L-threonine dehydratase variant and method of producing l-isoleucine using the same

12509673 ยท 2025-12-30

Assignee

Inventors

Cpc classification

International classification

Abstract

An L-threonine dehydratase variant is provided that is capable of producing increased yields of the amino acid L-isoleucine when expressed in host organisms and methods of producing increased yields of L-isoleucine using the same.

Claims

1. An L-threonine dehydratase variant in which an amino acid corresponding to the 381st position of an amino acid sequence of SEQ ID NO: 1 is substituted with a different amino acid, wherein the L-threonine dehydratase variant comprises a sequence having at least 96% identity with the amino acid sequence of SEQ ID NO:1, and wherein the different amino acid is selected from the group consisting of: alanine, serine, proline, glutamine, valine, isoleucine, and glycine.

2. The variant of claim 1, wherein the variant comprises one amino acid sequence selected from the group consisting of amino acid sequences of SEQ ID NOS: 4 to 9.

3. The variant of claim 1, wherein the variant is one in which an amino acid corresponding to the 383.sup.rd position of the amino acid sequence of SEQ ID NO: 1 is further substituted with alanine.

4. The variant of claim 3, wherein the variant comprises one amino acid sequence selected from the group consisting of amino acid sequences of SEQ ID NOS: 24-29.

5. A polynucleotide encoding the L-threonine dehydratase variant according to claim 1.

6. A microorganism comprising at least one of: the L-threonine dehydratase variant according to claim 1; a polynucleotide encoding the variant; and a vector including the polynucleotide.

7. The microorganism of claim 6, wherein the microorganism has L-isoleucine producing capability.

8. The microorganism of claim 6, wherein the microorganism belongs to the genus Corynebacterium.

9. The microorganism of claim 6, wherein the microorganism is Corynebacterium glutamicum.

10. A method of producing L-isoleucine, the method comprising: culturing a microorganism comprising at least one of: the L-threonine dehydratase variant according to claim 1, a polynucleotide encoding the variant, and a vector including the polynucleotide; in a culture medium.

11. The method of claim 10, further comprising recovering L-isoleucine from the culture medium or the microorganism.

12. A composition for producing L-isoleucine comprising a microorganism comprising at least one of: the L-threonine dehydratase variant according to claim 1, a polynucleotide encoding the variant, and a vector including the polynucleotide; or cultures of the microorganism.

13. The variant of claim 1, wherein the L-threonine dehydratase variant comprises a sequence having at least 98% identity with the amino acid sequence of SEQ ID NO: 1.

14. The variant of claim 1, wherein the L-threonine dehydratase variant comprises a sequence having at least 99% identity with the amino acid sequence of SEQ ID NO: 1.

15. The variant of claim 1, wherein the different amino acid is alanine.

16. The variant of claim 1, wherein the variant comprises the amino acid sequence of SEQ ID NO: 3.

17. The variant of claim 3, wherein the variant comprises the amino acid sequence of SEQ ID NO: 23.

Description

MODE FOR INVENTION

(1) Hereinafter, the present disclosure will be described in more detail with reference to the following examples. However, the following examples are merely presented to exemplify the present disclosure, and the scope of the present disclosure is not limited thereto.

Example 1: Preparation of ilvA Variant (F383A) Plasmid Having L-Threonine Dehydratase Activity

(2) In order to obtain a variant of the microorganism having enhanced L-isoleucine producing capability, mutation was induced in the microorganism according to the following method.

(3) In order to amplify a gene encoding L-threonine dehydratase (TD), ilvA gene (SEQ ID NO: 2), a BamHI restriction enzyme site was inserted into both ends of primer (SEQ ID NOS: 11 and 12) for amplification from a promoter region (about 300 bp upstream from an initiation codon) to a terminator region (about 100 bp downstream from a termination codon) based on a reported ilvA sequence introduced with F383A mutation (World J Microbiol Biotechnol (2015) 31:1369-1377). Also, primers (SEQ ID NOS: 13 and 14) were used to introduce F383A mutation into the ilvA gene. Sequences of the primers used herein are listed in Table 1 below.

(4) TABLE-US-00001 TABLE1 SEQIDNO: Name Sequence 11 primer1 ggatccGACTGAGCCTGGGCAACTGG 12 primer2 ggatccCCGTCACCGACACCTCCACA 13 primer3 ACATCACGCTGgcaGAGTACCTCAA 14 primer4 TTGAGGTACTCtgcCAGCGTGATGT

(5) PCR was performed using a chromosome of wild-type Corynebacterium glutamicum ATCC 13032 as a template and primers of SEQ ID NOS: 11 and 14 and SEQ ID NOS: 12 and 13. The PCR was performed under the following conditions. After denaturation at 95 C. for 5 minutes, cycles of denaturation at 95 C. for 30 seconds, annealing at 55 C. for 30 seconds, and polymerization at 72 C. for 90 seconds were repeated 30 times, and then polymerization was performed at 72 C. for 5 minutes.

(6) As a result, a DNA fragment of a 1460 bp 5 upstream region and a DNA fragment of a 276 bp 3 downstream region with respect to the mutation of the ilvA gene were obtained.

(7) PCR was performed using the two amplified DNA fragments as templates and primers of SEQ ID NOS: 11 and 12.

(8) As a result, a DNA fragment of 1531 bp including ilvA mutation (SEQ ID NO: 7) in which phenylalanine at the 383.sup.rd position was substituted with alanine was amplified. The pECCG117 (Korean Patent No. 10-0057684) vector and the ilvA DNA fragment were treated with BamHI restriction enzyme and ligated with a DNA ligase, followed by cloning to obtain a plasmid named pECCG117-ilvA (F383A).

Example 2: Preparation of ilvA Variant Plasmid Having L-Threonine Dehydratase Activity

(9) In order to obtain a variant of a gene encoding L-threonine dehydratase, an ilvA variant gene plasmid was prepared using a random mutagenesis kit (Agilent Technologies, USA). PCR was performed using the ilvA(F383A) chromosome of Example 1 as a template and primers of SEQ ID NOS: 11 and 12. The PCR was performed under the following conditions. After denaturation at 95 C. for 2 minutes, cycles of denaturation at 95 C. for 30 seconds, annealing at 55 C. for 30 seconds, and polymerization at 72 C. for 90 seconds were repeated 30 times, and then polymerization was performed at 72 C. for 10 minutes.

(10) As a result, a DNA fragment of 1531 bp including ilvA mutation capable of encoding L-threonine dehydratase having additional random mutation in addition to the mutation in which the phenylalanine at the 383.sup.rd position was substituted with alanine was amplified. The pECCG117 vector and the ilvA-mutated DNA fragment were treated with BamHI restriction enzyme and ligated with a DNA ligase, followed by cloning to obtain a plasmid.

Example 3: Preparation and Evaluation of Strain Belonging to the Genus Corynebacterium with L-Isoleucine Producing Capability

(11) An L-isoleucine-producing strain was prepared using the wild-type Corynebacterium glutamicum ATCC13032. Specifically, in order to relieve feedback inhibition of threonine, which is a precursor of isoleucine in the biosynthesis pathway of L-isoleucine, arginine at the 407.sup.th position of horn gene encoding homoserine dehydrogenase was substituted with histidine (U.S. Patent Application Publication No. US 2020-0340022 A1, SEQ ID NO: 17).

(12) More specifically, in order to prepare strains introduced with hom mutation (R407H), PCR was performed using the chromosome of Corynebacterium glutamicum ATCC13032 as a template and primers of SEQ ID NOS: 18 and 19 or SEQ ID NOS: 20 and 21, respectively. Sequences of the primers used herein are listed in Table 2 below.

(13) TABLE-US-00002 TABLE2 SEQ ID NO: Name Sequence 18 primer5 TCGAGCTCGGTACCCCGCTTTTGCACTCATCGAGC 19 primer6 CACGATCAGATGTGCATCATCAT 20 primer7 ATGATGATGCACATCTGATCGTG 21 primer8 CTCTAGAGGATCCCCGAGCATCTTCCAAAACCTTG

(14) As a polymerase for PCR, a PfuUltra high-reliability DNA polymerase (Stratagene) was used, and the PCR conditions included denaturation at 95 C. for 30 seconds, annealing at 55 C. for 30 seconds, and 28 repetitions of polymerization at 72 C. for 1 minute.

(15) As a result, a DNA fragment of a 1000 bp 5 upstream region and a DNA fragment of a 1000 bp 3 downstream region with respect to the mutation of the horn gene were obtained.

(16) PCR was performed using the two amplified DNA fragments as templates and primers of SEQ ID NOS: 18 and 21. The PCR was performed under the following conditions. After denaturation at 95 C. for 2 minutes, cycles of denaturation at 95 C. for 30 seconds, annealing at 55 C. for 30 seconds, and polymerization at 72 C. for 2 minutes were repeated 28 times, and then polymerization was performed at 72 C. for 5 minutes.

(17) As a result, a DNA fragment of 2 kb including mutation in the horn gene encoding the homoserine dehydrogenase variant in which arginine at the 407.sup.th position was substituted with histidine was amplified. The amplified product was purified using a PCR purification kit (QUIAGEN) and used as a DNA fragment to be inserted for preparation of a vector. After the purified amplification product was treated with smaI restriction enzyme, a pDZ vector (U.S. Pat. No. 9,109,242 B2) heat-treated at 65 C. for 20 minutes and the DNA fragment, as the amplification product, were mixed in a molar ratio (M) of 1:2 and cloned in accordance with manuals provided in an infusion cloning kit (TaKaRa) to prepare a pDZ-R407H vector for introduction of horn mutation (R407H) into the chromosome.

(18) Corynebacterium glutamicum ATCC13032 was transformed with the prepared vector by electroporation and subjected to a second crossover process to obtain a strain including horn mutation (R407H) on the chromosome, and the strain was named Corynebacterium glutamicum ATCC13032 hom(R407H).

Example 4: Evaluation of L-Isoleucine Producing Capability of ilvA Variant-Introduced L-Isoleucine-Producing Strain

(19) Strains were prepared according to the following method to identify L-isoleucine productivity of the variant obtained in Example 2. Specifically, the plasmid prepared in Example 1 was introduced into the Corynebacterium glutamicum ATCC 13032 hom(R407H) strain prepared in Example 3, and the prepared strain introduced with the plasmid was named ATCC13032 hom(R407H)/pECCG117-ilvA(F383A). In addition, the variant plasmid obtained in Example 2 was introduced into the Corynebacterium glutamicum ATCC13032 hom(R407H) strain, and an apoptosis rate measured after smearing the strain on a minimum medium was 70%. Surviving cells were inoculated onto and cultured in a seed medium to select a strain having superior isoleucine producing capability compared to that of the ATCC13032 hom(R407H)/pECCG117-ilvA(F383A) control, and the selected strain was named Corynebacterium glutamicum CJILE-301.

(20) The strain was inoculated onto a 250 mL corner-baffle flask containing 25 mL of an isoleucine production medium and cultured at 32 C. for 60 hours while shaking at 200 rpm to prepare L-isoleucine. A composition of a production medium used herein is described below.

(21) <Seed Medium>

(22) 5% glucose, 1% bacto-peptone, 0.25% sodium chloride, 1% yeast extract, 0.4% urea, and pH 7.2

(23) <Minimum Medium>

(24) 1.0% glucose, 0.4% ammonium sulfate, 0.04% magnesium sulfate, 0.1% monopotassium phosphate, 0.1% urea, 0.001% thiamine, 200 g/L biotin, 2% agar, and pH 7.2

(25) <Production Medium>

(26) 10% glucose, 0.2% yeast extract, 1.6% ammonium sulfate, 0.1% potassium phosphate, 0.1% magnesium sulfate heptahydrate, 10 mg/L ferrous sulfate heptahydrate, 10 mg/L manganese sulfate monohydrate, 200 g/L biotin, and pH 7.2.

(27) After culturing was completed, concentrations of L-isoleucine and L-threonine in the culture solution were measured using high-performance liquid chromatography (HPLC), and the results are shown in Table 3 below.

(28) TABLE-US-00003 TABLE 3 L-Isoleucine L-Threonine Strain concentration (g/L) concentration (g/L) ATCC13032 hom(R407H)/ 2.5 1.5 pECCG117-ilvA(F383A) (parent strain) CJILE-301 (strain) 4.3 0.0

(29) As shown in Table 1, although the parent strain, Corynebacterium glutamicum ATCC13032 hom(R407H)/pECCG117-ilvA(F383A), produced L-isoleucine at a concentration of 2.5 g/L, the Corynebacterium glutamicum CJILE-301 strain, a variant according to the present disclosure, produced L-isoleucine at a concentration of 4.3 g/L, indicating that L-isoleucine productivity of the CJILE-301 strain increased compared to that of the parent strain by about 172%. In addition, the concentration of residual L-threonine decreased from 1.5 g/L to 0.0 g/L, indicating an increase in the activity of ilvA to threonine.

(30) As a result of sequencing the ilvA gene by isolating the plasmid from the CJILE-301 strain, it was confirmed that A, the 1141.sup.st base of the base sequence of the ilvA gene, was substituted with G, and thus a protein variant in which T of the 381.sup.st position of the ilvA protein is substituted with A in addition to variation in which F of the 383.sup.rd position is substituted with A may be encoded thereby, and may be expressed as SEQ ID NO: 22.

(31) This result indicates that the strain introduced with the ilvA variant (T381A) of Example 2 obtained by random mutation may produce L-isoleucine with high efficiency and high yield.

Example 5: Preparation of Strain Introduced with ilvA(T381A) and ilvA(T381A AND F383A) Variants with L-Threonine Dehydratase Activity

(32) Primers of SEQ ID NOS: 31 and 32 for introduction of the ilvA variant (T381A and F383A) confirmed in Example 4 into the wild-type strain were prepared.

(33) For preparation of the strain introduced with the ilvA variant (T381A and F383A), PCR was performed using the plasmid DNA extracted from the CJILE-301 strain of Example 4 as a template and primers of SEQ ID NOS: 31 and 32. Sequences of the primers used herein are listed in Table 4 below.

(34) TABLE-US-00004 TABLE4 SEQ ID NO: Name Sequence 31 primer9 TCGAGCTCGGTACCCATGAGTGAAACATACGTGTC 32 primer10 CTCTAGAGGATCCCCCGTCACCGACACCTCCACA

(35) As a polymerase for PCR, a PfuUltra high-reliability DNA polymerase (Stratagene) was used, and the PCR conditions included denaturation at 95 C. for 30 seconds, annealing at 55 C. for 30 seconds, and 28 repetitions of polymerization at 72 C. for 2 minutes.

(36) As a result, gene fragments of 1411 bp including a terminator region of about 100 bp of the ilvA gene of 1311 bp were obtained.

(37) The amplified product was purified using a PCR purification kit and used as a DNA fragment to be inserted for preparation of a vector. After the purified amplification product was treated with smaI restriction enzyme, the pDZ vector heat-treated at 65 C. for 20 minutes and the DNA fragment for insertion, as the amplification product, were mixed in a molar ratio (M) of 1:2 and cloned using the infusion cloning kit in accordance with provided manuals to prepare a pDZ-T381A F383A vector for introduction of T381A and F383A mutations into the chromosome.

(38) Corynebacterium glutamicum ATCC13032 hom(R407H) was transformed with the prepared vector by electroporation and subjected to a second crossover process to obtain a strain including ilvA(T381A and F383A) mutation on the chromosome, and the strain was named CA10-3101.

(39) The CA10-3101 strain was deposited under the Budapest Treaty to the Korean Culture Center of Microorganisms (KCCM) on May 27, 2020, with Accession No. KCCM12739P.

(40) In addition, in order to identify isoleucine producing capability and threonine degrading effects of the ilvA(T381A) variant with single mutation, primers of SEQ ID NOS: 47 and 48 were prepared.

(41) In order to prepare a strain introduced with the ilvA variant (T381A), PCR was performed using the genomic DNA of Cgl13032 as a template and primers of SEQ ID NOS: 31 and 48 and SEQ ID NOS: 32 and 47. In this regard, sequences of the primers used herein are as shown in Table 5 below.

(42) TABLE-US-00005 TABLE5 SEQ ID NO: Name Sequence 47 primer47 CCGGATGATGACATCgctCTGTTTGAGTACCTC 48 primer48 TCAAACAGagcGATGTCATCATCCGG

(43) As a polymerase for PCR, a PfuUltra high-reliability DNA polymerase (Stratagene) was used, and the PCR conditions included denaturation at 95 C. for 30 seconds, annealing at 55 C. for 30 seconds, and 28 repetitions of polymerization at 72 C. for 2 minutes.

(44) As a result, gene fragments of 301 bp including a terminator region of about 100 bp of the ilvA gene of 1311 bp were obtained.

(45) PCR was performed using the two amplified DNA fragments as templates and primers of SEQ ID NOS: 31 and 32. The PCR was performed under the following conditions. After denaturation at 95 C. for 10 minutes, cycles of denaturation at 95 C. for 30 seconds, annealing at 55 C. for 30 seconds, and polymerization at 72 C. for 2 minutes were repeated 30 times, and then polymerization was performed at 72 C. for 10 minutes.

(46) As a result, A 1411 bp gene fragment including a 1311 bp ilvA gene and a 100 bp terminator site was obtained.

(47) The amplified product was purified using a PCR purification kit and used as a DNA fragment to be inserted for preparation of a vector. After the purified amplification product was treated with smaI restriction enzyme, the pDZ vector heat-treated at 65 C. for 20 minutes and the DNA fragment for insertion, as the amplification product, were mixed in a molar ratio (M) of 1:2 and cloned using the infusion cloning kit in accordance with provided manuals to prepare a pDZ-T381A vector for introduction of T381A mutation into the chromosome.

(48) Corynebacterium glutamicum ATCC13032 hom(R407H) was transformed with the prepared vector by electroporation and subjected to a second crossover process to obtain a strain including ilvA(T381A) mutation on the chromosome, and the strain was named ATCC13032 hom(R407H) ilvA(T381A).

(49) The strain was inoculated onto a 250 mL corner-baffle flask containing 25 mL of an isoleucine production medium and cultured at 32 C. for 60 hours while shaking at 200 rpm to prepare L-isoleucine. A composition of a production medium used herein is described below.

(50) <Production Medium>

(51) 10% glucose, 0.2% yeast extract, 1.6% ammonium sulfate, 0.1% monopotassium phosphate, 0.1% magnesium sulfate heptahydrate, 10 mg/L ferrous sulfate heptahydrate, 10 mg/L manganese sulfate monohydrate, 200 g/L biotin, and pH 7.2.

(52) After culturing was completed, concentrations of L-isoleucine and L-threonine in the culture solution were measured using high-performance liquid chromatography (HPLC), and the results are shown in Table 6 below.

(53) TABLE-US-00006 TABLE 6 Strain L-Isoleucine (g/L) L-Threonine (g/L) ATCC13032 hom(R407H) 0.0 3.8 ATCC13032 hom(R407H) ilvA(WT) 0.0 3.7 ATCC13032 hom(R407H) ilvA(T381A) 0.5 3.3 CAW-3101 (ATCC13032 hom(R407H) 3.3 0.0 ilvA(T381A and F383A))

(54) As shown in Table 6, although the parent strain, Corynebacterium glutamicum ATCC13032 hom(R407H), did not produce L-isoleucine, the ATCC13032 hom(R407H) ilvA(T381A) variant with single mutation produced L-isoleucine at a concentration of 0.5 g/L with a decreased amount of L-threonine, and thus it was confirmed that productivity of L-isoleucine was increased compared with the parent strain. Also, the ATCC13032 hom(R407H) ilvA(T381A and F383A) variant further including F383A mutation produced L-isoleucine at a concentration of 3.9 g/L, and thus it was confirmed that productivity of L-isoleucine considerably increased compared to the parent strain.

Example 6: Preparation of ilvA Variant Vector with L-Threonine Dehydratase Activity

(55) Variants in which the amino acid at the ilvA mutation position with a high L-isoleucine productivity discovered in Example 1 above was substituted with different amino acids and effects thereof were identified. Specifically, 7 types of variants in which the amino acid at the 381.sup.st position of ilvA was substituted with different amino acids were prepared using the plasmid prepared in Example 3 as a template. The variants, substituted amino acids, and sequences of primers used in respective variants are shown in Table 7 below.

(56) TABLE-US-00007 TABLE 7 Substituted Gene amino acid Primer SEQ ID NO: ilvA T381S SEQ ID NO: 3, 33/SEQ ID NO: 34, 4 T381P SEQ ID NO: 3, 35/SEQ ID NO: 36, 4 T381Q SEQ ID NO: 3, 37/SEQ ID NO: 38, 4 T381V SEQ ID NO: 3, 39/SEQ ID NO: 40, 4 T381I SEQ ID NO: 3, 41/SEQ ID NO: 42, 4 T381G SEQ ID NO: 3, 43/SEQ ID NO: 44, 4 T381M SEQ ID NO: 3, 45/SEQ ID NO: 46, 4

(57) Sequences of the primers used in Table 7 are as shown in Table 8 below.

(58) TABLE-US-00008 TABLE8 SEQIDNO: Name Sequence 33 primer15 AGGTACTCtgcCAGggaGATGTCAT 34 primer16 ATGACATCtccCTGgcaGAGTACCT 35 primer21 AGGTACTCtgcCAGtggGATGTCAT 36 primer22 ATGACATCccaCTGgcaGAGTACCT 37 primer27 AGGTACTCtgcCAGctgGATGTCAT 38 primer28 ATGACATCcagCTGgcaGAGTACCT 39 primer33 AGGTACTCtgcCAGaacGATGTCAT 40 primer34 ATGACATCgttCTGgcaGAGTACCT 41 primer35 AGGTACTCtgcCAGgatGATGTCAT 42 primer36 ATGACATCatcCTGgcaGAGTACCT 43 primer41 AGGTACTCtgcCAGgccGATGTCAT 44 primer42 ATGACATCggcCTGgcaGAGTACCT 45 primer45 AGGTACTCtgcCAGcatGATGTCAT 46 primer46 ATGACATCatgCTGgcaGAGTACCT

(59) PCR was performed using the primers listed in Tables 7 and 8. Solg Pfu-X DNA polymerase (SolGent Co., Ltd.) was used as a polymerase, and the PCR was performed under the following conditions. After denaturation at 95 C. for 10 minutes, cycles of denaturation at 95 C. for 30 seconds, annealing at 55 C. for 30 seconds, and polymerization at 72 C. for 90 seconds were repeated 30 times, and then polymerization was performed at 72 C. for 5 minutes.

(60) As a result, a DNA fragment of a 1457 bp 5 upstream region and a DNA fragment of a 279 bp 3 downstream region with respect to the mutation of the ilvA gene were obtained.

(61) PCR was performed using the two amplified DNA fragments as templates and primers of SEQ ID NOS: 11 and 12. The PCR was performed under the following conditions. After denaturation at 95 C. for 10 minutes, cycles of denaturation at 95 C. for 30 seconds, annealing at 55 C. for 30 seconds, and polymerization at 72 C. for 2 minutes were repeated 30 times, and then polymerization was performed at 72 C. for 10 minutes.

(62) As a result, DNA fragments of 1736 bp including mutation of the ilvA gene encoding threonine dehydratase variants in which threonine at the 381.sup.st position was substituted with each of the amino acids of Table 3 were amplified. The pECCG117 vector and the ilvA DNA fragment of 1736 bp obtained via PCR were treated with BamHI restriction enzyme and ligated with a DNA ligase, followed by cloning to obtain a plasmid. Thus, 7 types of the ilvA variant vectors in which threonine at the 381.sup.st position was substituted with each of the amino acids shown in Table 3 named as listed in Table 9 below.

(63) TABLE-US-00009 TABLE 9 Substituted Gene amino acid Name of ilvA variant vector ilvA T381S pECCG117-ilvA(T381S, F383A) T381P pECCG117-ilvA(T381P, F383A) T381Q pECCG117-ilvA(T381Q, F383A) T381V pECCG117-ilvA(T381V, F383A) T381I pECCG117-ilvA(T381I, F383A) T381G pECCG117-ilvA(T381G, F383A) T381M pECCG117-ilvA(T381M, F383A)

Example 7: Evaluation of L-Isoleucine Producing Capability of Strain Introduced with ilvA Variant Having L-Threonine Dehydratase Activity

(64) A Corynebacterium glutamicum ATCC13032-derived lysC gene encoding aspartokinase was introduced with mutation (L377K) for enhancement of expression of the lysC gene and relief of feedback inhibition by L-lysine and L-threonine (U.S. Pat. No. 10,662,450 B2). In order to prepare a vector including the mutant lysC gene, a pair of primers for amplifying a 5 upstream region (SEQ ID NOS: 50 and 51) and a pair of primers for amplifying a 3 downstream region (SEQ ID NOS: 52 and 53) with respect to the mutation position were designed. XbaI and SalI restriction enzymes were inserted to both ends of the primers of SEQ ID NOS: 50 and 53, and the primers of SEQ ID NOS: 51 and 52 were designed to cross each other, and nucleotide substitution was located at this region. Sequences of the primers are as shown in Table 10 below.

(65) TABLE-US-00010 TABLE10 SEQ IDNO: Name Sequence SEQ lysC_L377K_ tcctctagaGCTGCGCAGTGTTGAATACG IDNO:50 5F SEQID lysC_L377K_ AGGTGGAAATCTTTTCGATGTTC NO:51 5R SEQID lysC_L377K_ GAACATCGAAAAGATTTCCACCT NO:52 3F SEQID lysC_L377K_ gactctagaGTTCACCTCAGAGACGATTA NO:53 3R

(66) PCR was performed using the chromosome of Corynebacterium glutamicum ATCC13032 as a template and primers of SEQ ID NOS: 50 and 51 and SEQ ID NOS: 52 and 53. The PCR was performed under the following conditions. After denaturation at 95 C. for 5 minutes, cycles of denaturation at 95 C. for 30 seconds, annealing at 55 C. for 30 seconds, and polymerization at 72 C. for 30 seconds were repeated 30 times, and then polymerization was performed at 72 C. for 7 minutes.

(67) As a result, a DNA fragment of a 512 bp 5 upstream region and a DNA fragment of a 522 bp 3 downstream region with respect to the mutation of the lysC gene were obtained.

(68) PCR was performed using the two amplified DNA fragments as templates and primers of SEQ ID NOS: 50 and 53. The PCR was performed under the following conditions. After denaturation at 95 C. for 5 minutes, cycles of denaturation at 95 C. for 30 seconds, annealing at 55 C. for 30 seconds, and polymerization at 72 C. for 60 seconds were repeated 30 times, and then polymerization was performed at 72 C. for 7 minutes.

(69) As a result, a DNA fragment of 1011 bp including the mutant lysC(L377K) gene (SEQ ID NO: 49) encoding an aspartokinase variant in which leucine at the 377th position was substituted with lysine was amplified.

(70) The lysC(L377K) fragment obtained by the PCR was treated with XbaI and SalI restriction enzymes at both ends and ligated to a pDZ vector (KR 2008-0025355) treated with the XbaI and SalI restriction enzymes, followed by cloning to finally obtain a pDZ-lysC(L377K) recombinant vector cloned with a lysC(L377K) substitution cassette.

(71) The ATCC13032 hom(R407H) strain of Example 3 was transformed with the prepared pDZ-lysC(L377K) vector using an electric pulse method and subjected to a second crossover process to obtain Corynebacterium ATCC13032 hom(R407H) lysC(L377K) introduced with the lysC gene on the chromosome. The mutant gene was finally identified by PCR performed using the primers of SEQ ID NOS: 50 and 53 and then comparing the sequence with that of the wild-type lysC gene by sequencing.

(72) Thereafter, the 7 types of ilvA variant vectors prepared in Example 6 and pECCG117-ilvA(T381A and F383A) extracted from the CJILE-301 strain of Example 4 were introduced into the prepared Corynebacterium glutamicum ATCC13032 hom(R407H) lysC(L377K) strain using an electric pulse method and smeared on a selective medium containing 25 mg/L kanamycin to obtain transformed strains. Thereafter, concentrations of L-isoleucine and L-threonine were measured in the same manner as in Example 4, and the results are shown in Table 11 below.

(73) TABLE-US-00011 TABLE 11 L-Isoleucine L-Threonine Strain (g/L) (g/L) ATCC13032 hom(R407H) lysC(L377K) 0.0 3.5 ATCC13032 hom(R407H) 2.3 1.5 lysC(L377K)/pECCG117- ilvA(F383A) ATCC13032 hom(R407H) 4.3 0.0 lysC(L377K)/pECCG117- ilvA(T381A and F383A) ATCC13032 hom(R407H) 2.7 1.1 lysC(L377K)/pECCG117- ilvA(T381S, F383A) ATCC13032 hom(R407H) 2.9 1.4 lysC(L377K)/pECCG117- ilvA(T381P, F383A) ATCC13032 hom(R407H) 2.6 1.3 lysC(L377K)/pECCG117- ilvA(T381Q, F383A) ATCC13032 hom(R407H) 3.0 0.7 lysC(L377K)/pECCG117- ilvA(T381V, F383A) ATCC13032 hom(R407H) 3.8 0.2 lysC(L377K)/pECCG117- ilvA(T381I, F383A) ATCC13032 hom(R407H) 3.2 0.5 lysC(L377K)/pECCG117- ilvA(T381G, F383A) ATCC13032 hom(R407H) 2.5 1.2 lysC(L377K)/pECCG117- ilvA(T381M, F383A)

(74) As shown in Table 11 above, it was confirmed that the T381A, T381S, T381P, T381Q, T381V, T381I, T381G, and T381M variants of ilvA had higher threonine degradation rates and enhanced L-isoleucine producing capability.

Example 8: Evaluation of L-Isoleucine Producing Capability of ilvA Variant Having Threonine Dehydratase Activity in L-Isoleucine-Producing Strain

(75) The ilvA mutation (T381A and F383A) exhibiting the most increased L-isoleucine producing capability in Example 7 was introduced into an L-isoleucine-producing KCJI-38 strain (KCCM11248P, Korean Patent No. 10-1335789) treated with N-methyl-N-nitro-N-nitrosoguanidine (NTG) using an electric pulse method and smeared on a selective medium containing 25 mg/L kanamycin to obtain transformed strains. Thereafter, concentrations of L-isoleucine and L-threonine were measured in the same manner as in Example 4, and the results are shown in Table 12 below.

(76) TABLE-US-00012 TABLE 12 L- Isoleucine L- Threonine Strain (g/L) (g/L) KCCM11248P 1.5 0.5 KCCM11248P/pECCG117-ilvA(F383A) 2.8 0.6 KCCM11248P/pECCG117- ilvA(T381A and F383A) 4.0 0.0

(77) As shown in Table 12 above, it was confirmed that the KCCM11248P/pECCG117-ilvA(T381A and F383A) strain introduced with the ilvA mutation (F381T and F383A) had significantly increased L-isoleucine productivity and a higher L-threonine degradation rate compared to the KCCM11248P strain or the KCCM11248P/pECCG117-ilvA(F383A) strain.

(78) The above-described results indicate that the ilvA variant according to the present disclosure may increase production of L-isoleucine. In addition, the variation at the 381.sup.st position of the ilvA gene is confirmed as a variation assisting binding for degradation of L-threonine, and thus the variation was confirmed to have a role in an increase in production of L-isoleucine.

(79) The above description of the present disclosure is provided for the purpose of illustration, and it would be understood by those skilled in the art that various changes and modifications may be made without changing the technical conception and essential features of the present disclosure. Thus, it is clear that the above-described embodiments are illustrative in all aspects and do not limit the present disclosure. The various embodiments disclosed herein are not intended to be limiting, with the true scope and spirit being indicated by the following claims. The present disclosure is to be limited only by the terms of the appended claims, along with the full scope of equivalents to which such claims are entitled.