53 (s, 1H), 7.33 (d, J = 9.9 Hz, 1H), 7.26-7.17 (m, 2H), 5.21-4.93 (m, 1H), 3.64 (s, 1H), 3.49-3.39 (m, 1H), 2.98 (s, 3H), 2.89 (s, 1H), 2.58-2.53 (m, 2H), 2.42-2.27 (m, 2H), 1.99-1.58 (m, 4H), 1.20 (t, J = 7.5 Hz, 3H). 441 Instrument: SFC-80 (Thar, Waters) Column: OJ 20 * 250 mm, 10 um (Daicel) Column temperature: 35 C. Mobile phase: CO2/ETOH (0.5% Methanol Ammonia) = 80/20 Flow rate: 80 g/min Back pressure: 100 bar Detection wavelength: 254 nm 1.92 8-azabicyclo[3.2.1]octan-3- 1H NMR (400 MHz, 441 Cycle time: 2.65 yl)(methyl)amino)pyridazin-3- DMSO-d6) 14.17 (s, 4.0 min yl)-5-(4-ethyl-1H-imidazol-1- 1H), 8.41-8.13 Sample yl)phenol (m, 2H), 7.98 (d, solution: 2-(6-(((1R,3S,5S)-6,6-difluoro- J = 8.7 Hz, 1H), 7.5 300 mg 8-azabicyclo[3.2.1]octan-3- 3(s, 1H), 7.33 (d, J = dissolved in yl)(methyl)amino)pyridazin-3- 9.9 Hz, 1H), 7.26- 20 ml yl)-5-(4-ethyl-1H-imidazol-1- 7.17 (m, 2H), 5.21- Methanol yl)phenol 4.93 (m, 1H), 3.64 (s, Injection 1H), 3.49-3.39 (m, volume: 1H), 2.98 (s, 3H), 1.0 ml 2.89 (s, 1H), 2.58-2.53 (m, 2H), 2.42-2.27 (m, 2H), 1.99-1.58 (m, 4H), 1.20 (t, J = 7.5 Hz, 3H). 19A/ 19B 2-(6-(((1S,3R,5R)-6,6-difluoro- F 1H NMR (400 MHz, DMSO-d6) 14.20 (s, 1H), 8.28 (d, J = 10.0 Hz, 1H), 8.07 (d, J = 1.5 Hz, 1H), 7.98 (d, J = 8.7 Hz, 1H), 7.33 (d, J = 9.9 Hz, 1H), 7.27-7.14 (m, 3H), 5.09 (s, 2H), 3.75 (s, 3H), 3.64 (s, 1H), 3.48-3.42 (m, 1H), 2.98 (s, 3H), 2.88 (s, 1H), 2.43-2.30 (m, 2H), 1.99-1.64 (m, 4H). 443 Instrument: SFC-80 (Thar, Waters) Column: OJ 20 * 250 mm, 10 um (Daicel) Column temperature: 35 C. Mobile phase: CO2/ MeOH (0.2% Methanol Ammonia) = 75/25 Flow rate: 80 g/min Back pressure: 100 bar Detection wavelength: 214 nm Cycle time: 1.07 8-azabicyclo[3.2.1]octan-3- 1H NMR (400 MHz, 443 4.2 min 1.37 yl)(methyl)amino)pyridazin-3- DMSO-d6) 14.20 (s, Sample yl)-5-(4-methoxy-1H-imidazol- 1H), 8.28 (d, J = 10.0 solution: 1-yl)phenol Hz, 1H), 8.07 (d, J = 300 mg 2-(6-(((1R,3S,5S)-6,6-difluoro- 1.5 Hz, 1H), 7.98 (d, dissolved in 8-azabicyclo[3.2.1]octan-3- J = 8.7 Hz, 1H), 7.33 30 ml yl)(methyl)amino)pyridazin-3- (d, J = 9.9 Hz, 1H), Methanol yl)-5-(4-methoxy-1H-imidazol- 7.27-7.14 (m, 3H), Injection 1-yl)phenol 5.09 (s, 2H), 3.75 volume: (s, 3H), 3.64 (s, 1H), 1.0 ml 3.48-3.42 (m, 1H), 2.98 (s, 3H), 2.88 (s, 1H), 2.43-2.30 (m, 2H), 1.99-1.64 (m, 4H). 20A/ 20B 5-(1-(difluoromethyl)-1H- F 1H NMR (500 MHz, DMSO-d6) 13.80 (s, 1H), 8.79 (s, 1H), 8.34 (s, 1H), 8.29 (d, J = 9.9 Hz, 1H), 7.98- 7.66 (m, 2H), 7.39 (d, J = 9.9 Hz, 1H), 7.32 (s, 1H), 7.28 (d, J = 8.1 Hz, 1H), 5.14-4.92 (m, 1H), 4.72-4.52 (m, 1H), 3.53 (s, 2H), 3.04 (s, 3H), 2.38 (s, 1H), 2.29-2.16 (m, 1H), 1.85-1.61 (m, 4H), 1.59-1.50 (m, 1H). 445 Instrument: SFC-80 (Thar, Waters) Column: AD 20 * 250 mm, 10 um (Daicel) Column temperature: 35 C. Mobile phase: CO2/ MeOH (0.2% Methanol Ammonia) = 60/40 Flow rate: 80 g/min Back pressure: 100 bar 1.15 pyrazol-4-yl)-2-(6- 1H NMR (500 MHz, 445 Detection 1.99 (((1S,2S,3R,5R)-2-fluoro-8- DMSO-d6) 13.80 (s, wavelength: azabicyclo[3.2.1]octan-3- 1H), 8.79 (s, 1H), 214 nm yl)(methyl)amino)pyridazin-3- 8.34 (s, 1H), 8.29 (d, Cycle time: yl)phenol J = 9.9 Hz, 1H), 7.98- 5.6 min 5-(1-(difluoromethyl)-1H- 7.66 (m, 2H), 7.39 Sample pyrazol-4-yl)-2-(6- (d, J = 9.9 Hz, 1H), solution: 300 (((1R,2R,3S,5S)-2-fluoro-8- 7.32 (s, 1H), 7.28 mg dissolved azabicyclo[3.2.1]octan-3- (d, J = 8.1 Hz, 1H), in 35 ml yl)(methyl)amino) pyridazin-3- 5.14-4.92 (m, 1H), Methanol yl)phenol 4.72-4.52 (m, 1H), Injection 3.53 (s, 2H), 3.04 (s, volume: 3H), 2.38 (s, 1H), 2.0 ml 2.29-2.16 (m, 1H), 1.85-1.61 (m, 4H), 1.59-1.50 (m, 1H). 21A/ 21B 5-(1-(difluoromethyl)-1H- F 1H NMR (400 MHz, DMSO-d6) 8.79 (s, 1H), 8.37-8.25 (m, 2H), 8.02-7.66 (m, 2H), 7.40-7.27 (m, 3H), 5.90-5.53 (m, 1H), 4.88-4.50 (m, 1H), 3.27-3.15 (m, 2H), 3.06 (d, J = 1.5 Hz, 3H), 2.45-2.32 (m, 1H), 1.94-1.56 (m, 7H). 459 Instrument: SFC-80 (Thar, Waters) Column: AD 20 * 250 mm, 10 um (Daicel) Column temperature: 35 C. Mobile phase: CO2/ MeOH (0.2% Methanol Ammonia) = 50/50 Flow rate: 80 g/min Back pressure: 100 bar 1.55 pyrazol-4-yl)-2-(6- 1H NMR (400 MHz, 459 Detection 3.25 (((1S,2S,3R,5R)-2-fluoro-9- DMSO-d6) 8.80 (s, wavelength: azabicyclo[3.3.1]nonan-3- 1H), 8.37-8.25 (m, 285 nm yl)(methyl)amino)pyridazin-3- 2H), 8.04-7.66 (m, Cycle time: yl)phenol 2H), 7.39-7.26 (m, 3.0 min 5-(1-(difluoromethyl)-1H- 3H), 5.81-5.60 (m, Sample pyrazol-4-yl)-2-(6-(1R, 1H), 4.84-4.61 (m, solution: 2R,3S,5S)-2-fluoro-9- 1H), 3.29-3.13 (m, 200 mg azabicyclo[3.3.1]nonan-3- 2H), 3.06 (s, 3H), dissolved in yl)(methyl)amino)pyridazin-3- 2.44-2.34 (m, 1H), 25 ml yl)phenol 1.97-1.53 (m, 7H). Methanol Injection volume: 1.5 ml 22A/ 22B 4-(4-(6-(((1S,3R,5R)-6,6- F 1H NMR (300 MHz, Chloroform-d) 7.78 (d, J = 9.9 Hz, 1H), 7.41-7.31 (m, 2H), 7.14 (d, J = 6.8 Hz, 1H), 7.04 (d, J = 9.8 Hz, 1H), 6.87 (s, 1H), 6.44 (d, J = 7.0 Hz, 1H), 5.15 (s, 1H), 3.82 (s, 1H), 3.61 (s, 4H), 3.09 (s, 3H), 2.49 (q, J = 16.1, 12.7 Hz, 2H), 2.16-1.92 (m, 2H), 1.88 (d, J = 17.1 Hz, 1H), 1.74 (s, 1H). 472 Column: CHIRALPAK AD-3, 0.3 * 10 cm, 3.0 um; Mobile Phase A: CO2, Mobile Phase B: IPA (10 mM NH3); Flow rate: 2.0 ml/min; Gradient: 10% B to 50% B in 4 min; 220 nm 3.04 difluoro-8- 1H NMR (300 MHz, 472 3.35 azabicyclo[3.2.1]octan-3- DMSO-d6) 8.30 (d, yl)(methyl)amino)pyridazin-3- J = 10.0 Hz, 1H), 7.91 yl)-2-fluoro-5-hydroxyphenyl)- (d, J = 12.5 Hz, 1H), 1-methylpyridin-2(1H)-one 7.78 (d, J = 7.1 Hz, 4-(4-(6-(((1R,3S,5S)-6,6- 1H), 7.31 (d, J = 10.0 difluoro-8- Hz, 1H), 7.08 (d, J = azabicyclo[3.2.1]octan-3- 6.9 Hz, 1H), 6.58 (s, yl)(methyl)amino)pyridazin-3- 1H), 6.49-6.40 (m, yl)-2-fluoro-5-hydroxyphenyl)- 1H), 5.13 (s, 1H), 3.64 1-methylpyridin-2(1H)-one (s, 1H), 3.47 (s, 3H), 3.42 (s, 1H), 2.99 (s, 3H), 2.89 (s, 1H), 2.44- 2.28 (m, 2H), 1.91 (d, J = 12.7 Hz, 1H), 1.80 (s, 1H), 1.71 (s, 1H). 23A/ 23B 2-(6-(((1S,2S,3R,5R)-2-fluoro- K 1H NMR (400 MHz, DMSO-d6) 13.37 (s, 1H), 8.72-8.64 (m, 1H), 8.36 (d, J = 9.9 Hz, 1H), 8.06-7.98 (m, 2H), 7.95-7.85 (m, 1H), 7.69 (s, 2H), 7.44 (d, J = 9.8 Hz, 1H), 7.42-7.35 (m, 1H), 5.94-5.66 (m, 1H), 5.19-4.96 (m, 1H), 3.84-3.71 (m, 1H), 3.71-3.60 (m, 1H), 3.07 (s, 3H), 2.72-2.58 (m, 1H), 2.16-1.67 (m, 7H). 420 Instrument: SFC-200 (Thar, Waters) Column: AD 50 * 250 mm, 10 um (Daicel) Column temperature: 35 C. Mobile phase: CO2/ETOH (1% Methanol Ammonia) = 65/35 Flow rate: 120 g/min Back pressure: 100 bar Detection 0.83 9-azabicyclo[3.3.1]nonan-3- 1H NMR (400 MHz, 420 wavelength: 1.61 yl)(methyl)amino)pyridazin-3- DMSO-d6) 13.37 (s, 214 nm yl)-5-(pyridin-2-yl)phenol 1H), 8.72-8.64 (m, Cycle time: 2-(6-(((1R,2R,3S,5S)-2-fluoro- 1H), 8.36 (d, J = 9.9 5.7 min 9-azabicyclo[3.3.1]nonan-3- Hz, 1H), 8.06-7.98 Sample yl)(methyl)amino)pyridazin-3- (m, 2H), 7.95-7.85 solution: yl)-5-(pyridin-2-yl)phenol (m, 1H), 7.69 (s, 2H), 3000 mg 7.44 (d, J = 9.8 Hz, dissolved in 1H), 7.42-7.35 (m, 80 ml MeOH 1H), 5.94-5.66 (m, Injection 1H), 5.19-4.96 (m, volume: 1H), 3.84-3.71 (m, 3.5 ml 1H), 3.71-3.60 (m, 1H), 3.07 (s, 3H), 2.72-2.58 (m, 1H), 2.16-1.67 (m, 7H). 24A/ 24B 2-(6-(((1S,2S,3R,5R)-2-fluoro- K 1H NMR (400 MHz, DMSO-d6) 13.63 (s, 1H), 9.31 (d, J = 1.4 Hz, 1H), 8.78-8.71 (m, 1H), 8.63 (d, J = 2.4 Hz, 1H), 8.35 (d, J = 10.0 Hz, 1H), 8.07 (d, J = 8.9 Hz, 1H), 7.76-7.74 (m, 2H), 7.39 (d, J = 9.9 Hz, 1H), 5.96-5.47 (m, 1H), 4.96-4.58 (m, 1H), 3.27-3.18 (m, 2H), 3.07 (d, J = 1.4 Hz, 3H), 2.44-2.39 (m, 1H), 2.01-1.57 (m, 7H). 421 Instrument: SFC-80 (Thar, Waters) Column: AD 20 * 250 mm, 10 um (Daicel) Column temperature: 35 C. Mobile phase: CO2/MEOH/ ACN (0.2% Methanol Ammonia) = 40/30/30 Flow rate: 80 g/min Back pressure: 100 bar 0.54 9-azabicyclo[3.3.1]nonan-3- 1H NMR (500 MHz, 421 Detection 2.1 yl)(methyl)amino)pyridazin-3- DMSO-d6) 13.63 (s, wavelength: yl)-5-(pyrazin-2-yl)phenol 1H), 9.31 (s, 1H), 280 nm 2-(6-(((1R,2R,3S,5S)-2-fluoro- 8.78-8.57 (m, 2H), Cycle time: 9-azabicyclo[3.3.1]nonan-3- 8.34 (d, J = 9.9 Hz, 15 min yl)(methyl)amino)pyridazin-3- 1H), 8.07 (d, J = 8.4 Sample yl)-5-(pyrazin-2-yl)phenol Hz, 1H), 7.76-7.74 solution: (m, 2H), 7.39 (d, J = 1570 mg 9.9 Hz, 1H), 5.80- dissolved in 5.68 (m, 1H), 4.79- 25 ml 4.62 (m, 1H), 3.26- Methanol 3.15 (m, 2H), 3.07 Injection (s, 3H), 2.42-2.39 volume: 4 ml (m, 1H), 1.92-1.58 (m, 7H). 25A/ 25B 2-(6-(((1R,2R,3S,5S)-2-fluoro- K 1H NMR (400 MHz, DMSO-d6) 13.61 (s, 1H), 8.33 (d, J = 10.0 Hz, 1H), 8.18 (d, J = 8.8 Hz, 1H), 8.07 (d, J = 9.0 Hz, 1H), 7.75- 7.69 (m, 2H), 7.66 (d, J = 8.8 Hz, 1H), 7.42 (d, J = 10.0 Hz, 1H), 5.21-4.93 (m, 1H), 4.69 (d, J = 51.9 Hz, 1H), 3.67-3.53 (m, 2H), 3.06 (d, J = 1.5 Hz, 3H), 2.67 (s, 3H), 2.30-2.20 (m, 1H), 1.93-1.52 (m, 5H). 421 Instrument: SFC-200 (Thar, Waters) Column: AD 20 * 250 mm, 10 um (Daicel) Column temperature: 35 C. Mobile phase: CO2/MEOH (0.2% Methanol Ammonia) = 80/20 Flow rate: 120 g/min Back pressure: 100 bar 1.05 8-azabicyclo[3.2.1]octan-3- 1H NMR (400 MHz, 421 Detection 2.07 yl)(methyl)amino)pyridazin-3- DMSO-d6) 13.62 (s, wavelength: yl)-5-(6-methylpyridazin-3- 1H), 8.32 (d, J = 10.1 214 nm yl)phenol Hz, 1H), 8.18 (d, J = Cycle time: 2-(6-(((1S,2S,3R,5R)-2-fluoro- 8.8 Hz, 1H), 8.07 (d, 4.1 min 8-azabicyclo[3.2.1]octan-3- J = 8.9 Hz, 1H), 7.79- Sample yl)(methyl)amino)pyridazin-3- 7.69 (m, 2H), 7.66 (d, solution: yl)-5-(6-methylpyridazin-3- J = 8.8 Hz, 1H), 7.42 6000 mg yl)phenol (d, J = 9.9 Hz, 1H), dissolved in 5.20-4.97 (m, 1H), 110 ml 4.67 (d, J = 51.5 Hz, MEOH 1H), 3.64-3.51 (m, Injection 2H), 3.06 (d, J = 1.4 volume: 2 ml Hz, 3H), 2.67 (s, 3H), 2.32-2.21 (m, 1H), 1.89-1.50 (m, 5H). 26A/ 26B 2-(6-(((1S,2S,3R,5R)-2-fluoro- K 1H NMR (500 MHz, DMSO-d6) 13.59 (s, 1H), 9.16 (d, J = 1.4 Hz, 1H), 8.62 (s, 1H), 8.32 (d, J = 9.9 Hz, 1H), 8.04 (d, J = 8.5 Hz, 1H), 7.69 (d, J = 7.0 Hz, 2H), 7.38 (d, J = 9.9 Hz, 1H), 5.86- 5.60 (m, 1H), 4.84- 4.64 (m, 1H), 3.26- 3.13 (m, 2H), 3.07 (d, J = 1.7 Hz, 3H), 2.55 (s, 3H), 2.45-2.27 (m, 2H), 1.99-1.50 (m, 8H). 435 Instrument: SFC-80 (Thar, Waters) Column: AD 20 * 250 mm, 10 um (Daicel) Column temperature: 35 C. Mobile phase: CO2/MEOH/ ACN (0.2% Methanol Ammonia) = 40/30/30 Flow rate: 80 g/min Back pressure: 100 bar 0.54 9-azabicyclo[3.3.1]nonan-3- 1H NMR (500 MHz, 435 Detection 2.1 yl)(methyl)amino)pyridazin-3- DMSO-d6) 13.59 (s, wavelength: yl)-5-(5-methylpyrazin-2- 1H), 9.16 (d, J = 1.4 280 nm yl)phenol Hz, 1H), 8.62 (s, 1H), Cycle time: 2-(6-(((1R,2R,3S,5S)-2-fluoro- 8.32 (d, J = 9.9 Hz, 15 min 9-azabicyclo[3.3.1]nonan-3- 1H), 8.04 (d, J = 8.5 Sample yl)(methyl)amino)pyridazin-3- Hz, 1H), 7.69 (d, J = solution: yl)-5-(5-methylpyrazin-2- 7.0 Hz, 2H), 7.38 (d, 1570 mg yl)phenol J = 9.9 Hz, 1H), 5.86- dissolved in 5.60 (m, 1H), 4.84- 25 ml 4.64 (m, 1H), 3.26- Methanol 3.13 (m, 2H), 3.07 (d, Injection J = 1.7 Hz, 3H), 2.55 volume: 4 ml (s, 3H), 2.45-2.27 (m, 2H), 1.99-1.50 (m, 8H). 27A/ 27B 0 2-(6-(((1S,2S,3R,5R)-2-fluoro- K 1H NMR (500 MHz, DMSO-d6) 13.59 (s, 1H), 8.34 (d, J = 9.9 Hz, 1H), 8.18 (d, J = 8.8 Hz, 1H), 8.07 (d, J = 8.8 Hz, 1H), 7.72 (d, J = 7.4 Hz, 2H), 7.65 (d, J = 8.8 Hz, 1H), 7.39 (d, J = 9.9 Hz, 1H), 5.82-5.65 (m, 1H), 4.84-4.61 (m, 1H), 3.25-3.14 (m, 2H), 3.07 (s, 3H), 2.67 (s, 3H), 2.42-2.36 (m, 1H), 1.93-1.56 (m, 7H). 435 Instrument: SFC-80 (Thar, Waters) Column: AD 20 * 250 mm, 10 um (Daicel) Column temperature: 35 C. Mobile phase: CO2/MEOH/ ACN (0.2% Methanol Ammonia) = 40/30/30 Flow rate: 80 g/min Back pressure: 100 bar 0.54 9-azabicyclo[3.3.1]nonan-3- 1H NMR (400 MHz, 435 Detection 2.1 yl)(methyl)amino)pyridazin-3- DMSO-d6) 13.59 (s, wavelength: yl)-5-(6-methylpyridazin-3- 1H), 8.33 (d, J = 9.9 280 nm yl)phenol Hz, 1H), 8.18 (d, J = Cycle time: 2-(6-(((1R,2R,3S,5S)-2-fluoro- 8.8 Hz, 1H), 8.06 (d, 15 min 9-azabicyclo[3.3.1]nonan-3- J = 8.8 Hz, 1H), 7.78- Sample yl)(methyl)amino)pyridazin-3- 7.59 (m, 3H), 7.39 (d, solution: yl)-5-(6-methylpyridazin-3- J = 9.9 Hz, 1H), 5.83- 1570 mg yl)phenol 5.62 (m, 1H), 4.86- dissolved in 4.66 (m, 1H), 3.25- 25 ml 3.16 (m, 2H), 3.07 (s, Methanol 3H), 2.67 (s, 3H), Injection 2.44-2.37 (m, 1H), volume: 4 ml 1.94-1.56 (m, 7H). 28A/ 28B 5-(4-(6-(((1S,2S,3R,5R)-2- K 1H NMR (500 MHz, MeOD-d4) 9.34 (s, 1H), 9.07 (s, 1H), 8.23 (d, J = 9.9 Hz, 1H), 7.99 (d, J = 8.3 Hz, 1H), 7.87-7.75 (m, 2H), 7.37 (d, J = 9.9 Hz, 1H), 6.02-5.85 (m, 1H), 3.42-3.38 (m, 2H), 3.17 (s, 3H), 2.66-2.58 (m, 1H), 2.11-1.77 (m, 7H). 446 Instrument: SFC-80 (Thar, Waters) Column: AD 20 * 250 mm, 10 um (Daicel) Column temperature: 35 C. Mobile phase: CO2/MEOH/ ACN (0.2% Methanol Ammonia) = 40/30/30 Flow rate: 80 g/min Back pressure: 100 bar 0.54 fluoro-9- 1H NMR (500 MHz, 446 Detection 2.1 azabicyclo[3.3.1]nonan-3- DMSO-d6) 13.70 wavelength: yl)(methyl)amino)pyridazin-3- (s, 1H), 9.53 (s, 1H), 280 nm yl)-3-hydroxyphenyl)pyrazine- 9.27 (s, 1H), 8.36 Cycle time: 2-carbonitrile (d, J = 10.1 Hz, 1H), 15 min 5-(4-(6-(((1R,2R,3S,5S)-2- 8.12 (d, J = 8.3 Hz, Sample fluoro-9- 1H), 7.83 (d, J = 10.0 solution: azabicyclo[3.3.1]nonan-3- Hz, 2H), 7.40 (d, J = 1570 mg yl)(methyl)amino)pyridazin-3- 9.8 Hz, 1H), 5.90-5.61 dissolved in yl)-3-hydroxyphenyl)pyrazine- (m, 1H), 4.83-4.49 25 ml 2-carbonitrile (m, 1H), 3.24-3.16 Methanol (m, 2H), 3.07 (s, 3H), Injection 2.41-2.37 (m, 1H), volume: 4 ml 1.90-1.61 (m, 7H). 29A/ 29B 2-(6-(((1S,2S,3R,5R)-2-fluoro- K 1H NMR (500 MHz, DMSO-d6) 13.61 (s, 1H), 8.87 (s, 1H), 8.31 (d, J = 9.9 Hz, 1H), 8.01 (d, J = 8.9 Hz, 1H), 7.62 (d, J = 6.9 Hz, 2H), 7.38 (d, J = 9.9 Hz, 1H), 5.81-5.55 (m, 1H), 4.87-4.52 (m, 1H), 3.97 (s, 3H), 3.25- 3.15 (m, 2H), 3.06 (s, 3H), 2.42-2.36 (m, 1H), 1.91-1.56 (m, 7H). 451 Instrument: SFC-80 (Thar, Waters) Column: AD 20 * 250 mm, 10 um (Daicel) Column temperature: 35 C. Mobile phase: CO2/MEOH/ ACN (0.2% Methanol Ammonia) = 40/30/30 Flow rate: 80 g/min Back pressure: 100 bar 0.54 9-azabicyclo[3.3.1]nonan-3- 1H NMR (500 MHz, 451 Detection 2.1 yl)(methyl)amino)pyridazin-3- DMSO-d6) 13.61 (s, wavelength: yl)-5-(5-methoxypyrazin-2- 1H), 8.87 (s, 1H), 8.31 280 nm yl)phenol (d, J = 9.9 Hz, 1H), Cycle time: 2-(6-(((1R,2R,3S,5S)-2-fluoro- 8.01 (d, J = 8.9 Hz, 15 min 9-azabicyclo[3.3.1]nonan-3- 1H), 7.62 (d, J = 6.9 Sample yl)(methyl)amino)pyridazin-3- Hz, 2H), 7.38 (d, J = solution: yl)-5-(5-methoxypyrazin-2- 9.9 Hz, 1H), 5.81- 1570 mg yl)phenol 5.55 (m, 1H), 4.87- dissolved in 4.52 (m, 1H), 3.97 (s, 25 ml 3H), 3.25-3.15 (m, Methanol 2H), 3.06 (s, 3H), Injection 2.42-2.36 (m, 1H), volume: 4 ml 1.91-1.56 (m, 7H). 30A/ 30B or G 1H NMR (500 MHz, DMSO-d6) 13.57 (s, 1H), 8.24 (d, J = 10.0 Hz, 1H), 7.86 (d, J = 7.5 Hz, 1H), 7.38 (d, J = 10.0 Hz, 1H), 6.93-6.91 (m, 2H), 5.10-4.96 (m, 1H), 4.67 (d, J = 55.0 Hz, 1H), 3.52 (s, 2H), 3.04 (d, J = 2.0 Hz, 3H), 2.37 (m, 1H), 2.26- 2.20 (m, 1H), 2.06 (s, 3H), 1.78 (m, 2H), 1.71-1.65 (m, 2H), 1.55-1.52 (m, 1H). 367 Instrument: SFC-150 (Thar, Waters) Column: SC 20 * 250 mm, 10 um (Regis) Column temperature: 35 C. Mobile phase: CO2/MEOH (0.2% Methanol Ammonia) = 60/40 Flow rate: 100 g/min Back pressure: 1.05 2-(6-(((1R,2R,3S,5S)-2-fluoro- 1H NMR (500 MHz, 367 100 bar 2.07 8-azabicyclo[3.2.1]octan-3- DMSO-d6) 13.57 Detection yl)(methyl)amino)pyridazin-3- (s, 1H), 8.24 wavelength: yl)-5-(prop-1-yn-1-yl)phenol (d, J = 10.0 Hz, 1H), 214 nm 2-(6-(((1S,2S,3R,5R)-2-fluoro- 7.86 (d, J = 7.5 Hz, Cycle time: 8-azabicyclo[3.2.1]octan-3- 1H), 7.38 (d, J = 10.0 3 min yl)(methyl)amino)pyridazin-3- Hz, 1H), 6.93-6.91 Sample yl)-5-(prop-1-yn-1-yl)phenol (m, 2H), 5.10-4.96 solution: (m, 1H), 4.67 (d, J = 3000 mg 55.0 Hz, 1H), 3.52 (s, dissolved in 2H), 3.04 (d, J = 2.0 100 ml Hz, 3H), 2.37 Methanol (m, 1H), 2.26-2.20 Injection (m, 1H), 2.06 (s, 3H), volume: 1 ml 1.78 (m, 2H), 1.71- 1.65 (m, 2H), 1.55- 1.52 (m, 1H). 31A/ 31B 5-cyclopropyl-2-(6- G 1H NMR (400 MHz, Methanol-d4) 8.09 (d, J = 10.0 Hz, 1H), 7.64 (d, J = 8.2 Hz, 1H), 7.31 (d, J = 9.9 Hz, 1H), 6.83-6.54 (m, 2H), 5.29-5.19 (m, 1H), 4.81-4.68 (m, 1H), 3.71 (s, 2H), 3.12 (d, J = 1.9 Hz, 3H), 2.44-2.39 (m, 1H), 2.10-1.82 (m, 5H), 1.69 (d, J = 6.8 Hz, 1H), 1.03-0.98 (m, 2H), 0.78-0.64 (m, 2H). 369 Instrument: SFC-150 (Thar, Waters) Column: SC 20 * 250 mm, 10 um (Regis) Column temperature: 35 C. Mobile phase: CO2/MEOH (0.2% Methanol Ammonia) = 60/40 Flow rate: 100 g/min 1.55 (((1S,2S,3R,5R)-2-fluoro-8- 1H NMR (400 MHz, 369 Back pressure: 2.3 azabicyclo[3.2.1]octan-3- Methanol-d4) 8.09 100 bar yl)(methyl)amino)pyridazin-3- (d, J = 10.0 Hz, 1H), Detection yl)phenol 7.64 (d, J = 8.2 Hz, wavelength: 5-cyclopropyl-2-(6- 1H), 7.31 (d, J = 9.9 214 nm (((1R,2R,3S,5S)-2-fluoro-8- Hz, 1H), Cycle time: azabicyclo[3.2.1]octan-3- 6.83-6.54 (m, 2H), 3 min yl)(methyl)amino)pyridazin-3- 5.29-5.19 (m, 1H), Sample yl)phenol 4.81-4.68 (m, 1H), solution: 3.71 (s, 2H), 3.12 3000 mg (d, J = 1.9 Hz, 3H), dissolved in 2.44-2.39 (m, 1H), 100 ml 2.10-1.82 (m, 5H), Methanol 1.72-1.65 (m, 1H), Injection 1.03-0.98 (m, 2H), volume: 1 ml 0.78-0.64 (m, 2H). 32A/ 32B N-(4-(6-(((1S,2S,3R,5R)-2- G 1H NMR (500 MHz, DMSO-d6) 13.45 (s, 1H), 10.07 (s, 1H), 8.20 (d, J = 10.0 Hz, 1H), 7.81 (d, J = 8.8 Hz, 1H), 7.44 (d, J = 9.9 Hz, 1H), 7.34 (d, J = 1.6 Hz, 1H), 7.12- 7.10 (m, 1H), 5.35- 4.75 (m, 2H), 4.25- 4.00 (m, 2H), 3.01 (s, 3H), 2.60-2.51 (m, 1H), 2.19-1.88 (m, 7H), 1.83 (s, 1H). 386 Instrument: SFC-150 (Thar, Waters) Column: SC 20 * 250 mm, 10 um (Regis) Column temperature: 35 C. Mobile phase: CO2/MEOH (0.2% Methanol Ammonia) = 60/40 Flow rate: 100 g/min Back pressure: 1.05 fluoro-8- 1H NMR (500 MHz, 386 100 bar 2.07 azabicyclo[3.2.1]octan-3- DMSO-d6) 13.45 (s, Detection yl)(methyl)amino)pyridazin-3- 1H), 10.07 (s, 1H), wavelength: yl)-3-hydroxyphenyl)acetamide 8.20 (d, J = 10.0 Hz, 214 nm N-(4-(6-(((1R,2R,3S,5S)-2- 1H), 7.81 (d, J = 8.8 Cycle time: fluoro-8- Hz, 1H), 7.44 (d, J = 3 min azabicyclo[3.2.1]octan-3- 9.9 Hz, 1H), 7.34 (d, Sample yl)(methyl)amino)pyridazin-3- J = 1.6 Hz, 1H), 7.12- solution: yl)-3-hydroxyphenyl)acetamide 7.10 (m, 1H), 5.35- 3000 mg 4.75 (m, 2H), 4.25- dissolved in 4.00 (m, 2H), 3.01 (s, 100 ml 3H), 2.60-2.51 (m, Methanol 1H), 2.19-1.88 (m, Injection 7H), 1.83 (s, 1H). volume: 1 ml 33A/ 33B 2-(6-(((1R,2R,3S,5S)-2-fluoro- G 1H NMR (400 MHz, Methanol-d4) 8.16 (d, J = 10.0 Hz, 1H), 7.83 (d, J = 8.6 Hz, 1H), 7.72 (s, 1H), 7.42- 7.33 (m, 3H), 6.72 (s, 1H), 5.36- 5.22 (m, 1H), 4.84- 4.69 (m, 1H), 3.75- 3.66 (m, 2H), 3.14 (s, 3H), 2.46-2.39 (m, 1H), 2.05-1.89 (m, 4H), 1.75-1.65 (m, 1H). 395 Instrument: SFC-200 (Thar, Waters) Column: AD 20 * 250 mm, 10 um (Daicel) Column temperature: 35 C. Mobile phase: CO2/MEOH (0.2% Methanol Ammonia) = 80/20 Flow rate: 120 g/min Back pressure: 100 bar 1.05 8-azabicyclo[3.2.1]octan-3- 1H NMR (500 MHz, 395 Detection 2.07 yl)(methyl)amino)pyridazin-3- DMSO-d6) 8.28 (d, wavelength: yl)-5-(1H-pyrazol-3-yl)phenol J = 9.9 Hz, 1H), 7.93 214 nm 2-(6-(((1S,2S,3R,5R)-2-fluoro- (d, J = 6.8 Hz, 1H), Cycle time: 8-azabicyclo[3.2.1]octan-3- 7.79 (s, 1H), 7.48- 4.1 min yl)(methyl)amino)pyridazin-3- 7.29 (m, 3H), 6.77 Sample yl)-5-(1H-pyrazol-3-yl)phenol (d, J = 1.6 Hz, 1H), solution: 5.22-4.97 (m, 1H), 6000 mg 4.81 (d, J = 50.8 Hz, dissolved in 1H), 3.80-3.76 (m, 110 ml 2H), 3.05 (s, 3H), MEOH 2.39-2.29 (m, 1H), Injection 1.98-1.53 (m, 5H). volume: 2 ml 34A/ 34B 5-(cyclopent-1-en-1-yl)-2-(6- G 1H NMR (400 MHz, DMSO-d6) 13.53 (s, 1H), 8.23 (d, J = 10.0 Hz, 1H), 7.83 (d, J = 8.4 Hz, 1H), 7.37 (d, J = 9.9 Hz, 1H), 7.8- 7.05 (m, 1H), 6.98 (s, 1H), 6.36 (s, 1H), 5.13-4.95 (m, 1H), 4.71-4.58 (m, 1H), 3.50 (s, 2H), 3.04 (s, 3H), 2.71-2.62 (m, 2H), 2.54-2.50 (m, 2H), 2.29-2.19 (m, 1H), 2.03-1.91 (m, 2H), 1.84-1.62 (m, 4H), 1.59-1.50 (m, 1H). 359 Instrument: SFC-150 (Thar, Waters) Column: SC 20 * 250 mm, 10 um (Regis) Column temperature: 35 C. Mobile phase: CO2/MEOH (0.2% Methanol Ammonia) = 60/40 Flow rate: 100 g/min Back pressure: 100 bar Detection 1.55 (((1S,2S,3R,5R)-2-fluoro-8- 1H NMR (400 MHz, 359 wavelength: 2.3 azabicyclo[3.2.1]octan-3- DMSO-d6) 13.53 (s, 214 nm yl)(methyl)amino)pyridazin-3- 1H), 8.23 (d, J = 10.0 Cycle time: yl)phenol Hz, 1H), 7.83 (d, J = 3 min 5-(cyclopent-1-en-1-yl)-2-(6- 8.4 Hz, 1H), 7.37 (d, Sample (((1R,2R,3S,5S)-2-fluoro-8- J = 9.9 Hz, 1H), 7.8- solution: azabicyclo[3.2.1]octan-3- 7.05 (m, 1H), 6.98 (s, 3000 mg yl)(methyl)amino)pyridazin-3- 1H), 6.36 (s, 1H), dissolved in yl)phenol 5.13-4.95 (m, 1H), 100 ml 4.71-4.58 (m, 1H), Methanol 3.50 (s, 2H), 3.04 Injection (s, 3H), 2.71-2.62 volume: 1 ml (m, 2H), 2.54-2.50 (m, 2H), 2.29-2.19 (m, 1H), 2.03-1.91 (m, 2H), 1.84-1.62 (m, 4H), 1.59-1.50 (m, 1H). 35A/ 35B N-(4-(6-(((1S,2S,3R,5R)-2- G 1H NMR (400 MHz, DMSO-d6) 8.03 (d, J = 10 Hz, 1H), 7.76 (d, J = 8.4 Hz, 1H), 7.23 (d, J = 10 Hz, 1H), 6.79-6.74 (m, 2H), 5.24-5.15 (m, 1H), 4.70-4.69 (m, 1H), 3.63-3.49 (m, 2H), 3.21 (s, 3H), 3.19-3.14 (m, 2H), 3.02 (s, 3H), 2.34- 2.26 (m, 1H), 1.93- 1.77 (m, 5H), 1.59- 1.55 (m, 1H). 400 Instrument: SFC-150 (Thar, Waters) Column: SC 20 * 250 mm, 10 um (Regis) Column temperature: 35 C. Mobile phase: CO2/MEOH (0.2% Methanol Ammonia) = 60/40 Flow rate: 100 g/min Back pressure: 100 bar 1.05 fluoro-8- 1H NMR (400 MHz, 400 Detection 2.07 azabicyclo[3.2.1]octan-3- DMSO-d6) 8.03 (d, wavelength: yl)(methyl)amino)pyridazin-3- J = 10 Hz, 1H), 7.76 214 nm yl)-3-hydroxyphenyl)-N- (d, J = 8.4 Hz, 1H), Cycle time: methylacetamide 7.23 (d, J = 10 Hz, 3 min N-(4-(6-(((1R,2R,3S,5S)-2- 1H), 6.79-6.74 (m, Sample fluoro-8- 2H), 5.24-5.15 (m, solution: azabicyclo[3.2.1]octan-3- 1H), 4.70-4.69 (m, 3000 mg yl)(methyl)amino)pyridazin-3- 1H), 3.63-3.49 (m, dissolved in yl)-3-hydroxyphenyl)-N- 2H), 3.21 (s, 3H), 100 ml methylacetamide 3.19-3.14 (m, 2H), Methanol 3.02 (s, 3H), 2.34- Injection 2.26 (m, 1H), 1.93- volume: 1 ml 1.77 (m, 5H), 1.59- 1.55 (m, 1H). 36A/ 36B 2-(6-(((1R,2R,3S,5S)-2-fluoro- G 1H NMR (500 MHz, DMSO-d6) 13.54 (s, 1H), 8.27 (d, J = 9.9 Hz, 1H), 7.90 (d, J = 13.7 Hz, 1H), 7.74 (s, 1H), 7.56-7.16 (m, 3H), 6.74 (s, 1H), 5.29-5.02 (m, 1H), 4.87-4.77 (m, 1H), 3.89 (s, 3H), 3.81- 3.77 (m, 2H), 3.05 (s, 3H), 2.43-2.23 (m, 1H), 1.99-1.60 (m, 5H). 409 Instrument: SFC-200 (Thar, Waters) Column: AD 20 * 250 mm, 10 um (Daicel) Column temperature: 35 C. Mobile phase: CO2/MEOH (0.2% Methanol Ammonia) = 80/20 Flow rate: 120 g/min Back pressure: 100 bar 1.05 8-azabicyclo[3.2.1]octan-3- 1H NMR (500 MHz, 409 Detection 2.07 yl)(methyl)amino)pyridazin-3- DMSO-d6) 13.54 (s, wavelength: yl)-5-(1-methyl-1H-pyrazol-3- 1H), 8.27 (d, J = 9.9 214 nm yl)phenol Hz, 1H), 7.90 (d, J = Cycle time: 2-(6-(((1S,2S,3R,5R)-2-fluoro- 13.7 Hz, 1H), 7.74 (s, 4.1 min 8-azabicyclo[3.2.1]octan-3- 1H), 7.56-7.16 (m, Sample yl)(methyl)amino)pyridazin-3- 3H), 6.74 (s, 1H), solution: yl)-5-(1-methyl-1H-pyrazol-3- 5.29-5.02 (m, 1H), 6000 mg yl)phenol 4.87-4.77 (m, 1H), dissolved in 3.89 (s, 3H), 3.81- 110 ml 3.77 (m, 2H), 3.05 MEOH (s, 3H), 2.43-2.23 Injection (m, 1H), 1.99-1.60 volume: 2 ml (m, 5H). 37A/ 37B 0 5-(4-chloro-1H-imidazol-1-yl)- G 1H NMR (400 MHz, DMSO-d6) 14.28 (s, 1H), 8.36 (s, 1H), 8.30 (d, J = 10.1 Hz, 1H), 8.08-7.95 (m, 2H), 7.39-7.27 (m, 2H), 7.23 (d, J = 8.6 Hz, 1H), 5.18-4.99 (m, 1H), 3.64 (s, 1H), 3.48-3.41 (m, 1H), 2.98 (s, 3H), 2.88 (s, 1H), 2.43-2.28 (m, 2H), 2.01-1.64 (m, 4H). 447 Instrument: SFC-80 (Thar, Waters) Column: OJ 20 * 250 mm, 10 um (Daicel) Column temperature: 35 C. Mobile phase: CO2/ MeOH (0.2% Methanol Ammonia) = 70/30 Flow rate: 80 g/min Back pressure: 100 bar Detection wavelength: 1.52 2-(6-(((1S,3R,5R)-6,6-difluoro- 1H NMR (400 MHz, 447 214 nm 2.04 8-azabicyclo[3.2.1]octan-3- DMSO-d6) 14.28 (s, Cycle time: yl)(methyl)amino)pyridazin-3- 1H), 8.36 (s, 1H), 8.30 3.3 min yl)phenol (d, J = 10.1 Hz, 1H), Sample 5-(4-chloro-1H-imidazol-1-yl)- 8.08-7.95 (m, 2H), solution: 2-(6-(((1R,3S,5S)-6,6-difluoro- 7.39-7.27 (m, 2H), 300 mg 8-azabicyclo[3.2.1]octan-3- 7.23 (d, J = 8.6 Hz, dissolved in yl)(methyl)amino)pyridazin-3- 1H), 5.18-4.99 (m, 25 ml yl)phenol 1H), 3.64 (s, 1H), Methanol 3.48-3.41 (m, 1H), Injection 2.98 (s, 3H), 2.88 volume: (s, 1H), 2.43-2.28 0.8 ml (m, 2H), 2.01-1.64 (m, 4H). 38A/ 38B 4-(6-(((1S,2S,3R,5R)-2-fluoro- L 1H NMR (400 MHz, DMSO-d6) 8.39- 8.27 (m, 1H), 8.07 (d, J = 8.2 Hz, 1H), 7.36 (d, J = 9.9 Hz, 1H), 7.30 (s, 1H), 7.27 (d, J = 8.2 Hz, 1H), 5.21-4.90 (m, 1H), 4.62 (d, J = 52.4 Hz, 1H), 3.52 (s, 2H), 3.04 (s, 3H), 2.31-2.15 (m, 1H), 1.88-1.62 (m, 4H), 1.58-1.45 (m, 1H). 354 Instrument: SFC-80 (Thar, Waters) Column: AD 20 * 250 mm, 10 um (Daicel) Column temperature: 35 C. Mobile phase: CO2/MeOH (0.2% Methanol Ammonia) = 45/55 Flow rate: 75 g/min Back pressure: 100 bar 1.11 8-azabicyclo[3.2.1]octan-3- 1H NMR (400 MHz, 354 Detection 2.49 yl)(methyl)amino)pyridazin-3- DMSO-d6) 8.39- wavelength: yl)-3-hydroxybenzonitrile 8.27 (m, 1H), 8.07 214 nm 4-(6-(((1R,2R,3S,5S)-2-fluoro- (d, J = 8.2 Hz, 1H), Cycle time: 8-azabicyclo[3.2.1]octan-3- 7.36 (d, J = 9.9 Hz, 18.0 min yl)(methyl)amino)pyridazin-3- 1H), 7.30 (s, 1H), Sample yl)-3-hydroxybenzonitrile 7.27 (d, J = 8.2 Hz, solution: 1H), 5.21-4.90 (m, 350 mg 1H), 4.62 (d, J = 52.4 dissolved in Hz, 1H), 3.52 (s, 20 ml 2H), 3.04 (s, 3H), Methanol 2.31-2.15 (m, 1H), Injection 1.88-1.62 (m, 4H), volume: 1.58-1.45 (m, 1H). 1.9 ml 39A/ 39B 4-(6-(((1S,2S,3R,5R)-2-fluoro- L 1H NMR (400 MHz, DMSO-d6) 8.32 (d, J = 9.7 Hz, 1H), 8.09 (d, J = 8.0 Hz, 1H), 7.53-7.18 (m, 3H), 5.95-5.53 (m, 1H), 4.90-4.56 (m, 1H), 3.26-3.15 (m, 2H), 3.06 (s, 3H), 2.42- 2.36 (m, 1H), 1.93- 1.57 (m, 7H). 368 Instrument: SFC-80 (Thar, Waters) Column: IC 20 * 250 mm, 10 um (Daicel) Column temperature: 35 C. Mobile phase: CO2/MeOH (0.2% Methanol Ammonia) = 45/55 Flow rate: 80 g/min Back pressure: 100 bar 2.09 9-azabicyclo[3.3.1]nonan-3- 1H NMR (400 MHz, 368 Detection 3.53 yl)(methyl)amino)pyridazin-3- DMSO-d6) 8.32 (d, wavelength: yl)-3-hydroxybenzonitrile J = 9.9 Hz, 1H), 8.09 214 nm 4-(6-(((1R,2R,3S,5S)-2-fluoro- (d, J = 8.1 Hz, 1H), Cycle time: 9-azabicyclo[3.3.1]nonan-3- 7.41-7.29 (m, 3H), 5.3 min yl)(methyl)amino)pyridazin-3- 5.84-5.53 (m, 1H), Sample yl)-3-hydroxybenzonitrile 4.84-4.53 (m, 1H), solution: 3.25-3.14 (m, 2H), 300 mg 3.06 (d, J = 1.6 Hz, dissolved in 3H), 2.42-2.36 15 ml (m, 1H), 1.92- Methanol 1.53 (m, 7H). Injection volume: 1.0 ml 40A/ 40B 6-(6-(((1S,2R,3R,5R)-2-fluoro- L 1H NMR (400 MHz, DMSO-d6) 13.54 (s, 1H), 8.27 (d, J = 10.0 Hz, 1H), 8.21 (s, 1H), 7.45 (d, J = 10.0 Hz, 1H), 7.12 (s, 1H), 4.89-4.68 (m, 2H), 3.58-3.56 (s, 1H), 3.46 (m, 1H), 3.02 (s, 3H), 2.60 (s, 3H), 1.96-1.61 (m, 6H). 384 Instrument: SFC-80 (Thar, Waters) Column: OD 20 * 250 mm, 10 um (Daicel) Column temperature: 35 C. Mobile phase: CO2/MeOH (0.2% Methanol Ammonia) = 75/25 Flow rate: 80 g/min 1.72 8-azabicyclo[3.2.1]octan-3- 1H NMR (400 MHz, 384 Back pressure: 2.32 yl)(methyl)amino)pyridazin-3- DMSO-d6) 13.54 (s, 100 bar yl)-2-methylbenzo[d]oxazol-5- 1H), 8.27 (d, J = 10.0 Detection ol Hz, 1H), 8.21 (s, 1H), wavelength: 6-(6-(((1R,2S,3S,5S)-2-fluoro- 7.45 (d, J = 10.0 Hz, 214 nm 8-azabicyclo[3.2.1]octan-3- 1H), 7.12 (s, 1H), Cycle time: yl)(methyl)amino)pyridazin-3- 4.89-4.68 (m, 2H), 3.0 min yl)-2-methylbenzo[d]oxazol-5- 3.58-3.56 (s, 1H), Sample ol 3.46 (m, 1H), 3.02 solution: (s, 3H), 2.60 (s, 3H), 300 mg 1.96-1.61 (m, 6H). dissolved in 25 ml Methanol Injection volume: 0.6 ml 41A/ 41B 6-(6-(((1S,2S,3R,5R)-2-fluoro- L 1H NMR (400 MHz, DMSO-d6) 13.18 (s, 1H), 8.79 (dd, J = 4.2, 1.7 Hz, 1H), 8.57 (s, 1H), 8.36 (d, J = 9.9 Hz, 1H), 8.30 (d, J = 7.4 Hz, 1H), 7.41 (d, J = 6.3 Hz, 1H), 7.34 (dd, J = 8.2, 4.2 Hz, 1H), 5.90-5.72 (m, 1H), 4.82-4.69 (m, 2H), 3.33-3.19 (m, 2H), 3.08 (s, 3H), 2.46-2.33 (m, 1H), 1.96-1.90 (m, 3H), 1.82-1.59 (m, 4H). 394 Instrument: SFC-150 (Waters) Column: AD 20 * 250 mm, 10 um (Daicel) Column temperature: 35 C. Mobile phase: CO2/ (MeOH/ACN (0.2% Methanol Ammonia) = 1:1) = 40/60 3.19 9-azabicyclo[3.3.1]nonan-3- Flow rate: yl)(methyl)amino)pyridazin-3- 1H NMR (400 MHz, 394 120 g/min 3.52 yl)quinolin-7-ol DMSO-d6) 13.02 (s, Back pressure: 6-(6-(((1R,2R,3S,5S)-2-fluoro- 1H), 8.79 (dd, J = 4.2, 100 bar 9-azabicyclo[3.3.1]nonan-3- 1.7 Hz, 1H), 8.57 (s, Detection yl)(methyl)amino)pyridazin-3- 1H), 8.38 (d, J = 9.9 wavelength: yl)quinolin-7-ol Hz, 1H), 8.31 (d, J = 214 nm 7.3 Hz, 1H), 7.46 (d, Cycle time: J = 9.9 Hz, 1H), 7.40 3 min (s, 1H), 7.35 (dd, J = Sample 8.2, 4.2 Hz, 1H), solution: 5.90-5.80 (m, 1H), 450 mg 5.08-4.96 (m, 2H), dissolved in 3.73-3.60 (m, 2H), 40 ml 3.08 (s, 3H), 2.71- Methanol 2.60 (m, 1H), 2.5- Injection 2.02 (m, 3H), volume: 1.89-1.69 (m, 4H). 1.9 ml 42A/ 42B 2-(6-(((1R,2R,3S,5S)-2-fluoro- L 1H NMR (500 MHz, DMSO-d6) 8.25 (d, J = 9.9 Hz, 2H), 7.97 (s, 1H), 7.85 (d, J = 8.2 Hz, 1H), 7.38 (d, J = 9.9 Hz, 1H), 7.27- 7.08 (m, 2H), 5.13- 4.91 (m, 1H), 4.64 (d, J = 51.9 Hz, 1H), 3.54 (s, 2H), 3.04 (s, 3H), 2.32-2.15 (m, 1H), 1.95-1.46 (m, 5H). 395 Instrument: Gilson-281 Column: IG 20 * 250, 10 um Mobile Phase: n-ACN (0.2% MEA):MEOH (0.2% MEA): DCM (0.2% MEA) = 70:25:5 Flow Rate: 45 ml/min Run time per injection: 30 min Injection: 0.7 ml 3.1 8-azabicyclo[3.2.1]octan-3- 1H NMR (500 MHz, 395 Sample 3.9 yl)(methyl)amino)pyridazin-3- DMSO-d6) 8.25 (d, solution: 420 yl)-5-(1H-pyrazol-4-yl)phenol J = 9.9 Hz, 2H), 7.97 mg in 19 mL 2-(6-(((1S,2S,3R,5R)-2-fluoro- (s, 1H), 7.85 (d, J = MEOH 8-azabicyclo[3.2.1]octan-3- 8.2 Hz, 1H), 7.38 (d, yl)(methyl)amino)pyridazin-3- J = 9.9 Hz, 1H), 7.27- yl)-5-(1H-pyrazol-4-yl)phenol 7.08 (m, 2H), 5.13- 4.91 (m, 1H), 4.64 (d, J = 51.9 Hz, 1H), 3.54 (s, 2H), 3.04 (s, 3H), 2.32-2.15 (m, 1H), 1.95-1.46 (m, 5H). 43A/ 43B 7-(6-(((1S,2S,3R,5R)-2-fluoro- L 1H NMR (400 MHz, DMSO-d6) ppm 12.96 (s, 1H), 8.36 (d, J = 9.9 Hz, 1H), 8.30 (d, J = 6.0 Hz, 1H), 8.23 (s, 1H), 7.43 (s, 1H), 7.38 (d, J = 9.9 Hz, 1H), 6.30 (d, J = 6.0 Hz, 1H), 5.07 (s, 1H), 4.80-4.42 (m, 1H), 3.54 (s, 2H), 3.30- 3.20 (m, 1H) 3.06 (d, J = 1.8 Hz, 3H), 2.26 (td, J = 12.6, 3.2 Hz, 1H), 1.80 (s, 2H), 1.74- 1.61 (m, 2H), 1.60- 1.50 (m, 1H). 397 Column: CHIRALPAK IF, 2 * 25 cm, Sum; Mobile Phase A: MTBE (10 mM NH3- MEOH)- HPLC, Mobile Phase B: EtOH- HPLC; Flow rate: 18 mL/min; Gradient: 25 B to 25 B in 10 min; 254\220 nm 6.5 8-azabicyclo[3.2.1]octan-3- 1H NMR (400 MHz, 397 7.8 yl)(methyl)amino)pyridazin-3- DMSO-d6) ppm yl)-6-hydroxy-4H-chromen-4- 12.96 (s, 1H), 8.36 one (d, J = 9.9 Hz, 1H), 7-(6-(((1R,2R,3S,5S)-2-fluoro- 8.30 (d, J = 6.0 Hz, 8-azabicyclo[3.2.1]octan-3- 1H), 8.23 (s, 1H), yl)(methyl)amino)pyridazin-3- 7.43 (s, 1H), 7.38 (d, yl)-6-hydroxy-4H-chromen-4- J = 9.9 Hz, 1H), 6.30 one (d, J = 6.0 Hz, 1H), 5.07 (s, 1H), 4.80- 4.42 (m, 1H), 3.54 (s, 2H), 3.30-3.20 (m, 1H) 3.06 (d, J = 1.8 Hz, 3H), 2.26 (td, J = 12.6, 3.2 Hz, 1H), 1.80 (s, 2H), 1.74-1.61 (m, 2H), 1.60-1.50 (m, 1H). 44A/ 44B 2-(6-(((1S,2S,3R,5R)-2-fluoro- L 1H NMR (400 MHz, DMSO-d6) 9.37 (s, 1H), 8.31 (d, J = 10.0 Hz, 1H), 8.14 (d, J = 8.4 Hz, 1H), 7.68- 7.49 (m, 2H), 7.42 (d, J = 10.0 Hz, 1H), 5.27-4.92 (m, 1H), 4.86-4.53 (m, 1H), 3.66-3.50 (m, 2H), 3.06 (s, 3H), 2.33-2.22 (m, 1H), 1.71-1.65 (m, 5H). 397 Instrument: SFC-80 (Thar, Waters) Column: AD 20 * 250 mm, 10 um (Daicel) Column temperature: 35 C. Mobile phase: CO2/ MeOH (0.2% Methanol Ammonia) = 70/30 Flow rate: 80 g/min Back pressure: 100 bar 1.05 8-azabicyclo[3.2.1]octan-3- 1H NMR (400 MHz, 397 Detection 2.07 yl)(methyl)amino)pyridazin-3- DMSO-d6) 9.37 (s, wavelength: yl)-5-(1,3,4-oxadiazol-2- 1H), 8.31 (d, J = 10.0 214 nm yl)phenol Hz, 1H), 8.14 (d, J = Cycle time: 2-(6-(((1R,2R,3S,5S)-2-fluoro- 8.4 Hz, 1H), 7.68- 3.5 min 8-azabicyclo[3.2.1]octan-3- 7.49 (m, 2H), 7.42 Sample yl)(methyl)amino)pyridazin-3- (d, J = 10.0 Hz, 1H), solution: yl)-5-(1,3,4-oxadiazol-2- 5.27-4.92 (m, 1H), 10000 mg yl)phenol 4.86-4.53 (m, 1H), dissolved in 3.66-3.50 (m, 2H), 210 ml 3.06 (s, 3H), Methanol 2.33-2.22 (m, 1H), Injection 1.71-1.65 (m, 5H). volume: 1.9 ml 45A/ 45B 6-(6-(((1S,3R,5R)-6,6-difluoro- L 1H NMR (500 MHz, DMSO-d6) 8.78 (d, 1H), 8.54 (s, 1H), 8.35 (d, J = 9.9 Hz, 1H), 8.27 (d, J = 7.7 Hz, 1H), 7.45-7.19 (m, 3H), 5.26-5.10 (m, 1H), 3.68-3.59 (m, 1H), 3.50-3.40 (m, 1H), 3.00 (s, 3H), 2.92-2.80 (m, 1H), 2.39-2.27 (m, 2H), 2.00-1.88 (m, 1H), 1.88-1.77 (m, 2H), 1.77-1.66 (m, 1H). 398 Instrument: SFC-150 (Thar, Waters) Column: IC 20 * 250 mm, 10 um (Daicel) Column temperature: 35 C. Mobile phase: CO2/MEOH (0.2% Methanol Ammonia) = 50/50 Flow rate: 2.47 8-azabicyclo[3.2.1]octan-3- 1H NMR (500 MHz, 398 120 g/min 3.06 yl)(methyl)amino)pyridazin-3- DMSO-d6) 8.79 (d, Back pressure: yl)quinolin-7-ol J = 2.7 Hz, 1H), 8.56 100 bar 6-(6-(((1R,3S,5S)-6,6-difluoro- (s, 1H), 8.35 (d, J = Detection 8-azabicyclo[3.2.1]octan-3- 9.9 Hz, 1H), 8.28 (d, wavelength: yl)(methyl)amino)pyridazin-3- J = 8.2 Hz, 1H), 7.62- 214 nm yl)quinolin-7-ol 7.09 (m, 3H), 5.36- Cycle time: 4.95 (m, 1H), 3.74- 6 min 3.59 (m, 1H), 3.50- Sample 3.40 (m, 1H), 3.01 solution: (s, 3H), 2.40-2.24 180 mg (m, 2H), 2.03-1.91 dissolved in (m, 1H), 1.88-1.77 30 ml (m, 2H), 1.76-1.64 Methanol (m, 1H). and Dichloro- methane Injection volume: 1.9 ml 46A/ 46B 7-(6-(((1S,3R,5R)-6,6-difluoro- 8-azabicyclo[3.2.1]octan-3- L 1H NMR (500 MHz, Methanol-d4) 8.70 (dd, J = 4.2, 1.6 Hz, 1H), 8.43 (s, 1H), 8.34 (d, J = 10.0 Hz, 1H), 8.21 (d, J = 7.0 Hz, 1H), 7.47 (dd, J = 8.4, 4.3 Hz, 1H), 7.44-7.29 (m, 2H), 5.42-5.22 (m, 1H), 4.00-3.75 (m, 1H), 3.73-3.53 (m, 1H), 3.11 (s, 3H), 2.70- 2.45 (m, 2H), 2.22- 2.08 (m, 1H), 2.10- 2.00 (m, 2H), 1.98-1.84 (m, 1H). 398 Instrument: SFC-150 (Thar, Waters) Column: RR WHELK 20 * 250 mm, 10 um (Daicel) Column temperature: 35 C. Mobile phase: CO2/MEOH (0.2% Methanol Ammonia) = 60/40 2.94 yl)(methyl)amino)pyridazin-3- Flow rate: yl)quinolin-6-ol 1H NMR (500 MHz, 398 100 g/min 3.46 7-(6-(((1R,3S,5S)-6,6-difluoro- Methanol-d4) 8.70 Back pressure: 8-azabicyclo[3.2.1]octan-3- (dd, J = 4.2, 1.6 Hz, 100 bar yl)(methyl)amino)pyridazin-3- 1H), 8.43 (s, 1H), 8.34 Detection yl)quinolin-6-ol (d, J = 10.0 Hz, 1H), wavelength: 8.21 (d, J = 7.0 Hz, 214 nm 1H), 7.47 (dd, J = 8.4, Cycle time: 4.3 Hz, 1H), 7.44- 9 min 7.29 (m, 2H), 5.42- Sample 5.22 (m, 1H), 4.00- solution: 3.75 (m, 1H), 3.73- 150 mg 3.53 (m, 1H), 3.11 dissolved in (s, 3H), 2.70-2.45 20 ml (m, 2H), 2.22-2.08 Methanol (m, 1H), 2.10-2.00 Injection (m, 2H), 1.98-1.84 volume: (m, 1H). 1.9 ml 47A/ 47B 0 2-fluoro-4-(6-(((1S,2S,3R,5R)- 2-fluoro-8- L 1H NMR (400 MHz, DMSO-d6) ppm 13.10 (s, 1H), 8.36- 8.15 (m, 2H), 7.87 (d, J = 11.9 Hz, 1H), 7.38 (d, J = 9.9 Hz, 1H), 7.14 (d, J = 6.3 Hz, 1H), 5.08 (dd, J = 35.4, 11.6 Hz, 1H), 4.64 (dt, J = 52.2, 3.2 Hz, 1H), 3.54 (s, 2H), 3.05 (d, J = 1.8 Hz, 3H), 2.78 (d, J = 4.5 Hz, 3H), 2.25 (td, J = 12.6, 3.1 Hz, 1H), 1.78 (d, J = 13.4 Hz, 2H), 1.74-1.60 (m, 2H), 1.55 (dd, J = 12.4, 6.2 Hz, 1H). 404 Column: Chiralpak AD-H, 2 * 25 cm (5 um); Mobile Phase A: Hex (10 mM NH3-MeOH), Mobile Phase B: IPA-HPLC; Flow rate: 20 mL/min; Gradient: 40 B to 40 B in 16.5 min; 306/254 nm 6 azabicyclo[3.2.1]octan-3- yl)(methyl)amino)pyridazin-3- 1H NMR (400 MHz, 404 9.9 yl)-5-hydroxy-N- DMSO-d6) ppm methylbenzamide 13.10 (s, 1H), 8.36- 2-fluoro-4-(6-(((1R,2R,3S,5S)- 8.15 (m, 2H), 7.87 2-fluoro-8- (d, J = 11.9 Hz, 1H), azabicyclo[3.2.1]octan-3- 7.38 (d, J = 9.9 Hz, yl)(methyl)amino)pyridazin-3- 1H), 7.14 (d, J = 6.3 yl)-5-hydroxy-N- Hz, 1H), 5.08 (dd, methylbenzamide J = 35.4, 11.6 Hz, 1H), 4.64 (dt, J = 52.2, 3.2 Hz, 1H), 3.54 (s, 2H), 3.05 (d, J = 1.8 Hz, 3H), 2.78 (d, J = 4.5 Hz, 3H), 2.25 (td, J = 12.6, 3.1 Hz, 1H), 1.78 (d, J = 13.4 Hz, 2H), 1.74-1.60 (m, 2H), 1.55 (dd, J = 12.4, 6.2 Hz, 1H). 48A/ 48B 2-(6-(((1S,2S,3R,5R)-2-fluoro- L 1H NMR (400 MHz, DMSO-d6) 13.74- 13.41 (m, 1H), 8.27 (d, J = 10.0 Hz, 1H), 8.03 (d, J = 8.3 Hz, 1H), 7.49-7.40 (m, 3H), 7.02 (d, J = 1.2 Hz, 1H), 5.06 (d, J = 28.8 Hz, 1H), 4.65 (d, J = 52.3 Hz, 1H), 3.66-3.45 (m, 2H), 3.05 (s, 3H), 2.40 (s, 3H), 2.41-2.40 (m, 1H), 1.87-1.63 (m, 4H), 1.61-1.50 (m, 1H). 410 Instrument: SFC-150 (Thar, Waters) Column: AD 20 * 250 mm, 10 um (Daicel) Column temperature: 35 C. Mobile phase: CO2/ MeOH (0.2% Methanol Ammonia) = 40/60 Flow rate: 100 g/min Back pressure: 100 bar Detection wavelength: 1.14 8-azabicyclo[3.2.1]octan-3- 1H NMR (400 MHz, 410 214 nm 3.97 yl)(methyl)amino)pyridazin-3- DMSO-d6) 13.74- Cycle time: yl)-5-(5-methyloxazol-2- 13.41 (m, 1H), 8.27 8.3 min yl)phenol (d, J = 10.0 Hz, 1H), Sample 2-(6-(((1R,2R,3S,5S)-2-fluoro- 8.03 (d, J = 8.3 Hz, solution: 8-azabicyclo[3.2.1]octan-3- 1H), 7.49-7.40 (m, 200 mg yl)(methyl)amino)pyridazin-3- 3H), 7.02 (d, J = 1.2 dissolved in yl)-5-(5-methyloxazol-2- Hz, 1H), 5.06 (d, J = 12 ml yl)phenol 28.8 Hz, 1H), 4.65 Methanol (d, J = 52.3 Hz, 1H), Injection 3.66-3.45 (m, 2H), volume: 3.05 (s, 3H), 2.40 1.9 ml (s, 3H), 2.41-2.40 (m, 1H),1.87-1.63 (m, 4H), 1.61-1.50 (m, 1H). 49A/ 49B 7-(6-(((1S,2S,3R,5R)-2-fluoro- L 1H NMR (300 MHz, DMSO-d6) ppm 13.08 (s, 1H), 8.38 (d, J = 9.8 Hz, 1H), 8.21 (s, 1H), 7.47- 7.27 (m, 2H), 6.21 (s, 1H), 5.11 (d, J = 31.5 Hz, 1H), 4.65 (d, J = 52.0 Hz, 1H), 3.55 (s, 2H), 3.06 (s, 3H), 2.40 (s, 4H), 2.26 (t, J = 12.4 Hz, 1H), 1.88- 1.64 (m, 4H), 1.56 (d, J = 12.2 Hz, 1H). 411 Column: CHIRALPAK IA, 2 * 25 cm, 5 um; Mobile Phase A: CO2, Mobile Phase B: MeOH: DCM = 4:1; Flow rate: 40 mL/min; Gradient: 40% B; 240 nm 4 8-azabicyclo[3.2.1]octan-3- 1H NMR (300 MHz, 411 5.3 yl)(methyl)amino)pyridazin-3- DMSO-d6) ppm yl)-6-hydroxy-2-methyl-4H- 13.08 (s, 1H), 8.38 chromen-4-one (d, J = 9.8 Hz, 1H), 7-(6-(((1R,2R,3S,5S)-2-fluoro- 8.21 (s, 1H), 7.47- 8-azabicyclo[3.2.1]octan-3- 7.27 (m, 2H), 6.21 yl)(methyl)amino)pyridazin-3- (s, 1H), 5.11 (d, J = yl)-6-hydroxy-2-methyl-4H- 31.5 Hz, 1H), 4.65 chromen-4-one (d, J = 52.0 Hz, 1H), 3.55 (s, 2H), 3.06 (s, 3H), 2.40 (s, 4H), 2.26 (t, J = 12.4 Hz, 1H), 1.88-1.64 (m, 4H), 1.56 (d, J = 12.2 Hz, 1H). 50A/ 50B 6-(6-(((1S,2S,3R,5R)-2-fluoro- L 1H NMR (400 MHz, Methanol-d4) ppm 8.50 (s, 1H), 8.21 (d, J = 9.9 Hz, 1H), 7.39 (d, J = 9.9 Hz, 1H), 6.98 (s, 1H), 6.17 (s, 1H), 5.28 (d, J = 31.8 Hz, 1H), 4.74 (d, J = 51.5 Hz, 1H), 3.70 (s, 2H), 3.14 (d, J = 1.9 Hz, 3H), 2.51-2.36 (m, 4H), 1.96 (dd, J = 32.7, 14.8 Hz, 4H), 1.69 (dd, J = 12.4, 5.8 Hz, 1H). 411 Column: CHIRALPAK IA, 2 * 25 cm, 5 um; Mobile Phase A: CO2, Mobile Phase B: EtOH- HPLC; Flow rate: 40 mL/min; Gradient: 50% B; 270 nm 4 8-azabicyclo[3.2.1]octan-3- 1H NMR (400 MHz, 411 6.2 yl)(methyl)amino)pyridazin-3- Methanol-d4) ppm yl)-7-hydroxy-2-methyl-4H- 8.50 (s, 1H), 8.21 (d, chromen-4-one J = 9.9 Hz, 1H), 7.39 6-(6-(((1R,2R,3S,5S)-2-fluoro- (d, J = 9.9 Hz, 1H), 8-azabicyclo[3.2.1]octan-3- 6.98 (s, 1H), 6.17 (s, yl)(methyl)amino)pyridazin-3- 1H), 5.28 (d, J = 31.8 yl)-7-hydroxy-2-methyl-4H- Hz, 1H), 4.74 (d, J = chromen-4-one 51.5 Hz, 1H), 3.70 (s, 2H), 3.14 (d, J = 1.9 Hz, 3H), 2.51-2.36 (m, 4H), 1.96 (dd, J = 32.7, 14.8 Hz, 4H), 1.69 (dd, J = 12.4, 5.8 Hz, 1H). 51A/ 51B 7-(6-(((1S,2S,3R,5R)-2-fluoro- 8-azabicyclo[3.2.1]octan-3- L 1H NMR (300 MHz, DMSO-d6) ppm 13.26 (s, 1H), 8.39 (d, J = 9.9 Hz, 1H), 8.24 (d, J = 3.2 Hz, 2H), 7.56 (s, 1H), 7.38 (d, J = 9.9 Hz, 1H), 5.09 (d, J = 31.8 Hz, 1H), 4.66 (d, J = 52.0 Hz, 1H), 3.55 (s, 2H), 3.50 (s, 3H), 3.07 (d, J = 1.8 Hz, 3H), 2.35- 2.16 (m, 1H), 1.88- 1.62 (m, 4H), 1.62- 1.48 (m, 1H). 411 Column: CHIRAL ART Cellulose-SB, 2 * 25 cm, 5 um; Mobile Phase A: MTBE (10 mM NH3- MEOH)- HPLC, Mobile Phase B: EtOH- HPLC; Flow rate: 18 mL/min; Gradient: 50 B to 50 B in 21 min; 240/280 nm 10.8 yl)(methyl)amino)pyridazin-3- 1H NMR (300 MHz, 411 13.5 yl)-6-hydroxy-3- DMSO-d6) ppm methylquinazolin-4(3H)-one 13.26 (s, 1H), 8.39 (d, 7-(6-(((1R,2R,3S,5S)-2-fluoro- J = 9.9 Hz, 1H), 8.24 8-azabicyclo[3.2.1]octan-3- (d, J = 3.2 Hz, 2H), yl)(methyl)amino)pyridazin-3- 7.56 (s, 1H), 7.38 yl)-6-hydroxy-3- (d, J = 9.9 Hz, 1H), methylquinazolin-4(3H)-one 5.09 (d, J = 31.8 Hz, 1H), 4.66 (d, J = 52.0 Hz, 1H), 3.55 (s, 2H), 3.50 (s, 3H), 3.07 (d, J = 1.8 Hz, 3H), 2.35- 2.16 (m, 1H), 1.88- 1.62 (m, 4H), 1.62- 1.48 (m, 1H). 52A/ 52B 4-fluoro-2-(6-(((1S,2S,3R,5R)- L 1H NMR (300 MHz, Methanol-d4) ppm 8.46 (dd, J = 2.5, 1.2 Hz, 1H), 8.18 (d, J = 9.9 Hz, 1H), 7.96 (d, J = 1.2 Hz, 1H), 7.90 (d, J = 12.4 Hz, 1H), 7.45 (d, J = 6.5 Hz, 1H), 7.34 (d, J = 9.8 Hz, 1H), 5.43-5.23 (m, 1H), 4.84-4.64 (m, 1H), 3.72- 3.65 (m, 2H), 3.14 (d, J = 1.8 Hz, 3H), 2.47- 2.35 (m, 1H), 2.06- 1.86 (m, 4H), 1.73- 1.64 (m, 1H). 414 Column: CHIRALPAK IF, 2 * 25 cm, 5 um; Mobile Phase A: Hex (10 mM NH3-MeOH), Mobile Phase B: IPA-HPLC; Flow rate: 18 mL/min; Gradient: 50 B to 50 B in 13 min; 312/220 nm; 10.3 2-fluoro-8- 1H NMR (300 MHz, 414 15.3 azabicyclo[3.2.1]octan-3- Methanol-d4) 8.45 yl)(methyl)amino)pyridazin-3- (dd, J = 2.5, 1.2 Hz, yl)-5-(1H-1,2,3-triazol-1- 1H), 8.18 (d, J = 9.9 yl)phenol Hz, 1H), 7.96 (d, J = 4-fluoro-2-(6-(((1R,2R,3S,5S)- 1.2 Hz, 1H), 7.90 (d, 2-fluoro-8- J = 12.4 Hz, 1H), 7.45 azabicyclo[3.2.1]octan-3- (d, J = 6.5 Hz, 1H), 7.34 (d, J = 9.8 Hz, yl)(methyl)amino)pyridazin-3- 1H), 5.43-5.23 (m, yl)-5-(1H-1,2,3-triazol-1- 1H), 4.84-4.64 (m, yl)phenol 1H), 3.72-3.65 (m, 2H), 3.14 (d, J = 1.8 Hz, 3H), 2.47-2.35 (m, 1H), 2.06-1.86 (m, 4H), 1.73- 1.64 (m, 1H). 53A/ 53B 2-fluoro-4-(6-(((1S,2S,3R,5R)- 2-fluoro-8- L 1H NMR (400 MHz, Methanol-d4) ppm 8.15 (d, J = 9.9 Hz, 1H), 7.68 (d, J = 10.7 Hz, 1H), 7.34 (d, J = 9.9 Hz, 1H), 6.93 (d, J = 5.9 Hz, 1H), 5.31 (dd, J = 38.1, 6.9 Hz, 1H), 4.73 (dt, J = 51.3, 3.4 Hz, 1H), 3.68 (s, 2H), 3.14 (d, J = 2.2 Hz, 6H), 3.03 (d, J = 1.2 Hz, 3H), 2.41 (td, J = 12.8, 3.1 Hz, 1H), 2.09-1.85 (m, 4H), 1.68 (dd, J = 12.0, 6.5 Hz, 1H). 418 Column: XBridge Shield RP18 OBD Column, 5 um, 19 * 150 mm; Mobile Phase A: Water (10 MMOL/L NH4HCO3 + 0.1% NH3H2O), Mobile Phase B: ACN; Flow rate: 20 mL/min; Gradient: 47% B to 77% B in 8 min; 254 nm 2.4 azabicyclo[3.2.1]octan-3- 1H NMR (400 MHz, 418 2.8 yl)(methyl)amino)pyridazin-3- Methanol-d4) ppm yl)-5-hydroxy-N,N- 8.15 (d, J = 9.9 Hz, dimethylbenzamide 1H), 7.68 (d, J = 10.7 2-fluoro-4-(6-(((1R,2R,3S,5S)- Hz, 1H), 7.34 (d, J = 2-fluoro-8- 9.9 Hz, 1H), 6.93 (d, azabicyclo[3.2.1]octan-3- J = 5.9 Hz, 1H), 5.31 yl)(methyl)amino)pyridazin-3- (dd, J = 38.1, 6.9 Hz, yl)-5-hydroxy-N,N- 1H), 4.73 (dt, J = 51.3, dimethylbenzamide 3.4 Hz, 1H), 3.68 (s, 2H), 3.14 (d, J = 2.2 Hz, 6H), 3.03 (d, J = 1.2 Hz, 3H), 2.41 (td, J = 12.8, 3.1 Hz, 1H), 2.09-1.85 (m, 4H), 1.68 (dd, J = 12.0, 6.5 Hz, 1H). 54A/ 54B 4-fluoro-6-(6-(((1S,2S,3R,5R)- L 1H NMR (300 MHz, Methanol-d4) ppm 8.32 (d, J = 9.9 Hz, 1H), 8.22 (s, 1H), 7.83 (d, J = 2.2 Hz, 1H), 7.38 (d, J = 9.9 Hz, 1H), 7.33 (d, J = 6.4 Hz, 1H), 5.52- 5.28 (m, 1H), 4.92- 4.70 (m, 1H), 3.85- 3.75 (m, 2H), 3.60 (s, 3H), 3.17 (d, J = 1.8 Hz, 3H), 2.63- 2.40 (m, 1H), 2.11- 1.95 (m, 4H), 1.79-1.70 (m, 1H). 428 CHIRALPAK IF, 2 * 25 cm, 5 um; Mobile Phase A: MTBE (10 mM NH3- MEOH)- HPLC, Mobile Phase B EtOH-HPLC; Flow rate: 20 mL/min; Gradient: 30 B to 30 B in 12.5 min; 290/254 nm; 7.5 2-fluoro-8- 1H NMR (300 MHz, 428 9.2 azabicyclo[3.2.1]octan-3- Methanol-d4) ppm yl)(methyl)amino)pyridazin-3- 8.31 (d, J = 9.9 Hz, yl)-7-hydroxy-2- 1H), 8.21 (s, 1H), methylisoquinolin-1(2H)-one 7.82 (d, J = 2.2 Hz, 4-fluoro-6-(6-(((1R,2R,3S,5S)- 1H), 7.37 (d, J = 9.9 2-fluoro-8- Hz, 1H), 7.32 (d, J = azabicyclo[3.2.1]octan-3- 6.4 Hz, 1H), 5.51- yl)(methyl)amino)pyridazin-3- 5.28 (m, 1H), 4.91- yl)-7-hydroxy-2- 4.70 (m, 1H), 3.85- methylisoquinolin-1(2H)-one 3.74 (m, 2H), 3.59 (s, 3H), 3.16 (d, J = 1.8 Hz, 3H), 2.62- 2.40 (m, 1H), 2.10- 1.95 (m, 4H), 1.78- 1.70 (m, 1H). 56A/ 56B 7-(6- L 1H NMR (300 MHz, DMSO-d6) ppm 13.09 (s, 1H), 8.41 (d, J = 9.9 Hz, 1H), 8.23 (d, J = 7.6 Hz, 2H), 7.68 (d, J = 9.8 Hz, 1H), 7.57 (s, 1H), 4.84 (t, J = 46.8 Hz, 2H), 3.61 (s, 2H), 3.50 (s, 3H), 2.66- 2.54 (m, 2H), 1.89- 1.60 (m, 5H), 1.13- 0.89 (m, 3H), 0.47 (q, J = 6.6, 6.1 Hz, 1H). 437 Column: CHIRALPAK IA, 2 * 25 cm, 5 um; Mobile Phase A: Hex (10 mM NH3-MeOH), Mobile Phase B: IPA; Flow rate: 18 mL/min; Gradient: 50 B to 50 B in 26 min; 243/276 nm 8.5 (cyclopropyl((1S,2S,3R,5R)-2- 1H NMR (300 MHz, 437 16.8 fluoro-8- DMSO-d6) ppm azabicyclo[3.2.1]octan-3- 13.09 (s, 1H), 8.41 yl)amino)pyridazin-3-yl)-6- (d, J = 9.9 Hz, 1H), hydroxy-3-methylquinazolin- 8.23 (d, J = 7.6 Hz, 4(3H)-one 2H), 7.68 (d, J = 9.8 7-(6- Hz, 1H), 7.57 (s, 1H), 4.84 (t, J = 46.8 (cyclopropyl((1R,2R,3S,5S)-2- Hz, 2H), 3.61 (s, 2H), fluoro-8- 3.50 (s, 3H), 2.66- azabicyclo[3.2.1]octan-3- 2.54 (m, 2H), 1.89- yl)amino)pyridazin-3-yl)-6- 1.60 (m, 5H), 1.13- hydroxy-3-methylquinazolin- 0.89 (m, 3H), 0.47 (q, 4(3H)-one J = 6.6, 6.1 Hz, 1H). 57A/ 57B azetidin-1-yl(6-(6- L 1H NMR (300 MHz, DMSO-d6) 13.12 (s, 1H), 8.37 (d, J = 9.9 Hz, 1H), 8.22 (s, 1H), 7.69 (d, J = 9.8 Hz, 1H), 7.34 (s, 1H), 7.21 (s, 1H), 4.81 (s, 1H), 4.80-4.53 (m, 3H), 4.09 (t, J = 7.7 Hz, 2H), 3.54 (s, 2H), 2.57 (d, J = 13.1 Hz, 1H), 2.36 (p, J = 7.7 Hz, 3H), 1.78 (s, 3H), 1.66 (d, J = 10.1 Hz, 2H), 1.07-0.97 (m, 3H), 0.45 (d, J = 7.5 Hz, 1H). 478 Column: CHIRALPAK IF, 2 * 25 cm, 5 um; Mobile Phase A: MTBE (10 mM NH3- MEOH)- HPLC, Mobile Phase B: EtOH- HPLC; Flow rate: 20 mL/min; Gradient: 50 B to 50 B in 14 min; 300/254 nm; 7.3 (cyclopropyl((1S,2S,3R,5R)-2- 1H NMR (300 MHz, 478 9.3 fluoro-8- DMSO-d6) 13.12 (s, azabicyclo[3.2.1]octan-3- 1H), 8.37 (d, J = 9.9 yl)amino)pyridazin-3-yl)-5- Hz, 1H), 8.22 (s, 1H), hydroxybenzofuran-2- 7.69 (d, J = 9.8 Hz, yl)methanone 1H), 7.34 (d, J = 0.9 azetidin-1-yl(6-(6- Hz, 1H), 7.21 (s, 1H), (cyclopropyl((1R,2R,3S,5S)-2- 4.88 (d, J = 25.6 Hz, fluoro-8- 1H), 4.81-4.52 (m, azabicyclo[3.2.1]octan-3- 3H), 4.09 (t, J = 7.7 yl)amino)pyridazin-3-yl)-5- Hz, 2H), 3.54 (s, 2H), hydroxybenzofuran-2- 2.57 (d, J = 13.1 Hz, yl)methanone 1H), 2.35 (p, J = 7.7 Hz, 3H), 1.78 (s, 3H), 1.66 (d, J = 10.1 Hz, 2H), 1.09-0.93 (m, 3H), 0.47 (d, J = 8.5 Hz, 1H). 58A/ 58B 0 7-(6-(((1S,2S,3R,5R)-2-fluoro- L 1H NMR (400 MHz, DMSO-d6) 8.42 (d, J = 9.9 Hz, 1H), 8.28 (s, 2H), 7.60 (s, 1H), 7.38 (d, J = 9.9 Hz, 1H), 5.87-5.73 (m, 1H), 5.00-4.93 (m, 2H), 4.79 (d, J = 50.8 Hz, 1H), 3.30-3.20 (m, 2H), 3.08 (d, J = 1.5 Hz, 3H), 2.47- 2.41 (m, 1H), 1.91- 1.87 (m, 3H), 1.79- 1.61 (m, 4H) 493 Instrument: SFC-80 (Thar, Waters) Column: AD 20 * 250 mm, 10 um (Daicel) Column temperature: 35 C. Mobile phase: CO2/ MeOH (0.2% Methanol Ammonia) = 50/50 Flow rate: 80 g/min Back pressure: 0.87 9-azabicyclo[3.3.1]nonan-3- 1H NMR (400 MHz, 493 100 bar 1.81 yl)(methyl)amino)pyridazin-3- DMSO-d6) 8.42 (d, Detection yl)-6-hydroxy-3-(2,2,2- J = 9.9 Hz, 1H), 8.28 wavelength: trifluoroethyl)quinazolin-4(3H)- (s, 2H), 7.60 (s, 1H), 214 nm one 7.38 (d, J = 9.9 Hz, Cycle time: 7-(6-(((1R,2R,3S,5S)-2-fluoro- 1H), 5.87-5.73 (m, 5.0 min 9-azabicyclo[3.3.1]nonan-3- 1H), 5.00-4.93 (m, Sample yl)(methyl)amino)pyridazin-3- 2H), 4.79 (d, J = 50.8 solution: yl)-6-hydroxy-3-(2,2,2- Hz, 1H), 3.30-3.20 500 mg trifluoroethyl)quinazolin-4(3H)- (m, 2H), 3.08 (d, J = dissolved in one 1.5 Hz, 3H), 2.47- 25 ml 2.41 (m, 1H), 1.91 Methanol (s, 3H), 1.79-1.61 Injection (m, 4H) volume: 1.9 ml 59A/ 59B 7-(6-(((1S,3R,5R)-6,6-difluoro- L 1H NMR (500 MHz, DMSO-d6) 8.40 (d, J = 8.0 Hz, 1H), 8.26 (d, J = 2.4 Hz, 2H), 7.57 (s, 1H), 7.31 (d, J = 7.8 Hz, 1H), 5.18- 5.12 (m, 1H), 4.98- 4.93 (m, 2H), 3.64 (s, 1H), 3.45 (d, J = 11.6 Hz, 2H), 3.01 (s, 3H), 2.88 (s, 1H), 2.44- 2.32 (m, 2H), 1.98- 1.92 (m, 1H), 1.84- 1.77 (m, 2H), 1.71- 1.69 (m, 1H) 497 Instrument: SFC-80 (Thar, Waters) Column: WHELK 20 * 250 mm, 10 um (Daicel) Column temperature: 35 C. Mobile phase: CO2/ MeOH (0.2% Methanol Ammonia) = 60/40 3.15 8-azabicyclo[3.2.1]octan-3- 1H NMR (500 MHz, 497 Flow rate: 3.56 yl)(methyl)amino)pyridazin-3- DMSO-d6) 8.40 (d, 80 g/min yl)-6-hydroxy-3-(2,2,2- J = 8.0 Hz, 1H), 8.26 Back pressure: trifluoroethyl)quinazolin-4(3H)- (d, J = 2.4 Hz, 2H), 100 bar one 7.57 (s, 1H), 7.31 (d, Detection 7-(6-(((1R,3S,5S)-6,6-difluoro- J = 7.8 Hz, 1H), 5.18- wavelength: 8-azabicyclo[3.2.1]octan-3- 5.12 (m, 1H), 4.98- 214 nm yl)(methyl)amino)pyridazin-3- 4.93 (m, 2H), 3.64 (s, Cycle time: 1H),3.45 (d, J = 11.6 3.0 min yl)-6-hydroxy-3-(2,2,2- Hz, 2H), 3.01 (s, 3H), Sample trifluoroethyl)quinazolin-4(3H)- 2.88 (s, 1H), 2.44- solution: one 2.32 (m, 2H), 1.98- 400 mg 1.92 (m, 1H), 1.84- dissolved in 1.77 (m, 2H), 1.71- 35 ml 1.69 (m, 1H) Methanol 60A/ 60B 7-(6- L 1H NMR (300 MHz, DMSO-d6) ppm 13.23 (s, 1H), 8.43 (dd, J = 9.9, 1.9 Hz, 1H), 8.28 (d, J = 1.8 Hz, 2H), 7.69 (d, J = 9.6 Hz, 1H), 7.61 (s, 1H), 4.97 (q, J = 9.1 Hz, 3H), 4.76 (d, J = 52.3 Hz, 1H), 3.64 (d, J = 29.2 Hz, 2H), 3.18 (s, 1H), 2.63 (d, J = 35.8 Hz, 2H), 2.03- 1.52 (m, 5H), 1.05 (d, J = 5.2 Hz, 3H), 0.48 (s, 1H). 505 Column: CHIRALPAK IE, 2 * 25 cm, 5 um; Mobile Phase A: MTBE (10 mM NH3- MEOH)- HPLC, Mobile Phase B: MeOH- HPLC; Flow rate: 20 mL/min; Gradient: 40 B to 40 B in 8 min; 250/220 nm 4.3 (cyclopropyl((1S,2S,3R,5R)-2- 1H NMR (300 MHz, 505 5.5 fluoro-8- DMSO-d6) ppm azabicyclo[3.2.1]octan-3- 13.23 (s, 1H), 8.43 yl)amino)pyridazin-3-yl)-6- (dd, J = 9.9, 1.9 Hz, hydroxy-3-(2,2,2- 1H), 8.28 (d, J = 1.8 trifluoroethyl)quinazolin-4(3H)- Hz, 2H), 7.69 (d, J = one 9.6 Hz, 1H), 7.61 (s, 7-(6- 1H), 4.97 (q, J = 9.1 (cyclopropyl((1R,2R,3S,5S)-2- Hz, 3H), 4.76 (d, fluoro-8- J = 52.3 Hz, 1H), azabicyclo[3.2.1]octan-3- 3.64 (d, J = 29.2 Hz, yl)amino)pyridazin-3-yl)-6- 2H), 3.18 (s, 1H), hydroxy-3-(2,2,2- 2.63 (d, J = 35.8 Hz, trifluoroethyl)quinazolin-4(3H)- 2H), 2.03-1.52 (m, one 5H), 1.05 (d, J = 5.2 Hz, 3H), 0.48 (s, 1H). 61A/ 61B 2-(6-(((1S,2S,3R,5R)-2-fluoro- 8-azabicyclo[3.2.1]octan-3- J 1H NMR (400 MHz, DMSO-d6) 14.09 (s, 1H), 8.91 (s, 1H), 8.32 (d, J = 9.9 Hz, 1H), 8.13 (d, J = 8.5 Hz, 1H), 7.99 (s, 1H), 7.58-7.47 (m, 2H), 7.42 (d, J = 9.9 Hz, 1H), 5.18-4.94 (m, 1H), 4.77-4.47 (m, 1H), 3.55 (s, 2H), 3.05 (s, 3H), 2.41 (s, 1H), 2.30-2.14 (m, 1H), 1.87-1.47 (m, 5H). 396 Instrument: SFC-150 (Thar, Waters) Column: AD 20 * 250 mm, 10 um (Daicel) Column temperature: 35 C. Mobile phase: CO2/MeOH/ ACN = 1:1 (0.2% Methanol Ammonia) = 50/50 Flow rate: 100 g/min Back pressure: 100 bar 1.36 yl)(methyl)amino)pyridazin-3- 1H NMR (400 MHz, 396 Detection 3.43 yl)-5-(1H-1,2,3-triazol-1- DMSO-d6) 14.09 wavelength: yl)phenol (s, 1H), 8.91 (s, 1H), 214 nm 2-(6-(((1R,2R,3S,5S)-2-fluoro- 8.32 (d, J = 9.9 Hz, Cycle time: 8-azabicyclo[3.2.1]octan-3- 1H), 8.13 (d, J = 8.5 7.3 min yl)(methyl)amino)pyridazin-3- Hz, 1H), 7.99 (s, 1H), Sample yl)-5-(1H-1,2,3-triazol-1- 7.58-7.47 (m, 2H), solution: 160 yl)phenol 7.42 (d, J = 9.9 Hz, mg dissolved 1H), 5.18-4.94 (m, in 10 ml 1H), 4.77-4.47 (m, Methanol 1H), 3.55 (s, 2H), Injection 3.05 (s, 3H), 2.41 volume: (s, 1H), 2.30-2.14 1.5 ml (m, 1H), 1.87-1.47 (m, 5H). 62A/ 62B 2-(6-(((1S,2S,3R,5R)-2-fluoro- J 1H NMR (400 MHz, DMSO-d6) 8.92 (d, J = 0.8 Hz, 1H), 8.32 (d, J = 9.9 Hz, 1H), 8.13 (d, J = 8.5 Hz, 1H), 8.00 (d, J = 0.8 Hz, 1H), 7.59-7.50 (m, 2H), 7.40 (d, J = 9.9 Hz, 1H), 5.84- 5.61 (m, 1H), 4.85- 4.63 (m, 1H), 3.24- 3.13 (m, 2H), 3.06 (d, J = 1.4 Hz, 3H), 2.51-2.33 (m, 2H), 1.91-1.55 (m, 7H). 410 Instrument: SFC-150 (Waters) Column: AD 20 * 250 mm, 10 um (Daicel) Column temperature: 35 C. Mobile phase: CO2/ MeOH/ACN (0.2% Methanol Ammonia) = 30/70 Flow rate: 100 g/min Back pressure: 1.08 9-azabicyclo[3.3.1]nonan-3- 1H NMR (400 MHz, 410 100 bar 3.75 yl)(methyl)amino)pyridazin-3- DMSO-d6) 8.92 (d, Detection yl)-5-(1H-1,2,3-triazol-1- J = 0.8 Hz, 1H), 8.32 wavelength: yl)phenol (d, J = 9.9 Hz, 1H), 214 nm 2-(6-(((1R,2R,3S,5S)-2-fluoro- 8.13 (d, J = 8.5 Hz, Cycle time: 9-azabicyclo[3.3.1]nonan-3- 1H), 8.00 (d, J = 0.8 9 min yl)(methyl)amino)pyridazin-3- Hz, 1H), 7.59-7.50 Sample yl)-5-(1H-1,2,3-triazol-1- (m, 2H), 7.40 (d, J = solution: yl)phenol 9.9 Hz, 1H), 5.84- 170 mg 5.61 (m, 1H), 4.85- dissolved in 4.63 (m, 1H), 3.24- 25 ml 3.13 (m, 2H), 3.06 Methanol (d, J = 1.4 Hz, 3H), Injection 2.51-2.33 (m, 2H), volume: 5 ml 1.91-1.55 (m, 7H). 63A/ 63B 1-(4-(6-(((1S,2S,3R,5R)-2- J 1H NMR (500 MHz, DMSO-d6) 8.86- 8.79 (m, 1H), 8.62 (d, J = 1.1 Hz, 1H), 8.35-8.33 (m, 1H), 8.09 (d, J = 8.7 Hz, 1H), 7.40 (d, J = 9.9 Hz, 1H), 7.37 (d, J = 2.3 Hz, 1H), 7.31- 7.28 (m, 1H), 5.76- 5.65 (m, 1H), 4.73 (d, J = 51.0 Hz, 1H), 3.27-3.16 (m, 3H), 3.05 (s, 3H), 2.45- 2.33 (m, 1H), 1.94- 1.83 (m, 3H), 1.74- 1.53 (m, 4H). 434 Instrument: Gilson-281 Column: IG 20 * 250, 10 um Mobile Phase: ACN (0.1% DEA):MEOH (0.1% DEA) = 70:30 FlowRate : 50 ml/min Run time per injection: 19 min Injection: 3 ml Sample solution: 200 mg in 21 mL MEOH 10.2 fluoro-9- 1H NMR (500 MHz, 434 27.2 azabicyclo[3.3.1]nonan-3- DMSO-d6) 8.86- yl)(methyl)amino)pyridazin-3- 8.79 (m, 1H), 8.62 yl)-3-hydroxyphenyl)-1H- (d, J = 1.1 Hz, 1H), imidazole-4-carbonitrile 8.35-8.33 (m, 1H), 1-(4-(6-(((1R,2R,3S,5S)-2- 8.09 (d, J = 8.7 Hz, fluoro-9- 1H), 7.40 (d, J = 9.9 azabicyclo[3.3.1]nonan-3- Hz, 1H), 7.37 (d, J = yl)(methyl)amino)pyridazin-3- 2.3 Hz, 1H), 7.31- yl)-3-hydroxyphenyl)-1H- 7.28 (m, 1H), 5.76- imidazole-4-carbonitrile 5.65 (m, 1H), 4.73 (d, J = 51.0 Hz, 1H), 3.27-3.16 (m, 3H), 3.05 (s, 3H), 2.45- 2.33 (m, 1H), 1.94- 1.83 (m, 3H), 1.74- 1.53 (m, 4H). 64A/ 64B 2-(6-(((1S,3R,5R)-6,6-difluoro- J 1H NMR (400 MHz, DMSO-d6) 8.65 (s, 1H), 8.29 (d, J = 10.0 Hz, 1H), 8.08 (d, J = 8.3 Hz, 1H), 7.48 (s, 1H), 7.46 (d, J = 2.2 Hz, 1H), 7.35 (d, J = 9.9 Hz, 1H), 5.11 (s, 1H), 3.64 (s, 1H), 3.45 (d, J = 14.2 Hz, 1H), 2.99 (s, 3H), 2.77- 2.67 (m, 2H), 2.42- 2.28 (m, 2H), 2.00- 1.88 (m, 1H), 1.86- 1.74 (m, 2H), 1.73- 1.63 (m, 1H), 1.33- 1.22 (m, 3H). 442 Instrument: SFC-80 (Thar, Waters) Column: OJ 20 * 250 mm, 10 um (Daicel) Column temperature: 35 C. Mobile phase: CO2/ MeOH (0.2% Methanol Ammonia) = 65/35 Flow rate: 80 g/min Back pressure: 100 bar Detection wavelength: 2.53 8- 1H NMR (400 MHz, 442 214 nm 3.23 azabicyclo[3.2.1]octan-3- DMSO-d6) 8.65 (s, Cycle time: yl)(methyl)amino)pyridazin-3- 1H), 8.29 (d, J = 10.0 3.5 min yl)-5-(4-ethyl-1H-1,2,3-triazol- Hz, 1H), 8.08 (d, J = Sample 1-yl)phenol 8.2 Hz, 1H), 7.48 (s, solution: 2-(6-(((1R,3S,5S)-6,6-difluoro- 1H), 7.46 (d, J = 2.2 180 mg 8-azabicyclo[3.2.1]octan-3- Hz, 1H), 7.35 (d, dissolved in yl)(methyl)amino)pyridazin-3- J = 9.9 Hz, 1H), 5.11 20 ml yl)-5-(4-ethyl-1H-1,2,3-triazol- (s, 1H), 3.64 (s, 1H), Methanol 1-yl)phenol 3.45 (d, J = 12.3 Hz, Injection 1H), 2.97 (s, 3H), volume: 2.81-2.66 (m, 2H), 1.0 ml 2.40-2.26 (m, 2H), 2.02-1.87 (m, 1H), 1.83-1.74 (m, 2H), 1.74-1.62 (m, 1H), 1.33-1.19 (m, 3H). 65A/ 65B (1S,2S,3R,5R)-2-fluoro-N- R 1H NMR (400 MHz, DMSO-d6) 9.22 (s, 1H), 8.46 (d, J = 12.8 Hz, 1H), 8.17 (d, J = 10.0 Hz,1H), 8.10 (s, 1H), 7.77 (d, J = 5.2 Hz 1H), 7.28 (d, J = 9.6 Hz, 1H), 5.29- 5.17 (m, 1H), 4.79- 4.63 (m, 1H), 3.65 (s, 2H), 3.04 (s, 3H), 2.02-1.46 (m, 6H). 370 Instrument: SFC-200 (Thar, Waters) Column: AD 20 * 250 mm, 10 um (Daicel) Column temperature: 35 C. Mobile phase: CO2/MEOH (0.2% Methanol Ammonia) = 80/20 Flow rate: 120 g/min 1.05 methyl-N-(6-(thieno[2,3- 1H NMR (400 MHz, 370 Back pressure: 2.07 c]pyridin-2-yl)pyridazin-3-yl)- DMSO-d6) 9.22 (s, 100 bar 8-azabicyclo[3.2.1]octan-3- 1H), 8.46 (d, J = 12.8 Detection amine Hz, 1H), 8.17 (d, J = wavelength: (1R,2R,3S,5S)-2-fluoro-N- 10.0 Hz,1H), 8.10 (s, 214 nm methyl-N-(6-(thieno[2,3- 1H), 7.77 (d, J = 5.2 Cycle time: c]pyridin-2-yl)pyridazin-3-yl)- Hz 1H), 7.28 (d, J = 4.1 min 8-azabicyclo[3.2.1]octan-3- 9.6 Hz, 1H), 5.29- Sample amine 5.17 (m, 1H), 4.79- solution: 4.63 (m, 1H), 3.65 6000 mg (s, 2H), 3.04 (s, 3H), dissolved in 2.02-1.46 (m, 6H). 110 ml MEOH Injection volume: 2 ml 66A/ 66B 2-(6-(((1S,2S,3R,5R)-2-fluoro- R 1H NMR (400 MHz, DMSO-d6) 11.80- 11.40 (m, 1H), 8.09- 8.06 (m, 1H), 7.88 (s, 1H), 7.30 (d, J = 6.8 Hz, 1H), 7.23-7.20 (m, 1H), 6.65 (d, J = 6.8 Hz, 1H), 5.32- 5.19 (m, 1H), 4.70- 4.51 (m, 1H), 3.52 (s, 2H), 3.02 (d, J = 1.6 Hz, 3H), 2.25-2.18 (m, 1H), 1.84-1.65 (m, 4H), 1.54-1.49 (m, 1H). 386 Instrument: SFC-200 (Thar, Waters) Column: AD 20 * 250 mm, 10 um (Daicel) Column temperature: 35 C. Mobile phase: CO2/IPA (0.2% Methanol Ammonia)= 80/20 Flow rate: 130 g/min Back pressure: 100 bar Detection 1.02 8-azabicyclo[3.2.1]octan-3- 1H NMR (400 MHz, 386 wavelength: 1.7 yl)(methyl)amino)pyridazin-3- DMSO-d6) 11.80- 214 nm yl)thieno[2,3-c]pyridin-7(6H)- 11.40 (m, 1H), 8.09- Cycle time: one 8.06 (m, 1H), 7.88 (s, 4 min 2-(6-(((1R,2R,3S,5S)-2-fluoro- 1H), 7.30 (d, J = 6.8 Sample 8-azabicyclo[3.2.1]octan-3- Hz, 1H), 7.23-7.20 solution: yl)(methyl)amino)pyridazin-3- (m, 1H), 6.65 (d, J = 15000 mg yl)thieno[2,3-c]pyridin-7(6H)- 6.8 Hz, 1H), 5.32- dissolved in one 5.19 (m, 1H), 4.70- 410 ml 4.51 (m, 1H), 3.52 (s, MEOH 2H), 3.02 (d, J = 1.6 Injection Hz, 3H), 2.25-2.18 volume: 3 ml (m, 1H), 1.84-1.65 (m, 4H), 1.54-1.49 (m, 1H). 67A/ 67B 2-(6-(((1S,2S,3R,5R)-2-fluoro- R 1H NMR (400 MHz, Methanol-d4) 8.00 (d, J = 9.6 Hz, 1H), 7.73 (s, 1H), 7.50 (d, J = 7.2 Hz, 1H), 7.22 (d, J = 9.6 Hz, 1H), 6.82 (d, J = 7.2 Hz, 1H), 5.59-5.44 (m, 1H), 5.11-4.97 (m, 1H), 4.22-4.15 (m, 2H), 3.66 (s, 3H), 3.12 (d, J = 1.6 Hz, 3H), 2.67-2.59 (m, 1H), 2.26-2.14 (m, 4H), 1.97-1.90 (m, 1H). 400 Instrument: SFC-200 (Thar, Waters) Column: AD 20 * 250 mm, 10 um (Daicel) Column temperature: 35 C. Mobile phase: CO2/IPA (0.2% Methanol Ammonia) = 80/20 Flow rate: 130 g/min Back pressure: 100 bar Detection 1.02 8-azabicyclo[3.2.1]octan-3- 1H NMR (400 MHz, 400 wavelength: 1.7 yl)(methyl)amino)pyridazin-3- Methanol-d4) 8.00 214 nm yl)-6-methylthieno[2,3- (d, J = 9.6 Hz, 1H), Cycle time: c]pyridin-7(6H)-one 7.73 (s, 1H), 7.50 (d, 4 min 2-(6-(((1R,2R,3S,5S)-2-fluoro- J = 7.2 Hz, 1H), 7.22 Sample 8-azabicyclo[3.2.1]octan-3- (d, J = 9.6 Hz, 1H), solution: yl)(methyl)amino)pyridazin-3- 6.82 (d, J = 7.2 Hz, 15000 mg yl)-6-methylthieno[2,3- 1H), 5.59-5.44 (m, dissolved in c]pyridin-7(6H)-one 1H), 5.11-4.97 (m, 410 ml 1H), 4.22-4.15 (m, MEOH 2H), 3.66 (s, 3H), Injection 3.12 (d, J = 1.6 Hz, volume: 3 ml 3H), 2.67-2.59 (m, 1H), 2.26-2.14 (m, 4H), 1.97-1.90 (m, 1H). 68A/ 68B 0 2-(6-(((1R,2R,3S,5S)-2-fluoro- 8-azabicyclo[3.2.1]octan-3- R 1H NMR (400 MHz, DMSO-d6) 8.22 (d, J = 9.6 Hz, 1H), 8.08 (s, 1H), 7.60 (d, J = 7.2 Hz, 1H), 7.17 (d, J = 9.6 Hz, 2H), 5.22- 5.08 (m, 1H), 4.67- 4.44 (m, 2H), 3.52 (s, 3H), 3.39-3.38 (m, 2 H), 3.03-3.00 (m, 3H), 2.25-2.18 (m, 1H), 2.02-1.95 (m, 1H), 1.79-1.75 (m, 2H), 1.53-1.49 (m, 2H), 1.25-1.21 (m, 1H) 400 Instrument: SFC-80 (Thar, Waters) Column: AD 20 * 250 mm, 10 um (Daicel) Column temperature: 35 C. Mobile phase: CO2/MeOH (0.2% Methanol Ammonia) = 70/30 Flow rate: 80 g/min 1.05 yl)(methyl)amino)pyridazin-3- 1H NMR (400 MHz, 400 Back pressure: 2.07 yl)-5-methylthieno[3,2- DMSO-d6) 8.22 (d, 100 bar c]pyridin-4(5H)-one J = 9.6 Hz, 1H), 8.08 Detection 2-(6-(((1S,2S,3R,5R)-2-fluoro- (s, 1H), 7.60 (d, J = wavelength: 8-azabicyclo[3.2.1]octan-3- 7.2 Hz, 1H), 7.17 (d, 214 nm yl)(methyl)amino)pyridazin-3- J = 9.6 Hz, 2H), Cycle time: yl)-5-methylthieno[3,2- 5.22-5.08 (m, 1H), 3.5 min c]pyridin-4(5H)-one 4.67-4.44 (m, 2H), Sample 3.52 (s, 3H), 3.39- solution: 3.38 (m, 2 H), 3.03- 10000 mg 3.00 (m, 3H), 2.25- dissolved in 2.18 (m, 1H), 2.02- 210 ml 1.95 (m, 1H), 1.79- Methanol 1.75 (m, 2H), 1.53- Injection 1.49 (m, 2H), 1.25- volume: 1.21 (m, 1H) 1.9 ml 69A/ 69B 1-(4-(6-(((1S,2S,3R,5R)-2- R 1H NMR (400 MHz, DMSO-d6) 14.23 (s, 1H), 8.83 (d, J = 1.2 Hz, 1H), 8.62 (d, J = 1.2 Hz, 1H), 8.33 (d, J = 10.0 Hz, 1H), 8.10 (d, J = 8.7 Hz, 1H), 7.43 (d, J = 10.0 Hz, 1H), 7.37 (d, J = 2.3 Hz, 1H), 7.31- 7.28 (m, 1H), 5.13- 4.90 (m, 1H), 4.66- 4.62 (m, 1H), 3.53 (s, 2H), 3.04 (s, 3H), 2.32-2.19 (m, 1H), 1.82-1.50 (m, 5H). 420 Instrument: SFC-200 (Thar, Waters) Column: AD 20 * 250 mm, 10 um (Daicel) Column temperature: 35 C. Mobile phase: CO2/MEOH (0.2% Methanol Ammonia) = 80/20 Flow rate: 120 g/min Back pressure: 100 bar Detection wavelength: 214 nm 1.05 fluoro-8- 1H NMR (400 MHz, 420 Cycle time: 2.07 azabicyclo[3.2.1]octan-3- DMSO-d6) 14.23 4.1 min yl)(methyl)amino)pyridazin-3- (s, 1H), 8.83 (d, J = Sample yl)-3-hydroxyphenyl)-1H- 1.2 Hz, 1H), 8.62 (d, solution: imidazole-4-carbonitrile J = 1.2 Hz, 1H), 8.33 6000 mg 1-(4-(6-(((1R,2R,3S,5S)-2- (d, J = 10.0 Hz, 1H), dissolved in fluoro-8- 8.10 (d, J = 8.7 Hz, 110 ml azabicyclo[3.2.1]octan-3- 1H), 7.43 (d, J = 10.0 MEOH yl)(methyl)amino)pyridazin-3- Hz, 1H), 7.37 (d, J = Injection yl)-3-hydroxyphenyl)-1H- 2.3 Hz, 1H), 7.31- volume: 2 ml imidazole-4-carbonitrile 7.28 (m, 1H), 5.13- 4.90 (m, 1H), 4.66- 4.62 (m, 1H), 3.53 (s, 2H), 3.04 (s, 3H), 2.32-2.19 (m, 1H), 1.82-1.50 (m, 5H). 70A/ 70B 3-(6-(((1S,2S,3R,5R)-2-fluoro- Q 1H NMR (400 MHz, DMSO-d6) 8.45 (d, J = 1.9 Hz, 1H), 8.38 (d, J = 9.9 Hz, 1H), 7.71-7.69 (m, 1H), 7.43 (d, J = 9.9 Hz, 1H), 7.09 (d, J = 8.6 Hz, 1H), 5.10-5.00 (m, 1H), 4.71-4.57 (m, 1H), 3.55 (s, 2H), 3.05 (d, J = 1.5 Hz, 3H), 2.28-2.21 (m, 1H), 1.83-1.66 (m, 4H), 1.57-1.53 (m, 1H) 354 Instrument: SFC-200 (Thar, Waters) Column: AD 20 * 250 mm, 10 um (Daicel) Column temperature: 35 C. Mobile phase: CO2/MEOH (0.2% Methanol Ammonia) = 80/20 Flow rate: 1.05 8-azabicyclo[3.2.1]octan-3- 1H NMR (400 MHz, 354 120 g/min 2.07 yl)(methyl)amino)pyridazin-3- DMSO-d6) 8.45 (d, Back pressure: yl)-4-hydroxybenzonitrile J = 2.0 Hz, 1H), 8.38 100 bar 3-(6-(((1R,2R,3S,5S)-2-fluoro- (d, J = 10.0 Hz, 1H), Detection 8-azabicyclo[3.2.1]octan-3- 7.72-7.69 (m, 1H), wavelength: yl)(methyl)amino)pyridazin-3- 7.45 (d, J = 9.9 Hz, 214 nm yl)-4-hydroxybenzonitrile 1H), 7.10 (d, J = 8.6 Cycle time: Hz, 1H), 5.12-5.00 4.1 min (m, 1H), 4.78-4.64 Sample (m, 1H), 3.64 (s, 2H), solution: 3.05 (d, J = 1.5 Hz, 6000 mg 3H), 2.33-2.26 (m, dissolved in 1H), 1.83-1.70 (m, 110 ml 4H), 1.62-1.57 (m, MEOH 1H) Injection volume: 2 ml 71A/ 71B 5-(6-(((1R,2R,3S,5S)-2-fluoro- 8-azabicyclo[3.2.1]octan-3- Q 1H NMR (400 MHz, Methanol-d4) 8.72 (s, 1H), 8.27 (d, J = 9.6 Hz, 1H), 7.30 (d, J = 9.6 Hz, 1H), 7.18 (s, 1H), 5.50-5.38 (m, 1H), 4.00-3.97 (m, 2H), 3.14 (d, J = 2.0 Hz, 3H), 2.57- 2.50 (m, 1H), 2.16- 2.05 (m, 4H), 1.86- 1.81 (m, 1H). 355 Instrument: SFC-200 (Thar, Waters) Column: AD 20 * 250 mm, 10 um (Daicel) Column temperature: 35 C. Mobile phase: CO2/MEOH (0.2% Methanol Ammonia) = 80/20 Flow rate: 120 g/min 1.05 yl)(methyl)amino)pyridazin-3- 1H NMR (400 MHz, 355 Back pressure: 2.07 yl)-4-hydroxypicolinonitrile Methanol-d4) 8.72 100 bar 5-(6-(((1S,2S,3R,5R)-2-fluoro- (s, 1H), 8.27 (d, J = Detection 8-azabicyclo[3.2.1]octan-3- 9.6 Hz, 1H), 7.30 (d, wavelength: yl)(methyl)amino)pyridazin-3- J = 9.6 Hz, 1H), 7.18 214 nm yl)-4-hydroxypicolinonitrile (s, 1H), 5.50-5.38 (m, Cycle time: 1H), 4.00-3.97 (m, 4.1 min 2H), 3.14 (d, J = 2.0 Sample Hz, 3H), 2.57-2.50 solution: (m, 1H), 2.16-2.05 6000 mg (m, 4H), 1.86-1.81 dissolved in (m, 1H). 110 ml MEOH Injection volume: 2 ml 72A/ 72B 2-fluoro-5-(6-(((1S,2S,3R,5R)- Q 1H NMR (500 MHz, DMSO-d6) 8.53 (d, J = 7.5 Hz, 1H), 8.36 (d, J = 10.0 Hz, 1H), 7.52 (d, J = 10.0 Hz, 1H), 7.05 (d, J = 11.5 Hz, 1H), 5.14-5.03 (m, 1H), 5.95-4.85 (m, 1H), 3.97-3.88 (m, 2H), 3.06 (s, 3H), 2.46-2.40 (m, 1H), 1.98-1.82 (m, 4H), 1.76-1.72 (m, 1H). 372 Instrument: SFC-80 (Thar, Waters) Column: WHELK 20 * 250 mm, 10 um (Regis) Column temperature: 35 C. Mobile phase: CO2/ MeOH (0.2% Methanol Ammonia) = 65/35 2.58 2-fluoro-8- 1H NMR (500 MHz, 372 Flow rate: 3.07 azabicyclo[3.2.1]octan-3- DMSO-d6) 15.24 80 g/min yl)(methyl)amino)pyridazin-3- (m, 1H), 9.20 (m, Back pressure: yl)-4-hydroxybenzonitrile 1H), 8.55 (d, J = 7.5 100 bar 2-fluoro-5-(6-(((1R,2R,3S,5S)- Hz, 1H), 8.37 (d, J = Detection 2-fluoro-8- 10.0 Hz, 1H), 7.56 wavelength: azabicyclo[3.2.1]octan-3- (d, J = 10.0 Hz, 1H), 214 nm yl)(methyl)amino)pyridazin-3- 7.09 (d, J = 11.0 Hz, Cycle time: yl)-4-hydroxybenzonitrile 1H), 5.19-5.02 (m, 3.3 min 2H), 4.26-4.14 (m, Sample 2H), 3.07 (s, 3H), solution: 2.58-2.50 (m, 1H), 300 mg 2.15-1.96 (m, 4H), dissolved in 1.89-1.87 (m, 1H). 30 ml Methanol Injection volume: 0.6 ml 73A/ 73B 7-(6-(((1S,2S,3R,5R)-2-fluoro- Q 1H NMR (400 MHz, DMSO-d6) 13.35 (s, 1H), 8.76-8.71 (m, 1H), 8.57 (s, 1H), 8.48 (d, J = 10.0 Hz, 1H), 8.20-8.14 (m, 1H), 7.49-7.39 (m, 2H), 7.35 (s, 1H), 5.20-5.00 (m, 1H), 4.77-4.54 (m, 1H), 3.60-3.50 (m, 2H), 3.07 (s, 3H), 2.31- 2.20 (m, 1H), 1.89- 1.63 (m, 4H), 1.61- 1.51 (m, 1H). 380 Instrument: SFC-200 (Thar, Waters) Column: AD 20 * 250 mm, 10 um (Daicel) Column temperature: 35 C. Mobile phase: CO2/MEOH (0.2% Methanol Ammonia) = 80/20 Flow rate: 1.05 8-azabicyclo[3.2.1]octan-3- 1H NMR (400 MHz, 380 120 g/min 2.07 yl)(methyl)amino)pyridazin-3- DMSO-d6) 13.35 Back pressure: yl)quinolin-6-ol (s, 1H), 8.76-8.70 (m, 100 bar 7-(6-(((1R,2R,3S,5S)-2-fluoro- 1H), 8.57 (s, 1H), 8.48 Detection 8-azabicyclo[3.2.1]octan-3- (d, J = 10.0 Hz, 1H), wavelength: yl)(methyl)amino)pyridazin-3- 8.21-8.14 (m, 1H), 214 nm yl)quinolin-6-ol 7.48-7.39 (m, 2H), Cycle time: 7.35 (s, 1H), 5.23- 4.1 min 4.99 (m, 1H), 4.76- Sample 4.55 (m, 1H), 3.60- solution: 3.50 (m, 2H), 3.07 6000 mg (s, 3H), 2.32-2.19 dissolved in (m, 1H), 1.89-1.62 110 ml (m, 4H), 1.61-1.50 MEOH (m, 1H). Injection volume: 2 ml 74A/ 74B 6-(6-(((1S,2S,3R,5R)-2-fluoro- 8-azabicyclo[3.2.1]octan-3- Q 1H NMR (400 MHz, DMSO-d6) 13.28 (s, 1H), 8.79 (dd, J = 4.2, 1.7 Hz, 1H), 8.57 (s, 1H), 8.35 (d, J = 9.9 Hz, 1H), 8.30 (d, J = 7.1 Hz, 1H), 7.43 (d, J = 9.9 Hz, 1H), 7.38 (s, 1H), 7.34 (dd, J = 8.2, 4.2 Hz, 1H), 5.21-5.04 (m, 1H), 4.70-4.60 (m, 1H), 3.60-3.48 (m, 2H), 3.07 (s, 3H), 2.30-2.21 (m, 1H), 1.85-1.64 (m, 4H), 1.60-1.52 (m, 1H). 380 Instrument: SFC-200 (Thar, Waters) Column: AD 20 * 250 mm, 10 um (Daicel) Column temperature: 35 C. Mobile phase: CO2/MEOH (0.2% Methanol Ammonia) = 80/20 Flow rate: 120 g/min 1.05 yl)(methyl)amino)pyridazin-3- Back pressure: yl)quinolin-7-ol 1H NMR (400 MHz, 380 100 bar 2.07 6-(6-(((1R,2R,3S,5S)-2-fluoro- DMSO-d6) 13.28 Detection 8-azabicyclo[3.2.1]octan-3- (s, 1H), 8.79 (dd, J = wavelength: yl)(methyl)amino)pyridazin-3- 4.2, 1.7 Hz, 1H), 8.57 214 nm yl)quinolin-7-ol (s, 1H), 8.35 (d, J = Cycle time: 9.9 Hz, 1H), 8.30 (d, 4.1 min J = 7.1 Hz, 1H), 7.43 Sample (d, J = 9.9 Hz, 1H), solution: 7.38 (s, 1H), 7.34 (dd, 6000 mg J = 8.2, 4.2 Hz, 1H), dissolved in 5.21-5.04 (m, 1H), 110 ml 4.70-4.60 (m, 1H), MEOH 3.60-3.48 (m, 2H), Injection 3.07 (s, 3H), 2.30 volume: 2 ml 2.21 (m, 1H), 1.85- 1.64 (m, 4H), 1.60- 1.52 (m, 1H). 75A/ 75B 6-(6-(((1S,2S,3R,5R)-2-fluoro- Q 1H NMR (500 MHz, DMSO-d6) 9.41 (s, 1H), 9.12 (s, 1H), 8.75 (s, 1H), 8.35 (d, J = 9.8 Hz, 1H), 7.46 (d, J = 9.8 Hz, 1H), 7.32 (s, 1H), 5.27-4.98 (m, 1H), 4.78-4.68 (m, 1H), 3.70-3.56 (m, 2H), 3.07 (s, 3H), 2.33- 2.22 (m, 1H), 1.89- 1.59 (m, 5H). 381 Instrument: SFC-200 (Thar, Waters) Column: AD 20 * 250 mm, 10 um (Daicel) Column temperature: 35 C. Mobile phase: CO2/MEOH (0.2% Methanol Ammonia) = 80/20 Flow rate: 1.05 8-azabicyclo[3.2.1]octan-3- 1H NMR (500 MHz, 381 120 g/min 2.07 yl)(methyl)amino)pyridazin-3- DMSO-d6) 9.41 (s, Back pressure: yl)quinazolin-7-ol 1H), 9.12 (s, 1H), 100 bar 6-(6-(((1R,2R,3S,5S)-2-fluoro- 8.75 (s, 1H), 8.35 Detection 8-azabicyclo[3.2.1]octan-3- (d, J = 9.8 Hz, 1H), wavelength: yl)(methyl)amino)pyridazin-3- 7.46 (d, J = 9.8 Hz, 214 nm yl)quinazolin-7-ol 1H), 7.32 (s, 1H), Cycle time: 5.27-4.98 (m, 1H), 4.1 min 4.78-4.68 (m, 1H), Sample 3.70-3.56 (m, 2H), solution: 3.07 (s, 3H), 2.33- 6000 mg 2.22 (m, 1H), 1.89- dissolved in 1.59 (m, 5H). 110 ml MEOH Injection volume: 2 ml 76A/ 76B 5-(6-(((1S,2S,3R,5R)-2-fluoro- Q 1H NMR (400 MHz, DMSO-d4) 8.37- 8.25 (m, 2H), 7.98 (s, 1H), 7.43 (d, J = 10.0 Hz, 1H), 7.02 (s, 1H), 5.16-4.97 (m, 1H), 4.84-4.61 (m, 1H), 3.95 (s, 3H), 3.62 (s, 2H), 3.05 (s, 3H), 2.35-2.18 (m, 1H), 1.92-1.67 (m, 4H), 1.67-1.54 (m, 1H). 383 Instrument: SFC-200 (Thar, Waters) Column: AD 20 * 250 mm, 10 um (Daicel) Column temperature: 35 C. Mobile phase: CO2/MEOH (0.2% Methanol Ammonia) = 80/20 Flow rate: 120 g/min 1.02 8-azabicyclo[3.2.1]octan-3- 1H NMR (400 MHz, 383 Back pressure: 1.7 yl)(methyl)amino)pyridazin-3- DMSO-d4) 8.37- 100 bar yl)-1-methyl-1H-indazol-6-ol 8.25 (m, 2H), 7.98 Detection 5-(6-(((1R,2R,3S,5S)-2-fluoro- (s, 1H), 7.43 (d, J = wavelength: 8-azabicyclo[3.2.1]octan-3- 10.0 Hz, 1H), 7.02 214 nm yl)(methyl)amino)pyridazin-3- (s, 1H), 5.16-4.97 Cycle time: yl)-1-methyl-1H-indazol-6-ol (m, 1H), 4.84-4.61 4.1 min (m, 1H), 3.95 (s, 3H), Sample 3.62 (s, 2H), 3.05 (s, solution: 3H), 2.35-2.18 (m, 6000 mg 1H), 1.92-1.67 dissolved in (m, 4H), 1.67-1.54 110 ml (m, 1H). MEOH Injection volume: 2 ml 77A/ 77B 4-(6-(((1R,2R,3S,5S)-2-fluoro- Q 1H NMR (400 MHz, DMSO-d6) 8.44 (d, J = 4.5 Hz, 1H), 8.29 (d, J = 10.0 Hz, 1H), 7.98 (d, J = 8.3 Hz, 1H), 7.42-7.36 (m, 3H), 5.08 (d, J = 34.4 Hz, 1H), 4.66 (d, J = 52.1 Hz, 1H), 3.61- 3.53 (m, 2H), 3.05 (d, J = 1.5 Hz, 3H), 2.78 (d, J = 4.5 Hz, 3H), 2.25 (d, J = 12.6 Hz, 1H), 1.83- 1.54 (m, 5H). 386 Instrument: SFC-200 (Thar, Waters) Column: AD 20 * 250 mm, 10 um (Daicel) Column temperature: 35 C. Mobile phase: CO2/MEOH (0.2% Methanol Ammonia) = 80/20 Flow rate: 120 g/min Back pressure: 100 bar 1.05 8-azabicyclo[3.2.1]octan-3- 1H NMR (400 MHz, 386 Detection 2.07 yl)(methyl)amino)pyridazin-3- DMSO-d6) 8.44 (d, wavelength: yl)-3-hydroxy-N- J = 4.5 Hz, 1H), 8.29 214 nm methylbenzamide (d, J = 10.0 Hz, 1H), Cycle time: 4-(6-(((1S,2S,3R,5R)-2-fluoro- 7.98 (d, J = 8.3 Hz, 4.1 min 8-azabicyclo[3.2.1]octan-3- 1H), 7.42-7.36 (m, Sample yl)(methyl)amino)pyridazin-3- 3H), 5.08 (d, J = 34.4 solution: yl)-3-hydroxy-N- Hz, 1H), 4.66 (d, J = 6000 mg methylbenzamide 52.1 Hz, 1H), 3.61- dissolved in 3.53 (m, 2H), 3.05 110 ml (d, J = 1.5 Hz, 3H), MEOH 2.78 (d, J = 4.5 Hz, Injection 3H), 2.25 (d, J = volume: 2 ml 12.6 Hz, 1H), 1.83- 1.54 (m, 5H). 78A/ 78B 00 7-(6-(((1S,2S,3R,5R)-2-fluoro- 9-azabicyclo[3.3.1]nonan-3- yl)(methyl)amino)pyridazin-3- Q 1H NMR (400 MHz, DMSO-d6) 13.33 (s, 1H), 8.75-8.70 (m, 1H), 8.56 (s, 1H), 8.49 (d, J = 9.6 Hz, 1H), 8.17 (d, J = 7.6 Hz, 1H), 7.47- 7.42 (m, 1H), 7.39 (d, J = 10.0 Hz, 1H), 7.35 (s, 1H), 5.89- 5.65 (m, 1H), 4.74 (d, J = 51.2 Hz, 1H), 3.28-3.12 (m, 2H), 3.08 (d, J = 1.2 Hz, 3H), 2.47-2.27 (m, 2H), 1.97-1.79 (m, 3H), 1.80-1.58 (m, 4H). 394 Instrument: SFC-80 (Thar, Waters) Column: AD 20 * 250 mm, 10 um (Daicel) Column temperature: 35 C. Mobile phase: CO2/ MeOH (0.2% Methanol Ammonia) = 70/30 Flow rate: 80 g/min Back pressure: 1.6 yl)quinolin-6-ol 1H NMR (400 MHz, 394 100 bar 4.81 7-(6-(((1R,2R,3S,5S)-2-fluoro- DMSO-d6) 13.33 Detection 9-azabicyclo[3.3.1]nonan-3- (s, 1H), 8.76-8.71 wavelength: yl)(methyl)amino)pyridazin-3- (m, 1H), 8.57 (s, 214 nm yl)quinolin-6-ol 1H), 8.50 (d, J = 9.6 Cycle time: Hz, 1H), 8.17 (d, J = 4.0 min 7.6 Hz, 1H), 7.47- Sample 7.42 (m, 1H), 7.39 solution: (d, J = 10.0 Hz, 1H), 400 mg 7.35 (s, 1H), 5.88- dissolved in 5.65 (m, 1H), 4.74 25 ml (d, J = 51.2 Hz, 1H), Methanol 3.29-3.13 (m, 2H), Injection 3.08 (d, J = 1.2 Hz, volume: 3H), 2.47-2.29 (m, 1.9 ml 2H), 1.99-1.80 (m, 3H), 1.78-1.55 (m, 4H). 79A/ 79B 01 6-(6-(((1R,2R,3S,5S)-2-fluoro- Q 1H NMR (400 MHz, DMSO-d6) 14.15 (s, 1H), 8.25 (d, J = 10.0 Hz, 1H), 7.92 (s, 1H), 7.39 (d, J = 9.9 Hz, 1H), 6.86 (s, 1H), 5.11-4.88 (m, 1H), 4.76-4.50 (m, 1H), 3.53 (s, 2H), 3.30 (s, 3H), 3.03 (d, J = 1.6 Hz, 3H), 2.27- 2.17 (m, 1H), 1.82- 1.21 (m, 6H). 400 Instrument: SFC-80 (Thar, Waters) Column: AD 20 * 250 mm, 10 um (Daicel) Column temperature: 35 C. Mobile phase: CO2/ MeOH (0.2% Methanol Ammonia) = 70/30 Flow rate: 80 g/min 1.05 8-azabicyclo[3.2.1]octan-3- 1H NMR (400 MHz, 400 Back pressure: 2.07 yl)(methyl)amino)pyridazin-3- DMSO-d6) 14.15 100 bar yl)-5-hydroxy-3- (s, 1H), 8.25 (d, J = Detection methylbenzo[d]oxazol-2(3H)- 10.0 Hz, 1H), 7.92 (s, wavelength: one 1H), 7.39 (d, J = 9.9 214 nm 6-(6-(((1S,2S,3R,5R)-2-fluoro- Hz, 1H), 6.86 (s, 1H), Cycle time: 8-azabicyclo[3.2.1]octan-3- 5.14-4.90 (m, 1H), 3.0 min yl)(methyl)amino)pyridazin-3- 4.75-4.51 (m, 1H), Sample yl)-5-hydroxy-3- 3.60-3.46 (m, 2H), solution: methylbenzo[d]oxazol-2(3H)- 3.30 (s, 3H), 3.03 (d, 8000 mg one J = 1.6 Hz, 3H), dissolved in 2.26-2.19 (m, 1H), 120 ml 1.85-1.24 (m, 6H). Methanol Injection volume: 1.9 ml 80A/ 80B 02 2-(6-(((1S,5S,6S,7R)-6-fluoro- Q 1H NMR (400 MHz, Methanol-d4) 8.31 (d, J = 10.0 Hz, 1H), 8.05 (s, 1H), 7.88 (s, 1H), 7.76 (d, J = 8.4 Hz, 1H), 7.61 (d, J = 10.0 Hz, 1H), 7.24- 7.21 (m, 1H), 7.18 (d, J = 1.6 Hz, 1H), 6.34- 6.03 (m, 1H), 5.49- 5.28 (m, 1H), 4.35- 4.19 (m, 2H), 4.17- 4.02 (m, 2H), 4.01- 3.97 (m, 1H), 3.97 (s, 3H), 3.83-3.77 (m, 1H), 3.22 (s, 3H), 2.97-2.84 (m, 1H), 2.30-2.22 (m, 1H). 425 Instrument: SFC-80 (Thar, Waters) Column: IE 20 * 250 mm, 10 um (Daicel) Column temperature: 35 C. Mobile phase: CO2/IPA (0.2% Methanol Ammonia) = 75/25 Flow rate: 80 g/min Back pressure: 100 bar 0.774 3-oxa-9- 1H NMR (400 MHz, 425 Detection 2.17 azabicyclo[3.3.1]nonan-7- Methanol-d4) 8.31 wavelength: yl)(methyl)amino)pyridazin-3- (d, J = 10.0 Hz, 1H), 214 nm yl)-5-(1-methyl-1H-pyrazol-4- 8.05 (s, 1H), 7.88 (s, Cycle time: yl)phenol 1H), 7.76 (d, J = 8.4 3.8 min 2-(6-(((1R,5R,6R,7S)-6-fluoro- Hz, 1H), 7.61 (d, J = Sample 3-oxa-9- 10.0 Hz, 1H), 7.24- solution: azabicyclo[3.3.1]nonan-7- 7.21 (m, 1H), 7.18 (d, 740 mg yl)(methyl)amino)pyridazin-3- J = 1.6 Hz, 1H), 6.34- dissolved in yl)-5-(1-methyl-1H-pyrazol-4- 6.03 (m, 1H), 5.49- 25 ml yl)phenol 5.28 (m, 1H), 4.35- Methanol 4.19 (m, 2H), 4.17- Injection 4.02 (m, 2H), 4.01- volume: 3.97 (m, 1H), 3.97 (s, 0.6 ml 3H), 3.83-3.77 (m, 1H), 3.22 (s, 3H), 2.97-2.84 (m, 1H), 2.30-2.22 (m, 1H). 81A/ 81B 03 7-(6-(((1S,2S,3R,5R)-2-fluoro- Q 1H NMR (500 MHz, Methanol-d4) 13.36 (s, 1H), 8.31 (d, J = 12.5 Hz, 1H), 8.18 (d, J = 10.0 Hz, 2H), 7.73 (s, 1H), 7.39 (d, J = 9.6 Hz, 1H), 5.39- 5.17 (m, 1H), 4.97- 4.93 (m, 2H), 4.74- 4.61 (m, 1H), 3.63- 3.42 (s, 2H), 3.06 (s, 3H), 2.28-2.26 (m, 1H), 1.82-1.69 (m, 5H). 479 Instrument: SFC-200 (Thar, Waters) Column: AD 20 * 250 mm, 10 um (Daicel) Column temperature: 35 C. Mobile phase: CO2/MEOH (0.2% Methanol Ammonia) = 80/20 Flow rate: 120 g/min Back pressure: 100 bar 1.05 8-azabicyclo[3.2.1]octan-3- 1H NMR (400 MHz, 479 Detection 2.07 yl)(methyl)amino)pyridazin-3- DMSO-d6) 13.35 wavelength: yl)-6-hydroxy-3-(2,2,2- (s, 1H), 8.40 (d, J = 214 nm trifluoroethyl)quinazolin-4(3H)- 10.0 Hz, 1H), 8.28 (s, Cycle time: one 1H), 8.27 (s, 1H), 7.59 4.1 min 7-(6-(((1R,2R,3S,5S)-2-fluoro- (s, 1H), 7.39 (d, J = Sample 8-azabicyclo[3.2.1]octan-3- 10.0 Hz, 1H), 5.20- solution: yl)(methyl)amino)pyridazin-3- 5.04 (m, 1H), 4.99- 6000 mg yl)-6-hydroxy-3-(2,2,2- 4.92 (m, 2H), 4.76- dissolved in trifluoroethyl)quinazolin-4(3H)- 4.60 (m, 1H), 3.59- 110 ml one 3.56 (m, 2H), 3.07 (d, MEOH J = 1.4 Hz, 3H), 2.34- Injection 2.23 (m, 1H), 1.85- volume: 2 ml 1.68 (m, 4H), 1.62- 1.54 (m, 1H) 82A/ 82B 04 7-(6-(((1S,2S,3R,5R)-2-fluoro- S H NMR (300 MHz, DMSO-d6) 9.22 (s, 1H), 8.41 (d, J = 9.6 Hz, 1H), 7.82 (d, J = 6.4 Hz, 1H), 7.11 (d, J = 9.7 Hz, 1H), 6.08 (s, 1H), 5.54 (d, J = 6.4 Hz, 1H), 5.24 (dd, J = 36.8, 12.5 Hz, 1H), 4.92-4.54 (m, 1H), 3.68 (s, 4H), 3.00 (d, J = 1.8 Hz, 3H), 2.39-2.22 (m, 1H), 1.96-1.71 (m, 4H), 1.61 (d, J = 10.7 Hz, 1H). 396 Column: CHIRALPAK ID, 2 * 25 cm (5 um); Mobile Phase A: 135, Mobile Phase B: 12.5; Flow rate: 20 mL/min; Gradient: 50 B to 50 B in 7 min; 220/254 nm; 10 8-azabicyclo[3.2.1]octan-3- yl)(methyl)amino)pyridazin-3- H NMR (300 MHz, 396 12.5 yl)-8-hydroxy-4H-pyrido[1,2- DMSO-d6) 9.22 (s, a]pyrimidin-4-one 1H), 8.40 (d, J = 9.6 7-(6-(((1R,2R,3S,5S)-2-fluoro- Hz, 1H), 7.85 (d, J = 8-azabicyclo[3.2.1]octan-3- 6.7 Hz, 1H), 7.13 (d, yl)(methyl)amino)pyridazin-3- J = 9.7 Hz, 1H), 6.09 yl)-8-hydroxy-4H-pyrido[1,2- (s, 1H), 5.60 (d, J = a]pyrimidin-4-one 6.6 Hz, 1H), 5.39- 5.09 (m, 1H), 4.79 (dt, J = 50.9, 3.2 Hz, 1H), 3.74 (s, 4H), 3.00 (d, J = 1.7 Hz, 3H), 2.31 (dd, J = 12.9, 3.1 Hz, 1H), 1.87 (s, 4H), 1.86- 1.52 (m, 1H). 83A/ 83B 05 7-(6-(((1S,2S,3R,5R)-2-fluoro- 8-azabicyclo[3.2.1]octan-3- yl)(methyl)amino)pyridazin-3- yl)-6-hydroxy-2- S H-NMR (400 MHz, DMSO-d6): 13.91 (s, 1H), 8.65 (s, 1H), 8.31 (d, J = 9.9 Hz, 1H), 7.52-7.27 (m, 2H), 7.08 (s, 1H), 6.49 (d, J = 7.4 Hz, 1H), 5.08 (d, J = 32.9 Hz, 1H), 4.82-4.50 (m, 1H), 3.54 (s, 2H), 3.48 (s, 3H), 3.06 (d, J = 1.8 Hz, 3H), 2.25 (d, J = 3.2 Hz, 1H), 1.80 (s, 2H), 1.75-1.62 (m, 2H), 1.56 (dd, J = 11.8, 6.3 Hz, 1H). 409 Column: CHIRALPAK IF, 2 * 25 cm, 5 um; Mobile Phase A: MTBE (10 mM NH3- MEOH)- HPLC Mobile Phase B: EtOH- HPLC; Flow rate: 18 mL/min; Gradient: 50 B to 50 B in 13 min; 220/254 nm; 15.5 methylisoquinolin-1(2H)-one H-NMR (400 MHz, 409 18.5 7-(6-(((1R,2R,3S,5S)-2-fluoro- DMSO-d6): 13.87 8-azabicyclo[3.2.1]octan-3- (s, 1H), 8.65 (s, 1H), yl)(methyl)amino)pyridazin-3- 8.30 (d, J = 9.9 Hz, yl)-6-hydroxy-2- 1H), 7.41 (dd, J = methylisoquinolin-1(2H)-one 17.0, 8.6 Hz, 2H), 7.08 (s, 1H), 6.49 (d, J = 7.3 Hz, 1H), 5.08 (dd, J = 36.1, 12.6 Hz, 1H), 4.67 (dt, J = 51.9, 3.2 Hz, 1H), 3.58 (dd, J = 6.9, 3.6 Hz, 2H), 3.48 (s, 3H), 3.05 (d, J = 1.8 Hz, 3H), 2.27 (td, J = 12.7, 3.2 Hz, 1H), 1.91-1.80 (m, 2H), 1.80-1.64 (m, 2H), 1.57 (dd, J = 12.6, 6.0, 2.5 Hz, 1H). 84A/ 84B 06 6-(6-(((1S,2S,3R,5R)-2-fluoro- S 1H NMR (300 MHz, DMSO-d6) ppm 12.95 (s, 1H), 8.37- 8.11 (m, 2H), 7.66 (s, 1H), 7.51-7.12 (m, 2H), 6.60 (d, J = 7.4 Hz, 1H), 5.12 (dd, J = 35.2, 12.6 Hz, 1H), 4.64 (dt, J = 52.2, 3.3 Hz, 1H), 3.53 (s, 2H), 3.50 (s, 3H), 3.06 (d, J = 1.8 Hz, 3H), 2.25 (td, J = 12.5, 3.2 Hz, 1H), 1.87-1.64 (m, 4H), 1.60-1.49 (m, 1H). 410 Column: CHIRALPAK IA, 2 * 25 cm, 5 um; Mobile Phase A: CO2, Mobile Phase B: IPA; Flow rate: 40 mL/min; Gradient: 45% B; 254 nm; 5.3 8-azabicyclo[3.2.1]octan-3- 1H NMR (300 MHz, 410 7.3 yl)(methyl)amino)pyridazin-3- DMSO-d6) ppm yl)-7-hydroxy-2- 12.96 (s, 1H), 8.44- methylisoquinolin-1(2H)-one 8.04 (m, 2H), 7.66 6-(6-(((1R,2R,3S,5S)-2-fluoro- (s, 1H), 7.55 7.12 (m, 8-azabicyclo[3.2.1]octan-3- 2H), 6.60 (d, J = 7.3 yl)(methyl)amino)pyridazin-3- Hz, 1H), 5.44-4.91 yl)-7-hydroxy-2- (m, 1H), 4.84-4.34 methylisoquinolin-1(2H)-one (m, 1H), 3.54 (s, 2H), 3.50 (s, 3H), 3.06 (d, J = 1.8 Hz, 3H), 2.35-2.17 (m, 1H), 1.90-1.62 (m, 4H), 1.60-1.49 (m, 1H). 85A/ 85B 07 6-(6-(((1S,2S,3R,5R)-2-fluoro- 8-azabicyclo[3.2.1]octan-3- yl)(methyl)amino)pyridazin-3- S 1H NMR (300 MHz, DMSO-d6) ppm 8.59 (s, 1H), 8.40- 8.20 (m, 2H), 7.37 (d, J = 9.9 Hz, 1H), 7.07 (s, 1H), 5.30- 4.94 (m, 1H), 4.64 (d, J = 52.0 Hz, 1H), 3.54 (s, 2H), 3.48 (s, 3H), 3.05 (d, J = 1.7 Hz, 3H), 2.25 (dd, J = 13.4, 10.4 Hz, 1H), 1.87-1.61 (m, 4H), 1.54 (d, J = 11.9 Hz, 1H). 411 Column: CHIRALPAK AD-H-TC001 SFC, 2 * 25 cm, 5 um; Mobile Phase A: Hex (10 mM NH3), Mobile Phase B: IPA- HPLC; Flow rate: 18 mL/min; Gradient: 40 B to 40 B in 19 min; 230/254 nm 11 yl)-7-hydroxy-3- 1H NMR (300 MHz, 411 15 methylquinazolin-4(3H)-one DMSO-d6) ppm 6-(6-(((1R,2R,3S,5S)-2-fluoro- 8.59 (s, 1H), 8.40- 8-azabicyclo[3.2.1]octan-3- 8.20 (m, 2H), 7.37 yl)(methyl)amino)pyridazin-3- (d, J = 9.9 Hz, 1H), yl)-7-hydroxy-3- 7.07 (s, 1H), 5.30- methylquinazolin-4(3H)-one 4.94 (m, 1H), 4.64 (d, J = 52.0 Hz, 1H), 3.54 (s, 2H), 3.48 (s, 3H), 3.05 (d, J = 1.7 Hz, 3H), 2.25 (dd, J = 13.4, 10.4 Hz, 1H), 1.87-1.61 (m, 4H), 1.54 (d, J = 11.9 Hz, 1H). 86A/ 86B 08 6-(6- S 1H NMR (400 MHz, Methanol-d4) 8.22~8.17 (d, J = 9.9 Hz, 1H), 8.03 (s, 1H), 8.77~8.72 (d, J = 9.8 Hz, 1H), 7.28 (s, 1H), 7.19 (s, 1H), 5.10~ 4.93 (m, 1H), 4.92~ 4.76 (s, 1H), 3.70 (s, 2H), 3.38 (s, 3H), 3.14 (s, 3H), 2.83~ 2.71 (td, J = 13.0, 3.0 Hz, 1H), 2.60~ 2.51 (m, 1H), 2.02~ 1.82 (m, 5H), 1.20~ 0.96 (m, 3H), 0.60~ 0.51 (m, 1H) 466 CHIRALPAK IA, 2 * 25 cm, 5 um; Mobile Phase A: CO2, Mobile Phase B: IPA-HPLC; Flow rate: 40 mL/min; Gradient: 50% B; 220 nm 2.72 (cyclopropyl((1S,2S,3R,5R)-2- 1H NMR (400 MHz, 466 4.18 fluoro-8- Methanol-d4) azabicyclo[3.2.1]octan-3- 8.22~8.17 (d, J = 9.9 yl)amino)pyridazin-3-yl)-5- Hz, 1H), 8.03 (s, 1H), hydroxy-N,N- 8.77~8.72 (d, J = 9.8 dimethylbenzofuran-2- Hz, 1H), 7.28 (s, 1H), carboxamide 7.19 (s, 1H), 5.10~ 6-(6- 4.94 (m, 1H), 4.93~ (cyclopropyl((1R,2R,3S,5S)-2- 4.76 (s, 1H), 3.70 fluoro-8- (s, 2H), 3.38 (s, 3H), azabicyclo[3.2.1]octan-3- 3.14 (s, 3H), 2.83~ yl)amino)pyridazin-3-yl)-5- 2.71 (td, J = 13.0, 3.0 hydroxy-N,N- Hz, 1H), 2.60~2.51 dimethylbenzofuran-2- (m, 1H), 2.02~1.82 carboxamide (m, 5H), 1.20~0.96 (m, 3H), 0.61~0.51 (m, 1H) 87A/ 87B 09 6-(6-(((1R,2R,3S,5S)-2-fluoro- N 1H NMR (400 MHz, DMSO-d6) 13.18 (s, 1H), 9.14 (s, 1H), 8.56 (s, 1H), 8.38 (d, J = 9.9 Hz, 1H), 8.32 (d, J = 5.7 Hz, 1H), 7.76 (d, J = 5.8 Hz, 1H), 7.48 (s, 1H), 7.43 (d, J = 9.9 Hz, 1H), 5.22-5.03 (m, 1H), 4.75-4.54 (m, 1H), 3.54 (s, 2H), 3.07 (s, 3H), 2.33- 2.19 (m, 1H), 1.90- 1.62 (m, 4H), 1.61- 1.49 (m, 1H). 380 Instrument: SFC-200 (Thar, Waters) Column: AD 20 * 250 mm, 10 um (Daicel) Column temperature: 35 C. Mobile phase: CO2/MEOH (0.2% Methanol Ammonia) = 80/20 Flow rate: 120 g/min Back pressure: 100 bar 1.05 8-azabicyclo[3.2.1]octan-3- 1H NMR (400 MHz, 380 Detection 2.07 yl)(methyl)amino)pyridazin-3- DMSO-d6) 9.14 (s, wavelength: yl)isoquinolin-7-ol 1H), 8.57 (s, 1H), 214 nm 6-(6-(((1S,2S,3R,5R)-2-fluoro- 8.42-8.31 (m, 2H), Cycle time: 8-azabicyclo[3.2.1]octan-3- 7.76 (d, J = 5.8 Hz, 4.1 min yl)(methyl)amino)pyridazin-3- 1H), 7.50-7.41 (m, Sample yl)isoquinolin-7-ol 2H), 5.16 (d, J = 29.4 solution: Hz, 1H), 4.73 (d, J = 6000 mg 51.4 Hz, 1H), 3.71- dissolved in 3.58 (m, 2H), 3.07 110 ml (s, 3H), 2.31 (s, 1H), MEOH 1.89-1.69 (m, 4H), Injection 1.63 (s, 1H). volume: 2 ml 88A/ 88B 0 7-(6-(((1S,2S,3R,5R)-2-fluoro- N 1H NMR (500 MHz, DMSO-d6) 8.82 (d, J = 1.8 Hz, 1H), 8.76 (d, J = 1.8 Hz, 1H), 8.63 (s, 1H), 8.48 (d, J = 9.9 Hz, 1H), 7.43 (s, 1H), 7.42 (d, J = 9.9 Hz, 1H), 5.20- 5.02 (m, 1H), 4.71- 4.60 (m, 3.0 Hz, 1H), 3.55-3.53 (m, 2H), 3.08 (s, 3H), 2.30- 2.21 (m, 1H), 1.84- 1.64 (m, 4H), 1.60- 1.52 (m, 1H). 381 Instrument: SFC-200 (Thar, Waters) Column: AD 20 * 250 mm, 10 um (Daicel) Column temperature: 35 C. Mobile phase: CO2/MEOH (0.2% Methanol Ammonia) = 80/20 Flow rate: 1.05 8-azabicyclo[3.2.1]octan-3- 1H NMR (500 MHz, 381 120 g/min 2.07 yl)(methyl)amino)pyridazin-3- DMSO-d6) 8.82 (d, Back pressure: yl)quinoxalin-6-ol J = 1.8 Hz, 1H), 8.76 100 bar 7-(6-(((1R,2R,3S,5S)-2-fluoro- (d, J = 1.8 Hz, 1H), Detection 8-azabicyclo[3.2.1]octan-3- 8.63 (s, 1H), 8.48 (d, wavelength: yl)(methyl)amino)pyridazin-3- J = 9.9 Hz, 1H), 7.43 214 nm yl)quinoxalin-6-ol (s, 1H), 7.42 (d, J = Cycle time: 9.9 Hz, 1H), 5.20- 4.1 min 5.02 (m, 1H), 4.71- Sample 4.60 (m, 3.0 Hz, 1H), solution: 3.55-3.53 (m, 2H), 6000 mg 3.08 (s, 3H), 2.30- dissolved in 2.21 (m, 1H), 1.84- 110 ml 1.64 (m, 4H), 1.60- MEOH 1.52 (m, 1H). Injection volume: 2 ml 89A 7-(6-(((1S,2S,3R,5R)-2-fluoro- 8-azabicyclo[3.2.1]octan-3- yl)(methyl)amino)pyridazin-3- yl)cinnolin-6-ol N 1H NMR (400 MHz, DMSO-d6) 9.13 (d, J = 5.9 Hz, 1H), 9.01 (s, 1H), 8.56 (d, J = 9.9 Hz, 1H), 7.97 (d, J = 5.9 Hz, 1H), 7.45 (d, J = 9.9 Hz, 1H), 7.33 (s, 1H), 5.18- 5.06 (m, 1H), 4.74- 4.61 (m, 1H), 3.58- 3.54 (m, 2H), 3.08 (s, 3H), 2.34-2.19 (m, 1H), 1.73 (m, 4H), 1.59 (m, 1H). 381 Instrument: SFC-200 (Thar, Waters) Column: AD 20 * 250 mm, 10 um (Daicel) Column temperature: 35 C. Mobile phase: CO2/MEOH (0.2% Methanol Ammonia) = 1.05 80/20 Flow rate: 120 g/min Back pressure: 100 bar Detection wavelength: 214 nm Cycle time: 4.1 min Sample solution: 6000 mg dissolved in 110 ml MEOH Injection volume: 2 ml 90A/ 90B 2-(6-(((1S,2S,3R,5R)-2-fluoro- N 1H NMR (400 MHz, Methanol-d4) 8.26- 8.11 (m, 1H), 7.94 (d, J = 7.5 Hz, 3H), 7.81- 7.61 (m, 2H), 7.36 (d, J = 9.9 Hz, 1H), 5.48- 5.20 (m, 1H), 4.73 (s, 1H), 3.84-3.68 (m, 2H), 3.15 (s, 3H), 2.60-2.36 (m, 1H), 2.17-1.84 (m, 4H), 1.82-1.66 (m, 1H). 396 Instrument: SFC-150 (Thar, Waters) Column: SC 20 * 250 mm, 10 um (Regis) Column temperature: 35 C. Mobile phase: CO2/MEOH (0.2% Methanol Ammonia) = 60/40 Flow rate: 100g/min Back pressure: 100 bar 1.05 8-azabicyclo[3.2.1]octan-3- 1H NMR (400 MHz, 396 Detection 2.07 yl)(methyl)amino)pyridazin-3- Methanol-d4) 8.26- wavelength: yl)-5-(2H-1,2,3-triazol-2- 8.11 (m, 1H), 7.94 (d, 214 nm yl)phenol J = 7.5 Hz, 3H), 7.81- Cycle time: 2-(6-(((1R,2R,3S,5S)-2-fluoro- 7.61 (m, 2H), 7.36 (d, 3 min 8-azabicyclo[3.2.1]octan-3- J = 9.9 Hz, 1H), Sample yl)(methyl)amino)pyridazin-3- 5.48-5.20 (m, 1H), solution: yl)-5-(2H-1,2,3-triazol-2- 4.73 (s, 1H), 3.84- 3000 mg yl)phenol 3.68 (m, 2H), 3.15 (s, dissolved in 3H), 2.60-2.36 (m, 100 ml 1H), 2.17-1.84 (m, Methanol 4H), 1.82-1.66 Injection (m, 1H). volume: 1 ml 91A/ 91B 2-(6-(((1S,2S,3R,5R)-2-fluoro- N 1H NMR (400 MHz, Methanol-d4) 7.94 (d, J = 9.9 Hz, 1H), 7.60 (d, J = 8.8 Hz, 1H), 7.49 (s, 1H), 7.27 (s, 1H), 7.19 (d, J = 9.9 Hz, 1H), 6.55- 5.56 (m, 1H), 6.43 (s, 1H), 5.09-5.14 (m, 1H), 5.09-5.14 (m, 1H), 3.79 (s, 3H), 3.67-3.88 (m, 2H), 3.00 (s, 3H), 2.40- 2.21 (m, 1H), 1.6- 2.03 (m, 4H), 1.64- 1.47 (m, 1H). 425 Instrument: SFC-150 (Thar, Waters) Column: SC 20 * 250 mm, 10 um (Regis) Column temperature: 35 C. Mobile phase: CO2/MEOH (0.2% Methanol Ammonia) = 60/40 1.05 8-azabicyclo[3.2.1]octan-3- yl)(methyl)amino)pyridazin-3- 1H NMR (400 MHz, 425 Flow rate: 2.07 yl)-5-((1-methyl-1H-pyrazol-4- Methanol-d4) 7.94 100 g/min yl)oxy)phenol (d, J = 9.9 Hz, 1H), Back pressure: 2-(6-(((1R,2R,3S,5S)-2-fluoro- 7.60 (d, J = 8.8 Hz, 100 bar 8-azabicyclo[3.2.1]octan-3- 1H), 7.49 (s, 1H), Detection yl)(methyl)amino)pyridazin-3- 7.27 (s, 1H), 7.19 (d, wavelength: yl)-5-((1-methyl-1H-pyrazol-4- J = 9.9 Hz, 1H), 5.56- 214 nm yl)oxy)phenol 6.55 (m, 1H), 6.43 (s, Cycle time: 1H), 5.09-5.14 (m, 3 min 1H), 5.09-5.14 (m, Sample 1H), 3.79 (s, 3H), solution: 3.67-3.88 (m, 2H), 3000 mg 3.00 (s, 3H), 2.40- dissolved in 2.21 (m, 1H), 1.6- 100 ml 2.03 (m, 4H), 1.64- Methanol 1.47 (m, 1H). Injection volume: 1 ml 92A/ 92B azetidin-1-yl(6-(6- N 1H NMR (300 MHz, DMSO-d6) 13.12 (s, 1H), 8.37 (d, J = 9.9 Hz, 1H), 8.22 (s, 1H), 7.68 (d, J = 9.8 Hz, 1H), 7.34 (s, 1H), 7.21 (s, 1H), 4.81 (s, 1H), 4.59 (s, 3H), 4.08 (s, 2H), 3.27 (s, 2H), 2.66 (t, J = 12.5 Hz, 1H), 2.41-2.30 (m, 3H), 2.23 (s, 3H), 2.01 (s, 2H), 1.82- 1.49 (m, 3H), 1.02 (s, 3H), 0.44 (s, 1H). 492 Column: CHIRALPAK IF, 2 * 25 cm, 5 um; Mobile Phase A: MTBE (10 mM NH3- MEOH)- HPLC, Mobile Phase B: EtOH- HPLC; Flow rate: 20 mL/min; Gradient: 50 B to 50 B in 14 min; 300/254 nm; 7.3 (cyclopropyl((1S,2S,3R,5R)-2- 1H NMR (300 MHz, 492 9.3 fluoro-8-methyl-8- DMSO-d6) 13.12 azabicyclo[3.2.1]octan-3- (s, 1H), 8.38 (d, J = yl)amino)pyridazin-3-yl)-5- 9.9 Hz, 1H), 8.22 hydroxybenzofuran-2- (s, 1H), 7.68 (d, yl)methanone J = 9.8 Hz, 1H), 7.34 azetidin-1-yl(6-(6- (d, J = 0.8 Hz, 1H), (cyclopropyl((1R,2R,3S,5S)-2- 7.21 (s, 1H), 4.81 (s, fluoro-8-methyl-8- 1H), 4.67-4.53 (m, azabicyclo[3.2.1]octan-3- 3H), 4.09 (t, J = 7.7 yl)amino)pyridazin-3-yl)-5- Hz, 2H), 3.30 (d, J = hydroxybenzofuran-2- 12.9 Hz, 2H), 2.66 (t, yl)methanone J = 12.4 Hz, 1H), 2.36 (p, J = 7.5 Hz, 3H), 2.23 (s, 3H), 2.01 (s, 2H), 1.81-1.52 (m, 3H), 1.08-0.97 (m, 3H), 0.45 (d, J = 9.1 Hz, 1H) 93A/ 93B 7-(6-(((1S,2S,3R,5R)-2-fluoro- 8-methyl-8- azabicyclo[3.2.1]octan-3- yl)(methyl)amino)pyridazin-3- X 1H NMR (300 MHz, DMSO-d6) 13.69 (s, 1H), 9.20 (s, 1H), 8.75 (s, 1H), 8.50- 8.27 (m, 2H), 7.62 (d, J = 5.9 Hz, 1H), 7.46 (d, J = 9.8 Hz, 1H), 7.31 (s, 1H), 5.03 (dd, J = 34.9, 12.8 Hz, 1H), 4.67 (d, J = 52.0 Hz, 1H), 3.28 (s, 2H), 3.06 (d, J = 1.7 Hz, 3H), 2.35 (t, J = 11.8 Hz, 1H), 2.24 (s, 3H), 2.04 (s, 2H), 1.72 (t, J = 9.5 Hz, 1H), 1.58 (d, J = 10.3 Hz, 2H). 394 Column: CHIRALPAK IF, 2 * 25 cm, 5 um; Mobile Phase A: MTBE (10 mM NH3- MEOH)- HPLC, Mobile Phase B: MeOH- HPLC; Flow rate: 20 mL/min; Gradient: 50 B to 50 B in 10 min; 234/254 nm 6.5 yl)isoquinolin-6-ol 1H NMR (300 MHz, 394 7.7 7-(6-(((1R,2R,3S,5S)-2-fluoro- DMSO-d6) 13.69 8-methyl-8- (s, 1H), 9.20 (s, 1H), azabicyclo[3.2.1]octan-3- 8.75 (s, 1H), 8.50- yl)(methyl)amino)pyridazin-3- 8.27 (m, 2H), 7.62 yl)isoquinolin-6-ol (d, J = 5.9 Hz, 1H), 7.46 (d, J = 9.8 Hz, 1H), 7.31 (s, 1H), 5.03 (dd, J = 34.9, 12.8 Hz, 1H), 4.67 (d, J = 52.0 Hz, 1H), 3.28 (s, 2H), 3.06 (d, J = 1.7 Hz, 3H), 2.35 (t, J = 11.8 Hz, 1H), 2.24 (s, 3H), 2.04 (s, 2H), 1.72 (t, J = 9.5 Hz, 1H), 1.58 (d, J = 10.3 Hz, 2H). 94A/ 94B 7-(6-(((1S,2S,3R,5R)-2-fluoro- X 1H NMR (400 MHz, DMSO-d6) ppm 12.95 (s, 1H), 8.36 (d, J = 9.9 Hz, 1H), 8.30 (d, J = 6.0 Hz, 1H), 8.23 (s, 1H), 7.43 (s, 1H), 7.38 (d, J = 9.9 Hz, 1H), 6.30 (d, J = 6.0 Hz, 1H), 5.03 (d, J = 36.5 Hz, 1H), 4.66 (d, J = 51.4 Hz, 1H), 3.31-3.21 (m, 2H), 3.05 (d, J = 1.7 Hz, 3H), 2.41-2.28 (m, 1H), 2.25 (s, 3H), 2.04 (s, 2H), 1.72 (t, J = 9.3 Hz, 1H), 1.58 (d, J = 11.4 Hz, 2H). 411 Column: CHIRALPAK IF, 2 * 25 cm, 5 um; Mobile Phase A: MTBE (10 mM NH3- MEOH)- HPLC, Mobile Phase B: EtOH-HPLC; Flow rate: 18 mL/min; Gradient: 25 B to 25 B in 10 min; 254\220 nm 6.5 8-methyl-8- azabicyclo[3.2.1]octan-3- 1H NMR (400 MHz, 411 7.8 yl)(methyl)amino)pyridazin-3- DMSO-d6) ppm yl)-6-hydroxy-4H-chromen-4- 12.95 (s, 1H), 8.36 (d, one J = 9.9 Hz, 1H), 8.30 7-(6-(((1R,2R,3S,5S)-2-fluoro- (d, J = 6.0 Hz, 1H), 8-methyl-8- 8.23 (s, 1H), 7.43 azabicyclo[3.2.1]octan-3- (s, 1H), 7.38 (d, J = yl)(methyl)amino)pyridazin-3- 9.9 Hz, 1H), 6.30 (d, yl)-6-hydroxy-4H-chromen-4- J = 6.0 Hz, 1H), 5.03 one (d, J = 36.5 Hz, 1H), 4.66 (d, J = 51.4 Hz, 1H), 3.31-3.21 (m, 2H), 3.05 (d, J = 1.7 Hz, 3H), 2.41-2.28 (m, 1H), 2.25 (s, 3H), 2.04 (s, 2H), 1.72 (t, J = 9.3 Hz, 1H), 1.58 (d, J = 11.4 Hz, 2H). 95A 7-(6-(((1S,2S,3R,5R)-2-fluoro- 8-methyl-8- azabicyclo[3.2.1]octan-3- yl)(methyl)amino)pyridazin-3- yl)-8-hydroxy-4H-pyrido[1,2- a]pyrimidin-4-one X H NMR (300 MHz, DMSO-d6) 9.22 (s, 1H), 8.40 (d, J = 9.6 Hz, 1H), 7.82 (d, J = 6.4 Hz, 1H), 7.09 (d, J = 9.7 Hz, 1H), 6.07 (s, 1H), 5.53 (d, J = 6.4 Hz, 1H), 5.20- 4.99 (m, 1H), 4.79- 4.48 (m, 1H), 2.98 (d, J = 1.8 Hz, 3H), 2.39-2.26 (m, 1H), 2.25 (s, 3H), 2.03 (s, 2H), 1.68 (dt, J = 18.6, 9.4 Hz, 2H), 1.52 (s, 1H). 410 Column: CHIRALPAK ID, 2 * 25 cm (5 um); Mobile Phase A: 135, Mobile Phase B: 12.5; Flow rate: 20 mL/min; Gradient: 50 B to 50 B in 7 min; 220/256 nm; 10 96A/ 96B 2-fluoro-4-(6-(((1S,2S,3R,5R)- 1H NMR (400 MHz, DMSO-d6) ppm 13.10 (s, 1H), 8.39- 8.12 (m, 2H), 7.87 (d, J = 11.9 Hz, 1H), 7.38 (d, J = 9.9 Hz, 1H), 7.14 (d, J = 6.3 Hz, 1H), 4.99 (d, J = 35.0 Hz, 1H), 4.70- 4.42 (m, 1H), 3.35- 3.25 (m, 2H), 3.03 (d, J = 1.7 Hz, 3H), 2.78 (d, J = 4.6 Hz, 3H), 2.33 (td, J = 12.3, 3.0 Hz, 1H), 2.23 (s, 3H), 2.02 (s, 2H), 1.70 (t, J = 9.5 Hz, 1H), 1.62-1.47 (m, 2H). 418 Column: Chiralpak AD-H, 2 * 25 cm (5 um); Mobile Phase A: Hex (10 mM NH3-MeOH), Mobile Phase B: IPA-HPLC; Flow rate: 20 mL/min; Gradient: 40 B to 40 B in 16.5 min; 306/254 nm 6 2-fluoro-8-methyl-8- azabicyclo[3.2.1]octan-3- 1H NMR (400 MHz, 418 9.9 yl)(methyl)amino)pyridazin-3- DMSO-d6) ppm yl)-5-hydroxy-N- 13.10 (s, 1H), 8.39- methylbenzamide 8.12 (m, 2H), 7.87 2-fluoro-4-(6-(((1R,2R,3S,5S)- (d, J = 11.9 Hz, 1H), 2-fluoro-8-methyl-8- 7.38 (d, J = 9.9 Hz, azabicyclo[3.2.1]octan-3- 1H), 7.14 (d, J = 6.3 yl)(methyl)amino)pyridazin-3- Hz, 1H), 4.99 (d, J = yl)-5-hydroxy-N- 35.0 Hz, 1H), 4.70- methylbenzamide 4.42 (m, 1H), 3.35- 3.25 (m, 2H), 3.03 (d, J = 1.7 Hz, 3H), 2.78 (d, J = 4.6 Hz, 3H), 2.33 (td, J = 12.3, 3.0 Hz, 1H), 2.23 (s, 3H), 2.02 (s, 2H), 1.70 (t, J = 9.5 Hz, 1H), 1.62-1.47 (m, 2H). 97A/ 97B 6-(6-(((1S,2S,3R,5R)-2-fluoro- 8-methyl-8- azabicyclo[3.2.1]octan-3- yl)(methyl)amino)pyridazin-3- yl)-7-hydroxy-2- X 1H NMR (300 MHz, DMSO-d6) ppm 12.94 (s, 1H), 8.47- 8.04 (m, 2H), 7.66 (s, 1H), 7.45-7.18 (m, 2H), 6.75-6.52 (m, 1H), 5.03 (d, J = 42.1 Hz, 1H), 4.66 (d, J = 51.5 Hz, 1H), 3.50 (s, 3H), 3.28 (s, 2H), 3.04 (d, J = 1.7 Hz, 3H), 2.43-2.18 (m, 4H), 2.03 (s, 2H), 1.81-1.45 (m, 4H). 424 Column: CHIRALPAK IA, 2 * 25 cm, 5 um; Mobile Phase A: CO2, Mobile Phase B: IPA; Flow rate: 40 mL/min; Gradient: 45% B; 254 nm; 5.3 methylisoquinolin-1(2H)-one 6-(6-(((1R,2R,3S,5S)-2-fluoro- 1H NMR (300 MHz, 424 7.3 8-methyl-8- DMSO-d6) ppm azabicyclo[3.2.1]octan-3- 12.94 (s, 1H), 8.41- yl)(methyl)amino)pyridazin-3- 8.17 (m, 2H), 7.66 (s, yl)-7-hydroxy-2- 1H), 7.51-7.08 (m, methylisoquinolin-1(2H)-one 2H), 6.86-6.39 (m, 1H), 5.03 (d, J = 36.8 Hz, 1H), 4.65 (d, J = 51.5 Hz, 1H), 3.50 (s, 3H), 3.28 (s, 2H), 3.04 (d, J = 1.7 Hz, 3H), 2.40-2.17 (m, 4H), 2.03 (s, 2H), 1.78-1.45 (m, 3H). 98A/ 98B 0 7-(6-(((1S,2S,3R,5R)-2-fluoro- 8-methyl-8- azabicyclo[3.2.1]octan-3- yl)(methyl)amino)pyridazin-3- X H NMR (400 MHz, Chloroform-d) 14.47 (s, 1H), 8.75 (s, 1H), 8.14 (d, J = 9.9 Hz, 1H), 7.16-6.93 (m, 3H), 6.42 (d, J = 7.3 Hz, 1H), 5.52-5.16 (m, 1H), 4.76 (dt, J = 51.3, 3.7 Hz, 1H), 3.61 (s, 3H), 3.54- 3.32 (m, 2H), 3.12 (d, J = 1.8 Hz, 3H), 2.50 (td, J = 12.7, 3.0 Hz, 1H), 2.41 (s, 3H), 2.18 (s, 2H), 1.92-1.81 (m, 2H), 1.65 (ddd, J = 12.1, 6.0, 3.3 Hz, 1H). 423 Column: CHIRALPAK IF, 2 * 25 cm, 5 um; Mobile Phase A: MTBE (10 mM NH3- MEOH)- HPLC, Mobile Phase B: EtOH- HPLC; Flow rate: 18 mL/min; Gradient: 50 B to 50 B in 13 min; 220/256 nm; 15.5 yl)-6-hydroxy-2- H NMR (400 MHz, 423 18.5 methylisoquinolin-1(2H)-one Chloroform-d) 7-(6-(((1R,2R,3S,5S)-2-fluoro- 14.48 (s, 1H), 8.75 (s, 8-methyl-8- 1H), 8.14 (d, J = 9.9 azabicyclo[3.2.1]octan-3- Hz, 1H), 7.14-6.97 yl)(methyl)amino)pyridazin-3- (m, 3H), 6.42 (d, J = yl)-6-hydroxy-2- 7.3 Hz, 1H), 5.31 methylisoquinolin-1(2H)-one (dddd, J = 35.1, 13.2, 6.1, 3.3 Hz, 1H), 4.74 (dt, J = 51.2, 3.5 Hz, 1H), 3.60 (s, 3H), 3.52-3.32 (m, 2H), 3.11 (d, J = 1.8 Hz, 3H), 2.47 (td, J = 12.7, 3.1 Hz, 1H), 2.39 (s, 3H), 2.17 (d, J = 8.0 Hz, 3H), 1.90- 1.82 (m, 2H), 1.67- 1.56 (m, 1H). 99A/ 99B 7-(6-(((1S,2S,3R,5R)-2-fluoro- X 1H NMR (300 MHz, DMSO-d6) ppm 13.07 (s, 1H), 8.38 (d, J = 9.9 Hz, 1H), 8.21 (s, 1H), 7.46- 7.32 (m, 2H), 6.21 (d, J = 0.8 Hz, 1H), 5.01 (d, J = 41.4 Hz, 1H), 4.66 (d, J = 51.3 Hz, 1H), 3.40-3.35 (m, 2H), 3.05 (d, J = 1.7 Hz, 3H), 2.40 (s, 3H), 2.36-2.27 (m, 1H), 2.25 (s, 3H), 2.04 (s, 2H), 1.74 (d, J = 11.0 Hz, 1H), 1.58 (d, J = 10.2 Hz, 2H). 425 Column: CHIRALPAK IA, 2 * 25 cm, 5 um; Mobile Phase A: CO2, Mobile Phase B: MeOH: DCM = 4:1; Flow rate: 40 mL/min; Gradient: 40% B; 240 nm 4 8-methyl-8- azabicyclo[3.2.1]octan-3- 1H NMR (300 MHz, 425 5.3 yl)(methyl)amino)pyridazin-3- DMSO-d6) ppm yl)-6-hydroxy-2-methyl-4H- 13.07 (s, 1H), 8.38 (d, chromen-4-one J = 9.9 Hz, 1H), 8.21 7-(6-(((1R,2R,3S,5S)-2-fluoro- (s, 1H), 7.46-7.32 (m, 8-methyl-8- 2H), 6.21 (d, J = 0.8 azabicyclo[3.2.1]octan-3- Hz, 1H), 5.01 (d, J = yl)(methyl)amino)pyridazin-3- 41.4 Hz, 1H), 4.66 (d, yl)-6-hydroxy-2-methyl-4H- J = 51.3 Hz, 1H), chromen-4-one 3.40-3.35 (m, 2H), 3.05 (d, J = 1.7 Hz, 3H), 2.40 (s, 3H), 2.36-2.27 (m, 1H), 2.25 (s, 3H), 2.04 (s, 2H), 1.74 (d, J = 11.0 Hz, 1H), 1.58 (d, J = 10.2 Hz, 2H). 100A/ 100B 6-(6-(((1S,2S,3R,5R)-2-fluoro- 8-methyl-8- azabicyclo[3.2.1]octan-3- yl)(methyl)amino)pyridazin-3- X 1H NMR (400 MHz, Methanol-d4) ppm 8.47 (s, 1H), 8.18 (d, J = 9.9 Hz, 1H), 7.38 (d, J = 9.9 Hz, 1H), 6.97 (s, 1H), 6.16 (d, J = 0.9 Hz, 1H), 5.33-5.05 (m, 1H), 4.75 (d, J = 50.7 Hz, 1H), 3.51 (s, 1H), 3.43 (s, 1H), 3.13 (d, J = 1.9 Hz, 3H), 2.48 (td, J = 12.8, 3.1 Hz, 1H), 2.44- 2.34 (m, 6H), 2.22 (d, J = 6.9 Hz, 2H), 1.95-1.80 (m, 2H), 1.69 (ddd, J = 12.6, 6.3, 3.2 Hz, 1H). 425 Column: CHIRALPAK IA, 2 * 25 cm, 5 um; Mobile Phase A: CO2, Mobile Phase B: EtOH- HPLC; Flow rate: 40 mL/min; Gradient: 50% B; 270 nm 4 yl)-7-hydroxy-2-methyl-4H- chromen-4-one 1H NMR (400 MHz, 425 6.2 6-(6-(((1R,2R,3S,5S)-2-fluoro- Methanol-d4) ppm 8-methyl-8- 8.47 (s, 1H), 8.18 (d, azabicyclo[3.2.1]octan-3- J = 9.9 Hz, 1H), 7.38 yl)(methyl)amino)pyridazin-3- (d, J = 9.9 Hz, 1H), yl)-7-hydroxy-2-methyl-4H- 6.97 (s, 1H), 6.16 (d, chromen-4-one J = 0.9 Hz, 1H), 5.33-5.05 (m, 1H), 4.75 (d, J = 50.7 Hz, 1H), 3.51 (s, 1H), 3.43 (s, 1H), 3.13 (d, J = 1.9 Hz, 3H), 2.48 (td, J = 12.8, 3.1 Hz, 1H), 2.44-2.34 (m, 6H), 2.22 (d, J = 6.9 Hz, 2H), 1.95- 1.80 (m, 2H), 1.69 (ddd, J = 12.6, 6.3, 3.2 Hz, 1H). 101A/ 101B 7-(6-(((1S,2S,3R,5R)-2-fluoro- 8-methyl-8- X 1H NMR (300 MHz, DMSO-d6) ppm 13.27 (s, 1H), 8.39 (d, J = 9.9 Hz, 1H), 8.23 (d, J = 3.9 Hz, 2H), 7.55 (s, 1H), 7.38 (d, J = 9.9 Hz, 1H), 5.09 (d, J = 31.8 Hz, 1H), 4.66 (d, J = 52.0 Hz, 1H), 3.50 (s, 3H), 3.30 (s, 2H), 3.05 (d, J = 1.7 Hz, 3H), 2.34 (td, J = 12.3, 3.1 Hz, 1H), 2.24 (s, 3H), 2.03 (s, 2H), 1.65 (dt, J = 37.5, 10.5 Hz, 3H). 425 Column: CHIRAL ART Cellulose-SB, 2 * 25 cm, 5 um; Mobile Phase A: MTBE (10 mM NH3- MEOH)- HPLC, Mobile Phase B: EtOH- HPLC; Flow rate: 18 mL/min; Gradient: 50 B to 50 B in 21 min; 240/280 nm 10.8 azabicyclo[3.2.1]octan-3- 1H NMR (300 MHz, 425 13.5 yl)(methyl)amino)pyridazin-3- DMSO-d6) ppm yl)-6-hydroxy-3- 13.27 (s, 1H), 8.39 methylquinazolin-4(3H)-one (d, J = 9.9 Hz, 1H), 7-(6-(((1R,2R,3S,5S)-2-fluoro- 8.23 (d, J = 3.9 Hz, 8-methyl-8- 2H), 7.55 (s, 1H), azabicyclo[3.2.1]octan-3- 7.38 (d, J = 9.9 Hz, yl)(methyl)amino)pyridazin-3- 1H), 5.09 (d, J = 31.8 yl)-6-hydroxy-3- Hz, 1H), 4.66 (d, J = methylquinazolin-4(3H)-one 52.0 Hz, 1H), 3.50 (s, 3H), 3.30 (s, 2H), 3.05 (d, J = 1.7 Hz, 3H), 2.34 (td, J = 12.3, 3.1 Hz, 1H), 2.24 (s, 3H), 2.03 (s, 2H), 1.65 (dt, J = 37.5, 10.5 Hz, 3H). 102A/ 102B 6-(6-(((1S,2S,3R,5R)-2-fluoro- 8-methyl-8- X 1H NMR (300 MHz, DMSO-d6) 14.00 (s, 1H), 8.59 (s, 1H), 8.33 (d, J = 9.9 Hz, 2H), 7.36 (d, J = 9.9 Hz, 1H), 7.06 (s, 1H), 4.99 (d, J = 30.5 Hz, 1H), 4.65 (d, J = 51.2 Hz, 1H), 3.48 (s, 3H), 3.30 (s, 2H), 3.03 (d, J = 1.7 Hz, 3H), 2.33 (dd, J = 13.8, 10.7 Hz, 1H), 2.23 (s, 3H), 2.03 (s, 2H), 1.71 (t, J = 9.3 Hz, 1H), 1.63- 1.44 (m, 2H). 425 Column: CHIRALPAK AD-H-TC001 SFC, 2 * 25 cm, 5 um; Mobile Phase A: Hex (10 mM NH3), Mobile Phase B: IPA- HPLC; Flow rate: 18 mL/min; Gradient: 40 B to 40 B in 19 min; 230/254 nm 11 azabicyclo[3.2.1]octan-3- 1H NMR (300 MHz, 425 15 yl)(methyl)amino)pyridazin-3- DMSO-d6) 14.00 yl)-7-hydroxy-3- (s, 1H), 8.59 (s, 1H), methylquinazolin-4(3H)-one 8.33 (d, J = 9.9 Hz, 6-(6-(((1R,2R,3S,5S)-2-fluoro- 2H), 7.36 (d, J = 9.9 8-methyl-8- Hz, 1H), 7.06 (s, 1H), azabicyclo[3.2.1]octan-3- 4.99 (d, J = 30.5 Hz, yl)(methyl)amino)pyridazin-3- 1H), 4.65 (d, J = 51.2 yl)-7-hydroxy-3- Hz, 1H), 3.48 (s, 3H), methylquinazolin-4(3H)-one 3.30 (s, 2H), 3.03 (d, J = 1.7 Hz, 3H), 2.33 (dd, J = 13.8, 10.7 Hz, 1H), 2.23 (s, 3H), 2.03 (s, 2H), 1.71 (t, J = 9.3 Hz, 1H), 1.63- 1.44 (m, 2H). 103A/ 103B 4-fluoro-2-(6-(((1S,2S,3R,5R)- X 1H NMR (300 MHz, Methanol-d4) ppm 8.47 (s, 1H), 8.19 (d, J = 9.9 Hz, 1H), 8.00-7.87 (m, 2H), 7.47 (d, J = 6.6 Hz, 1H), 7.35 (d, J = 9.9 Hz, 1H), 5.38-5.16 (m, 1H), 4.84-4.64 (m, 1H), 3.52-3.38 (m, 2H), 3.14 (d, J = 1.9 Hz, 3H), 2.52- 2.43 (m, 1H), 2.36 (s, 3H), 2.26-2.15 (m, 2H), 1.93-1.81 (m, 2H), 1.72-1.64 (m, 1H). 428 Column: CHIRALPAK IF, 2 * 25 cm, 5 um; Mobile Phase A: Hex (10 mM NH3- MeOH), Mobile Phase B: IPA- HPLC; Flow rate: 18 mL/min; Gradient: 50 B to 50 B in 13 min; 312/220 nm; 10.3 2-fluoro-8-methyl-8- 1H NMR (300 MHz, 428 15.3 azabicyclo[3.2.1]octan-3- Methanol-d4) ppm yl)(methyl)amino)pyridazin-3- 8.47 (s, 1H), 8.19 (d, yl)-5-(1H-1,2,3-triazol-1- J = 9.9 Hz, 1H), yl)phenol 8.00-7.87 (m, 2H), 4-fluoro-2-(6-(((1R,2R,3S,5S)- 7.47 (d, J = 6.6 Hz, 2-fluoro-8-methyl-8- 1H), 7.35 (d, J = 9.9 azabicyclo[3.2.1]octan-3- Hz, 1H), 5.38-5.16 yl)(methyl)amino)pyridazin-3- (m, 1H), 4.84-4.64 yl)-5-(1H-1,2,3-triazol-1- (m, 1H), 3.52-3.38 yl)phenol (m, 2H), 3.14 (d, J = 1.9 Hz, 3H), 2.52- 2.43 (m, 1H), 2.36 (s, 3H), 2.26-2.15 (m, 2H), 1.93-1.81 (m, 2H), 1.72-1.64 (m, 1H). 104A/ 104B 2-fluoro-4-(6-(((1S,2S,3R,5R)- 2-fluoro-8-methyl-8- azabicyclo[3.2.1]octan-3- yl)(methyl)amino)pyridazin-3- yl)-5-hydroxy-N,N- X 1H NMR (400 MHz, Methanol-d4) ppm 8.15 (d, J = 9.9 Hz, 1H), 7.68 (d, J = 10.7 Hz, 1H), 7.33 (d, J = 9.9 Hz, 1H), 6.93 (d, J = 5.8 Hz, 1H), 5.26 (dd, J = 36.2, 11.9 Hz, 1H), 4.82-4.62 (m, 1H), 3.47 (d, J = 5.4 Hz, 1H), 3.40 (s, 1H), 3.14 (s, 3H), 3.13 (d, J = 1.9 Hz, 3H), 3.03 (d, J = 1.2 Hz, 3H), 2.47 (td, J = 12.8, 3.0 Hz, 1H), 2.36 (s, 3H), 2.21 (d, J = 6.4 Hz, 2H), 1.95-1.79 (m, 2H), 1.68 (ddd, J = 12.5, 6.2, 3.2 Hz, 1H). 432 Column: XBridge Shield RP18 OBD Column, 5 um, 19 * 150 mm; Mobile Phase A: Water (10 MMOL/L NH4HCO3 + 0.1% NH3.Math.H2O), Mobile Phase B: ACN; Flow rate: 20 mL/min; Gradient: 47% B to 77% B in 8 min; 254 nm 2.4 dimethylbenzamide 1H NMR (400 MHz, 432 2.8 2-fluoro-4-(6-(((1R,2R,3S,5S)- Methanol-d4) ppm 8.15 (d, J = 9.9 Hz, 2-fluoro-8-methyl-8- 1H), 7.68 (d, J = 10.7 azabicyclo[3.2.1]octan-3- Hz, 1H), 7.33 (d, J = yl)(methyl)amino)pyridazin-3- 9.9 Hz, 1H), 6.93 (d, yl)-5-hydroxy-N,N- J = 5.8 Hz, 1H), 5.26 dimethylbenzamide (dd, J = 36.2, 11.9 Hz, 1H), 4.82-4.62 (m, 1H), 3.47 (d, J = 5.4 Hz, 1H), 3.40 (s, 1H), 3.14 (s, 3H), 3.13 (d, J = 1.9 Hz, 3H), 3.03 (d, J = 1.2 Hz, 3H), 2.47 (td, J = 12.8, 3.0 Hz, 1H), 2.36 (s, 3H), 2.21 (d, J = 6.4 Hz, 2H), 1.95-1.79 (m, 2H), 1.68 (ddd, J = 12.5, 6.2, 3.2 Hz, 1H). 105A/ 105B 7-(6-(((1S,2S,3R,5R)-2-fluoro- 8-methyl-8- X 1H NMR (400 MHz, DMSO-d6) ppm 13.26 (s, 1H), 8.39 (d, J = 9.9 Hz, 1H), 8.15 (s, 1H), 7.49 (s, 1H), 7.38 (d, J = 9.9 Hz, 1H), 4.99 (d, J = 31.0 Hz, 1H), 4.65 (dt, J = 51.4, 3.7 Hz, 1H), 3.53 (s, 3H), 3.35-3.28 (m, 2H), 3.04 (d, J = 1.7 Hz, 3H), 2.56 (s, 3H), 2.33 (td, J = 12.4, 3.1 Hz, 1H), 2.24 (s, 3H), 2.02 (d, J = 5.5 Hz, 2H), 1.71 (t, J = 9.4 Hz, 1H), 1.63-1.48 (m, 2H). 439 Column: CHIRAL ART Cellulose-SB, 2 * 25 cm, 5 um; Mobile Phase A: MTBE (10 mM NH3- MEOH)- HPLC, Mobile Phase B: EtOH- HPLC; Flow rate: 20 mL/min; Gradient: 30 B to 30 B in 6.5 min; 240/220 nm, 7.30 azabicyclo[3.2.1]octan-3- 1H NMR (400 MHz, 439 8.30 yl)(methyl)amino)pyridazin-3- DMSO-d6) ppm yl)-6-hydroxy-2,3- 13.26 (s, 1H), 8.39 dimethylquinazolin-4(3H)-one (d, J = 9.9 Hz, 1H), 7-(6-(((1R,2R,3S,5S)-2-fluoro- 8.15 (s, 1H), 7.49 (s, 8-methyl-8- 1H), 7.38 (d, J = 9.9 azabicyclo[3.2.1]octan-3- Hz, 1H), 4.99 (d, J = yl)(methyl)amino)pyridazin-3- 31.0 Hz, 1H), 4.65 yl)-6-hydroxy-2,3- (dt, J = 51.4, 3.7 Hz, dimethylquinazolin-4(3H)-one 1H), 3.53 (s, 3H), 3.35-3.28 (m, 2H), 3.04 (d, J = 1.7 Hz, 3H), 2.56 (s, 3H), 2.33 (td, J = 12.4, 3.1 Hz, 1H), 2.24 (s, 3H), 2.02 (d, J = 5.5 Hz, 2H), 1.71 (t, J = 9.4 Hz, 1H), 1.63-1.48 (m, 2H). 106A/ 106B 6-(6-(((1S,2S,3R,5R)-2-fluoro- X 1H NMR (400 MHz, Methanol-d4) 8.20~8.16 (d, J = 10.0 Hz, 1H), 7.99 (s, 1H), 7.33~7.27 (m, 2H), 7.18 (s, 1H), 5.28~5.13 (m, 1H), 4.80~4.63 (m, 1H), 3.50~3.43 (m, 1H), 3.38 (s, 4H), 3.18~3.08 (m, 6H), 2.45 (td, J = 12.8, 3.1 Hz, 1H), 2.34 (s, 3H), 2.25~2.12 (m, 2H), 1.92~1.80 (m, 2H), 1.69~1.62 (m, 1H) 454 CHIRALPAK IA, 2 * 25 cm, 5 um; Mobile Phase A: CO2, Mobile Phase B: IPA- HPLC; Flow rate: 40 mL/min; Gradient: 50% B; 220 nm; 3.22 8-methyl-8- azabicyclo[3.2.1]octan-3- 1H NMR (400 MHz, 454 4.66 yl)(methyl)amino)pyridazin-3- Methanol-d4) yl)-5-hydroxy-N,N- 8.20~8.15 (d, J = dimethylbenzofuran-2- 10.0 Hz, 1H), 7.99 carboxamide (s, 1H), 7.32~7.26 6-(6-(((1R,2R,3S,5S)-2-fluoro- (m, 2H), 7.17 (s, 1H), 8-methyl-8- 5.29~5.12 (m, 1H), azabicyclo[3.2.1]octan-3- 4.80~4.64 (m, 1H), yl)(methyl)amino)pyridazin-3- 3.50~3.43 (m, 1H), yl)-5-hydroxy-N,N- 3.38 (s, 4H), 3.18~ dimethylbenzofuran-2- 3.08 (m, 6H), 2.45 carboxamide (td, J = 12.8, 3.1 Hz, 1H), 2.34 (s, 3H), 2.25~2.12 (m, 2H), 1.91~1.80 (m, 2H), 1.70~1.62 (m, 1H) 107A/ 107B azetidin-1-yl(6-(6- X 1H NMR (300 MHz, DMSO-d6) 13.25 (s, 1H), 8.35 (d, J = 9.9 Hz, 1H), 8.23 (s, 1H), 7.40 (d, J = 9.9 Hz, 1H), 7.33 (d, J = 0.8 Hz, 1H), 7.19 (s, 1H), 4.97 (d, J = 27.1 Hz, 1H), 4.77-4.51 (m, 3H), 4.08 (t, J = 7.8 Hz, 2H), 3.30 (d, J = 14.7 Hz, 2H), 3.04 (d, J = 1.7 Hz, 3H), 2.40-2.31 (m, 3H), 2.24 (s, 3H), 2.03 (s, 2H), 1.71 (t, J = 9.3 Hz, 1H), 1.55 (s, 2H). 466 Column: CHIRALPAK IA, 2 * 25 cm, 5 um; Mobile Phase A: Hex (10 mM NH3), Mobile Phase B: IPA- HPLC; Flow rate: 20 mL/min; Gradient: 50 B to 50 B in 20 min; 223/261 nm; 7.8 (((1S,2S,3R,5R)-2-fluoro-8- methyl-8- 1H NMR (300 MHz, 466 12.5 azabicyclo[3.2.1]octan-3- DMSO-d6) 13.25 yl)(methyl)amino)pyridazin-3- (s, 1H), 8.35 (d, J = yl)-5-hydroxybenzofuran-2- 9.9 Hz, 1H), 8.23 (s, yl)methanone 1H), 7.40 (d, J = 9.9 azetidin-1-yl(6-(6- Hz, 1H), 7.33 (s, 1H), (((1R,2R,3S,5S)-2-fluoro-8- 7.20 (s, 1H), 4.96 (d, methyl-8- J = 34.7 Hz, 1H), azabicyclo[3.2.1]octan-3- 4.73 (s, 1H), 4.63- yl)(methyl)amino)pyridazin-3- 4.54 (m, 2H), 4.08 yl)-5-hydroxybenzofuran-2- (t, J = 7.7 Hz, 2H), yl)methanone 3.32 (s, 2H), 3.04 (d, J = 1.7 Hz, 3H), 2.37 (q, J = 7.9 Hz, 3H), 2.24 (s, 3H), 2.03 (s, 2H), 1.71 (t, J = 9.5 Hz, 1H), 1.55 (s, 2H). 108A/ 108B 0 7-(6-(((1S,2S,3R,5R)-2-fluoro- X 1H NMR (400 MHz, DMSO-d6) 13.36 (s, 1H), 8.40 (d, J = 10.0 Hz, 1H), 8.27 (d, J = 4.4 Hz, 2H), 7.59 (s, H), 7.39 (d, J = 10.0 Hz, 1H), 4.99-4.92 (m, 3H), 4.70-4.55 (m, 1H), 3.30-3.24 (m, 2H), 3.05 (s, 3H), 2.38- 2.30 (m, 1H), 2.24 (s, 3H), 2.03 (s, 2H), 1.74-1.69 (m, 1H), 1.62-1.52 (m, 2H). 493 Instrument: SFC-200 (Thar, Waters) Column: AD 20 * 250 mm, 10 um (Daicel) Column temperature: 35 C. Mobile phase: CO2/MEOH (0.2% Methanol Ammonia) = 80/20 Flow rate: 120 g/min Back pressure: 100 bar 1.05 8-methyl-8- 1H NMR (400 MHz, 493 Detection 2.07 azabicyclo[3.2.1]octan-3- DMSO-d6) 13.36 wavelength: yl)(methyl)amino)pyridazin-3- (s, 1H), 8.40 (d, J = 214 nm yl)-6-hydroxy-3-(2,2,2- 10.0 Hz, 1H), 8.27 Cycle time: trifluoroethyl)quinazolin-4(3H)- (d, J = 4.4 Hz, 2H), 4.1 min one 7.59 (s, 1H), 7.39 (d, Sample 7-(6-(((1R,2R,3S,5S)-2-fluoro- J = 10.0 Hz, 1H), solution: 8-methyl-8- 4.99-4.92 (m, 3H), 6000 mg azabicyclo[3.2.1]octan-3- 4.70-4.55 (m, 1H), dissolved in yl)(methyl)amino)pyridazin-3- 3.30-3.24 (m, 2H), 110 ml yl)-6-hydroxy-3-(2,2,2- 3.05 (d, J = 1.6 Hz, MEOH trifluoroethyl)quinazolin-4(3H)- 3H), 2.38-2.30 (m, Injection one 1H), 2.24 (s, 3H), volume: 2 ml 2.03 (s, 2H), 1.74- 1.69 (m, 1H), 1.62-1.52 (m, 2H). 109A/ 109B 7-(6-(((1S,2S,3R,5R)-2-fluoro- X 1H NMR (500 MHz, DMSO-d6) 8.43 (d, J = 9.8 Hz, 1H), 8.26-8.25 (m, 2H), 7.58 (s, 1H), 7.35 (d, J = 9.0 Hz, 1H), 5.80-5.75 (m, 1H), 4.98-4.93 (m, 2H), 4.80 (d, J = 50.3 Hz, 1H), 3.11-3.03 (m, 5H), 2.65-2.59 (m, 1H), 2.55 (s, 3H), 2.08-1.85 (m, 3H), 1.74-1.71 (m, 1H), 1.57-1.40 (m, 3H) 507 Instrument: SFC-80 (Thar, Waters) Column: AD 20 * 250 mm, 10 um (Daicel) Column temperature: 35 C. Mobile phase: CO2/ MeOH (0.2% Methanol Ammonia) = 50/50 Flow rate: 80 g/min Back pressure: 0.87 9-methyl-9- 1H NMR (500 MHz, 507 100 bar 1.81 azabicyclo[3.3.1]nonan-3- DMSO-d6) 8.43 (d, Detection yl)(methyl)amino)pyridazin-3- J = 9.8 Hz, 1H), wavelength: yl)-6-hydroxy-3-(2,2,2- 8.26-8.25 (m, 2H), 214 nm trifluoroethyl)quinazolin-4(3H)- 7.58 (s, 1H), 7.35 (d, Cycle time: one J = 9.0 Hz, 1H), 5.0 min 7-(6-(((1R,2R,3S,5S)-2-fluoro- 5.80-5.75 (m, 1H), Sample 9-methyl-9- 4.98-4.93 (m, 2H), solution: azabicyclo[3.3.1]nonan-3- 4.80 (d, J = 50.3 Hz, 500 mg yl)(methyl)amino)pyridazin-3- 1H), 3.11-3.03 (m, dissolved in yl)-6-hydroxy-3-(2,2,2- 5H), 2.65-2.59 (m, 25 ml trifluoroethyl)quinazolin-4(3H)- 1H), 2.55 (s, 3H), Methanol one 2.08-1.85 (m, 3H), Injection 1.74-1.71 (m, 1H), volume: 1.57-1.40 (m, 3H) 1.9 ml 110A/ 110B 7-(6-(((1S,3R,5R)-6,6-difluoro- 8-methyl-8- X 1H NMR (400 MHz, DMSO-d6) 8.40 (d, J = 10.0 Hz, 1H), 8.26 (d, J = 14.4 Hz, 2H), 7.50 (s, 1H), 7.28 (d, J = 9.6 Hz, 1H), 5.18- 5.12 (m, 1H), 4.95- 4.93 (m, 2H), 3.43- 3.42 (m, 1H), 3.02 (s, 3H),2.67-2.59 (m, 1H), 2.50 (s, 3H), 2.38-2.31 (m, 2H), 2.16-2.01 (m, 2H), 1.65-1.51 (m, 2H) 511 Instrument: SFC-80 (Thar, Waters) Column: WHELK 20 * 250 mm, 10 um (Daicel) Column temperature: 35 C. Mobile phase: CO2/MeOH (0.2% Methanol Ammonia) = 60/40 Flow rate: 80 g/min 3.15 azabicyclo[3.2.1]octan-3- 1H NMR (400 MHz, 511 Back pressure: 3.56 yl)(methyl)amino)pyridazin-3- DMSO-d6) 8.40 (d, 100 bar yl)-6-hydroxy-3-(2,2,2- J = 10.0 Hz, 1H), Detection trifluoroethyl)quinazolin-4(3H)- 8.26 (d, J = 14.4 Hz, wavelength: one 2H), 7.50 (s, 1H), 214 nm 7-(6-(((1R,3S,5S)-6,6-difluoro- 7.28 (d, J = 9.6 Hz, Cycle time: 8-methyl-8- 1H), 5.18-5.12 (m, 3.0 min azabicyclo[3.2.1]octan-3- 1H), 4.95-4.93 (m, Sample yl)(methyl)amino)pyridazin-3- 2H), 3.43-3.42 (m, solution: yl)-6-hydroxy-3-(2,2,2- 1H), 3.02 (s, 3H), 400 mg trifluoroethyl)quinazolin-4(3H)- 2.67-2.59 (m, 1H), dissolved one 2.50 (s, 3H), 2.38- in 35 ml 2.31 (m, 2H), 2.16- Methanol 2.01 (m, 2H), 1.65- Instrument: 1.51 (m, 2H) SFC-80 (Thar, Waters) Column: WHELK 20 * 250 mm, 10 um (Daicel) Column temperature: 35 C. Mobile phase: CO2/ MeOH (0.2% Methanol Ammonia) = 60/40 Flow rate: 80 g/min Back pressure: 100 bar Detection wavelength: 214 nm Cycle time: 3.0 min Sample solution: 400 mg dissolved in 35 ml Methanol 111A/ 111B 7-(6- X 1H NMR (300 MHz, DMSO-d6) ppm 13.22 (s, 1H), 8.42 (d, J = 9.8 Hz, 1H), 8.28 (d, J = 1.7 Hz, 2H), 7.68 (d, J = 9.8 Hz, 1H), 7.61 (s, 1H), 5.06-4.60 (m, 4H), 3.35-3.30 (m, 2H), 2.65 (d, J = 12.1 Hz, 1H), 2.24 (s, 3H), 2.02 (s, 2H), 1.65 (dd, J = 35.4, 15.5 Hz, 3H), 1.05 (d, J = 5.5 Hz, 3H), 0.45 (s, 1H). 519 Column: CHIRALPAK IE, 2 * 25 cm, 5 um; Mobile Phase A: MTBE (10 mM NH3- MEOH)- HPLC, Mobile Phase B: MeOH- HPLC; Flow rate: 20 mL/min; Gradient: 40 B to 40 B in 8 min; 250/220 nm 4.3 (cyclopropyl((1S,2S,3R,5R)-2- 1H NMR (300 MHz, 519 5.5 fluoro-8-methyl-8- DMSO-d6) ppm azabicyclo[3.2.1]octan-3- 13.22 (s, 1H), 8.42 (d, yl)amino)pyridazin-3-yl)-6- J = 9.8 Hz, 1H), 8.28 hydroxy-3-(2,2,2- (d, J = 1.7 Hz, 2H), trifluoroethyl)quinazolin-4(3H)- 7.68 (d, J = 9.8 Hz, one 1H), 7.61 (s, 1H), 7-(6- 5.06-4.60 (m, 4H), (cyclopropyl((1R,2R,3S,5S)-2- 3.35-3.30 (m, 2H), fluoro-8-methyl-8- 2.65 (d, J = 12.1 Hz, azabicyclo[3.2.1]octan-3- 1H), 2.24 (s, 3H), yl)amino)pyridazin-3-yl)-6- 2.02 (s, 2H), 1.65 hydroxy-3-(2,2,2- (dd, J = 35.4, 15.5 trifluoroethyl)quinazolin-4(3H)- Hz, 3H), 1.05 (d, one J = 5.5 Hz, 3H), 0.45 (s, 1H). 112A/ 112B azetidin-1-yl(6-(6- F 1H NMR (300 MHz, DMSO-d6) 13.27 (s, 1H), 8.34 (d, J = 9.9 Hz, 1H), 8.22 (s, 1H), 7.39 (d, J = 9.9 Hz, 1H), 7.32 (s, 1H), 7.19 (s, 1H), 5.07 (dd, J = 34.5, 11.9 Hz, 1H), 4.77- 4.49 (m, 3H), 4.08 (t, J = 7.6 Hz, 2H), 3.53 (s, 2H), 3.05 (s, 3H), 2.42-2.26 (m, 2H), 2.26-2.18 (m, 1H), 1.79 (s, 2H), 1.69 (d, J = 10.7 Hz, 2H), 1.54 (d, J = 9.9 Hz, 1H). 452 Column: CHIRALPAK IA, 2 * 25 cm, 5 um; Mobile Phase A: Hex (10 mM NH3), Mobile Phase B: IPA- HPLC; Flow rate: 20 mL/min; Gradient: 50 B to 50 B in 20 min; 223/261 nm; 7.8 (((1S,2S,3R,5R)-2-fluoro-8- azabicyclo[3.2.1]octan-3- 1H NMR (300 MHz, 452 12.5 yl)(methyl)amino)pyridazin-3- DMSO-d6) 13.27 yl)-5-hydroxybenzofuran-2- (s, 1H), 8.35 (d, J = yl)methanone 9.9 Hz, 1H), 8.22 (s, azetidin-1-yl(6-(6- 1H), 7.39 (d, J = 9.9 (((1R,2R,3S,5S)-2-fluoro-8- Hz, 1H), 7.33 (s, azabicyclo[3.2.1]octan-3- 1H), 7.19 (s, 1H), yl)(methyl)amino)pyridazin-3- 5.07 (dd, J = 34.8, yl)-5-hydroxybenzofuran-2- 12.3 Hz, 1H), 4.80- yl)methanone 4.48 (m, 3H), 4.08 (t, J = 7.7 Hz, 2H), 3.53 (s, 2H), 3.05 (d, J = 1.8 Hz, 3H), 2.36 (q, J = 7.7 Hz, 2H), 2.31-2.19 (m, 1H), 1.79 (s, 2H), 1.69 (d, J = 10.3 Hz, 2H), 1.54 (dd, J = 11.2, 5.6 Hz, 1H). 113A/ 113B 7-(6-(((1S,2S,3R,5R)-2-fluoro- 8-azabicyclo[3.2.1]octan-3- L 1H NMR (400 MHz, DMSO-d6) ppm 13.38 (s, 1H), 8.42 (d, J = 10.0 Hz, 1H), 8.21 (s, 1H), 7.53 (s, 1H), 7.40 (d, J = 9.9 Hz, 1H), 5.07 (p, J = 11.8, 9.0 Hz, 3H), 4.64 (d, J = 52.1 Hz, 1H), 3.54 (s, 2H), 3.07 (d, J = 1.8 Hz, 3H), 2.61 (s, 3H), 2.32-2.18 (m, 1H), 1.80 (s, 2H), 1.70 (d, J = 13.3 Hz, 2H), 1.56 (dd, J = 11.5, 6.0 Hz, 1H). 493 Column: CHIRAL ART Cellulose-SB, 2 * 25 cm, 5 um; Mobile Phase A: MTBE (10 mM NH3- MEOH)- HPLC, Mobile Phase B:EtOH- HPLC; Flow rate: 20 mL/min; Gradient: 10 B to 10 B in 13 min; 250/220 nm 7.10 yl)(methyl)amino)pyridazin-3- 1H NMR (400 MHz, 493 9.30 yl)-6-hydroxy-2-methyl-3- DMSO-d6) ppm (2,2,2-trifluoroethyl)quinazolin- 13.38 (s, 1H), 8.42 (d, 4(3H)-one J = 10.0 Hz, 1H), 7-(6-(((1R,2R,3S,5S)-2-fluoro- 8.21 (s, 1H), 7.53 (s, 8-azabicyclo[3.2.1]octan-3- 1H), 7.40 (d, J = 9.9 yl)(methyl)amino)pyridazin-3- Hz, 1H), 5.07 (p, J = yl)-6-hydroxy-2-methyl-3- 11.8, 9.0 Hz, 3H), (2,2,2-trifluoroethyl)quinazolin- 4.64 (d, J = 52.1 Hz, 4(3H)-one 1H), 3.54 (s, 2H), 3.07 (d, J = 1.8 Hz, 3H), 2.61 (s, 3H), 2.32-2.18 (m, 1H), 1.80 (s, 2H), 1.70 (d, J = 13.3 Hz, 2H), 1.56 (dd, J = 11.5, 6.0 Hz, 1H). 114A/ 114B 7-(6-(((1S,2S,3R,5R)-2-fluoro- L 1H NMR (400 MHz, DMSO-d6) ppm 13.27 (s, 1H), 8.39 (d, J = 9.9 Hz, 1H), 8.15 (s, 1H), 7.49 (s, 1H), 7.38 (d, J = 9.9 Hz, 1H), 5.33-4.92 (m, 1H), 4.64 (dt, J = 52.1, 3.2 Hz, 1H), 3.53 (s, 5H), 3.06 (d, J = 1.8 Hz, 3H), 2.56 (s, 3H), 2.25 (td, J = 12.6, 3.1 Hz, 1H), 1.80 (s, 2H), 1.70 (q, J = 7.6, 5.9 Hz, 2H), 1.60-1.49 (m, 1H). 425 Column: CHIRAL ART Cellulose-SB, 2 * 25 cm, 5 um; Mobile Phase A: MTBE (10 mM NH3- MEOH)- HPLC, Mobile Phase B: EtOH- HPLC; Flow rate: 20 mL/min; Gradient: 30 B to 30 B in 6.5 min; 240/220 nm 7.30 8-azabicyclo[3.2.1]octan-3- 1H NMR (400 MHz, 425 8.30 yl)(methyl)amino)pyridazin-3- DMSO-d6) ppm yl)-6-hydroxy-2,3- 13.27 (s, 1H), 8.39 (d, dimethylquinazolin-4(3H)-one J = 9.9 Hz, 1H), 8.15 7-(6-(((1R,2R,3S,5S)-2-fluoro- (s, 1H), 7.49 (s, 1H), 8-azabicyclo[3.2.1]octan-3- 7.38 (d, J = 9.9 Hz, yl)(methyl)amino)pyridazin-3- 1H), 5.33-4.92 (m, yl)-6-hydroxy-2,3- 1H), 4.64 (dt, J = dimethylquinazolin-4(3H)-one 52.1, 3.2 Hz, 1H), 3.53 (s, 5H), 3.06 (d, J = 1.8 Hz, 3H), 2.56 (s, 3H), 2.25 (td, J = 12.6, 3.1 Hz, 1H), 1.80 (s, 2H), 1.70 (q, J = 7.6, 5.9 Hz, 2H), 1.60-1.49 (m, 1H). 115A/ 115B 5-(6-(((1S,2S,3R,5R)-2-fluoro- N 1H NMR (400 MHz, DMSO-d6) 13.69 (s, 1H), 8.44 (s, 1H), 8.39 (d, J = 10.0 Hz, 1H), 7.51 (s, 1H), 7.39 (d, J = 10.0 Hz, 1H), 5.10-4.98 (m, 1H), 4.70-4.56 (m, 1H), 3.52 (s, 2H), 3.04 (s, 3H), 2.74 (s, 3H), 2.45-2.40 (m, 1H), 2.27-2.20 (m, 1H), 1.79-1.63 (m, 4H), 1.56-1.51 (m, 1H). 400 Instrument: SFC-200 (Thar, Waters) Column: AD 20 * 250 mm, 10 um (Daicel) Column temperature: 35 C. Mobile phase: CO2/IPA (0.2% Methanol Ammonia)= 80/20 1.02 8-azabicyclo[3.2.1]octan-3- 1H NMR (400 MHz, 400 Flow rate: 1.7 yl)(methyl)amino)pyridazin-3- DMSO-d6) 13.69 130 g/min yl)-2-methylbenzo[d]thiazol-6- (s, 1H), 8.44 (s, 1H), Back pressure: ol 8.39 (d, J = 10.0 Hz, 100 bar 5-(6-(((IR,2R,3S,5S)-2-fluoro- 1H), 7.51 (s, 1H), Detection 8-azabicyclo[3.2.1]octan-3- 7.39 (d, J = 10.0 Hz, wavelength: yl)(methyl)amino)pyridazin-3- 1H), 5.10-4.98 (m, 214 nm yl)-2-methylbenzo[d]thiazol-6- 1H), 4.70-4.56 (m, Cycle time: ol 1H), 3.52 (s, 2H), 4 min 3.04 (s, 3H), 2.74 (s, Sample 3H), 2.45-2.40 (m, solution: 1H), 2.27-2.20 (m, 15000 mg 1H), 1.79-1.63 (m, dissolved in 4H), 1.56-1.51 (m, 410 ml 1H). MEOH Injection volume: 3 ml 116A/ 116B 6-(6-(((1S,2S,3R,5R)-2-fluoro- Q 1H NMR (400 MHz, DMSO-d6) 13.51 (s, 1H), 8.57 (s, 1H), 8.27 (s, 1H), 7.43- 7.39 (m, 2H), 5.16- 4.98 (m, 1H), 4.77- 4.56 (m, 1H), 3.56 (s, 2H), 3.05 (s, 3H), 2.78 (s, 3H), 2.27 (s, 1H), 1.90-1.66 (m, 4H), 1.60-1.55 (m, 1H). 400 Instrument: SFC-200 (Thar, Waters) Column: AD 20 * 250 mm, 10 um (Daicel) Column temperature: 35 C. Mobile phase: CO2/MEOH (0.2% Methanol Ammonia) = 80/20 1.05 8-azabicyclo[3.2.1]octan-3- 1H NMR (400 MHz, 400 Flow rate: 2.07 yl)(methyl)amino)pyridazin-3- DMSO-d6) 13.51 120 g/min yl)-2-methylbenzo[d]thiazol-5- (s, 1H), 8.57 (s, 1H), Back pressure: ol 8.27 (s, 1H), 7.43- 100 bar 6-(6-(((1R,2R,3S,5S)-2-fluoro- 7.39 (m, 2H), 5.16- Detection 8-azabicyclo[3.2.1]octan-3- 4.98 (m, 1H), 4.77- wavelength: yl)(methyl)amino)pyridazin-3- 4.56 (m, 1H), 3.56 214 nm yl)-2-methylbenzo[d]thiazol-5- (s, 2H), 3.05 (s, 3H), Cycle time: ol 2.78 (s, 3H), 2.27 4.1 min (s, 1H), 1.90-1.66 Sample (m, 4H), 1.60-1.55 solution: (m, 1H). 6000 mg dissolved in 110 ml MEOH Injection volume: 2 ml 117A/ 117B 0 6-(6-(((1S,2S,3R,5R)-2-fluoro- Q 1H NMR (500 MHz, DMSO-d6) 13.47 (s, 1H), 8.31 (d, J = 9.9 Hz, 1H), 8.22 (s, 1H), 7.40 (d, J = 9.9 Hz, 1H), 7.12 (s, 1H), 5.05 (dd, J = 38.0, 13.8 Hz, 1H), 4.71-4.58 (m, 1H), 3.57-3.47 (m, 2H), 3.05 (d, J = 1.5 Hz, 3H), 2.60 (s, 3H), 2.26-2.24 (m, 1H), 1.84-1.54 (m, 5H). 384 Instrument: SFC-150 (Thar, Waters) Column: SC 20 * 250 mm, 10 um (Regis) Column temperature: 35 C. Mobile phase: CO2/MEOH (0.2% Methanol Ammonia) = 60/40 Flow rate: 1.05 8-azabicyclo[3.2.1]octan-3- 1H NMR (500 MHz, 384 100 g/min 2.07 yl)(methyl)amino)pyridazin-3- DMSO-d6) 13.47 Back pressure: yl)-2-methylbenzo[d]oxazol-5- (s, 1H), 8.31 (d, J = 100 bar ol 9.9 Hz, 1H), 8.22 Detection 6-(6-(((1R,2R,3S,5S)-2-fluoro- (s, 1H), 7.40 (d, J = wavelength: 8-azabicyclo[3.2.1]octan-3- 9.9 Hz, 1H), 7.12 (s, 214 nm yl)(methyl)amino)pyridazin-3- 1H), 5.05 (dd, J = Cycle time: yl)-2-methylbenzo[d]oxazol-5- 38.0, 13.8 Hz, 1H), 3 min ol 4.71-4.58 (m, 1H), Sample 3.57-3.47 (m, 2H), solution: 3.05 (d, J = 1.5 Hz, 3000 mg 3H), 2.60 (s, 3H), dissolved in 2.26-2.24 (m, 1H), 100 ml 1.84-1.54 (m, 5H). Methanol Injection volume: 1 ml, 118A/ 118B 5-(6-(((1S,2S,3R,5R)-2-fluoro- Q 1H NMR (400 MHz, DMSO-d6) 14.03 (s, 1H), 8.35 (d, J = 10.0 Hz, 1H), 8.21 (s, 1H), 7.39 (d, J = 9.6 Hz, 1H), 7.17 (s, 1H), 5.07-4.99 (m, 1H), 4.70-4.57 (m, 1H), 3.52 (bs, 2H), 3.04 (s, 3H), 2.56 (s, 3H), 2.27-2.20 (m, 1H), 1.78-1.70 (m, 4H), 1.65-1.54 (m, 1H). 384.2 Instrument: SFC-200 (Thar, Waters) Column: AD 20 * 250 mm, 10 um (Daicel) Column temperature: 35 C. Mobile phase: CO2/MEOH (0.2% Methanol Ammonia) = 80/20 Flow rate: 1.05 8-azabicyclo[3.2.1]octan-3- 1H NMR (400 MHz, 384.2 120 g/min 2.07 yl)(methyl)amino)pyridazin-3- DMSO-d6) 14.02 (s, Back pressure: yl)-2-methylbenzo[d]oxazol-6- 1H), 8.37 (d, J = 10.0 100 bar ol Hz, 1H),8.22 (s, 1H), Detection 5-(6-(((1R,2R,3S,5S)-2-fluoro- 7.41 (d, J = 10.0 Hz, wavelength: 8-azabicyclo[3.2.1]octan-3- 1H), 7.18 (s, 1H), 214 nm yl)(methyl)amino)pyridazin-3- 5.09-5.01 (m, 1H), Cycle time: yl)-2-methylbenzo[d]oxazol-6- 4.76-4.63 (m, 1H), 4.1 min ol 3.61 (bs, 2H), 3.05 Sample (s, 3H), 2.57 (s, 3H), solution: 2.31-2.24 (m, 1H), 6000 mg 1.82-1.70 (m, 4H), dissolved in 1.65-1.54 (m, 1H). 110 ml MEOH Injection volume: 2 ml 119B 2-(6-(((1R,2R,3S,5S)-2-fluoro- 8-azabicyclo[3.2.1]octan-3- yl)(methyl)amino)pyridazin-3- yl)phenol Z 1H NMR (500 MHz, DMSO-d6) 13.44 (s, 1H), 8.24 (s, 1H), 7.89 (s, 1H), 7.38-7.26 (m, 2H), 6.94 (s, 2H), 5.03-5.00 (m, 1H), 4.73-4.58 (m, 1H), 3.67-3.62 (m, 2H), 3.04 (s, 3H), 2.26- 2.23 (m, 1H), 1.85- 1.50 (m, 5H). 329 Instrument: SFC-150 (Thar, Waters) Column: SC 20 * 250 mm, 10 um (Regis) Column temperature: 35 C. Mobile phase: CO2/MEOH (0.2% 2.07 Methanol Ammonia) = 60/40 Flow rate: 100 g/min Back pressure: 100 bar Detection wavelength: 214 nm Cycle time: 3 min Sample solution: 3000 mg dissolved in 100 ml Methanol Injection volume: 1 ml 120A/ 120B 5-(difluoromethyl)-2-(6- Z 1H NMR (400 MHz, Methanol-d4) 8.15 (d, J = 9.9 Hz, 1H), 7.88 (d, J = 8.6 Hz, 1H), 7.32 (d, J = 9.9 Hz, 1H), 7.12- 7.10 (m, 2H), 6.89- 6.61 (m, 1H), 5.41- 5.19 (m, 1H), 4.81- 4.66 (m, 1H), 3.68 (s, 2H), 3.13 (d, J = 1.7 Hz, 3H), 2.44- 2.37 (m, 1H), 2.09- 1.82 (m, 4H), 1.73-1.57 (m, 1H). 379 Instrument: SFC-80 (Thar, Waters) Column: OJ 20 * 250 mm, 10 um (Daicel) Column temperature: 35 C. Mobile phase: CO2/ MeOH (0.2% Methanol Ammonia) = 85/15 Flow rate: 80 g/min Back pressure: 100 bar 1.74 (((1S,2S,3R,5R)-2-fluoro-8- 1H NMR (400 MHz, 379 Detection 2.52 azabicyclo[3.2.1]octan-3- Methanol-d4) 8.15 wavelength: yl)(methyl)amino)pyridazin-3- (d, J = 9.9 Hz, 1H), 214 nm yl)phenol 7.88 (d, J = 8.6 Hz, Cycle time: 5-(difluoromethyl)-2-(6- 1H), 7.32 (d, J = 3.8 min (((1R,2R,3S,5S)-2-fluoro-8- 9.9 Hz, 1H), 7.12- Sample azabicyclo[3.2.1]octan-3- 7.10 (m, 2H), 6.89- solution: 840 yl)(methyl)amino)pyridazin-3- 6.61 (m, 1H), 5.41- mg dissolved yl)phenol 5.19 (m, 1H), 4.81- in 25 ml 4.66 (m, 1H), 3.68 Methanol (s, 2H), 3.13 (d, J = Injection 1.7 Hz, 3H), volume: 2.44-2.37 (m, 1H), 0.6 ml 2.09-1.82 (m, 4H), 1.73-1.57 (m, 1H). 121A/ 121B 7-(6-(((1S,2S,3R,5R)-2-fluoro- Z 1H NMR (400 MHz, DMSO-d6) 13.60 (s, 1H), 9.19 (s, 1H), 8.74 (s, 1H), 8.41 (d, J = 9.9 Hz, 1H), 8.35 (d, J = 5.8 Hz, 1H), 7.62 (d, J = 5.8 Hz, 1H), 7.44 (d, J = 9.9 Hz, 1H), 7.31 (s, 1H), 5.88-5.69 (m, 1H), 4.77 (d, J = 50.8 Hz, 1H), 3.30-3.20 (m, 2H), 3.08 (d, J = 1.5 Hz, 3H), 2.46- 2.36 (m, 1H), 2.00- 1.56 (m, 7H). 394 Instrument: SFC-150 (Waters) Column: AD 20 * 250 mm, 10 um (Daicel) Column temperature: 35 C. Mobile phase: CO2/ (MeOH/ACN (0.2% Methanol Ammonia) = 2.42 9-azabicyclo[3.3.1]nonan-3- 1:1) = 40/60 yl)(methyl)amino)pyridazin-3- 1H NMR (400 MHz, 394 Flow rate: 3.77 yl)isoquinolin-6-ol DMSO-d6) 13.59 120 g/min 7-(6-(((1R,2R,3S,5S)-2-fluoro- (s, 1H), 9.19 (s, 1H), Back pressure: 9-azabicyclo[3.3.1]nonan-3- 8.74 (s, 1H), 8.41 (d, 100 bar yl)(methyl)amino)pyridazin-3- J = 9.9 Hz, 1H), 8.35 Detection yl)isoquinolin-6-ol (d, J = 5.8 Hz, 1H), wavelength: 7.62 (d, J = 5.8 Hz, 214 nm 1H), 7.44 (d, J = 9.9 Cycle time: Hz, 1H), 7.31 (s, 1H), 4 min 5.89-5.67 (m, 1H), Sample 4.75 (d, J = 50.8 Hz, solution: 1H), 3.28-3.16 (m, 60 mg 2H), 3.08 (d, J = 1.5 dissolved in Hz, 3H), 2.46-2.36 20 ml (m, 1H), 1.98-1.56 Methanol (m, 7H). Injection volume: 1.9 ml 122 rac-5-(6-(((1R,2R,3S,5S)-2- fluoro-8- azabicyclo[3.2.1]octan-3- yl)(methyl)amino)pyridazin-3- Z 1H NMR (400 MHz, DMSO-d6) 8.70 (s, 1H), 8.55 (s, 1H), 8.29-8.20 (m, 2H), 7.20 (d, J = 9.6 Hz, 1H), 5.39-5.18 (m, 1H), 5.08-4.87 (m, 1H), 4.16-3.98 (m, 2H), 3.92 (s, 3H), 3.39 (s, 1H), 3.01 (s, 3H), 2.13-1.86 (m, 4H), 1.84-1.74 (m, 1H). 411 submitted as racemic yl)-2-(1-methyl-1H-pyrazol-4- yl)pyrimidin-4-ol 123A/ 123B 2-(6-(((1S,2S,3R,5R)-2-fluoro- Z 1H NMR (400 MHz, DMSO-d6) 13.78 (s, 1H), 8.20 (d, J = 10.0 Hz, 1H), 7.91 (d, J = 10.0 Hz, 1H), 7.40 (d, J = 9.9 Hz, 1H), 7.00 (d, J = 1.5 Hz, 1H), 6.78-6.61 (m, 3H), 5.06 (d, J = 23.9 Hz, 1H), 4.75 (d, J = 51.3 Hz, 1H), 3.66-3.64 (m, 2H), 3.49 (s, 3H), 3.03 (s, 3H), 2.32- 2.25 (m, 1H), 1.91- 1.67 (m, 4H), 1.62- 1.58 (m, 1H). 425 Instrument: SFC-200 (Thar, Waters) Column: AD 20 * 250 mm, 10 um (Daicel) Column temperature: 35 C. Mobile phase: CO2/MEOH (0.2% Methanol Ammonia) = 80/20 Flow rate: 120 g/min 1.05 8-azabicyclo[3.2.1]octan-3- 1H NMR (400 MHz, 425 Back pressure: 2.07 yl)(methyl)amino)pyridazin-3- DMSO-d6) 13.78 (s, 100 bar yl)-5-((1-methyl-1H-imidazol- 1H), 8.20 (d, J = 10.0 Detection 2-yl)oxy)phenol Hz, 1H), 7.91 (d, J = wavelength: 2-(6-(((1R,2R,3S,5S)-2-fluoro- 10.0 Hz, 1H), 7.40 214 nm 8-azabicyclo[3.2.1]octan-3- (d, J = 9.9 Hz, 1H), Cycle time: yl)(methyl)amino)pyridazin-3- 7.00 (d, J = 1.5 Hz, 4.1 min yl)-5-((1-methyl-1H-imidazol- 1H), 6.78-6.61 (m, Sample 2-yl)oxy)phenol 3H), 5.06 (d, J = solution: 23.9 Hz, 1H), 4.75 6000 mg (d, J = 51.3 Hz, 1H), dissolved in 3.66-3.64 (m, 2H), 110 ml 3.49 (s, 3H), 3.03 (s, MEOH 3H), 2.32-2.25 (m, Injection 1H), 1.91-1.67 volume: 2 ml (m, 4H), 1.62-1.58 (m, 1H). 124A N-(tert-butyl)-1-(4-(6- (((1S,2S,3R,5R)-2-fluoro-8- azabicyclo[3.2.1]octan-3- yl)(methyl)amino)pyridazin-3- yl)-3-hydroxyphenyl)-1H- imidazole-4-carboxamide Z 1H NMR (400 MHz, DMSO-d6) 14.14 (s, 1H), 8.45-8.38 (m, 1H), 8.32 (d, J = 10.0 Hz, 1H), 8.25 (s, 1H), 8.05 (d, J = 8.6 Hz, 1H), 7.42 (d, J = 9.7 Hz, 1H), 7.36 (s, 1H), 7.32 (d, J = 8.5 Hz, 1H), 7.19 (s, 1H), 5.16- 4.93 (m, 1H), 4.75- 4.54 (m, 1H), 3.54 (s, 2H), 3.05 (s, 3H), 2.25 (t, J = 11.6 Hz, 1H), 1.88-1.62 (m, 4H), 1.62-1.50 494 Instrument: SFC-200 (Thar, Waters) Column: AD 20 * 250 mm, 10 um (Daicel) Column temperature: 35 C. Mobile phase: CO2/MEOH (0.2% Methanol Ammonia) = 80/20 Flow rate: 120 g/min 1.05 (m, 1H), 1.40 (s, 9H). Back pressure: 100 bar Detection wavelength: 214 nm Cycle time: 4.1 min Sample solution: 6000 mg dissolved in 110 ml MEOH Injection volume: 2 ml 125A/ 125B 6-(6-(((1S,3R,5R)-6,6-difluoro- Z 1H NMR (500 MHz, DMSO-d6) 9.14 (s, 1H), 8.55 (s, 1H), 8.41-8.23 (m, 2H), 7.75 (d, J = 5.8 Hz, 1H), 7.48 (s, 1H), 7.37 (d, J = 9.9 Hz, 1H), 5.21 (s, 1H), 3.73 (s, 1H), 3.57 (d, J = 13.8 Hz, 1H), 3.02 (s, 3H), 2.46- 2.35 (m, 2H), 2.09- 1.64 (m, 4H). 398 nstrument: SFC-80 (Thar, Waters) Column: AD 20 * 250 mm, 10 um (Daicel) Column temperature: 35 C. Mobile phase: CO2/ MeOH (0.2% Methanol Ammonia) = 80/20 2.19 8-azabicyclo[3.2.1]octan-3- 1H NMR (500 MHz, 398 Flow rate: 3.16 yl)(methyl)amino)pyridazin-3- DMSO-d6) 9.14 (s, 80 g/min yl)isoquinolin-7-ol 1H), 8.55 (s, 1H), Back pressure: 6-(6-(((1R,3S,5S)-6,6-difluoro- 8.46-8.22 (m, 2H), 100 bar 8-azabicyclo[3.2.1]octan-3- 7.74 (d, J = 5.7 Hz, Detection yl)(methyl)amino)pyridazin-3- 1H), 7.48 (s, 1H), wavelength: yl)isoquinolin-7-ol 7.36 (d, J = 9.9 Hz, 214 nm 1H), 5.20 (s, 1H), Cycle time: 3.65 (d, J = 3.5 Hz, 4.8 min 1H), 3.46 (d, J = 12.8 Sample Hz, 1H), 3.01 (s, 3H), solution: 2.44-2.27 (m, 2H), 240 mg 2.05-1.66 (m, 4H). dissolved in 25 ml Methanol 126A/ 126Bc 7-(6-(((1S,3R,5R)-6,6-difluoro- Z 1H NMR (400 MHz, DMSO-d6) 13.86 (s, 1H), 9.18 (s, 1H), 8.73 (s, 1H), 8.40 (d, J = 9.9 Hz, 1H), 8.35 (d, J = 5.8 Hz, 1H), 7.61 (d, J = 5.8 Hz, 1H), 7.39 (d, J = 9.9 Hz, 1H), 7.30 (s, 1H), 5.26-5.08 (m, 1H), 3.65 (s, 1H), 3.47 (d, J = 13.1 Hz, 1H), 3.01 (s, 3H), 2.44-2.30 (m, 2H), 2.01-1.76 (m, 3H), 1.75-1.65 (m, 1H). 398 Instrument: SFC-150 (Thar, Waters) Column: RR WHELK 20 * 250 mm, 10 um (Daicel) Column temperature: 35 C. Mobile phase: CO2/ETOH (0.5% Methanol Ammonia) = 50/50 3.72 8-azabicyclo[3.2.1]octan-3- Flow rate: yl)(methyl)amino)pyridazin-3- 1H NMR (400 MHz, 398 120 g/min 4.4 yl)isoquinolin-6-ol DMSO-d6) 13.86 Back pressure: 7-(6-(((1R,3S,5S)-6,6-difluoro- (s, 1H), 9.18 (s, 1H), 100 bar 8-azabicyclo[3.2.1]octan-3- 8.73 (s, 1H), 8.40 (d, Detection yl)(methyl)amino)pyridazin-3- J = 9.9 Hz, 1H), wavelength: yl)isoquinolin-6-ol 8.35 (d, J = 5.8 Hz, 214 nm 1H), 7.61 (d, J = 5.8 Cycle time: Hz, 1H), 7.39 (d, J = 5 min 9.9 Hz, 1H), 7.30 (s, Sample 1H), 5.27-5.08 (m, solution: 1H), 3.64 (s, 1H), 260 mg 3.46 (d, J = 13.5 Hz, dissolved in 1H), 3.01 (s, 3H), 40 ml 2.44 2.30 (m, 2H), Methanol 2.01-1.75 (m, Injection 3H), 1.74-1.65 volume: (m, 1H). 1.5 ml 127A/ 127B 0 (R)-4-(4-(6-(((1R,3S,5S)-6,6- difluoro-8- Z H NMR (400 MHz, DMSO-d6) 13.36 (s, 1H), 8.21 (d, J = 9.9 Hz, 1H), 7.73 (d, J = 11.9 Hz, 1H), 7.29 (d, J = 9.9 Hz, 1H), 6.85 (d, J = 6.8 Hz, 1H), 5.09 (s, 1H), 3.63 (s, 1H), 3.48- 3.36 (m, 2H), 3.30 (s, 1H), 3.10 (s, 1H), 2.97 (s, 3H), 2.86 (s, 4H), 2.47-2.37 (m, 2H), 2.33 (d, J = 13.9 Hz, 2H), 2.00 (d, J = 4.8 Hz, 2H), 1.92 (td, J = 13.4, 12.7, 3.0 Hz, 1H), 1.81 (d, J = 13.2 Hz, 2H), 1.73-1.64 (m, 1H) 475 Column: CHIRALPAK IF, 2 * 25 cm, 5 um; Mobile Phase A:, Mobile Phase B: EtOH- HPLC; Flow rate: 15 mL/min; Gradient: 30 B to 30 B in 11.5 min; 290/210 nm; 8 azabicyclo[3.2.1]octan-3- yl)(methyl)amino)pyridazin-3- H NMR (400 MHz, 475 9.22 yl)-2-fluoro-5-hydroxyphenyl)- DMSO-d6) 13.36 1-methylpiperidin-2-one (s, 1H), 8.21 (d, J = (R)-4-(4-(6-(((1S,3R,5R)-6,6- 9.9 Hz, 1H), 7.73 (d, difluoro-8- J = 11.9 Hz, 1H), azabicyclo[3.2.1]octan-3- 7.29 (d, J = 9.9 Hz, yl)(methyl)amino)pyridazin-3- 1H), 6.85 (d, J = 6.8 yl)-2-fluoro-5-hydroxyphenyl)- Hz, 1H), 5.09 (s, 1H), 1-methylpiperidin-2-one 3.63 (s, 1H), 3.42 (t, J = 10.4 Hz, 2H), 3.29 (s, 1H), 3.10 (s, 1H), 2.97 (s, 3H), 2.86 (s, 4H), 2.47- 2.36 (m, 2H), 2.33 (d, J = 14.0 Hz, 2H), 1.99 (t, J = 6.3 Hz, 2H), 1.92 (t, J = 10.9 Hz, 1H), 1.80 (d, J = 12.7 Hz, 2H), 1.68 (dd, J = 10.1, 5.7 Hz, 1H). 128A/ 128B (S)-4-(4-(6-(((1R,3S,5S)-6,6- difluoro-8- azabicyclo[3.2.1]octan-3- Z H NMR (400 MHz, DMSO-d6) 13.36 (s, 1H), 8.21 (d, J = 9.9 Hz, 1H), 7.73 (d, J = 11.9 Hz, 1H), 7.29 (d, J = 9.9 Hz, 1H), 6.85 (d, J = 6.8 Hz, 1H), 5.09 (s, 1H), 3.63 (s, 1H), 3.48- 3.36 (m, 2H), 3.30 (s, 1H), 3.10 (s, 1H), 2.97 (s, 3H), 2.86 (s, 4H), 2.47-2.37 (m, 2H), 2.33 (d, J = 13.9 Hz, 2H), 2.00 (d, J = 4.8 Hz, 2H), 1.92 (td, J = 13.4, 12.7, 3.0 Hz, 1H), 1.81 (d, J = 13.2 Hz, 2H), 1.73-1.64 (m, 1H). 475 Column: CHIRALPAK IF, 2 * 25 cm, 5 um; Mobile Phase A:, Mobile Phase B: EtOH- HPLC; Flow rate: 15 mL/min; Gradient: 30 B to 30 B in 11.5 min; 290/210 nm; 9.8 yl)(methyl)amino)pyridazin-3- yl)-2-fluoro-5-hydroxyphenyl)- H NMR (400 MHz, 475 13.2 1-methylpiperidin-2-one DMSO-d6) 13.36 (S)-4-(4-(6-(((1S,3R,5R)-6,6- (s, 1H), 8.21 (d, J = difluoro-8- 9.9 Hz, 1H), 7.73 (d, azabicyclo[3.2.1]octan-3- J = 11.9 Hz, 1H), yl)(methyl)amino)pyridazin-3- 7.29 (d, J = 9.9 Hz, yl)-2-fluoro-5-hydroxyphenyl)- 1H), 6.85 (d, J = 6.8 1-methylpiperidin-2-one Hz, 1H), 5.09 (s, 1H), 3.63 (s, 1H), 3.42 (t, J = 10.4 Hz, 2H), 3.29 (s, 1H), 3.10 (s, 1H), 2.97 (s, 3H), 2.86 (s, 4H), 2.47-2.36 (m, 2H), 2.33 (d, J = 14.0 Hz, 2H), 1.99 (t, J = 6.3 Hz, 2H), 1.92 (t, J = 10.9 Hz, 1H), 1.80 (d, J = 12.7 Hz, 2H), 1.68 (dd, J = 10.1, 5.7 Hz, 1H). 129A/ 129B 2-(6-(((1S,2S,3R,5R)-2-fluoro- N 1H NMR (400 MHz, DMSO-d6) 13.65 (s, 1H), 9.67 (s, 1H), 8.30 (d, J = 10.0 Hz, 1H), 8.09 (d, J = 8.8 Hz, 1H), 7.60-7.54 (m, 2H), 7.41 (d, J = 10 Hz, 1H), 5.16- 5.09 (m, 1H), 5.07- 5.00 (m, 1H), 3.57 (bs, 2H), 3.05 (s, 3H), 2.30-2.21 (m, 1H), 1.82-1.68 (m, 4H), 1.65-1.56 (m, 1H). 413.2 Instrument: SFC-200 (Thar, Waters) Column: AD 20 * 250 mm, 10 um (Daicel) Column temperature: 35 C. Mobile phase: CO2/MEOH (0.2% Methanol Ammonia) = 80/20 Flow rate: 120 g/min Back pressure: 100 bar 1.05 8-azabicyclo[3.2.1]octan-3- 1H NMR (400 MHz, 413.2 Detection 2.07 yl)(methyl)amino)pyridazin-3- DMSO-d6) 13.65 wavelength: yl)-5-(1,3,4-thiadiazol-2- (s, 1H), 9.66 (s, 1H), 214 nm yl)phenol 8.31 (d, J = 9.6 Hz, Cycle time: 2-(6-(((1R,2R,3S,5S)-2-fluoro- 1H), 8.09 (dd, J = 4.1 min 8-azabicyclo[3.2.1]octan-3- 5.2, 4.0 Hz, 1H), Sample yl)(methyl)amino)pyridazin-3- 7.60-7.54 (m, 1H), solution: yl)-5-(1,3,4-thiadiazol-2- 7.41 (d, J = 10 Hz, 6000 mg yl)phenol 1H), 5.16-5.09 (m, dissolved in 1H), 5.07-5.00 (m, 110 ml 1H), 3.59 (bs, 2H), MEOH 3.05 (s, 3H), 2.30- Injection 2.21 (m, 1H), 1.82- volume: 2 ml 1.68 (m, 4H), 1.65- 1.56 (m, 1H). 130A/ 130B 7-(6-(((1S,2S,3R,5R)-2-fluoro- X 1H NMR (300 MHz, DMSO-d6) ppm 13.38 (s, 1H), 8.41 (d, J = 10.0 Hz, 1H), 8.21 (s, 1H), 7.53 (s, 1H), 7.40 (d, J = 9.9 Hz, 1H), 5.05 (q, J = 8.9 Hz, 3H), 4.66 (d, J = 51.4 Hz, 1H), 3.35-3.30 (m, 2H), 3.05 (d, J = 1.7 Hz, 3H), 2.61 (s, 3H), 2.36 (d, J = 13.4 Hz, 1H), 2.24 (s, 3H), 2.03 (s, 2H), 1.66 (dd, J = 44.8, 10.3 Hz, 3H). 507 Column: CHIRAL ART Cellulose-SB, 2 * 25 cm, 5 um; Mobile Phase A: MTBE (10 mM NH3- MEOH)- HPLC, Mobile Phase B: EtOH- HPLC; Flow rate: 20 mL/min; Gradient: 10 B to 10 B in 13 min; 250/220 nm 7.10 8-methyl-8- 1H NMR (300 MHz, 507 9.30 azabicyclo[3.2.1]octan-3- DMSO-d6) ppm yl)(methyl)amino)pyridazin-3- 13.38 (s, 1H), 8.41 (d, yl)-6-hydroxy-2-methyl-3- J = 10.0 Hz, 1H), (2,2,2-trifluoroethyl)quinazolin- 8.21 (s, 1H), 7.53 (s, 4(3H)-one 1H), 7.40 (d, J = 9.9 7-(6-(((1R,2R,3S,5S)-2-fluoro- Hz, 1H), 5.05 (q, J = 8-methyl-8- 8.9 Hz, 3H), 4.66 (d, azabicyclo[3.2.1]octan-3- J = 51.4 Hz, 1H), yl)(methyl)amino)pyridazin-3- 3.35-3.30 (m, 2H), yl)-6-hydroxy-2-methyl-3- 3.05 (d, J = 1.7 Hz, (2,2,2-trifluoroethyl)quinazolin- 3H), 2.61 (s, 3H), 4(3H)-one 2.36 (d, J = 13.4 Hz, 1H), 2.24 (s, 3H), 2.03 (s, 2H), 1.66 (dd, J = 44.8, 10.3 Hz, 3H).

Example A14. mHTT Protein Assay

(529) Compounds were tested on GM04724 (CAG 70/20) Huntington's disease patient lymphoblast cells at doses ranging from 10 M to 0.6 nM. 4,500 cells/well were seeded in 384 well plates. One plate replica was carried out for parallel viability testing by CellTiter Glo (CTG). Compounds were incubated for 48 hours. mHTT protein levels were assessed by the 2B7-MW1 assay via Mesoscale Discovery (MSD) as previously reported (Macdonald et al., 2014). The antibody pair is comprised of previously characterized monoclonals (2B7 and MW1) interrogating two regions for HTT conformation and biological properties: the N17 domain and the polyQ domain (Baldo et al., 2012; Ko et., 2001). 2B7-MW1 is dependent on subject/animal specific levels of HTT at the time of treatment. 2B7-MW1 is dependent on polyQ expansion (e.g., the higher the expansion the higher the signal) and on mHTT size (e.g., a similar polyQ will give higher signal with smaller HTT size). The viability readout was carried out by CTG according to the manufacturer's instructions.

(530) The results of the mHTT protein assay and permeability assay are shown in Table 15. It is to be understood that the absolute stereochemistry for compounds of Table 14 is not determined and is arbitrarily assigned, and may in fact correspond to the enantiomer of the compound drawn. In some embodiments, the relative stereochemistry is indicated.

Example A15. HTT Quantitative Splicing Assay

(531) GM04724 (CAG 70/20) Huntington's disease patient lymphoblasts (Coriell) are plated in 96-well v-bottom plates at 50,000 cells/well. Immediately after plating, cells are dosed with compound for 24 h at concentrations ranging from 2.5 M to 0.15 nM (0.1% DMSO). Treated cells are lysed and cDNA synthesized using the Fast Advanced Cells-to-Ct kit (Thermofisher A35378) according to the manufacturer's instructions. 2 L of each cDNA are used in qPCR reactions to confirm the compound-induced inclusion of a cryptic exon within intron 49 of the Huntingtin (HTT) transcripts. The qPCR reactions are prepared in 384-well plates in 10 uL volume, using TaqMan Fast Advanced Master Mix [ThermoFisher; 4444965] with primers and probes shown in the table below. Reactions are run in a Quant Studio 6 qPCR instrument with default settings

(532) TABLE-US-00050 Probe/primersequences: HTTcryp49b-FAM: Probe: (SEQIDNO:114) 5CAGCAGAGCCCTGTCCTG3 Primer1: (SEQIDNO:115) 5CCCACAGCGCTGAAGGA3 Primer2: (SEQIDNO:116) 5TCCAGACTCAGCGGGATCT3 HTTex49_50-FAM: Probe: (SEQIDNO:117) 5TGGCAACCCTTGAGGCCCTGT3 Primer1: (SEQIDNO:118) 5CCTCCTGAGAAAGAGAAGGACA3 Primer2: (SEQIDNO:119) 5TCTGCTCATGGATCAAATGCC3 TBP-YAK(endogenouscontrol) Probe: (SEQIDNO:120) 5CCGCAGCTGCAAAATATTGTATCCACA3 Primer1: (SEQIDNO:121) 5TCGGAGAGTTCTGGGATT3 Primer2: (SEQIDNO:122) 5AAGTGCAATGGTCTTTAGGT3

Example B19. SMN Protein Assay

(533) Compounds were tested on spinal muscular atrophy (SMA) patient fibroblasts (GM03813, Coriell) at doses ranging from 2.5 M to 0.6 nM. 7000 cells/well were seeded in 96-well plates. Compounds were incubated for 48 hours and the cells were lysed with 100 L of lysis buffer. 20 L of lysate was used for SMN protein measurement by Mesoscale Discovery (MSD) assay developed by PharmOptima (Michigan). A standard curve prepared with SMN protein ranging from 1 g/ml to 19.5 pg/ml was used in each MSD plate to calculate the absolute SMN protein amount in each sample.

(534) One plate with 700 cells/well was prepared for parallel viability testing by Cell Tier Glo reagents (Promega, G7572/G7573 (CTG). The viability readout was carried out according to the manufacturer's instructions. The assay results for some exemplary compounds are shown in Table 15.

Example B20. SMN Quantitative Splicing Assay

(535) Spinal muscular atrophy (SMA) patient fibroblasts (GM03813, Coriell) are plated in 96-well plates at 50,000 cells/well. Immediately after plating, cells are dosed with compounds for 24 h at concentrations ranging from 2.5 M to 0.6 nM (0.1% DMSO). Treated cells are lysed and cDNA synthesized using the Fast Advanced Cells-to-Ct kit (Thermofisher A35378) according to the manufacturer's instructions. 2 L of each cDNA are used in qPCR reactions. The qPCR reactions are prepared in 384-well plates in 10 L volume, using TaqMan Fast Advanced Master Mix (ThermoFisher; 4444965) with primers and probes shown in the table below. Reactions are run in a Quant Studio 6 qPCR instrument with default settings.

(536) TABLE-US-00051 Probe/primersequences: SMNFL-FAM: Probe: (SEQIDNO:105) 5CTGGCATAGAGCAGCACTAAATGACACCAC3 Primer1: (SEQIDNO:102) 5GCTCACATTCCTTAAATTAAGGAGAAA3 Primer2: (SEQIDNO:104) 5TCCAGATCTGTCTGATCGTTTCTT3 SMN7-FAM: Probe: (SEQIDNO:105) 5CTGGCATAGAGCAGCACTAAATGACACCAC3 Primer1: (SEQIDNO:103) 5TGGCTATCATACTGGCTATTATATGGAA3 Primer2: (SEQIDNO:104) 5TCCAGATCTGTCTGATCGTTTCTT3 TBP-YAK(endogenouscontrol) Probe: (SEQIDNO:120) 5CCGCAGCTGCAAAATATTGTATCCACA3 Primer1: (SEQIDNO:121) 5TCGGAGAGTTCTGGGATT3 Primer2: (SEQIDNO:122) 5AAGTGCAATGGTCTTTAGGT3

(537) TABLE-US-00052 TABLE 15 Assay data for Compounds HTT SMN2 MDCK- MDCK- MDCK- MDCK- mHTT Splicing: SMN2 Splicing MDR1: MDR1: MDR1: MDR1: protein E49-50 protein FL % Recov % Recov Papp A-B Papp B-A MDCK- SMSM EC.sub.50 EC.sub.50 EC.sub.50 EC.sub.50 A-B B-A (10{circumflex over ()}6, (10{circumflex over ()}6, MDR1: # (nM) (nM) (nM) (nM) (%) (%) cm/s) cm/s) Efflux 1A A A A A 83 88 0.61 49.3 81 1B A A A A 97 98 0.49 40.4 83 2A B B B 54 81 11.3 39 3 2B A A E A 54 84 9.99 52.8 5 3A B A B 75 81 19.3 33.8 2 3B C D 80 71 16.3 22.7 1 4A B B A C 86 73 2.75 44.8 16 4B A A A A 87 85 2.82 49.7 18 5A A A A B 29 58 4.85 20.1 4 5B A A D 30 52 5.84 9.91 2 6A B E E 90 91 0.09 6.69 74 6A A E C 95 82 0.06 7.34 121 7A A B A B 65 75 3.31 20.1 6 7B C A C 69 89 4.27 36.1 8 8A A B D 87 93 1.67 59.3 36 8B A A B B 84 98 2.04 39.1 19 9A C A B 108 111 0.76 61.1 80 9B D B D 88 100 0.62 48.2 78 10A A A A A 55 67 11.6 19 2 10B C C A C 52 82 11.2 21.2 2 11A A A C 79 90 2.76 53.2 19 11B A A B A 77 89 2.4 55 23 12A B C B D 72 74 0.89 23.6 27 12B A A A A 57 52 0.7 30.1 43 13A B A A 92 86 8.7 50.5 6 13B D E 90 97 9.96 55.7 6 14A B B A C 59 83 3 42.4 14 14B A A A C 54 91 2.95 32.1 11 15A A A 61 70 2.76 34.4 12 15B A A A 62 84 3.21 39.3 12 16A B B D D 31 41 2.31 15.2 7 16B B A A B 24 26 1.16 18.7 16 17A A A A A 57 81 2.08 39.2 19 17B B B B C 62 79 1.91 36.8 19 18A C B A B 56 71 7 40.7 6 18B D E 55 69 8.37 35.6 4 19A C A C 81 94 10.1 56.6 6 19B E C 91 88 12.2 63.3 5 20A B B B 47 71 4.68 39.9 9 20B A A E 45 65 3.59 39.2 11 21A B A C 34 71 1.99 19.3 10 21B B A 39 68 1.73 30.4 18 22A A A 86 94 1.82 80.9 45 22B C 88 95 2.83 87.7 31 23A C B C 64 83 3.33 34.9 10 23B B B A B 68 98 3.17 48.2 15 24A C C A D 79 90 4.73 61.3 13 24B A A A A 73 91 5.99 33.8 6 25A D A D 99 99 1.79 55 31 25B B B A B 105 108 1.61 46.8 29 26A D C 65 77 2.09 43.6 21 26B A C A C 60 81 2.76 45.1 16 27A D A C 90 86 1.08 46.6 43 27B A B A A 98 115 1.13 43.5 38 28A B E 40 61 1.41 28.4 20 28B B A A A 36 70 1.11 38.9 35 29A B B A E 26 60 1.85 12.6 7 29B A B A E 21 48 1.54 5.63 4 30A B A C 35 55 11.1 19.7 2 30B C D 38 69 10.6 11 1 31A E E 45 66 8.77 31.3 4 31B E E 43 74 7.08 27 4 32A E E 90 98 0.34 20.2 59 32B E E 95 95 0.27 21.2 78 33A B B B C 95 105 1.33 40.7 31 33B A A A B 87 82 1.75 53 30 34A D B 8 55 0.63 1.05 2 34B C C B B 12 48 1.02 2.81 3 35A E E 102 103 0.21 41 197 35B E A 103 99 0.23 42 181 36A B B A B 68 82 3.68 38.6 10 36B A A A A 72 79 5.87 41.8 7 37A B A B B 52 69 17.3 34.4 2 37B C D 54 70 19 32.7 2 38A D E B 83 85 13 39.2 3 38B B B B 95 102 18.9 47.1 2 39A B B A B 83 76 8.1 40.5 5 39B D B 96 86 4.57 40.6 9 40A D E 62 92 3.68 57.9 16 40B A A B 67 99 4.71 75.8 16 41A A C A B 64 98 2 48.1 24 41B A B A B 60 95 2.57 36.7 14 42A A A A A 87 91 0.86 36.8 43 42B A A A A 78 73 0.71 27.7 39 43A B C A B 64 58 2.14 23.2 11 43B A A A A 66 48 2.32 28.3 12 44A A B D 87 86 8.12 50.9 6 44B A A B A 91 92 8.2 54.7 7 45A C B D 104 115 9.45 54.6 6 45B E E 95 111 10.2 45.3 4 46A B B E 68 89 31.7 29.2 1 46B D B D 68 86 32 31.6 1 47A D D E 98 108 1.45 49.3 34 47B C C B C 101 120 1.26 49.8 40 48A C A 58 76 3.71 29 8 48B B B A 67 84 6.56 24.5 4 49A B B A A 93 78 0.72 30.7 43 49B A A A A 86 91 0.86 32.9 38 50A A A A B 85 92 2.16 68.3 32 50B A A A A 80 95 1.81 51.8 29 51A A A E 94 86 0.81 38 47 51B A A A A 88 90 0.91 50.3 55 52A B D B C 86 92 6.63 49.7 8 52B A B A B 97 90 7.44 54.4 7 53A E E 96 114 0.32 41 127 53B E E 100 112 0.27 41.8 153 54A A B 108 115 3.54 82.6 23 54B A A 99 107 2.28 61.5 27 56A D E D 83 83 0.92 51.4 56 56B A A E B 96 97 1.12 51.2 46 57A E E 89 104 0.78 63.2 80 57B A B A B 99 95 0.69 48.5 71 58A D A D 86 89 0.36 71.4 201 58B E A A 76 85 0.43 53.9 126 59A D B C 97 96 2.11 74 35 59B E E 107 101 2.97 84.2 28 60A E E 94 100 0.44 65.9 151 60B D D 88 92 0.68 53 77 61A B A B 91 88 4.29 60.3 14 61B A A A A 98 93 3.79 45.8 12 62A A A B B 113 109 3.37 61.4 18 62B A A A A 82 80 3.18 59.8 19 63A C A B 76 91 1.5 46 31 63B B A B 72 96 2.31 44.9 19 64A E E 64 78 7.18 52.2 7 64B D E 69 83 5.61 58.6 10 65A D E C 94 93 5.82 50.5 9 65B C D B 84 87 6.9 54.6 8 66A E E 93 100 0.09 4.4 51 66B E E 98 98 0.07 4.64 68 67A E E 94 99 0.42 37.9 90 67B E E 91 96 0.47 40.9 86 68A D C 92 78 0.41 45.6 111 68B D C B C 92 91 0.4 44.7 113 69A D B C 87 86 1.36 39.4 29 69B B A c 88 90 1.51 52.3 35 70A E D 86 89 3.17 60.2 19 70B D E E 95 100 3.84 58.1 15 71A E E 88 92 3.87 26.2 7 71B E E 90 89 5.04 20.9 4 72A E E 88 77 11.6 39.9 3 72B D D C 78 74 10.9 36.4 3 73A A A A A 76 91 2.92 61.3 21 73B B A B A 72 72 3.38 55.1 16 74A B B D 69 81 3.13 44.5 14 74B A C A B 77 90 3 56 19 75A D C 101 100 2.31 50.3 22 75B C C B B 88 90 2.44 50.5 21 76A B D B D 83 88 5.55 69.2 12 76B A B A B 84 93 3.97 60.3 15 77A E D 104 110 0.29 36.3 124 77B D D C 102 106 0.28 40.3 144 78A B B B C 74 89 2.19 50.5 23 78B A A A A 73 79 4.03 50.3 12 79A A B A B 89 99 2.51 34.9 14 79B C B D 90 99 2.69 42.9 16 80A C C D 68 88 4.93 53.6 11 80B B C D 76 87 6.01 40.8 7 81A D B C 100 94 0.37 51 139 81B C A B 96 100 0.4 54.6 138 82A E D 104 121 0.08 3.33 40 82B E D 72 110 <0.21 3.28 > 15 83A A A A A 89 83 0.98 43.5 44 83B A A A A 77 72 1.43 44.4 31 84A A B A B 92 90 0.9 52 58 84B A A A A 112 76 1.06 50.9 48 85A A B A B 99 99 0.67 49.2 74 85B A A A A 98 103 0.71 48.5 68 86A E E 93 90 1.05 62.5 60 86B B C 88 92 0.81 53.6 66 87A C C A D 59 79 5.33 43.1 8 87B A A A A 70 88 3.3 28.7 9 88A C B D 85 99 4.84 45.7 9 88B B B A B 84 93 6.88 50.5 7 89A D B D 92 106 1.31 67.3 51 90A A A A A 41 69 6.97 22.5 3 90B A A B A 43 67 6.56 16.1 2 91A E D 84 82 4.19 62.8 15 91B E E 106 102 3.94 73.3 19 92A E E 93 88 1.23 57.8 47 92B D D 94 105 1.16 52.3 45 93A E D 50 70 5.27 17.9 3 93B D C 45 63 5.39 22.3 4 94A E D 68 71 4.99 33.9 7 94B E D 73 83 4.47 41.2 9 95A E E 85 115 0.15 8.79 59 96A E E 100 114 2.97 53.7 18 96B E E 92 98 2.72 55.2 20 97A E D 73 74 1.96 40.3 20 97B D D D 85 83 1.96 53.1 27 98A D D B D 86 105 4.11 64.7 16 98B B B B B 88 87 5.01 52.6 10 99A E D 114 91 2 36.3 18 99B D A C 103 112 2.74 56.7 21 100A E C D 80 102 6.34 40.7 6 100B C B B 79 80 9.57 38.7 4 101A D C 101 109 2.81 72.6 26 101B C A C 118 119 2.41 59.1 24 102A E D 88 92 1.43 58.1 41 102B C B D 91 91 1.63 48.1 30 103A E E 86 91 13.9 60.3 4 103B E C D 95 94 12.6 49.1 4 104A E E 106 105 1.23 43.1 35 104B E E 99 105 0.89 50.2 56 105A D D 105 115 0.58 56.9 99 105B B C E D 114 119 1.28 64.3 50 106A E E 95 92 1.87 63.1 34 106B E D 92 99 1.61 55.7 35 107A E E 80 82 1.27 55.1 43 107B E B D 76 84 0.99 46.3 47 108A E E 82 91 1.51 73.7 49 108B E E 102 101 0.98 59.5 61 109A E E 76 81 2.72 63.3 23 109B E E 74 87 2.39 63.3 26 110A E E 80 92 11 44.4 4 110B E E 86 93 11.7 47.4 4 111A E E 90 83 0.89 44.3 45 111B E E 74 56 0.66 35.9 54 112A C A C 95 78 0.6 43.8 74 112B A B A A 98 81 0.5 47.3 95 113A E A 96 99 0.2 66.9 333 113B D A B 101 123 0.3 68.4 232 114A A A A B 102 102 0.28 37.8 133 114B A A A A 88 94 0.29 43 150 115A A B A B 93 78 4.7 39.3 8 115B A A A A 71 88 6.4 42.6 7 116A A B A C 86 88 4.39 42.9 10 116B A A A A 77 80 6.29 43.2 7 117A B C B D 84 97 6.87 39.9 6 117B A B A B 90 86 4.32 45 10 118A B 118B A 119B E E 93 95 6.13 58.2 9 120A E E 76 74 4.59 34.8 8 120B E E 60 76 5.84 27.3 5 121A B C E 81 95 2.65 29.8 11 121B A A A A 83 111 4.47 39.5 9 122 E 86 98 <0.20 0.6 >3 123A E E 97 102 0.76 59.7 79 123B E D 92 102 0.66 58.7 89 124A E D 78 78 0.34 45.7 133 125A D C 63 87 14.1 43.3 3 125B C B B 67 81 15.6 53.2 3 126A C A B 80 92 13.7 35.3 3 126B E D 75 88 12.6 39.4 3 127A E 89 82 3.2 53.5 17 127B E 76 84 1.05 59.8 57 128A E 86 89 1.62 65.2 40 128B E 94 92 1.21 49.4 41 129A 129B 130A E E 105 116 0.67 75.4 113 130B E E 107 110 0.77 72.2 94 *EC.sub.50 ranges 0.01 A 15 16 B 50 51 C 100 101 D 500 501 E 10.000

(538) The examples and embodiments described herein are for illustrative purposes only and various modifications or changes suggested to persons skilled in the art are to be included within the spirit and purview of this application and scope of the appended claims.