Carbon monoxide dehydrogenase having excellent oxygen resistance and enzyme activity, and use thereof

12509664 ยท 2025-12-30

Assignee

Inventors

Cpc classification

International classification

Abstract

Provided is a carbon monoxide (CO) dehydrogenase with increased oxygen resistance and/or enzyme activity, specifically, a mutant CO dehydrogenase with increased oxygen resistance and/or enzyme activity by mutating amino acid residues. The CO dehydrogenase may detoxify toxic carbon monoxide at room temperature and pressure by easily oxidizing carbon monoxide and converting the same into carbon dioxide, and may effectively oxidize carbon monoxide even in gas including oxygen. Furthermore, since it is possible to remove carbon monoxide, which is emitted in large quantities in industries such as petrochemical and steel industries, cigarette burning, household cooking, various boilers, and combustion, through cigarette filters, air purifiers, intake filters in household cooking equipment, gas boilers, etc. the CO dehydrogenase may be utilized in various ways.

Claims

1. A carbon monoxide (CO) dehydrogenase with increased oxygen resistance and/or enzyme activity, wherein the CO dehydrogenase is a protein encoded by a polynucleotide having a nucleotide sequence according to one of SEQ ID NOs: 24, 26, 30, 35-38, or 40-43.

2. The CO dehydrogenase of claim 1, wherein the oxygen resistance is increased 1 to 200 times compared to a wild type CO dehydrogenase.

3. The CO dehydrogenase of claim 1, wherein the enzyme activity is increased 1 to 200 times compared to the wild type CO dehydrogenase.

4. A polynucleotide encoding the CO dehydrogenase of claim 1.

5. A vector expressing the CO dehydrogenase of claim 1.

6. A microorganism expressing the CO dehydrogenase of claim 1.

7. A method of preparing the CO dehydrogenase comprising culturing the microorganism expressing the polynucleotide encoding the CO dehydrogenase of claim 1.

8. A method of removing carbon monoxide comprising contacting carbon monoxide with the CO dehydrogenase of claim 1.

9. A method of preparing carbon dioxide comprising contacting carbon monoxide with the CO dehydrogenase of claim 1.

10. A device for removing carbon monoxide comprising the CO dehydrogenase of claim 1.

11. A filter comprising the CO dehydrogenase of claim 1.

Description

BRIEF DESCRIPTION OF DRAWINGS

(1) FIG. 1 shows phylogenetic trees based on protein sequences of CO dehydrogenase enzymes.

(2) FIG. 2 is a diagram showing comparisons of protein sequences of CO dehydrogenase enzymes.

MODE OF DISCLOSURE

(3) Hereinafter, the present disclosure will be described in more detail through examples. However, these examples are intended to illustrate the present disclosure, and the scope of the present disclosure is not limited to these examples.

EXAMPLE

(4) 1. Drawing Phylogenetic Trees of Carbon Monoxide Dehydrogenases (CODH)

(5) Phylogenetic trees as shown in FIG. 1 were drawn based on sequence information of CO dehydrogenases known to date.

(6) Among the shown, the most active CO dehydrogenase is ChCODH-II derived from Carboxydothermus hydrogenoformans, which is more than 100 times more active than ChCODH-IV, which is known to have oxygen resistance, but is known to lose activity very quickly in the presence of oxygen due to not being resistant to oxygen.

(7) 2. Sequence Comparison of Various CO Dehydrogenases

(8) Sequences of various CO dehydrogenase enzymes, including ChCODH-II and ChCODH-IV, were compared with each other to determine key residues predicted to be mainly related to oxygen resistance.

(9) L82 (Leucine 82), A559 (Alanine 559), V565 (Valine 565), T578 (Threonine 578), and 1580 (Isoleucine 580) were determined as residues expected to be related to oxygen stability in ChCODH-II through sequence comparison of CO dehydrogenases (CODHs). Among the residues, A559, with which an enzyme activity was measured, showed a fairly high activity as a result of an initial experiment, so a mutant including the residue was made preferentially, and additional mutants were prepared by adding other sites thereto to conduct experiments.

(10) 3. Production of Mutants of Carbon Monoxide Dehydrogenase (CODH)

(11) An oxygen-resistant CO dehydrogenase (CODH) and a recombinant microorganism containing the same were prepared.

(12) (1) Wild Type Carbon Monoxide Dehydrogenase

(13) Genes (SEQ ID NOS: 1 and 2) encoding ChCODH-2 and ChCODH-4 proteins derived from C. hydrogenoforman (GenBank no. NC_007503) were artificially synthesized by GenScript (Piscataway, NJ, USA) to use as a genetic mutation template of an oxygen-resistant CO dehydrogenase.

(14) The synthesized C. hydrogenoforman-derived ChCODH-2 or ChCODH-4 gene was digested with NdeI/BamHI or NdeI/XhoI restriction enzymes (New England BioLabs Inc., US) at 37 C. for 20 minutes, and cloned into an expression vector pET-28 (Novagen, USA, SEQ ID NO: 3) by using a SolGent T4 DNA ligase. The vectors (SEQ ID NOS: 4 and 5) containing the CO dehydrogenase gene were introduced into Escherichia coli BL21 by heat shock (42 C., 1 minute) to prepare a recombinant microorganism containing a wild type CO dehydrogenase.

(15) (2) Oxygen-Resistant CO Dehydrogenase

(16) Site-directed mutagenesis was proceeded for single or multiple amino acid substitutions by using the synthesized wild type ChCODH-2 as a template, to synthesize various candidate oxygen-resistant CO dehydrogenase variants, and the vector containing a CO dehydrogenase variant was introduced into E. coli BL21 as in Example 3.-(1) to prepare a recombinant microorganism containing a CO dehydrogenase variant.

(17) Information on primers used in the synthesis of the CO dehydrogenase variants is shown in Table 1 below.

(18) TABLE-US-00001 TABLE 1 SEQ Substituted Inserted ID amino acid Primer vector NO A559W F-5gcgcggcggaatggatgcatgagaaggcggtgg pET28a 6 R-5tctcatgcatccattccgccgcgctcgcaacc 7 A559Y F-5gcgcggcggaatacatgcatgagaaggcggtgg 8 R-5tctcatgcatgtattccgccgcgctcgcaacc 9 A559S F-5cgcggcggaaagcatgcatgagaaggcggtgg 10 R-5tctcatgcatgctttccgccgcgctcgcaacc 11 A559H F-5cgcggcggaacacatgcatgagaaggcggtgg 12 R-5tctcatgcatgtgttccgccgcgctcgcaacc 13 A559D F-5cgcggcggaagatatgcatgagaaggcggtgg 14 R-5tctcatgcatatcttccgccgcgctcgcaacc 15 A559E F-5cgcggcggaagagatgcatgagaaggcgg 16 R-5tctcatgcatctcttccgccgcgctcgcaa 17 A559N F-5gcgcggcggaaaacatgcatgagaaggcggtgg 18 R-5tctcatgcatgttttccgccgcgctcgcaacc 19 V610A F-5gctacttcatcgcggaactggacccggagacc 20 R-5ggtccagttccgcgatgaagtagccaccgg 21 V610S F-5gctacttcatcagcgaactggacccggagacc 22 R-5ggtccagttcgctgatgaagtagccaccgg 23 A559W/ A559W F&R; V610A F&R V610A A559W/ A559W F&R; V610S F&R V610S A559S/ A559S F&R; V610A F&R V610A A559S/ A559S F&R; V610S F&R V610S A559H/ A559H F&R; V610A F&R V610A A559H/ A559H F&R; V610S F&R V610S
4. Expression and Purification of Oxygen-Resistant CO Dehydrogenase

(19) In order to obtain oxygen-resistant CO dehydrogenases derived from the recombinant microorganism, pET-28 (SEQ ID NO: 3) expression vector was used to synthesize an expression vector containing a CO dehydrogenase variant with a His-tag terminus. The synthesized expression vector of a CO dehydrogenase variant was introduced into E. coli BL21 containing pRKISC (J. Biochem. 126:917, 1999) plasmids to complete the final recombinant microorganisms, which were each cultured to induce expression of CO dehydrogenases in a form of a protein with a His-tag terminus, and then, the CO dehydrogenases were purified.

(20) The culturing of the recombinant E. coli was carried out in TB medium (400 mL, 2 L flask) including 50 g/mL of kanamycin, 10 g/mL of tetracycline, 0.02 mM of nickel chloride (NiCl.sub.2), 0.1 mM of ferrous sulfate (FeSO.sub.4), and 2 mM of L-cysteine, aerobically under the condition of 225 rpm at 37 C.

(21) Thereafter, after an optical density (OD) value reached about 0.4 to about 0.6, 0.2 mM of isopropyl--d-thiogalactopyranoside (IPTG), 0.5 mM of nickel chloride (NiCl.sub.2), 1 mM of ferrous sulfate (FeSO.sub.4), and 50 mM of potassium nitrate (KNO.sub.3) were each added to a N.sub.2-fluxed serum bottle, to induce expression of the enzyme. In this regard, the temperature was lowered to 30 C.

(22) After culturing for 24 hours, recombinant E. coli was obtained by centrifugation at 12,000 rpm for 30 minutes at 4 C., and the enzyme was purified by using Ni-NTA resin in an anaerobic chamber.

(23) 5. Measurement of Activity of CO Dehydrogenase

(24) CO oxidation reaction activity of the CO dehydrogenase was measured by an oxidation-reduction reaction of ethyl viologen (EV) by the enzyme in a reaction buffer at 30 C. saturated with carbon monoxide by using spectrophotometry (578 nm).

(25) The reaction was performed by using a screw cap cuvette with a carbon monoxide headspace, in this regard, the reaction solution (2 mL) included 20 mM of oxidized ethyl viologen and 50 mM of HEPES/NaOH buffer (pH 8) saturated with carbon monoxide, and the reaction began by injection of the enzyme, and measured for 2 minutes. Here, one unit of CO dehydrogenase activity is defined as an amount of enzyme required for reduction reaction of 1 mmol of oxidized ethyl viologen at a temperature of 30 C. and a pH of 8.

(26) 6. Measurement of Oxygen Stability of CO Dehydrogenase

(27) Oxygen stability of the CO dehydrogenase was measured by first reacting the enzyme with oxygen at a concentration of 0 mM to 250 mM for 1 minute, and then measuring the residual activity of the enzyme by measuring oxidation-reduction reaction of ethyl viologen (EV) by the oxygen-exposed enzyme by using spectrophotometry (578 nm) as in Example 5.

(28) 7. Measurement of Activity and Oxygen Resistance of Single Mutant of CO Dehydrogenase

(29) Results of measuring activity and oxygen resistance of the wild type and mutants of ChCODH-II derived from Carboxydothermus hydrogenoformans are shown in Table 2 below. Oxygen resistance was expressed as the maximum oxygen concentration at which an activity of the enzyme was maintained at 50% of the initial activity.

(30) TABLE-US-00002 TABLE 2 SEQ Oxygen concentration for ID Activity maintaining enzyme activity CODH type NO (U/mg) (mM) Wild type 1 1,000 1 ChCODH-II Wild type 2 100 25 ChCODH-IV ChCODH-II 24 3,000 25 A559W ChCODH-II 25 800 20 A559Y ChCODH-II 26 1,000 50 A559S ChCODH-II 27 0 0 A559T ChCODH-II 28 200 <5 A559N ChCODH-II 29 400 <1 A559Q ChCODH-II 30 10,000 50 A559H ChCODH-II 31 400 <5 A559D ChCODH-II 32 300 <5 A559E

(31) As a result of the experiment, as may be seen in Table 2 above, ChCODH-II A559W and A559H showed significantly excellent characteristics in terms of increased activity and oxygen resistance. Therefore, in subsequent studies, studies were conducted to increase oxygen resistance by introducing additional mutated residues.

(32) 8. Measurement of Activity and Oxygen Resistance of Double Mutant of CO Dehydrogenase

(33) The results of measuring activity and oxygen resistance of the wild type and mutants of ChCODH-II derived from Carboxydothermus hydrogenoformans are shown in Table 3 below. Oxygen resistance was expressed as the maximum oxygen concentration at which an activity of the enzyme was maintained at 50% of the initial activity.

(34) TABLE-US-00003 TABLE 3 SEQ Oxygen concentration for ID Activity maintaining enzyme CODH type NO (U/mg) activity (mM) Wild type ChCODH-II 1 1,000 1 Wild type ChCODH-IV 2 100 25 ChCODH-II A559W 24 3,000 25 ChCODH-II 33 100 0 A559W:V565A ChCODH-II 34 500 <10 A559W:V565S ChCODH-II 35 1,500 <10 A559Y:V565L ChCODH-II 36 1,500 <10 A559W:T578S ChCODH-II 37 2,000 <50 A559W:L82S ChCODH-II 38 1,000 <50 A559W:L82V ChCODH-II 39 500 1 A559Y:I580L ChCODH-II A559H 30 10,000 50 ChCODH-II 40 2,000 <25 A559H:I586S ChCODH-II 41 3,000 <25 A559H:T593S ChCODH-II 42 3,000 <50 A559H:T597S ChCODH-II 43 1,000 100 A559H:V610S

(35) As results of the experiment, as shown in Table 3, for the A559H: V610S double mutant, an oxygen concentration at which emzymatic activity was maintained at 50% reached 100 mM, and increased about 100 times compared to the wild type ChCODH-II, and the double mutant showed about 4 times higher oxygen resistance than the wild type ChCODH-IV, which is a wild type with the highest oxygen resistance known to date, and showed a characteristic that the enzyme activity is increased about 10 times compared to the wild type ChCODH-IV.

(36) In addition, the double mutant showed oxygen resistance twice as high as that of ChCODH-II A559H, which had the highest oxygen resistance among the single mutants.