ANTIBODY-DRUG CONJUGATE WITH IMPROVED THERAPEUTIC WINDOW
20260000783 ยท 2026-01-01
Assignee
Inventors
Cpc classification
A61K47/6889
HUMAN NECESSITIES
A61K47/6415
HUMAN NECESSITIES
A61K47/6807
HUMAN NECESSITIES
A61K47/55
HUMAN NECESSITIES
A61K47/6835
HUMAN NECESSITIES
A61K47/593
HUMAN NECESSITIES
A61K47/643
HUMAN NECESSITIES
C12N15/113
CHEMISTRY; METALLURGY
A61K47/6857
HUMAN NECESSITIES
A61K47/6851
HUMAN NECESSITIES
A61K47/554
HUMAN NECESSITIES
A61K47/6845
HUMAN NECESSITIES
A61K47/6885
HUMAN NECESSITIES
A61K47/549
HUMAN NECESSITIES
A61K47/6803
HUMAN NECESSITIES
A61K47/6849
HUMAN NECESSITIES
A61K47/6855
HUMAN NECESSITIES
A61K47/60
HUMAN NECESSITIES
A61K47/6825
HUMAN NECESSITIES
A61P35/00
HUMAN NECESSITIES
International classification
A61K47/68
HUMAN NECESSITIES
A61K47/55
HUMAN NECESSITIES
A61K47/59
HUMAN NECESSITIES
A61K47/60
HUMAN NECESSITIES
A61K47/64
HUMAN NECESSITIES
A61P35/00
HUMAN NECESSITIES
C12N15/113
CHEMISTRY; METALLURGY
Abstract
The invention relates to a therapeutic combination, comprising a first proteinaceous molecule comprising a first binding site for binding to a first epitope of a first cell-surface molecule, the first proteinaceous molecule provided with at least one saponin covalently bound to an amino-acid residue of said first proteinaceous molecule, and comprising a second pharmaceutical composition comprising a second proteinaceous molecule different from the first proteinaceous molecule, the second proteinaceous molecule comprising a second binding site for binding to a second epitope of a second cell-surface molecule different from the first cell-surface molecule, and comprising an effector moiety, wherein the second epitope is different from the first epitope. An aspect of the invention is a composition comprising the first proteinaceous molecule and the second proteinaceous molecule of the invention. The invention also relates to a composition or therapeutic combination comprising an antibodydrug conjugate or antibodyoligonucleotide conjugate and the first proteinaceous molecule of the invention. An aspect of the invention relates to a pharmaceutical composition comprising the composition or the antibodydrug conjugate of the invention, and optionally further comprising a pharmaceutically acceptable excipient. The invention also relates to the therapeutic combination or the composition or the antibodydrug conjugate or the pharmaceutical composition of the invention, for use as a medicament. The invention also relates to the therapeutic combination of the invention for use in the treatment or prophylaxis of a cancer.
Claims
1.-40. (canceled)
41. A method for treating a disease condition associated with the presence of an aberrant cell, comprising administering to a human subject a therapeutic combination, wherein the therapeutic combination comprises: (a) a first pharmaceutical composition comprising a first proteinaceous molecule comprising a first binding site for binding to a first cell-surface molecule and at least one saponin covalently bound to said first proteinaceous molecule preferably covalently bound to an amino-acid residue of said first proteinaceous molecule, the first pharmaceutical composition optionally further comprising a pharmaceutically acceptable excipient; and (b) a second pharmaceutical composition comprising a second proteinaceous molecule preferably different from the first proteinaceous molecule, the second proteinaceous molecule comprising a second binding site for binding to a second cell-surface molecule different from the first cell-surface molecule and an effector moiety, the second pharmaceutical composition optionally further comprising a pharmaceutically acceptable excipient, wherein the at least one saponin is a bisdesmosidic triterpene saponin belonging to the type of a 12,13-dehydrooleanane with an aldehyde function in position C-23, wherein the saponin is covalently coupled the first proteinaceous molecule, preferably covalently coupled to an amino-acid residue of the first proteinaceous molecule, via an aldehyde function in the saponin, preferably said aldehyde function in position C-23, preferably via at least one linker, and/or via at least one cleavable linker, wherein the amino-acid residue preferably is selected from cysteine and lysine; wherein the first binding site of the first proteinaceous molecule comprises or consists of an immunoglobulin or at least one binding fragment or-domain of said immunoglobulin for binding to the first cell-surface molecule, such as any one or more of an antibody, an IgG, a molecule comprising or consisting of a Vhh domain, a Fab, an scFv, an Fv, a dAb, an F (ab) 2, Fcab fragment, and/or comprises or consists of at least one ligand, preferably a non-proteinaceous ligand and/or a proteinaceous ligand for binding to the first cell-surface molecule such as EGF or a cytokine; wherein the second binding site of the second proteinaceous molecule comprises or consists of an immunoglobulin, at least one binding domain of said immunoglobulin and/or at least one binding fragment of said immunoglobulin for binding to the second cell-surface molecule, such as an antibody, an IgG, a molecule comprising or consisting of a Vhh domain, a Fab, an scFv, an Fv, a dAb, an F (ab) 2, Fcab fragment, and/or comprises or consists of at least one ligand, preferably a non-proteinaceous ligand and/or a proteinaceous ligand for binding to the second cell-surface molecule such as EGF or a cytokine; and wherein the effector moiety comprised by the second proteinaceous molecule comprises or consists of at least one of an oligonucleotide, a nucleic acid and a xeno nucleic acid.
42. The method of claim 41, wherein the second pharmaceutical composition and the first pharmaceutical composition are administered to the patient in need thereof.
43. The method of claim 41, wherein the at least one saponin is a triterpenoid saponin or a bisdesmosidic triterpene saponin, belonging to the type of a 12,13-dehydrooleanane with an aldehyde function in position C-23 and optionally comprising a glucuronic acid function in a carbohydrate substituent at the C-3beta-OH group of the saponin, and/or a saponin isolated from a Gypsophila species and/or a Saponaria species and/or an Agrostemma species and/or a Quillaja species such as Quillaja saponaria, or wherein the at least one saponin is a single specific saponin or is a mixture of two or more different saponins, such as one or more of the saponins in Table A1 or Scheme I, SO1861, SA1657, GE1741, SA1641, QS-21, QS-21A, QS-21 A-api, QS-21 A-xyl, QS-21B, QS-21 B-api, QS-21 B-xyl, QS-7-xyl, QS-7-api, QS-17-api, QS-17-xyl, QS1861, QS1862, Quillajasaponin, Saponinum album, QS-18, Quil-A, Gyp1, gypsoside A, AG1, AG2, SO1542, SO1584, SO1658, SO1674, SO1832, or any of their stereomers and/or any combinations thereof, preferably the saponin is SO1861 and/or GE1741 and/or SA1641 and/or QS-21 and/or saponin with a quillaic acid aglycon core, a Gal-(1.fwdarw.2)-[Xyl-(1.fwdarw.3)]-GlcA carbohydrate substituent at the C-3beta-OH group and a Glc-(1.fwdarw.3)-Xyl-(1.fwdarw.4)-Rha-(1.fwdarw.2)-[Xyl-(1.fwdarw.3)-4-OAc-Qui-(1.fwdarw.4)]-Fuc carbohydrate substituent at the C-28-OH group, and/or is 3-O-beta-D-galactopyranosyl-(1.fwdarw.2)-[beta-D-xylopyranosyl-(1.fwdarw.3)]-beta-D-glucuronopyranosyl quillaic acid 28-O-beta-D-glucopyranosyl-(1.fwdarw.3)-beta-D-xylopyranosyl-(1.fwdarw.4)-alpha-L-rhamnopyranosyl-(1.fwdarw.2)-[beta-D-xylopyranosyl-(1.fwdarw.3)-4-OAc-beta-D-quinovopyranosyl-(1.fwdarw.4)]-beta-D-fucopyranoside, more preferably the saponin is SO1861 and/or QS-21, or wherein the at least one saponin is a bisdesmosidic saponin having a molecular mass of at least 1.500 Dalton and comprising an oleanan-type triterpene containing an aldehyde group at the C-23 position and optionally a hydroxyl group at the C-16 position, with a first branched carbohydrate side chain at the C-3 position which first branched carbohydrate side chain optionally contains glucuronic acid, wherein the saponin contains an ester group with a second branched carbohydrate side chain at the C-28 position which second branched carbohydrate chain preferably comprises at least four carbohydrate units, optionally containing at least one acetyl residue such as two acetyl residues and/or at least one deoxy carbohydrates and/or a quinovose and/or a glucose and/or 4-methoxycinnamic acid and/or optionally comprising 5-O-[5-O-Ara/Api-3,5-dihydroxy-6-methyl-octanoyl].sup.3,5-dihydroxy-6-methyl-octanoic acid and/or optionally comprising 5-O-[5-O-Rha-(1.fwdarw.2)-Ara/Api-3,5-dihydroxy-6-methyl-octanoyl].sup.3,5-dihydroxy-6-methyl-octanoic acid bound to a carbohydrate via an ester bond, or wherein the at least one saponin is QS-21 or any one or more of QS-21A, QS-21 A-api, QS-21 A-xyl, QS-21B, QS-21 B-api, QS-21 B-xyl, QS-7-xyl, QS-7-api, QS-17-api, QS-17-xyl, QS-18, QS1861, protonated QS1861 (QS1862), Quil-A11.
44. The method of claim 41, wherein the aldehyde function in position C-23 of the at least one saponin is covalently coupled to linker N--maleimidocaproic acid hydrazide, which linker is covalently coupled via a thio-ether bond to a sulfhydryl group in the first proteinaceous molecule, such as a sulfhydryl group of a cysteine.
45. The method of claim 41, wherein the first binding site and the second binding site comprise or consist of cetuximab, daratumumab, gemtuzumab, trastuzumab, panitumumab, brentuximab, inotuzumab, moxetumomab, polatuzumab, obinutuzumab, OKT-9 anti-CD71 monoclonal antibody of the IgG type, pertuzumab, rituximab, ofatumumab, Herceptin, alemtuzumab, pinatuzumab, OKT-10 anti-CD38 monoclonal antibody, an antibody of Table A2 or Table A3 or Table A4, preferably cetuximab or trastuzumab or OKT-9, with the proviso that the first binding site is different from the second binding site.
46. The method of claim 41, wherein the effector moiety comprised by the second proteinaceous molecule comprises or consists of at least one of an oligonucleotide, a nucleic acid and a xeno nucleic acid, preferably selected from any one or more of a vector, a gene, a cell suicide inducing transgene, deoxyribonucleic acid (DNA), ribonucleic acid (RNA), anti-sense oligonucleotide (ASO, AON), short interfering RNA (siRNA), microRNA (miRNA), DNA aptamer, RNA aptamer, mRNA, mini-circle DNA, peptide nucleic acid (PNA), phosphoramidate morpholino oligomer (PMO), locked nucleic acid (LNA), bridged nucleic acid (BNA), 2-deoxy-2-fluoroarabino nucleic acid (FANA), 2-O-methoxyethyl-RNA (MOE), 2-0,4-aminoethylene bridged nucleic acid, 3-fluoro hexitol nucleic acid (FHNA), a plasmid, glycol nucleic acid (GNA) and threose nucleic acid (TNA), or a derivative thereof, more preferably a BNA, for example a BNA for silencing HSP27 protein expression.
47. The method of claim 41, wherein the effector moiety comprised by the second proteinaceous molecule comprises at least one proteinaceous molecule, preferably selected from any one or more of a peptide, a protein, an enzyme such as urease and Cre-recombinase, a proteinaceous toxin, a ribosome-inactivating protein, a protein toxin selected from Table A5 and/or a bacterial toxin, a plant toxin, more preferably selected from any one or more of a viral toxin such as apoptin; a bacterial toxin such as Shiga toxin, Shiga-like toxin, Pseudomonas aeruginosa exotoxin (PE) or exotoxin A of PE, full-length or truncated diphtheria toxin (DT), cholera toxin; a fungal toxin such as alpha-sarcin; a plant toxin including ribosome-inactivating proteins and the A chain of type 2 ribosome-inactivating proteins such as dianthin e.g. dianthin-30 or dianthin-32, saporin e.g. saporin-S3 or saporin-S6, bouganin or de-immunized derivative debouganin of bouganin, shiga-like toxin A, pokeweed antiviral protein, ricin, ricin A chain, modeccin, modeccin A chain, abrin, abrin A chain, volkensin, volkensin A chain, viscumin, viscumin A chain; or an animal or human toxin such as frog RNase, or granzyme B or angiogenin from humans, or any fragment or derivative thereof; preferably the protein toxin is dianthin and/or saporin.
48. The method of claim 41, wherein the effector moiety comprised by the second proteinaceous molecule comprises at least one payload, preferably selected from any one or more of a toxin targeting ribosomes, a toxin targeting elongation factors, a toxin targeting tubulin, a toxin targeting DNA and a toxin targeting RNA, more preferably any one or more of emtansine, pasudotox, maytansinoid derivative DM1, maytansinoid derivative DM4, monomethyl auristatin E (MMAE, vedotin), monomethyl auristatin F (MMAF, mafodotin), a Calicheamicin, N-Acetyl-y-calicheamicin, a pyrrolobenzodiazepine (PBD) dimer, a benzodiazepine, a CC-1065 analogue, a duocarmycin, Doxorubicin, paclitaxel, docetaxel, cisplatin, cyclophosphamide, etoposide, docetaxel, 5-fluorouracyl (5-FU), mitoxantrone, a tubulysin, an indolinobenzodiazepine, AZ13599185, a cryptophycin, rhizoxin, methotrexate, an anthracycline, a camptothecin analogue, SN-38, DX-8951f, exatecan mesylate, truncated form of Pseudomonas aeruginosa exotoxin (PE38), a Duocarmycin derivative, an amanitin, -amanitin, a spliceostatin, a thailanstatin, ozogamicin, tesirine, Amberstatin269 and soravtansine, or a derivative thereof.
49. The method of claim 41, wherein the second proteinaceous molecule comprises any one of Gemtuzumab ozogamicin, Brentuximab vedotin, Trastuzumab emtansine, Inotuzumab ozogamicin, Moxetumomab pasudotox and Polatuzumab vedotin and an antibodydrug conjugate of Table A2 and Table A3.
50. The method of claim 41, wherein the first proteinaceous molecule comprises more than one covalently bound saponin, preferably 2, 3, 4, 5, 6, 8, 10, 16, 32, 64, 128 or 1-100 saponins, or any number of saponins therein between, such as 7, 9, 12 saponins.
51. The method of claim 41, wherein the first proteinaceous molecule comprises more than one covalently bound saponin, preferably 2, 3, 4, 5, 6, 8, 10, 16, 32, 64, 128 or 1-100 saponins, or any number of saponins therein between, such as 7, 9, 12 saponins, and wherein the more than one covalently bound saponin are covalently bound directly to an amino-acid residue of the first proteinaceous molecule, preferably to a cysteine and/or to a lysine, and/or are covalently bound via at least one linker and/or via at least one cleavable linker and/or via at least one oligomeric or polymeric scaffold, preferably 1-8 of such scaffolds or 2-4 of such scaffolds, wherein the at least one scaffold is optionally based on a dendron, wherein 1-32 saponins, preferably 2, 3, 4, 5, 6, 8, 10, 16, 32 saponins, or any number of saponins therein between, such as 7, 9, 12 saponins, are covalently bound to the at least one scaffold.
52. The method of claim 41, wherein the at least one saponin is a bisdesmosidic triterpene saponin belonging to the type of a 12,13-dehydrooleanane with an aldehyde function in position C-23, wherein the saponin is covalently coupled the first proteinaceous molecule, preferably covalently coupled to an amino-acid residue of the first proteinaceous molecule, via an aldehyde function in the saponin, preferably said aldehyde function in position C-23, preferably via at least one cleavable linker, wherein the amino-acid residue preferably is selected from cysteine and lysine, and wherein the cleavable linker is subject to cleavage under acidic conditions, reductive conditions, enzymatic conditions or light-induced conditions, and preferably the cleavable linker comprises a cleavable bond selected from a hydrazone bond and a hydrazide bond subject to cleavage under acidic conditions, and/or a bond susceptible to proteolysis, for example proteolysis by Cathepsin B, and/or a bond susceptible for cleavage under reductive conditions such as a disulphide bond.
53. The method of claim 41, wherein the at least one saponin is a bisdesmosidic triterpene saponin belonging to the type of a 12,13-dehydrooleanane with an aldehyde function in position C-23, wherein the saponin is covalently coupled the first proteinaceous molecule, preferably covalently coupled to an amino-acid residue of the first proteinaceous molecule, via an aldehyde function in the saponin, preferably said aldehyde function in position C-23, preferably via at least one cleavable linker, wherein the amino-acid residue preferably is selected from cysteine and lysine, and wherein the cleavable linker is subject to cleavage in vivo under acidic conditions as present in endosomes and/or lysosomes of mammalian cells, preferably human cells, preferably at pH 4.0-6.5, and more preferably at pH5.5.
54. The method of claim 41, wherein the first proteinaceous molecule comprises more than one covalently bound saponin, preferably 2, 3, 4, 5, 6, 8, 10, 16, 32, 64, 128 or 1-100 saponins, or any number of saponins therein between, such as 7, 9, 12 saponins, and wherein the more than one covalently bound saponin are covalently bound via at least one oligomeric or polymeric scaffold, preferably 1-8 of such scaffolds or 2-4 of such scaffolds, wherein the at least one scaffold is optionally based on a dendron, wherein 1-32 saponins, preferably 2, 3, 4, 5, 6, 8, 10, 16, 32 saponins, or any number of saponins therein between, such as 7, 9, 12 saponins, are covalently bound to the at least one scaffold, and wherein the polymeric or oligomeric structure of the scaffold comprises a linear, branched and/or cyclic polymer, oligomer, dendrimer, dendron, dendronized polymer, dendronized oligomer, a DNA, a polypeptide, poly-lysine, a poly-ethylene glycol, or an assembly of these polymeric or oligomeric structures which assembly is preferably built up by covalent cross-linking.
55. The method of claim 41, wherein the first pharmaceutical composition and the second pharmaceutical composition are administered to the patient in need thereof.
56. A method for treating a disease condition associated with the presence of an aberrant cell, in a patient in need thereof comprising administering to the patient the first pharmaceutical composition of claim 41, wherein the first pharmaceutical composition further comprises the second proteinaceous molecule of claims 41.
57. The method of claim 41, wherein the cell-surface molecule is expressed on the surface of the aberrant cell.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0212]
[0213]
[0214]
[0215]
[0216]
[0217]
[0218]
[0219]
[0220]
[0221]
[0222]
[0223]
[0224]
[0225]
[0226]
[0227]
[0228]
[0229]
[0230]
[0231]
[0232]
[0233]
[0234]
[0235]
[0236]
[0237]
[0238]
[0239]
[0240]
[0241]
[0242]
[0243]
[0244]
[0245]
[0246]
[0247]
[0248]
[0249]
[0250]
[0251]
[0252]
[0253]
[0254]
[0255]
[0256]
[0257]
[0258]
[0259] The poly (peptide) chain endings can be further modified with click chemistry moieties (e.g., BCN-NHS linker) that can be used for conjugation to a toxin.
[0260]
[0261]
[0262]
[0263]
[0264]
[0265]
[0266]
[0267]
[0268]
[0269]
DETAILED DESCRIPTION
[0270] In order for a bioactive molecule to work, the molecule must be able to engage with its target, e.g. in the blood serum, on the outside of the cell surface or inside a cell or an organelle. The active moiety of almost all protein-based targeted toxins, e.g., must enter the cytosol of the target cell to mediate its target modulatory effect. In many constellations the toxin remains ineffective since (1) the targeting moiety is poorly internalized and remains bound to the outside of the cells, (2) is recycled back to the cell surface after internalization or (3) transported to the endolysosomes where it is degraded. Although these fundamental issues are known for decades and more than 500 targeted toxins have been investigated in the past decades, the problems have not been solved yet and only one antibodytargeted protein toxin, moxetumomab pasudotox-tdfk (LUMOXITI, AstraZeneca Pharmaceuticals LP), has been approved for relapsed or refractory hairy cell leukemia by the FDA to date.
[0271] To overcome these problems, many strategies have been described including approaches to redirect the toxins to endogenous cellular membrane transport complexes of the biosynthetic pathway in the endoplasmic reticulum and techniques to disrupt or weaken the membrane integrity of endosomes, i.e. the compartments of the endocytic pathway in a cell, and thus facilitating the endosomal escape. This comprises the use of lysosomotropic amines, carboxylic ionophores, calcium channel antagonists, various cell-penetrating peptides of viral, bacterial, plant, animal, human and synthetic origin, other organic molecules and light-induced techniques. Although the efficacy of the targeted toxins was typically augmented in cell culture hundred- or thousand-fold, in exceptional cases more than million-fold, the requirement to co-administer endosomal escape enhancers with other substances harbors new problems including additional side effects, loss of target specificity, difficulties to determine the therapeutic window and cell type-dependent variations.
[0272] All strategies, including physicochemical techniques, require enhancer molecules that interact more or less directly with membranes and comprise essentially small chemical molecules, secondary metabolites, peptides and proteins. A common feature of all these substances is that they are per se not target cell-specific and distribute with other kinetics than the targeted toxins. This is one major drawback of the current approaches.
[0273] The present invention will be described with respect to particular embodiments but the invention is not limited thereto but only by the claims. The embodiments of the invention described herein can operate in combination and cooperation, unless specified otherwise.
[0274] While the invention has been described in terms of several embodiments, it is contemplated that alternatives, modifications, permutations and equivalents thereof will become apparent to one having ordinary skill in the art upon reading the specification and upon study of the drawings and graphs. The invention is not limited in any way to the illustrated embodiments. Changes can be made without departing from the scope which is defined by the appended claims.
[0275] An aspect of the invention relates to a therapeutic combination for use as a medicament, wherein the therapeutic combination comprises: (a) a first pharmaceutical composition comprising a first proteinaceous molecule comprising a first binding site for binding to a first cell-surface molecule and at least one saponin covalently bound to said first proteinaceous molecule preferably covalently bound to an amino-acid residue of said first proteinaceous molecule, the first pharmaceutical composition optionally further comprising a pharmaceutically acceptable excipient; and (b) a second pharmaceutical composition comprising a second proteinaceous molecule preferably different from the first proteinaceous molecule, the second proteinaceous molecule comprising a second binding site for binding to a second cell-surface molecule different from the first cell-surface molecule and an effector moiety, the second pharmaceutical composition optionally further comprising a pharmaceutically acceptable excipient.
[0276] An aspect of the invention relates to the first pharmaceutical composition of the invention for use as a medicament.
[0277] An aspect of the invention relates to the therapeutic combination of the invention or to the therapeutic combination for use in the treatment or prevention of cancer in a human subject, wherein the therapeutic combination comprises: (a) the first pharmaceutical composition of the invention, wherein the first cell-surface molecule is a first tumor-cell surface molecule, preferably a first tumor cell-specific surface molecule; and (b) the second pharmaceutical composition of the invention, wherein the second cell-surface molecule is a second tumor-cell surface molecule different from the first tumor-cell surface molecule, preferably the second cell-surface molecule is a second tumor cell-specific surface molecule different from the first tumor cell-specific surface molecule.
[0278] An embodiment is the first pharmaceutical composition of the invention, for use in the treatment or prophylaxis of cancer in a patient in need thereof, wherein the first cell-surface molecule is a first tumor-cell surface molecule, preferably a first tumor cell-specific surface molecule.
[0279] An embodiment is the first pharmaceutical composition according to the invention or the first pharmaceutical composition for use according to the invention or the therapeutic combination of the invention, wherein the second pharmaceutical composition of the invention and the first pharmaceutical composition are administered to the patient in need thereof, and wherein the second tumor-cell surface molecule is different from the first tumor-cell surface molecule, preferably the second tumor cell-specific surface molecule is different from the first tumor cell-specific surface molecule.
[0280] The inventors established that the therapeutic window of an antibody drug conjugate, such as the second proteinaceous molecule in the second pharmaceutical composition of the invention, increases when administered to a tumor-bearing mammal (mouse) to whom also the first pharmaceutical composition is administered. The first proteinaceous protein has at least one glycoside such as a saponin bound thereto, preferably covalently, more preferably via a cleavable linker. The saponin augments the therapeutic efficacy of the effector moiety bound to the second proteinaceous molecule, likely by enhancing the endosomal escape of the effector moiety into the cytosol where the activity of the effector moiety is desired. This way, already at a lower dose than the conventional dose of the ADC, i.e. the second proteinaceous molecule, therapeutic effect is established under influence of the presence of the first proteinaceous molecule comprising the saponin near, at and/or inside the targeted cell. The targeted cell is for example a diseased cell such as a tumor cell or an auto-immune cell or a B-cell disease related B-cell, etc. The effector moiety is for example a toxin as part of an ADC or an oligonucleotide such as a BNA as part of an AOC according to the invention.
[0281] An embodiment is the therapeutic combination of the invention or the therapeutic combination for use of the invention or the first pharmaceutical composition of the invention or the first pharmaceutical composition for use according to the invention, wherein the first binding site of the first proteinaceous molecule comprises or consists of an immunoglobulin or at least one binding fragment or-domain of said immunoglobulin for binding to the first cell-surface molecule, such as any one or more of an antibody, an IgG, a molecule comprising or consisting of a Vhh domain or Vh domain, a Fab, an scFv, an Fv, a dAb, an F (ab) 2, Fcab fragment, and/or comprises or consists of at least one ligand, preferably at least one ligand for binding to the first cell-surface molecule such as EGF or a cytokine.
[0282] An embodiment is the therapeutic combination of the invention or the therapeutic combination for use of the invention or the first pharmaceutical composition of the invention or the first pharmaceutical composition for use according to the invention, wherein the first binding site for binding to the first tumor-cell surface molecule, preferably a tumor cell-specific surface molecule, is a first binding site for a first cell-surface receptor present at a tumor cell, preferably specifically present at a tumor cell.
[0283] An embodiment is the therapeutic combination of the invention or the therapeutic combination for use of the invention or the first pharmaceutical composition of the invention or the first pharmaceutical composition for use according to the invention, wherein the at least one saponin is a triterpenoid saponin or a bisdesmosidic triterpene saponin, belonging to the type of a 12,13-dehydrooleanane with an aldehyde function in position C-23 and optionally comprising a glucuronic acid function in a carbohydrate substituent at the C-3beta-OH group of the saponin, and/or a saponin isolated from a Gypsophila species and/or a Saponaria species and/or an Agrostemma species and/or a Quillaja species such as Quillaja saponaria.
[0284] An embodiment is the therapeutic combination of the invention or the therapeutic combination for use of the invention or the first pharmaceutical composition of the invention or the first pharmaceutical composition for use according to the invention, wherein the at least one saponin is a single specific saponin or is a mixture of two or more different saponins, such as one or more of the saponins in Table A1 or Scheme I, SO1861, SA1657, GE1741, SA1641, QS-21, QS-21A, QS-21 A-api, QS-21 A-xyl, QS-21B, QS-21 B-api, QS-21 B-xyl, QS-7-xyl, QS-7-api, QS-17-api, QS-17-xyl, QS1861, QS1862, Quillajasaponin, Saponinum album, QS-18, Quil-A, Gyp1, gypsoside A, AG1, AG2, SO1542, SO1584, SO1658, SO1674, SO1832, or any of their stereomers and/or any combinations thereof, preferably the saponin is SO1861 and/or GE1741 and/or SA1641 and/or QS-21 and/or saponin with a quillaic acid aglycon core, a Gal-(1.fwdarw.2)-[Xyl-(1.fwdarw.3)]-GICA carbohydrate substituent at the C-3beta-OH group and a Glc-(1.fwdarw.3)-Xyl-(1.fwdarw.4)-Rha-(1.fwdarw.2)-[Xyl-(1.fwdarw.3)-4-OAc-Qui-(1.fwdarw.4)]-Fuc carbohydrate substituent at the C-28-OH group, and/or is 3-O-beta-D-galactopyranosyl-(1.fwdarw.2)-[beta-D-xylopyranosyl-(1.fwdarw.3)]-beta-D-glucuronopyranosyl quillaic acid 28-O-beta-D-glucopyranosyl-(1.fwdarw.3)-beta-D-xylopyranosyl-(1.fwdarw.4)-alpha-L-rhamnopyranosyl-(1.fwdarw.2)-[beta-D-xylopyranosyl-(1.fwdarw.3)-4-OAc-beta-D-quinovopyranosyl-(1.fwdarw.4)]-beta-D-fucopyranoside, more preferably the saponin is SO1861 and/or QS-21.
[0285] An embodiment is the therapeutic combination of the invention or the therapeutic combination for use of the invention or the first pharmaceutical composition of the invention or the first pharmaceutical composition for use according to the invention, wherein the at least one saponin is a bisdesmosidic saponin having a molecular mass of at least 1.500 Dalton and comprising an oleanan-type triterpene containing an aldehyde group at the C-23 position and optionally a hydroxyl group at the C-16 position, with a first branched carbohydrate side chain at the C-3 position which first branched carbohydrate side chain optionally contains glucuronic acid, wherein the saponin contains an ester group with a second branched carbohydrate side chain at the C-28 position which second branched carbohydrate chain preferably comprises at least four carbohydrate units, optionally containing at least one acetyl residue such as two acetyl residues and/or at least one deoxy carbohydrates and/or a quinovose and/or a glucose and/or 4-methoxycinnamic acid and/or optionally comprising 5-O-[5-O-Ara/Api-3,5-dihydroxy-6-methyl-octanoyl]-3,5-dihydroxy-6-methyl-octanoic acid and/or optionally comprising 5-O-[5-O-Rha-(1.fwdarw.2)-Ara/Api-3,5-dihydroxy-6-methyl-octanoyl]-3,5-dihydroxy-6-methyl-octanoic acid bound to a carbohydrate via an ester bond, or wherein the at least one saponin is QS-21 or any one or more of QS-21A, QS-21 A-api, QS-21 A-xyl, QS-21B, QS-21 B-api, QS-21 B-xyl, QS-7-xyl, QS-7-api, QS-17-api, QS-17-xyl, QS-18, QS1861, protonated QS1861 (QS1862), Quil-A.
[0286] An embodiment is the therapeutic combination of the invention or the therapeutic combination for use of the invention or the first pharmaceutical composition of the invention or the first pharmaceutical composition for use according to the invention, wherein the at least one saponin is a bisdesmosidic triterpene saponin belonging to the type of a 12,13-dehydrooleanane with an aldehyde function in position C-23, wherein the saponin is covalently coupled the first proteinaceous molecule, preferably covalently coupled to an amino-acid residue of the first proteinaceous molecule, via an aldehyde function in the saponin, preferably said aldehyde function in position C-23, preferably via at least one linker, and/or via at least one cleavable linker, wherein the amino-acid residue preferably is selected from cysteine and lysine.
[0287] An embodiment is the therapeutic combination of the invention or the therapeutic combination for use of the invention or the first pharmaceutical composition of the invention or the first pharmaceutical composition for use according to the invention, wherein the aldehyde function in position C-23 of the at least one saponin is covalently coupled to linker N--maleimidocaproic acid hydrazide, which linker is covalently coupled via a thio-ether bond to a sulfhydryl group in the first proteinaceous molecule, such as a sulfhydryl group of a cysteine.
[0288] An embodiment is the therapeutic combination of the invention or the therapeutic combination for use of the invention or the first pharmaceutical composition of the invention or the first pharmaceutical composition for use according to the invention, wherein the at least one saponin is a bisdesmosidic triterpene saponin belonging to the type of a 12,13-dehydrooleanane with an aldehyde function in position C-23 and comprising a glucuronic acid function in a carbohydrate substituent at the C-3beta-OH group of the saponin, wherein the saponin is covalently coupled to an amino-acid residue of the first proteinaceous molecule via the glucuronic acid function in the carbohydrate substituent at the C-3beta-OH group of the saponin, preferably via at least one linker, wherein the amino-acid residue preferably is selected from cysteine and lysine.
[0289] An embodiment is the therapeutic combination of the invention or the therapeutic combination for use of the invention or the first pharmaceutical composition of the invention or the first pharmaceutical composition for use according to the invention, wherein the glucuronic acid function in the carbohydrate substituent at the C-3beta-OH group of the at least one saponin is covalently coupled to linker 1-[Bis(dimethylamino)methylene]-1H-1,2,3-triazolo[4,5-b]pyridinium 3-oxid hexafluorophosphate, which linker is covalently coupled via an amide bond to an amine group in the first proteinaceous molecule, such as an amine group of a lysine or an N-terminus of the first proteinaceous molecule.
[0290] An embodiment is the therapeutic combination of the invention or the therapeutic combination for use of the invention or the first pharmaceutical composition of the invention or the first pharmaceutical composition for use according to the invention, wherein the second binding site of the second proteinaceous molecule comprises or consists of an immunoglobulin, at least one binding domain of said immunoglobulin and/or at least one binding fragment of said immunoglobulin for binding to the second cell-surface molecule, such as an antibody, an IgG, a molecule comprising or consisting of a Vhh domain or Vh domain, a Fab, an scFv, an Fv, a dAb, an F (ab) 2, Fcab fragment, and/or comprises or consists of at least one ligand, preferably a ligand for binding to the second cell-surface molecule such as EGF or a cytokine.
[0291] By targeting (two) different cell-surface molecules with the first and second proteinaceous molecule, the delivery of the saponin and the effector moiety at and inside the cytosol of the very same targeted cell, exposing both different first and second cell-surface molecules on the cell surface, is improved and more specific, compared to exposure of such cells to only the second proteinaceous molecule such as an ADC or an AOC, without the presence of the cell-targeted saponin (first proteinaceous molecule). According to the invention, an aberrant cell is selected for separate targeting by the first binding site of the first proteinaceous molecule and by the second binding site of the second proteinaceous molecule, wherein the first and second binding sites are different and wherein the first epitope to which the first proteinacous molecule binds is different from the second epitope to which the second proteinacous molecule binds and wherein the first and second epitope are located in/on a different kind and type of first and second cell-surface molecule such as two different receptors. Thus, the first epitope and the second epitope are comprised on the first cell-surface molecule and the second cell-surface molecule respectively. Preferably, expression of the first cell surface molecule and/or the second cell surface molecule is to a relatively high extent at the surface of a selected targeted cell (i.e. relatively higher expression of the two distinct and different first and second cell-surface molecules on the targeted cell surface such as for example a tumor cell or an auto-immune cell, than the expression on a non-targeted cell such as for example a healthy cell). Furthermore, optionally additionally or alternatively, the selected targeted cell such as an aberrant cell or a cancer cell, exposes the first and second cell-surface molecules specifically, when (neighboring) healthy cells in a patient are considered. Preferably, both the first and second cell-surface molecules targeted by the first and second binding sites are relatively highly and/or specifically expressed on the targeted (diseased, tumor) cell compared to healthy cells. An embodiment is the pharmaceutical combination, wherein at least one of the first and second binding site and thus at least one of the first and second cell-surface molecule such as a first and second tumor-cell receptor, is expressed specifically or to a relatively higher extent when compared to expression of the first cell-surface molecule and/or expression of the second cell-surface molecule on the surface of a healthy (neighboring) cell. Thus, the first epitope or the second epitope, preferably the first epitope and the second epitope, on the targeted first and second cell-surface molecule(s) is/are ideally unique to the targeted diseased cells, and is/are at least specifically present and exposed at the surface of the targeted cells. Binding of the first and second proteinaceous molecules to their respective first and second epitope on a targeted cell is followed by endocytosis of the complexes of the first proteinaceous molecule and the first target cell-surface molecule and the second proteinaceous molecule and the second target cell-surface molecule. Since the first and second proteinaceous molecules have to enter the same target cell through binding interaction with two different first and second cell-surface molecules both expressed to a sufficient extent or even uniquely on the surface of the targeted cell when compared to healthy cells that should not be targeted, accumulation of a therapeutically active amount of first and second proteinaceous molecules inside the target cells is only possible and occurring if expression levels of the two distinct targeted first and second cell-surface molecules is both above a certain minimal expression threshold. At the same time, the fact that the effector moiety comprised by and bound to the second proteinaceous molecule is only capable of exerting its intracellular (e.g. cytotoxic or gene silencing) activity in the presence of the first proteinaceous molecule bearing the covalently bound saponin, when both the first and second proteinaceous molecules were capable to enter the target cell in sufficient amounts by binding to sufficiently exposed and expressed first and second cell-surface molecules, also provides a safeguard against negative and undesired side effects of the effector moiety towards e.g. healthy cells and healthy tissue not meant to be targeted and affected by the effector moiety, when expression of at least on of the first and second cell-surface molecules is sufficiently low at the healthy cells and preferably when expression of both the first and second targeted cell-surface molecules is sufficiently low at the healthy cells. That is to say, sufficiently low expression or even absence of exposed first and second cell-surface molecules with regard to the first and second cell-surface molecules, and at least either the first cell-surface molecule or the second cell-surface molecule, bound by the first and second binding site of the first and second proteinaceous molecules respectively, does ideally not allow entrance into (non-targeted) healthy cells of both the first and second proteinaceous molecules to amounts that would in concert result in endosomal escape of the effector moiety under influence of the saponin bound to the first proteinaceous molecule. Since the ADC or the AOC can be used at lower dose compared to when the first proteinaceous molecule was not added to the therapeutic regimen, ADC or AOC entrance in healthy cells to low extent already bears a lower risk for occurrence of unwanted side effects when for example the targeting and killing of target diseased cells such as tumor cells and auto-immune cells is considered in the absence of the first proteinaceous molecule with the covalently bound saponin(s).
[0292] An embodiment is the therapeutic combination of the invention or the therapeutic combination for use of the invention or the first pharmaceutical composition of the invention or the first pharmaceutical composition for use according to the invention, wherein the second binding site for binding to the second tumor-cell surface molecule, preferably the second tumor cell-specific surface molecule, is a second binding site for a second cell-surface receptor present at a tumor cell, preferably specifically present at a tumor cell.
[0293] Synchronization is the missing link between a successful delivery strategy for mice and its application in humans. Indeed, the inventors established in a series of in vivo mouse tumor models that separately administering to the mice a dose of free saponin and a dose of e.g. an ADC (second proteinaceous molecule according to the invention) did not result in any desired anti-tumor activity such as delayed tumor growth, tumor regression, diminished and slower tumor growth, compared to control animals not treated with the ADC and free saponin. The free saponin was administered using various routes of administration and using various time points of administering the free saponin compared to the moment of administering the ADC (administering free saponin before, during and after administering the ADC). The ADC tested in in vivo tumor models was cetuximab-dianthin (with free SO1861), or trastuzumab-saporin (with free SO1861). Varying the dose of free saponin did not provide for an efficacious anti-tumor activity. The ADCs referred to were administered at a dose that in itself did not inflict any beneficial anti-tumor effect on the tumor-bearing animals. Surprisingly, the inventors now established that beneficial anti-tumor activity in various in vitro mammalian cell-based bioassays and/or in various in vivo animal tumor models can be achieved by treating the animals with conjugates according to the invention, optionally comprising a scaffold according to the invention, i.e. combinations of first and second proteinaceous molecules of the invention. The scaffold for example being a tri-functional linker with a covalently bound saponin (e.g. SO1861, QS-21) via a cleavable or non-cleavable linkage, and/or with a covalently bound effector moiety (e.g. dianthin, silencing BNA (HSP27) via a non-cleavable bond or a cleavable bond, and/or with a covalently bound monoclonal antibody such as cetuximab, trastuzumab, OKT-9, or the scaffold being a dendron, such as a dendron to which for example four moieties can bind such as four saponin molecules, or a dendron for binding for example two saponins and two effector molecules, the dendron comprising a chemical group for (covalent) coupling to a ligand or an antibody or fragment or domain thereof. Reference is made to the Examples section, exemplifying various of these scaffolds according to the invention, showing in vivo and/or in vitro anti-tumor cell activity when cell toxicity exerted by e.g. a proteinaceous toxin is considered or when gene silencing in the tumor cell is considered.
[0294] Without wishing to be bound by any theory, in view of the failures observed when treatment of tumor-bearing animals with an ADC together with free saponin is considered, it is preferred to synchronize the presence of both, the at least one saponin, and the effector moiety, preferably a toxin or an oligonucleotide, in compartments or vesicles of the endocytic pathway of the target cell, e.g. a tumor cell or an auto-immune cell. With ADC and free saponin, synchronizing the presence of the molecules in the late endosomes, in order to obtain the synergistic effects in vivo was not beneficially obtainable according to attempts of the inventors. In one aspect, the invention preferably solves at least the following problem with respect to combining the effector moiety comprised by the second proteinaceous molecule and the saponins comprised by the first proteinaceous molecule: without wishing to be bound by any theory the only reasonable chemical group within, e.g., the saponins that can be used for (covalent), in particular single and cleavable, retainable coupling is required for the endosomal escape activity. Known restrictions are most likely the reason why saponins have not been used in combination with pharmaceutically active substances in clinical investigations other than the application of saponins in vaccination regimes wherein the use of an immune-potentiating adjuvant substance was implied, although the striking endosomal escape enhancer effect of, e.g., saponins listed in Table A1 and Scheme I is known for more than 10 years. For example providing a first proteinaceous molecule of the invention with a covalently conjugated scaffold solves these difficulties, at least in part. Surprisingly, the saponins previously applied for their immune-potentiating activity in the vaccination context involving saponins as adjuvant component, are now also suitably for (covalent) coupling to the first proteinaceous molecule of the invention, for anti-tumor activity in vitro and in vivo.
[0295] An effector moiety useful in the present invention preferably relies on late endosomal escape for exerting its effect. Some effectors, such as, e.g., a pseudomonas exotoxin, are rerouted to other organelles prior to the late endosomal stage and, thus, would normally not benefit from coupling to the second proteinaceous molecule according to the present invention. However, such toxin may be adapted for use with the present invention, e.g., by deleting the signal peptide responsible rerouting. In particular toxins that are highly toxic and would require only one molecule to escape the endosomes to kill a cell may be modified to be less potent. It is preferred to use a toxin that kills a cell if at least 2, more preferably at least 5, more preferably at least 10, more preferably at least 20, more preferably at least 50, most preferably at least 100 toxin molecules escape the endosome. It is further preferred that a second proteinaceous molecule of the invention comprises a covalently conjugated functionalized scaffold, i.e. a scaffold comprising covalently bound effector moietie(s) for targeting the scaffold comprising the bound effector moietie(s) at a target cell such as a tumor cell or an auto-immune cell. Further, in order to reduce off-target toxicity, cell membrane non-permeable small molecule toxins are preferred effector molecules over cell membrane permeable toxins.
[0296] The term ligand as used in this invention has its ordinary meaning and preferably means a molecule or structure that is able to bind another molecule or structure on the cell surface of a target cell, wherein said molecule or structure on the cell surface can be endocytosed and is preferably absent or less prominent on off-target cells. Preferably, said molecule or structure on the cell surface is constitutively endocytosed. More preferably a ligand in this invention induces endocytosis of said molecule or structure on the cell surface of target cells after binding to said molecule or structure. This is for instance the case for Epidermal Growth Factor Receptor (EGFR), present on the surface of a variety of cancer cells. Examples of molecules or structures on the cell surface of target cells that are constitutively endocytosed, are for instance Claudin-1 or major histocompatibility complex class Il glycoproteins. A ligand can, e.g., be an antibody, a growth factor or a cytokine. Combining in a carrier molecule a toxin with a ligand is one possibility to create a targeted toxin. A toxin that is only toxic in a target cell because it interferes with processes that occur in target cells only can also be seen as a targeted toxin (as in off-target cells it cannot exert its toxic action, e.g. apoptin). Preferably, a targeted toxin is a toxin that is combined with a ligand or e.g. a monoclonal antibody in order to be active in target cells and not in off-target cells (as it is only bound to and endocytosed by target cells). In a functionalized scaffold comprising a carrier molecule comprising a ligand and an effector moiety (i.e. a second proteinaceous molecule), the ligand or the monoclonal antibody guides the effector moiety and scaffold to the target cells. After internalization, the at least one glycoside, preferably a saponin comprised by the conjugate of the first proteinaceous molecule and the saponin, mediates the endosomal escape of the effector moiety. The saponin is typically a saponin listed in Table A1 and Scheme I, and preferably the saponin is SO1861 and/or QS-21, and/or SA1641 and/or GE1741.
[0297] Preferably, the effector moiety bound to the second proteinaceous molecule, which effect is enhanced by the saponins bound to the first proteinaceous molecule, detaches from the second proteinaceous molecule, e.g. an antibody, when endocytosed. This can be achieved by a cleavable bond that breaks, e.g. under acidic, reductive, enzymatic or light-induced conditions.
[0298] An embodiment is the therapeutic combination of the invention or the therapeutic combination for use of the invention or the first pharmaceutical composition of the invention or the first pharmaceutical composition for use according to the invention, wherein the first binding site and the second binding site are binding sites for binding to a first and second tumor-cell receptor respectively, preferably for binding to a first and second tumor-cell specific receptor respectively, preferably present at the same tumor cell, and wherein the first and second tumor-cell receptor are preferably tumor-cell specific receptors, and/or are selected from CD71, CA125, EpCAM (17-1A), CD52, CEA, CD44v6, FAP, EGF-IR, integrin, syndecan-1, vascular integrin alpha-V beta-3, HER2, EGFR, CD20, CD22, Folate receptor 1, CD146, CD56, CD19, CD138, CD27L receptor, PSMA, CanAg, integrin-alphaV, CA6, CD33, mesothelin, Cripto, CD3, CD30, CD239, CD70, CD123, CD352, DLL3, CD25, ephrinA4, MUC1, Trop2, CEACAM5, CEACAM6, HER3, CD74, PTK7, Notch3, FGF2, C4.4A, FLT3, CD38, FGFR3, CD7, PD-L1, CTLA4, CD52, PDGFRA, VEGFR1, VEGFR2, more preferably selected from HER2, CD71 and EGFR, with the proviso that the first binding site is different from the second binding site and with the proviso that the first and second tumor-cell specific receptor, preferably the first and second tumor-cell specific receptor, are different receptors.
[0299] An embodiment is the therapeutic combination of the invention or the therapeutic combination for use of the invention or the first pharmaceutical composition of the invention or the first pharmaceutical composition for use according to the invention, wherein the first binding site and the second binding site comprise or consist of cetuximab, daratumumab, gemtuzumab, trastuzumab, panitumumab, brentuximab, inotuzumab, moxetumomab, polatuzumab, obinutuzumab, OKT-9 anti-CD71 monoclonal antibody of the IgG type, pertuzumab, rituximab, ofatumumab, Herceptin, alemtuzumab, pinatuzumab, OKT-10 anti-CD38 monoclonal antibody, an antibody of Table A2 or Table A3 or Table A4, preferably cetuximab or trastuzumab or OKT-9, or at least one tumor-cell receptor binding-domain thereof and/or at least one tumor-cell receptor binding-fragment thereof, with the proviso that the first binding site is different from the second binding site.
[0300] The inventors established that such aforementioned monoclonal antibodies, immunoglobulins, domains thereof, ligands, etc., are particularly suitable for application as the first binding site of the first proteinaceous molecule comprising the first binding site. Similarly, the inventors established that such immunoglobulins, domains thereof, ligands, etc., are particularly suitable for application as the second binding site of the second proteinaceous molecule comprising the second binding site. For example, antibodies and binding domains of antibodies are suitable for targeting an epitope on the exposed surface of a selected cell-surface molecule, resulting in targeting the first and, separately, the second proteinaceous molecule to target cells expressing the cell-surface molecule targeted by the first proteinaceous molecule and/or target also cells expressing the second cell-surface molecule targeted by the second proteinaceous molecule, these cells also expressing the first cell-surface molecule (which is a different cell-surface molecule), and having said cell-surface molecules on their cell surface. Similarly, ligands such as EGF, targeting the EGFR on target cells, are suitable for application as the binding site in the first proteinaceous molecule, or as the second binding site in the second proteinaceous molecule with the proviso that the second binding site is different from the first binding site. Preferred are binding sites for the first epitope or for the second epitope, which are specific for the binding of the first proteinaceous molecule to the first cell-surface molecule and/or for the binding of the second proteinaceous molecule to the second cell-surface molecule, the first and second cell-surface molecules exposed on the very same target cell. Binding sites based on antibodies or domains or binding fragments thereof for example provide for such desired specificity for a selected first and second on a selected first or second cell-surface molecule of a selected cell for targeting such as a diseased cell, a tumor cell, an auto-immune cell, etc. Therefore, first and second binding sites based on antibodies or binding molecules (fragments, domains) are preferred for the first and second proteinaceous molecules.
[0301] An embodiment is the therapeutic combination of the invention or the therapeutic combination for use of the invention or the first pharmaceutical composition of the invention or the first pharmaceutical composition for use according to the invention, wherein the first tumor-cell receptor is internalized by the tumor cell after binding to the first proteinaceous molecule of any one of the claims 1-7, 11-14, 17 and 18, and wherein preferably binding of the first proteinaceous molecule to the first tumor-cell receptor is followed by tumor-cell receptor-mediated internalization, e.g. via endocytosis, of a complex of the first proteinaceous molecule and the first tumor-cell receptor, wherein the first tumor-cell receptor is preferably a first tumor-cell specific receptor.
[0302] An embodiment is the therapeutic combination for use of the invention or the therapeutic combination of the invention, wherein the second tumor-cell receptor is internalized by the tumor cell after binding to the second proteinaceous molecule of the invention, and wherein preferably binding of the second proteinaceous molecule to the second tumor-cell receptor is followed by tumor-cell receptor-mediated internalization, e.g. via endocytosis, of a complex of the second proteinaceous molecule and the second tumor-cell receptor, wherein the second tumor-cell receptor is preferably a second tumor-cell specific receptor.
[0303] By targeting two different first and second cell-surface molecules on the surface of a selected target cell such as a diseased cell, a tumor cell, an auto-immune cell, with the first and second proteinaceous molecules, the intracellular delivery of the saponin and the intracellular delivery of the effector moiety to and into the cytosol of the very same targeted cell is improved and more specific. An aberrant cell selected for targeting by the first and second binding sites of the first and second proteinaceous molecules respectively ideally bears both the different first and second cell-surface molecules to a high extent (high expression number for both the first and second proteinaceous molecules) and/or the target cells expose the first and second cell-surface molecules specifically at the target cell surface, when (neighboring) healthy cells in a patient are considered. Thus, the first epitope on the targeted first cell-surface molecule and the second epitope on the targeted second cell-surface molecule are ideally unique to the targeted diseased cells, and are at least specifically present and exposed at the surface of the targeted cells. Binding of the first and second proteinaceous molecules to the respective first and second epitope on the first and second cell-surface molecules respectively, is followed by endocytosis of the complexes of the first proteinaceous molecule and the target first cell-surface molecule and the second proteinaceous molecule and the target second cell-surface molecule. Since the first and second proteinaceous molecules have to enter the same target cell through binding interaction with the two different first and second cell-surface molecules, accumulation of a therapeutically active amount of first and second proteinaceous molecules inside the target cells is only possible and occurring if expression levels of the targeted first and second cell-surface molecules are above a certain minimal expression threshold. At the same time, the fact that the effector moiety bound to the second proteinaceous molecule is only capable of exerting its intracellular (e.g. cytotoxic or gene silencing) activity in the presence of the first proteinaceous molecule bearing the covalently bound saponin, when both the first and second proteinaceous molecules were capable to enter the target cell in sufficient amounts by binding to sufficiently exposed and expressed first and second cell-surface molecules respectively, also provides a safeguard against negative and undesired side effects of the effector moiety towards e.g. healthy cells and healthy tissue not meant to be targeted and affected by the effector moiety, when expression of the targeted cell-surface molecule is sufficiently low at the healthy cells. That is to say, relatively low expression of either or both of the first and second cell-surface molecules bound by the first binding site or the second binding site of the first and second proteinaceous molecules respectively, does not allow entrance of both the first and second proteinaceous molecules together to amounts that would in concert result in endosomal escape of the effector moiety under influence of the saponin bound to the first proteinaceous molecule. Since the ADC or AOC can be used at lower dose compared to when the first proteinaceous molecule was not added to the therapeutic regimen comprising administering the second proteinaceous molecule, e.g. an ADC or an AOC, if occurring at all, entrance of the second proteinaceous molecule in healthy cells to low extent already bears a lower risk for occurrence of unwanted side effects when for example the targeting and killing of target diseased cells such as tumor cells and auto-immune cells is considered.
[0304] A pharmaceutically active substance in this invention is an effector moiety that is used to achieve a beneficial outcome in an organism, preferably a vertebrate, more preferably a human being such as a cancer patient or an auto-immune patient. Benefit includes diagnosis, prognosis, treatment, cure and/or prevention of diseases and/or symptoms. The pharmaceutically active substance may also lead to undesired harmful side effects. In this case, pros and cons must be weighed to decide whether the pharmaceutically active substance is suitable in the particular case. If the effect of the pharmaceutically active substance inside a cell is predominantly beneficial for the whole organism, the cell is called a target cell. If the effect inside a cell is predominantly harmful for the whole organism, the cell is called an off-target cell. In artificial systems such as cell cultures and bioreactors, target cells and off-target cells depend on the purpose and are defined by the user.
[0305] An effector moiety that is a polypeptide may be, e.g., a polypeptide that recover a lost function, such as for instance enzyme replacement, gene regulating functions, or a toxin.
[0306] An embodiment is the therapeutic combination of the invention or the therapeutic combination for use of the invention or the first pharmaceutical composition of the invention or the first pharmaceutical composition for use according to the invention, wherein the effector moiety comprised by the second proteinaceous molecule comprises or consists of at least one of an oligonucleotide, a nucleic acid and a xeno nucleic acid, preferably selected from any one or more of a vector, a gene, a cell suicide inducing transgene, deoxyribonucleic acid (DNA), ribonucleic acid (RNA), anti-sense oligonucleotide (ASO, AON), short interfering RNA (siRNA), microRNA (miRNA), DNA aptamer, RNA aptamer, mRNA, mini-circle DNA, peptide nucleic acid (PNA), phosphoramidate morpholino oligomer (PMO), locked nucleic acid (LNA), bridged nucleic acid (BNA), 2-deoxy-2-fluoroarabino nucleic acid (FANA), 2-O-methoxyethyl-RNA (MOE), 2-0,4-aminoethylene bridged nucleic acid, 3-fluoro hexitol nucleic acid (FHNA), a plasmid, glycol nucleic acid (GNA) and threose nucleic acid (TNA), or a derivative thereof, more preferably a BNA, for example a BNA for silencing HSP27 protein expression.
[0307] An embodiment is the therapeutic combination comprising the second pharmaceutical composition of the invention, wherein the effector moiety that is comprised by the second proteinaceous molecule comprises or consists of any one or more of an oligonucleotide, a nucleic acid, a xeno nucleic acid, preferably selected from any one or more of a vector, a gene, a cell suicide inducing transgene, deoxyribonucleic acid (DNA), ribonucleic acid (RNA), anti-sense oligonucleotide (ASO, AON), short interfering RNA (siRNA), microRNA (miRNA), DNA aptamer, RNA aptamer, mRNA, mini-circle DNA, peptide nucleic acid (PNA), phosphoramidate morpholino oligomer (PMO), locked nucleic acid (LNA), bridged nucleic acid (BNA), 2-deoxy-2-fluoroarabino nucleic acid (FANA), 2-O-methoxyethyl-RNA (MOE), 2-0,4-aminoethylene bridged nucleic acid, 3-fluoro hexitol nucleic acid (FHNA), a plasmid, glycol nucleic acid (GNA) and threose nucleic acid (TNA), or a derivative thereof, more preferably a BNA, for example a BNA for silencing HSP27 protein expression.
[0308] An embodiment is the therapeutic combination of the invention or the therapeutic combination for use of the invention or the first pharmaceutical composition of the invention or the first pharmaceutical composition for use according to the invention, wherein the effector moiety comprised by the second proteinaceous molecule comprises or consists of at least one proteinaceous molecule, preferably selected from any one or more of a peptide, a protein, an enzyme such as urease and Cre-recombinase, a proteinaceous toxin, a ribosome-inactivating protein, a protein toxin selected from Table A5 and/or a bacterial toxin, a plant toxin, more preferably selected from any one or more of a viral toxin such as apoptin; a bacterial toxin such as Shiga toxin, Shiga-like toxin, Pseudomonas aeruginosa exotoxin (PE) or exotoxin A of PE, full-length or truncated diphtheria toxin (DT), cholera toxin; a fungal toxin such as alpha-sarcin; a plant toxin including ribosome-inactivating proteins and the A chain of type 2 ribosome-inactivating proteins such as dianthin e.g. dianthin-30 or dianthin-32, saporin e.g. saporin-S3 or saporin-S6, bouganin or de-immunized derivative debouganin of bouganin, shiga-like toxin A, pokeweed antiviral protein, ricin, ricin A chain, modeccin, modeccin A chain, abrin, abrin A chain, volkensin, volkensin A chain, viscumin, viscumin A chain; or an animal or human toxin such as frog RNase, or granzyme B or angiogenin from humans, or any fragment or derivative thereof; preferably the protein toxin is dianthin and/or saporin.
[0309] An embodiment is the therapeutic combination of the invention or the therapeutic combination for use of the invention or the first pharmaceutical composition of the invention or the first pharmaceutical composition for use according to the invention, wherein the effector moiety comprised by the second proteinaceous molecule comprises or consists of at least one payload, preferably selected from any one or more of a toxin targeting ribosomes, a toxin targeting elongation factors, a toxin targeting tubulin, a toxin targeting DNA and a toxin targeting RNA, more preferably any one or more of emtansine, pasudotox, maytansinoid derivative DM1, maytansinoid derivative DM4, monomethyl auristatin E (MMAE, vedotin), monomethyl auristatin F (MMAF, mafodotin), a Calicheamicin, N-Acetyl-y-calicheamicin, a pyrrolobenzodiazepine (PBD) dimer, a benzodiazepine, a CC-1065 analogue, a duocarmycin, Doxorubicin, paclitaxel, docetaxel, cisplatin, cyclophosphamide, etoposide, docetaxel, 5-fluorouracyl (5-FU), mitoxantrone, a tubulysin, an indolinobenzodiazepine, AZ13599185, a cryptophycin, rhizoxin, methotrexate, an anthracycline, a camptothecin analogue, SN-38, DX-8951f, exatecan mesylate, truncated form of Pseudomonas aeruginosa exotoxin (PE38), a Duocarmycin derivative, an amanitin, -amanitin, a spliceostatin, a thailanstatin, ozogamicin, tesirine, Amberstatin269 and soravtansine, or a derivative thereof.
[0310] An embodiment is the therapeutic combination of the invention or the therapeutic combination for use of the invention, wherein the second proteinaceous molecule comprises or consists of any one of Gemtuzumab ozogamicin, Brentuximab vedotin, Trastuzumab emtansine, Inotuzumab ozogamicin, Moxetumomab pasudotox and Polatuzumab vedotin and an antibodydrug conjugate of Table A2 and Table A3, or at least one tumor-cell receptor binding-domain thereof and/or at least one tumor-cell receptor binding-fragment thereof, wherein said domain(s) or fragment(s) comprise(s) the effector moiety and are preferably (a) tumor-cell specific receptor binding-domain(s) and/or (a) tumor-cell specific receptor binding-fragment(s).
[0311] Tables A2, A3 and A4 list preferred examples of the first cell-surface molecule comprising the first epitope for the first binding site of the first proteinaceous molecule and second cell-surface molecules comprising the second epitope for the second binding site of the second proteinaceous molecule. Thus, Tables A2, A3 and A4 for example list preferred examples of the first and second cell-surface molecules comprising the first and second epitopes respectively for the first and second binding site of the first and second proteinaceous molecules respectively, wherein the first and second cell-surface molecules selected from for example any of the Tables A2, A3, A4 are different, according to the invention. When the first and/or second cell-surface molecule is specifically expressed on the target cell, preferably both the first and second cell-surface molecules, and when the first and second epitopes on the first and second cell-surface molecules respectively, to which the first binding site and/or the second binding site can bind respectively, is specifically present in the first and/or second cell-surface molecule, specific targeting of the first and/or second proteinaceous molecule to the same desired target cell such as a tumor cell exposing the first and second tumor-cell surface molecules, is facilitated, whereas other cells such as healthy cells, which do not express the first and/or second cell-surface molecule or do express the first and/or second cell-surface molecule to a lower extent, preferably which do not express the first and second cell-surface molecule or do express the first and second cell-surface molecule to a lower extent compared to expression of the cell-surface molecule(s) on the targeted (aberrant) cell, are not targeted by the first and second proteinaceous molecule or are targeted to a lower extent.
[0312] An embodiment is the first proteinaceous molecule of the invention, wherein the first proteinaceous molecule comprises more than one saponin, preferably 2, 3, 4, 5, 6, 8, 10, 16, 32, 64 or 1-100 saponins, or any number of saponins therein between, such as 7, 9, 12 saponins, covalently bound directly to an amino-acid residue of the first proteinaceous molecule, preferably to a cysteine and/or to a lysine, and/or covalently bound via at least one linker and/or via at least one cleavable linker and/or via at least one polymeric or oligomeric scaffold, preferably 1-8 of such scaffolds or 2-4 of such scaffolds, wherein the at least one scaffold is optionally based on a dendron, wherein 1-32 saponins such as 2, 3, 4, 5, 6, 8, 10, 16, 32 saponins, or any number of saponins therein between, such as 7, 9, 12 saponins, are covalently bound to the at least one scaffold.
[0313] An embodiment is the therapeutic combination of the invention or the therapeutic combination for use of the invention or the first pharmaceutical composition of the invention or the first pharmaceutical composition for use according to the invention, wherein the first proteinaceous molecule comprises more than one covalently bound saponin, preferably 2, 3, 4, 5, 6, 8, 10, 16, 32, 64, 128 or 1-100 saponins, or any number of saponins therein between, such as 7, 9, 12 saponins.
[0314] An embodiment is the therapeutic combination of the invention or the therapeutic combination for use of the invention or the first pharmaceutical composition of the invention or the first pharmaceutical composition for use according to the invention, wherein the more than one covalently bound saponin are covalently bound directly to an amino-acid residue of the first proteinaceous molecule, preferably to a cysteine and/or to a lysine, and/or are covalently bound via at least one linker and/or via at least one cleavable linker and/or via at least one oligomeric or polymeric scaffold, preferably 1-8 of such scaffolds or 2-4 of such scaffolds, wherein the at least one scaffold is optionally based on a dendron, wherein 1-32 saponins, preferably 2, 3, 4, 5, 6, 8, 10, 16, 32 saponins, or any number of saponins therein between, such as 7, 9, 12 saponins, are covalently bound to the at least one scaffold.
[0315] Table A1 and Scheme I and the above embodiments summarize a series of saponins that have been identified for their endosomal escape enhancing activity when contacted to mammalian cells, in particular human tumor cells, in free form together with a second molecule (e.g. an effector moiety or effector molecule, such as a toxin, an oligonucleotide). Indeed, in cell-based bioassays using human tumor cells it was established for the saponins tabulated in Table A1 and those in Scheme I and in the various embodiments of the invention described herein, that under influence of these saponins, when bound to the first proteinaceous molecule, a second molecule (effector moiety) such as a nucleic acid and/or a toxin such as a protein toxin (e.g. one or more of the protein toxins listed in Table A5), bound to the second proteinaceous molecule, is delivered into the cytosol with increased efficiency and/or efficacy, presumably through intracellular release from the (late) endosomes and lysosomes. That is to say, endosomal and/or lysosomal escape of such second molecules (effector moieties bound to a second proteinaceous molecule of the invention), e.g. nucleic acids and/or toxins, is less efficient in the absence of the saponin.
[0316] Surprisingly, the inventors now demonstrate that a water-soluble saponin fraction from Quillaja saponaria, comprising QS-21 and its family members QS-21A, QS-21 A-api, QS-21 A-xyl, QS-21B, QS-21 B-api, QS-21 B-xyl, QS-7-xyl, QS-7-api, QS-17-api, QS-17-xyl, QS1861, QS1862, QS-18 and Quil-A, also exhibits the ability to potentiate a biological effect in vitro of e.g. a nucleic acid bound to a monoclonal antibody or a protein toxin bound to a monoclonal antibody (examples of a second proteinaceous molecule of the invention comprising covalently bound oligonucleotide or payload such as a (protein) toxin), when administered to tumor cells of a mammalian species (human) in the form of a covalent conjugate comprising a monoclonal antibody (first proteinaceous molecule of the invention), together with the second proteinaceous molecule comprising the effector moiety (the aforementioned second proteinaceous molecule) and the at least one glycoside such as the QS-21 and its family member saponins encompassed by such QS-21 preparation (e.g. water soluble fraction of Quillaja saponaria), comprised by the first proteinaceous molecule as a covalent conjugate, wherein the effector molecule and the glycoside, e.g. saponin fraction of Quillaja saponaria, QS-21, SO1861, SA1641,
[0317] GE1741, are covalently bound to for example the proteinaceous molecules directly or via a linker or via a polymeric or oligomeric scaffold, either directly or via at least one linker. Without wishing to be bound by any theory, the observed stimulation or potentiation of for example antisense BNA mediated reduction of tumor-cell HSP27 expression (HSP27 gene silencing) in the presence of saponins derived from Quillaja saponaria in vitro may (also) relate to activation of the inflammasome in the tumor cell by the saponins, for example resulting in tumor cell pyroptosis. The inventors established that second proteinaceous molecules conjugated to for example antisense BNA or dianthin or saporin, exerted any anti-tumor cell activity in vitro at all or improved anti-tumor cell activity when contacted with cells in bio-based cell assays, when in the presence of the first proteinaceous molecule of the invention, comprising the saponin, and targeted to the same (tumor) cells as the cell surface molecule targeted by the second proteinaceous molecule, whereas in the absence of the first proteinaceous molecule and thus in the absence of saponin, no such activity towards the tumor cell was observed, or activity to a much lesser extent, at best.
[0318] QS-21, and also the water-soluble saponins fraction comprising QS-21 from Quillaja saponaria is already for a long time known and previously intensively applied for its immune-potentiating abilities, e.g. as an adjuvant in e.g. sub-unit vaccines. For example, QS-21 is applied in two phase III clinical trials with human patients, who were vaccinated with a sub-unit vaccine mixed with an adjuvant comprising QS-21 (Glaxo-Smith-Kline, MAGRIT trial, DERMA study), wherein the sub-unit was MAGE-A3 protein, which is specifically expressed and presented by tumor cells. The anti-tumor vaccinations, potentiated with QS-21, aimed for extension of disease-free survival of the cancer patients (melanoma; non-small cell lung cancer). In addition, QS-21 has been tested as an adjuvant in clinical trials for developing anti-cancer vaccine treatment, for vaccines for HIV-1 infection, in development of a vaccine against hepatitis B, and for anti-malaria vaccine development using QS-21 comprising adjuvants AS01 and AS02 of Glaxo-Smith-Kline. Previous studies revealed an immune response elicited against MAGE-A3 peptides presented at the cancer cell surface, under influence of the QS-21 saponin comprising adjuvant (AS15; GSK). To the surprise of the inventors, the saponin fraction of Quillaja saponaria, and thus likely QS-21 (as part of the water soluble saponin fraction of Quillaja saponaria) potentiates the anti-tumor cell activity of e.g. a payload such as a protein toxin (dianthin), bound to the second proteinaceous molecule (e.g. the ligand EGF).
[0319] The inventors show that a tumor-cell targeting monoclonal antibody provided with covalently coupled antisense BNA such as BNA (HSP27), and contacted with the tumor cells together with a first proteinaceous molecule of the invention with covalently coupled saponin (e.g. SO1861, QS-21), both the BNA and the saponin coupled to the respective antibody (e.g. cetuximab) of the first proteinaceous molecule via a cleavable bond is capable of silencing HSP27 in vivo in tumors, compared to control and compared to AOC (second proteinaceous molecule) only, without presence of first proteinaceous molecule with coupled saponin. Co-administering an ADC or an antibodyoligonucleotide conjugate (AOC), such as an antibodyBNA conjugate, with a first proteinaceous molecule with a saponin thus endows the ADC or AOC with anti-tumor cell activity not seen with only the ADC or only the AOC at the same dose. Noteworthy, the AOC (the second proteinaceous molecule) and the monoclonal antibody with covalently coupled saponin (first proteinaceous molecule) increase HSP27 expression in tumor cells, when administered to tumor-bearing mice separately in separate groups of mice, compared to a control group (vehicle administered, only). Only co-administration of the AOC comprising the effector moiety of the invention (second proteinaceous molecule) and the first proteinaceous molecule with covalently coupled saponin, displays reduced HSP27 expression when compared to controls. The antisense BNA (HSP27) was BNA with oligo nucleic acid sequence 5-GGCacagccagtgGCG-3 according to Zhang et al. (2011) [Y Zhang, Z Qu, S Kim, V Shi, B Liao1, P Kraft, R Bandaru, Y Wu, L M Greenberger and I D Horak, Down-modulation of cancer targets using locked nucleic acid (LNA)-based antisense oligonucleotides without transfection, Gene Therapy (2011) 18, 326-333]. Noteworthy, to the best of the knowledge of the inventors, BNA is designed for application as a free nucleic acid. The inventors are now the first to demonstrate that the antisense BNA can be covalently coupled through a (non-) cleavable linker with a ligand or an antibody, in a way that gene-silencing activity is retained in vitro and more importantly in vivo in the tumor cells of a tumor-bearing animal. This approach of providing BNA based AOCs opens new ways to administer targeted BNA to human (cancer) patients in need thereof.
[0320] The inventors disclose here that covalently coupling saponins such as saponins in the water-soluble fraction of Quillaja saponaria, QS-21, SA1641, SO1861, Table A1, Scheme I, to a first proteinaceous molecule, such as via a tri-functional linker, e.g. the tri-functional linker of Scheme II, or via an oligomeric or polymeric structure of a scaffold comprising covalently bound saponins, results in improved cell toxicity exerted by the effector moiety such as a toxin, comprised by the second proteinaceous molecule, under influence of the covalently coupled saponin in the first proteinaceous molecule.
[0321] An embodiment is the first proteinaceous molecule of the invention comprising a saponin comprising one or several or all of the indicated structural features of the saponin of Structure A in Scheme I, the saponin of structure A referred to as a saponin with an ideal structure when endosomal escape enhancing activity towards an effector moiety present in the endosome of a cell contacted with first proteinaceous molecule, and/or a saponin selected from any one or more of the further saponins in Scheme I:
##STR00002## ##STR00003## ##STR00004## ##STR00005## ##STR00006##
[0322] According to the invention, a glycoside, such as a saponin according to the invention, bound to the first proteinaceous molecule of the invention, which has the ideal structure for the purpose of enhancing endosomal escape of an effector molecule bound to the second proteinaceous molecule of the invention is a bisdesmosidic saponin according to Structure A of Scheme I, having a molecular mass of at least 1.500 Dalton and comprising an oleanan-type triterpene containing an aldehyde group at the C-23 position and optionally a hydroxyl group at the C-16 position, with a first branched carbohydrate side chain at the C-3 position which first branched carbohydrate side chain optionally contains glucuronic acid, wherein the saponin contains an ester group with a second branched carbohydrate side chain at the C-28 position which second branched carbohydrate chain preferably comprises at least four carbohydrate units, optionally containing at least one acetyl residue such as two acetyl residues and/or optionally comprising deoxy carbohydrates and/or optionally comprising quinovose and/or optionally comprising glucose and/or optionally comprising 4-methoxycinnamic acid and/or optionally comprising 5-O-[5-O-Ara/Api-3,5-dihydroxy-6-methyl-octanoyl]-3,5-dihydroxy-6-methyl-octanoic acid and/or optionally comprising 5-O-[5-O-Rha-(1.fwdarw.2)-Ara/Api-3,5-dihydroxy-6-methyl-octanoyl]-3,5-dihydroxy-6-methyl-octanoic acid bound to a carbohydrate via an ester bond.
[0323] SO1861 is different from the ideal structure displayed in Scheme I, Structure A, only in having only one acetyl residue at the quinovose and having an additional xylose. The ideal structure of a saponin for enhancing endosomal escape of an effector molecule or effector moiety, is a saponin which preferably has the Structure A of Scheme I, and saponins which display the endosomal escape enhancing activity have one or more of the structural features displayed in Structure A of Scheme I. Without wishing to be bound by any theory, the inventors belief that the Structure A of Scheme I represents an ideal saponin (and not a minimum requirement saponin) for endosomal escape enhancing activity, which means that not all of the structures (chemical groups) can or must be present in each saponin with at least sufficient endosomal escape enhancing activity to promote accumulation of the effector moiety in the cytosol, and which means that some saponins might have other structure elements such as acyl chains, and/or for yet other saponins that display endosomal escape enhancing activity, the sugars can be different than the sugars displayed in Scheme I. For example, the QS-21 saponin and some of the saponins in the water soluble fraction of Quillaja saponaria (Quillaja saponins; Quil-A) differ in the carbohydrate modification at C-28 when the ideal structure of Structure A in Scheme I is considered: presence of an acyl chain in QS-21 for example. In the water soluble fraction of Quillaja saponaria, saponins such as QS-7, QS1862, are similar to the ideal Structure A, and are similar to SO1861.
[0324] According to the invention, typically the saponin is a saponin listed in Table A1, Scheme I. It has been proven beneficial for the activity of the saponin, e.g. the endosomal escape enhancing activity inside cells when the entry into the cell and the accumulation inside the cytosol of an effector moiety covalently coupled to the second proteinaceous molecule, is considered, when the saponin is covalently coupled to the first proteinaceous molecule involving a hydrazone bond, and/or a hydrazide bond, and/or a disulphide bond. Such bond types readily cleave under the acidic conditions inside (late) endosomes and lysosomes of mammalian cells, e.g. human cells, and/or under the reductive conditions.
[0325] Alternatively, the inventors also demonstrate that covalent coupling of saponin to the first proteinaceous molecule via a bond that is not readily cleavable under the physiological conditions inside cells, e.g. (late) endosomes, lysosomes, cytosol, is also beneficial to the potentiating activity of the saponin on the biological effect of e.g. an effector moiety such as a nucleic acid (e.g. BNA silencing HSP27) and a proteinaceous toxin such as saporin. Throughout the application, including the claims, the term cleavable linker, cleavable bond, etc., is also referred to as labile linker (L) and labile bond, for example in the context of cleavage of such a bond or linker in the (late) endosome and/or lysosome when a conjugate of the invention, e.g. a first proteinaceous molecule optionally comprising a scaffold with saponins coupled to the first proteinaceous molecule through a linker and/or via the scaffold via hydrazone bonds or disulphide bonds, is referred to. For example, the inventors demonstrated the in vivo HSP27 gene silencing in human tumors in mice. The tumor-bearing mice were treated with a first proteinaceous molecule consisting of monoclonal antibody with saponin bound thereto via a labile linker (hydrazone bond) according to the invention, whereas the second proteinaceous molecule comprised bound antisense BNA for silencing the HSP27 gene in the tumor cells, covalently coupled to the monoclonal antibody (same type as the first monoclonal antibody) via a a disulphide bond. Here, the first and second binding site were the same, capable of binding to the same epitope on the same target cell surface molecule. That is to say, without wishing to be bound by any theory, the hydrazone bond and the disulphide bond are cleaved in the (late) endosomes and/or lysosomes of the targeted tumor cells that express the epitope on the targeted cell-surface molecule, here the EGFR, at the cell surface, once the therapeutic combination of the invention is internalized by e.g. endocytosis. Cleavage of the bonds likely contributes to the endosomal escape enhancing activity of the saponin when the entry of the BNA from the endosome and/or lysosome into the cytosol is considered, although such cleavage is not a necessity for observing the gene silencing effect of the combination of the cetuximab-SO1861 conjugate and the cetuximab-BNA conjugate of the invention.
[0326] The skilled person will appreciate that a tri-functional linker is a scaffold of the invention suitable for covalently coupling one, two or three saponin moieties. For the tri-functional linker covalent coupling of one or two saponin moieties is preferred. The second binding site of the tri-functional linker is for example suitable for covalent coupling a proteinaceous ligand such as the first proteinaceous molecule. Typical proteinaceous ligands are EGF for targeting (tumor) cells expressing EGFR at the cell surface, and cytokines for targeting tumor cells or autoimmune cells. Moreover, the second or third binding site of the tri-functional linker is suitable for covalent coupling of an immunoglobulin such as a monoclonal antibody, i.e. the first proteinaceous molecule for binding to a first cell surface molecule such as a tumor cell surface molecule, preferably a tumor-cell specific molecule, more preferably a tumor cell receptor that is specifically (over-) expressed at the surface of the tumor cell. Similarly, the immunoglobulin, or any fragment(s) and/or domain(s) thereof which encompass the binding specificity of the immunoglobulin, is suitable for binding to a first cell surface molecule such as a receptor, expressed at the surface of an autoimmune cell. Thus, in an embodiment, the first proteinaceous molecule comprises the tri-functional linker, said linker comprises or consists of a covalently bound saponin, e.g. QS-21, SO1861, and the covalently bound first binding site such as a cell targeting moiety such as a ligand or an antibody for (specific) binding to a tumor cell via a first epitope in a first cell-surface molecule such as a tumor cell receptor, an auto-immune cell, a diseased cell, an aberrant cell, a non-healthy cell, a B-cell disease.
[0327] An embodiment is the first proteinaceous molecule of the invention, comprising the oligomeric tri-functional linker as the scaffold core structure, according to Scheme II:
##STR00007##
wherein the saponins are covalently bound to the tri-functional linker scaffold via labile, cleavable hydrazone linkers (acid sensitive) and/or via a maleimide comprising bond, whereas the binding of the scaffold to the binding site such as an antibody is established via labile, cleavable hydrazone linkers (acid sensitive) and/or via a maleimide comprising bond with cysteines in the binding site, therewith forming Structure B:
##STR00008##
such as 1, 2, 3 or 4 cysteines such that 1-4 scaffolds are covalently bound to a single e.g. antibody such as a monoclonal antibody.
[0328] An embodiment is the first proteinaceous molecule of the invention wherein the glycoside molecule is a saponin and the linkage between saponin and the first proteinaceous molecule preferably occurs via an acid-labile bond that is stable at pH 7.4 and, preferably releases the saponin below pH 6.5, more preferably between pH 6.5 and 5.0. This is, e.g., realized via an imine formed by an amino group of a linker linking the saponin and the first proteinaceous molecule and the aldehyde group of the saponin. Other chemical bonds that fulfill the pH-condition can also be used for aldehyde coupling, e.g. particular hydrazones or acetals, requiring hydrazides and hydroxyl groups as the functional group of the linker, respectively. If the bond is a cleavable bond, a saponin is preferably attached to the polymeric or oligomeric structure of a scaffold via an aldehyde function or via one of the carboxyl groups in saponin, more preferably through the aldehyde function, preferably an aldehyde function in position 23. Alternatively, a saponin is preferably attached to the first proteinaceous molecule via the polymeric or oligomeric structure of the scaffold via a linker that connects the polymeric or oligomeric structure of the scaffold either via the aldehyde function or via the carboxylic acid function of the glycoside molecule, i.e. the saponin.
[0329] An embodiment is the first proteinaceous molecule of the invention, wherein the at least one saponin is bound to the first proteinaceous molecule via a stable bond. In a more preferred embodiment, the stable bond between saponin first proteinaceous molecule preferably occurs via an amide coupling or amine formation. This is, e.g., realized via carbodiimide mediated amide bond formation by an amino group of a polymeric or oligomeric scaffold structure linking the saponin and the first proteinaceous molecule together, and the activated glucuronic acid group of the saponin. Chemical bonds that fulfill the stable bond definition can also be used for aldehyde coupling, e.g. particular amines derived after reductive amination, requiring primary amino groups as the functional group of a polymeric or oligomeric structure of a scaffold or a linker. If the bond is a stable bond, the saponin is preferably attached to a linker or a scaffold via one of the carboxyl groups of the saponin, the linker or scaffold further linked to the first proteinaceous molecule.
[0330] An embodiment is the first proteinaceous molecule of the invention wherein the saponin is coupled to the binding site via a scaffold according to the invention, wherein the chemical group for covalently coupling of the scaffold to the binding site is a click chemistry group.
[0331] An embodiment is the first proteinaceous molecule of the invention wherein the saponin is coupled to the binding site via a scaffold according to the invention, wherein the click chemistry group is a tetrazine, an azide, an alkene or an alkyne, or a cyclic derivative of any of these groups, preferably an azide. A click chemistry group is a functional chemical group suitable for click chemistry, which is defined as a reaction that is modular, wide in scope, gives very high yields, generates only inoffensive byproducts, offers high selectivity, and high tolerance over different functional groups, and is stereospecific. The required process characteristics include simple reaction conditions, readily available starting materials and reagents, the use of no solvent or a solvent that is benign (such as water) or easily removed, and simple product isolation. The click chemistry group for coupling the saponin to the binding site in the first proteinaceous molecule optionally via a scaffold or a linker, is preferably a tetrazine, azide, alkene, or alkyne, or reactive derivates of them such as methyl-tetrazine or maleimide (alkene), more preferably an alkyne, or a cyclic derivative of these groups, such as cyclooctyne (e.g. aza-dibenzocyclooctyne, difluorocyclooctyne, bicyclo[6.1.0]non-4-yne, dibenzocyclooctyne).
[0332] A first proteinaceous molecule according to the invention thus comprises at least one saponin. With at least one in this context is meant that the first proteinaceous molecule comprises one saponin molecule but may also comprise a couple (e.g. two, three or four) of saponins or a multitude (e.g. 10, 20 or 100) of saponins. Depending on the application, the first proteinaceous molecule may comprise a covalently bound scaffold with covalently bound saponins, wherein the scaffold may be designed such that it comprises a defined number of saponins. Preferably, a first proteinaceous molecule according to the invention comprises a defined number or range of saponins, rather than a random number. This is especially advantageous for drug development in relation to marketing authorization. A defined number in this respect means that a first proteinaceous molecule preferably comprises a previously defined number of saponins. This is, e.g., achieved by designing a scaffold comprising a polymeric structure with a certain number of possible moieties for the saponin(s) to attach. Under ideal circumstances, all of these moieties are coupled to a saponin and the scaffold than comprises the prior defined number of saponins. It is envisaged to offer a standard set of scaffolds, comprising, e.g., two, four, eight, sixteen, thirty-two, sixty-four, etc., saponins so that the optimal number can be easily tested by the user according to his needs. An embodiment is the first proteinaceous molecule of the invention comprising the scaffold of the invention, wherein the saponin is present in a defined range as, e.g., under non-ideal circumstances, not all moieties present in a polymeric structure bind a saponin. Such ranges may for instance be 2-4 saponin molecules per scaffold, 3-6 saponin molecules per scaffold, 4-8 saponin molecules per scaffold, 6-8 saponin molecules per scaffold, 6-12 saponin molecules per scaffold and so on. In such case, a first proteinaceous molecule comprising a scaffold according to the invention thus comprises 2, 3 or 4 saponins if the range is defined as 2-4.
[0333] The scaffold is fundamentally independent of the type of saponin covalently bound to the scaffold, the scaffold subsequently (in sequential order) covalently coupled to the first proteinaceous molecule. Thus, first proteinaceous molecule comprising the scaffold is the basis product for a new platform technology. Since the at least one covalently bound saponin mediates intracellular delivery of the effector moiety bound to the second proteinaceous molecule, the scaffold technology according to the invention is the first system known that mediates controlled intracellular effector moiety delivery by saponins. The scaffold provides an optimized and functionally active unit that can be linked to the saponin(s) and to the binding site comprised by the first proteinaceous molecule, e.g. a ligand, an antibody, etc., at a single and defined position.
[0334] An embodiment is the first proteinaceous molecule comprising a scaffold according to the invention, wherein the number of monomers of the polymeric or oligomeric structure is an exactly defined number or range. Preferably, the polymeric or oligomeric structure comprises structures such as poly (amines), e.g., polyethylenimine and poly (amidoamine), or structures such as polyethylene glycol, poly (esters), such as poly(lactides), poly (lactams), polylactide-co-glycolide copolymers, poly (dextrin), or a peptide or a protein, or structures such as natural and/or artificial polyamino acids, e.g. poly-lysine, DNA polymers, stabilized RNA polymers or PNA (peptide nucleic acid) polymers, either appearing as linear, branched or cyclic polymer, oligomer, dendrimer, dendron, dendronized polymer, dendronized oligomer or assemblies of these structures, either sheer or mixed. Preferably, the polymeric or oligomeric structures are biocompatible, wherein biocompatible means that the polymeric or oligomeric structure does not show substantial acute or chronic toxicity in organisms and can be either excreted as it is or fully degraded to excretable and/or physiological compounds by the body's metabolism.
[0335] Assemblies can be built up by covalent cross-linking or non-covalent bonds and/or attraction. They can therefore also form nanogels, microgels, or hydrogels, or they can be attached to carriers such as inorganic nanoparticles, colloids, liposomes, micelles or particle-like structures comprising cholesterol and/or phospholipids. Said polymeric or oligomeric structures preferably bear an exactly defined number or range of coupling moieties for the coupling of glycoside molecules (and/or effector molecules and/or carrier molecules such as a ligand, monoclonal antibody or a fragment thereof). Preferably at least 50%, more preferably at least 75%, more preferably at least 85%, more preferably at least 90%, more preferably at least 95%, more preferably at least 98%, more preferably at least 99%, most preferably 100% of the exactly defined number or range of coupling moieties in the polymeric or oligomeric structure is occupied by a glycoside molecule in a scaffold according to the invention.
[0336] Preferably, a dendron is a branched, clearly defined tree-like polymer with a single chemically addressable group at the origin of the tree, called the focal point. A dendrimer is a connection of two or more dendrons at their focal point. A dendronized polymer is a connection of the focal point of one or more dendrons to a polymer. In a preferred embodiment, a scaffold according to the invention is provided, wherein the polymeric or oligomeric structure comprises a linear, branched or cyclic polymer, oligomer, dendrimer, dendron, dendronized polymer, dendronized oligomer or assemblies of these structures, either sheer or mixed, wherein assemblies can be built up by covalent cross-linking or non-covalent attraction and can form nanogels, microgels, or hydrogels, and wherein, preferably, the polymer is a derivative of a poly (amine), e.g., polyethylenimine and poly (amidoamine), and structures such as polyethylene glycol, poly (esters), such as poly(lactids), poly (lactams), polylactide-co-glycolide copolymers, and poly (dextrin), and structures such as natural and/or artificial polyamino acids such as poly-lysine, or a peptide or a protein or DNA polymers, stabilized RNA polymers or PNA (peptide nucleic acid) polymers. Preferably, the polymeric or oligomeric structures are biocompatible.
[0337] An embodiment is the therapeutic combination of the invention or the therapeutic combination for use according to the invention, wherein the first proteinaceous molecule comprises more than one covalently bound saponin, preferably 2, 3, 4, 5, 6, 8, 10, 16, 32, 64, 128 or 1-100 saponins, or any number of saponins therein between, such as 7, 9, 12 saponins.
[0338] An embodiment is the therapeutic combination of the invention or the therapeutic combination for use of the invention or the first pharmaceutical composition of the invention or the first pharmaceutical composition for use according to the invention, wherein the cleavable linker is subject to cleavage under acidic conditions, reductive conditions, enzymatic conditions or light-induced conditions, and preferably the cleavable linker comprises a cleavable bond selected from a hydrazone bond and a hydrazide bond subject to cleavage under acidic conditions, and/or a bond susceptible to proteolysis, for example proteolysis by Cathepsin B, and/or a bond susceptible for cleavage under reductive conditions such as a disulphide bond.
[0339] An embodiment is the therapeutic combination of the invention or the therapeutic combination for use of the invention or the first pharmaceutical composition of the invention or the first pharmaceutical composition for use according to the invention, wherein the cleavable linker is subject to cleavage in vivo under acidic conditions as present in endosomes and/or lysosomes of mammalian cells, preferably human cells, preferably at pH 4.0-6.5, and more preferably at pH5.5.
[0340] An embodiment is the therapeutic combination of the invention or the therapeutic combination for use of the invention or the first pharmaceutical composition of the invention or the first pharmaceutical composition for use according to the invention, wherein the oligomeric or polymeric scaffold comprises a polymeric or oligomeric structure and comprises at least one chemical group, the at least one chemical group for covalently coupling of the scaffold to the amino-acid residue of said first proteinaceous molecule.
[0341] An embodiment is the therapeutic combination of the invention or the therapeutic combination for use of the invention or the first pharmaceutical composition of the invention or the first pharmaceutical composition for use according to the invention, wherein the at least one saponin is covalently bound to the polymeric or oligomeric structure of the scaffold via a cleavable linker according to the invention.
[0342] An embodiment is the therapeutic combination of the invention or the therapeutic combination for use of the invention or the first pharmaceutical composition of the invention or the first pharmaceutical composition for use according to the invention, wherein the at least one saponin is covalently bound to the polymeric or oligomeric structure of the scaffold via any one or more of an imine bond, a hydrazone bond, a hydrazide bond, an oxime bond, a 1,3-dioxolane bond, a disulphide bond, a thio-ether bond, an amide bond, a peptide bond or an ester bond, preferably via at least one linker.
[0343] An embodiment is the therapeutic combination of the invention or the therapeutic combination for use of the invention or the first pharmaceutical composition of the invention or the first pharmaceutical composition for use according to the invention, wherein the at least one saponin comprises an aldehyde function in position C-23 and optionally a glucuronic acid function in the carbohydrate substituent at the C-3beta-OH group of the at least one saponin, which aldehyde function is involved in the covalent bonding to the polymeric or oligomeric structure of the scaffold, and/or, if present, the glucuronic acid function is involved in the covalent bonding to the polymeric or oligomeric structure of the scaffold, either via direct binding or via at least one linker.
[0344] An embodiment is the therapeutic combination of the invention or the therapeutic combination for use of the invention or the first pharmaceutical composition of the invention or the first pharmaceutical composition for use according to the invention, wherein the aldehyde function in position C-23 of the at least one saponin is covalently coupled to linker N--maleimidocaproic acid hydrazide, which linker is covalently coupled via a thio-ether bond to a sulfhydryl group in the polymeric or oligomeric structure of the scaffold, such as a sulfhydryl group of a cysteine.
[0345] An embodiment is the therapeutic combination of the invention or the therapeutic combination for use of the invention or the first pharmaceutical composition of the invention or the first pharmaceutical composition for use according to the invention, wherein the glucuronic acid function in the carbohydrate substituent at the C-3beta-OH group of the at least one saponin is covalently coupled to linker 1-[Bis(dimethylamino)methylene]-1H-1,2,3-triazolo[4,5-b]pyridinium 3-oxid hexafluorophosphate, which linker is covalently coupled via an amide bond to an amine group in the polymeric or oligomeric structure of the scaffold, such as an amine group of a lysine or an N-terminus of a proteinaceous molecule.
[0346] An embodiment is the therapeutic combination of the invention or the therapeutic combination for use of the invention or the first pharmaceutical composition of the invention or the first pharmaceutical composition for use according to the invention, wherein the chemical group of the polymeric or oligomeric scaffold, for covalently coupling of the scaffold to the amino-acid residue of the first proteinaceous molecule, is a click chemistry group, preferably selected from a tetrazine, an azide, an alkene or an alkyne, or a cyclic derivative of these groups, more preferably the click chemistry group is an azide.
[0347] An embodiment is the therapeutic combination of the invention or the therapeutic combination for use of the invention or the first pharmaceutical composition of the invention or the first pharmaceutical composition for use according to the invention, wherein the polymeric or oligomeric structure of the scaffold comprises a linear, branched and/or cyclic polymer, oligomer, dendrimer, dendron, dendronized polymer, dendronized oligomer, a DNA, a polypeptide, poly-lysine, a poly-ethylene glycol, or an assembly of these polymeric or oligomeric structures which assembly is preferably built up by covalent cross-linking.
[0348] The inventors established that covalent coupling, preferably via cleavable bonds or linkers, of the saponin to the first proteinaceous molecule, according to any of the embodiments here above, provides efficient and cell-targeted potentiation of the activity of an effector moiety bound to the second proteinaceous molecule, wherein the first proteinaceous molecules comprise the first binding site and wherein the second proteinaceous molecules comprise a second binding site which first and second binding sites are different. Coupling saponin to a cysteine side chain or a lysine side chain of the first proteinaceous molecule such as a monoclonal antibody, directly or via a linker, proved to be a beneficial way of specific and efficient delivery of effector-moiety potentiating activity inside the target cell, when also the effector moiety is delivered in the same target cell by using the second proteinaceous molecule comprising a different second binding site than the first binding site.
[0349] To explain the invention in more detail, the process of cellular uptake of substances (although the inventors do not wish to be bound by any theory) and the used terminology in this invention is described. The uptake of extracellular substances into a cell by vesicle budding is called endocytosis. Said vesicle budding can be characterized by (1) receptor-dependent ligand uptake mediated by the cytosolic protein clathrin, (2) lipid-raft uptake mediated by the cholesterol-binding protein caveolin, (3) unspecific fluid uptake (pinocytosis), or (4) unspecific particle uptake (phagocytosis). All types of endocytosis run into the following cellular processes of vesicle transport and substance sorting called the endocytic pathways. The endocytic pathways are complex and not fully understood. Without wishing to be bound by any theory, organelles may be formed de novo and mature into the next organelle along the endocytic pathway. It is however, now hypothesized that the endocytic pathways involve stable compartments that are connected by vesicular traffic. A compartment is a complex, multifunctional membrane organelle that is specialized for a particular set of essential functions for the cell. Vesicles are considered to be transient organelles, simpler in composition, and are defined as membrane-enclosed containers that form de novo by budding from a preexisting compartment. In contrast to compartments, vesicles can undergo maturation, which is a physiologically irreversible series of biochemical changes. Early endosomes and late endosomes represent stable compartments in the endocytic pathway while primary endocytic vesicles, phagosomes, multivesicular bodies (also called endosome carrier vesicles), secretory granules, and even lysosomes represent vesicles. The endocytic vesicle, which arises at the plasma membrane, most prominently from clathrin-coated pits, first fuses with the early endosome, which is a major sorting compartment of approximately pH 6.5. A large part of the cargo and membranes internalized are recycled back to the plasma membrane through recycling vesicles (recycling pathway). Components that should be degraded are transported to the acidic late endosome (pH lower than 6) via multivesicular bodies. Lysosomes are vesicles that can store mature lysosomal enzymes and deliver them to a late endosomal compartment when needed. The resulting organelle is called the hybrid organelle or endolysosome. Lysosomes bud off the hybrid organelle in a process referred to as lysosome reformation. Late endosomes, lysosomes, and hybrid organelles are extremely dynamic organelles, and distinction between them is often difficult. Degradation of an endocytosed molecule occurs inside an endolysosome or lysosome. Endosomal escape is the active or passive release of a substance from the inner lumen of any kind of compartment or vesicle from the endocytic pathway, preferably from clathrin-mediated endocytosis, or recycling pathway into the cytosol. Endosomal escape thus includes but is not limited to release from endosomes, endolysosomes or lysosomes, including their intermediate and hybrid organelles.
[0350] Unless specifically indicated otherwise and in particular when relating to the endosomal escape mechanism of the glycoside molecule such as the saponin of the invention, whenever the word endosome or endosomal escape is used herein, it also includes the endolysosome and lysosome, and escape from the endolysosome and lysosome, respectively. After entering the cytosol, said substance might move to other cell units such as the nucleus.
[0351] In formal terms, a glycoside is any molecule in which a sugar group is bound through its anomeric carbon to another group via a glycosidic bond. Glycoside molecules, such as saponins, in the context of the invention are such molecules that are further able to enhance the effect of an effector moiety, without wishing to be bound by any theory, in particular by facilitating the endosomal escape of the effector moiety. Without wishing to be bound by any theory, the glycoside molecules (saponins, such as those listed in Table A1) interact with the membranes of compartments and vesicles of the endocytic and recycling pathway and make them leaky for said effector moieties resulting in augmented endosomal escape. With the term the scaffold is able to augment endosomal escape of the effector moiety is meant that the at least one saponin (glycoside molecule), which is coupled to the polymeric or oligomeric structure of the scaffold, is able to enhance endosomal escape of an effector moiety when both molecules are within an endosome, e.g. a late endosome, optionally and preferably after the at least one glycoside such as a saponin is released from the first proteinaceous molecule such as from a linker or polymeric or oligomeric structure comprised by said first proteinaceous molecule, e.g., by cleavage of a cleavable bond between the at least one glycoside (saponin) and the the first proteinaceous molecule (for example via a polymeric or oligomeric structure of a scaffold and/or via a linker). Even though a bond between the at least one glycoside such as a saponin according to the invention and the first proteinaceous molecule, optionally via a linker or a scaffold, may be a stable bond, that does not mean that such bond cannot be cleaved in the endosomes by, e.g., enzymes. For instance, the glycoside or saponin, optionally together with a linker or a part of the oligomeric or polymeric structure of a scaffold, may be cleaved off from the remaining linker fragment or oligomeric or polymeric structure. It could, for instance be that a protease cuts a (proteinaceous) linker or proteinaceous polymeric structure, e.g., albumin, thereby releasing the at least one glycoside, saponin. It is, however, preferred that the glycoside molecule (preferably saponin) is released in an active form, preferably in the original form that it had before it was (prepared to be) coupled to the first proteinaceous molecule optionally via a linker and/or an oligomeric or polymeric scaffold; thus the glycoside (saponin) has its natural structure after such cleavage or the glycoside (saponin) has (part of) a chemical group or linker bound thereto, after such cleavage, while glycoside biological activity (saponin biological activity), e.g. endosomal/lysosomal escape enhancing activity towards an effector moiety present in the same endosome or lysosome, is maintained or restored upon said cleavage of the bond between the glycoside (saponin) and the carrier molecule, i.e. the first proteinaceous molecule optionally comprising a linker and/or a scaffold of the invention. With regard to the present invention the term stable with respect to bonds between e.g. saponins and amino-acid residues of the first proteinaceous molecule, a linker, a polymeric or oligomeric structures (of the scaffold), ligands, (monoclonal) immunoglobulins or binding domains or-fragments thereof, and/or effectors (effector moieties, effector molecules), is meant that the bond is not readily broken or at least not designed to be readily broken by, e.g., pH differences, salt concentrations, or UV-light, reductive conditions. With regard to the present invention the term cleavable with respect to bonds between e.g. saponins and the first proteinaceous molecule, linkers, amino-acid residues, polymeric or oligomeric structures of the scaffold, ligands, antibodies and/or effectors, is meant that the bond is designed to be readily broken by, e.g., pH differences, salt concentrations, under reductive conditions, and the like. The skilled person is well aware of such cleavable bonds and how to prepare them.
[0352] An effector molecule, or effector moiety, in the context of this invention is any substance that affects the metabolism of a cell by interaction with an intracellular effector molecule target, wherein this effector molecule target is any molecule or structure inside cells excluding the lumen of compartments and vesicles of the endocytic and recycling pathway but including the membranes of these compartments and vesicles. Said structures inside cells thus include the nucleus, mitochondria, chloroplasts, endoplasmic reticulum, Golgi apparatus, other transport vesicles, the inner part of the plasma membrane and the cytosol. Cytosolic delivery of an effector moiety in the context of the invention preferably means that the effector moiety is able to escape the endosome (and/or lysosome), which, as defined previously, also includes escaping the endolysosome and the lysosome, and is preferably able to reach the effector moiety target as described herein. The invention also encompasses a new type of molecule, referred to as scaffold that serves to bring both an effector moiety and at least one glycoside molecule such as a saponin of the invention in an endosome at the same time in a pre-defined ratio, when the effector moiety is comprised by the second proteinaceous molecule of the invention and the saponin is comprised by the first proteinaceous molecule. Within the context of the present invention, the polymeric or oligomeric structure of the scaffold is a structurally ordered formation such as a polymer, oligomer, dendrimer, dendronized polymer, or dendronized oligomer or it is an assembled polymeric structure such as a hydrogel, microgel, nanogel, stabilized polymeric micelle or liposome, but excludes structures that are composed of non-covalent assemblies of monomers such as cholesterol/phospholipid mixtures. The terms polymer, oligomer, dendrimer, dendronized polymer, or dendronized oligomer have their ordinary meaning. In particular a polymer is a substance which has a molecular structure built up chiefly or completely from a large number of equal or similar units bonded together and an oligomer is a polymer whose molecules consist of relatively few repeating units. There is no consensus about one specific cut-off for many and a few as used in the above definition of polymer and oligomer, respectively. However, as the scaffold may comprise a polymeric or an oligomeric structure, or both, the full range of numbers of similar units bonded together applies to such structure. i.e. from 2 monomeric units to 100 monomeric units, 1000 monomeric units, and more. A structure comprising 5 or less, for instance may be called an oligomeric structure, whereas a structure comprising 50 monomeric units may be called a polymeric structure. A structure of 10 monomeric units may be called either oligomeric or polymeric. A scaffold as defined herein, further comprises at least one glycoside molecule such as a saponin of the invention. A scaffold preferably includes a polymeric or oligomeric structure such as poly- or oligo (amines), e.g., polyethylenimine and poly (amidoamine), and biocompatible structures such as polyethylene glycol, poly- or oligo (esters), such as poly(lactids), poly (lactams), polylactide-co-glycolide copolymers, and poly (dextrin), poly- or oligosaccharides, such as cyclodextrin or polydextrose, and poly- or oligoamino acids, such as poly-lysine or a peptide or a protein, or DNA oligo- or polymers. An assembled polymeric structure as defined herein comprises at least one scaffold and, optionally, other individual polymeric or oligomeric structures. Other individual polymeric or oligomeric structures of said assembly may be (a) scaffolds (thus comprising at least one glycoside molecule such as a saponin of the invention), (b) functionalized scaffolds (thus comprising at least one glycoside molecule such as a saponin, and a ligand, antibody, etc. as the first proteinaceous molecule, (c) polymeric or oligomeric structures without a glycoside molecule such as a saponin of the invention (See Table A1 for example), without a ligand, antibody, etc., as the first proteinaceous molecule. A functionalized assembled polymeric structure is an assembled polymeric structure that contains (a) at least one functionalized scaffold or (b) at least one scaffold and at least one polymeric structure comprising at least one ligand, antibody, etc. as the first proteinaceous molecule. Polymeric or oligomeric structures within an assembled polymeric structure that do not comprise any of the above mentioned molecules (i.e. no glycosides such as saponins, no first proteinaceous molecule such as ligands, antibodies) are in particular added as structural components of the assembled structures, which help to build up or to stabilize the assembled structure (glue-like). Without wishing to be bound by any theory, the acidic environment seems to be a prerequisite for the synergistic action between glycoside (saponin) and effector moiety.
[0353] Whether or not a first proteinaceous molecule comprising saponins, either or not further comprising one or more (cleavable) linkers and/or optionally a scaffold, is able to disturb the acidic environment and inhibit the endosomal escape function of the at least one glycoside (saponin) can be easily determined with an assay as described in Example 3 and as known in the art. The inhibition is described as fold amount increases of glycoside necessary to induced 50% cell killing. It is preferred that the scaffold does not lead to an increase that is at least the increase in glycoside molecules (saponins) necessary to obtain 50% cell killing observed when using Chloroquine as a positive control. Alternatively, and preferably, the first proteinaceous molecule comprising saponins, either or not further comprising one or more (cleavable) linkers and/or optionally a scaffold does not lead to an at least 4-fold increase of glycoside molecules to induce 50% cell killing, more preferably does not lead to an at least 2-fold increase. The fold increase is to be measured in assay, essentially as described in Example 4, wherein Chloroquine, as a positive control, induces a 2-fold increase in glycoside amount, preferably saponin amount wherein the saponin is any one or more of the saponins of the invention (see Table A1, Scheme I, previous embodiments) to observe 50% cell killing.
[0354] With the term improving or enhancing an effect of an effector moiety is meant that the glycoside molecule, preferably a saponin of the invention, increases the functional efficacy of that effector moiety (e.g. the therapeutic index of a toxin or a drug or an oligonucleotide such as a BNA; the metabolic efficacy of a modifier in biotechnological processes; the transfection efficacy of genes in cell culture research experiments), preferably by enabling or improving its target engagement. Acceleration, prolongation, or enhancement of antigen-specific immune responses are preferably not included.
[0355] Therapeutic efficacy includes but is not limited to a stronger therapeutic effect, preferably with lower dosing and/or with less side effects. Improving an effect of an effector moiety can also mean that an effector moiety, which could not be used because of lack of effect (and was e.g. not known as being an effector moiety), becomes effective when used in combination with the present invention. Any other effect, which is beneficial or desired and can be attributed to the combination of effector moiety and the second proteinaceous molecule, as provided by the invention is considered to be an improved effect. In an embodiment, the scaffold comprising bound saponin(s) and comprised by the first proteinaceous molecule enhances an effect of the effector moiety comprised by the second proteinaceous molecule which effect is intended and/or desired. In case of a first proteinaceous molecule comprising saponin bound to a proteinaceous scaffold, the proteinaceous polymeric structure of the scaffold as such may have, for instance, an effect on colloid osmotic pressure in the blood stream. If such effect is not the intended or desired effect of such a functionalized scaffold comprised by the first proteinaceous molecule, the proteinaceous structure of the scaffold is not an effector moiety as defined in the invention. Or, for instance in case of a DNA- or RNA-based scaffold carrying bound saponins and comprised by the first proteinaceous molecule, parts of that DNA or RNA may have an (unintended) function, e.g., by interfering with expression. If such interference is not the intended or desired effect of the ultimate functionalized scaffold, the DNA- or RNA polymeric structure of the scaffold is not the effector moiety as defined in the invention.
[0356] A number of preferred features can be formulated for endosomal escape enhancers comprised by the first proteinaceous molecule, i.e. a glycoside or saponin, preferably a saponin according to the invention: (1) they are preferably not toxic and do not invoke an immune response, (2) they preferably do not mediate the cytosolic uptake of the effector moiety into off-target cells, (3) their presence at the site of action is preferably synchronized with the presence of the effector moiety, (4) they are preferably biodegradable or excretable, and (5) they preferably do not substantially interfere with biological processes of the organism unrelated to the biological activity of the effector molecule with which the endosomal escape enhancer is combined with, e.g. interact with hormones. Examples of glycoside molecules such as saponins of the invention that fulfill the before mentioned criteria, at least to some extent, are bisdesmosidic triterpenes, preferably bisdesmosidic triterpene saponins, such as SO1861, SA1641, QS-21, GE1741, and the saponins in Table A1, Scheme I.
[0357] An aspect of the invention relates to the therapeutic combination of the invention or the therapeutic combination for use according to the invention, wherein the first pharmaceutical composition and the second pharmaceutical composition are administered to the patient in need thereof.
[0358] An aspect of the invention relates to the first pharmaceutical composition of the invention, further comprising the second proteinaceous molecule of the invention.
[0359] An aspect of the invention relates to the first pharmaceutical composition of the invention, further comprising the second proteinaceous molecule of the invention, for use as a medicament.
[0360] An aspect of the invention relates to the first pharmaceutical composition of the invention, further comprising the second proteinaceous molecule of the invention, for use in the treatment or prophylaxis of cancer in a patient in need thereof.
[0361] Before the present invention one of the major hurdles of introducing e.g. ADCs and AOCs on the market was the small therapeutic window: a therapeutically effective dose of an ADC or an AOC is accompanied with (unacceptable) side effects, hampering development and implication in treatment of patients with the ADCs. By the application of the first proteinaceous molecule of the invention it has now become possible to guide one or multiple glycoside molecules (saponin) to a (target) cell, together with the ADC carrying a payload or together with a (monoclonal) antibody conjugated with an oligonucleotide such as a BNA according to the invention (i.e. a particular second proteinaceous molecules of the invention). In particular, it was previously not possible to specifically guide an effector moiety of a second proteinaceous molecule and a (predefined, controllable) particular number or range of glycoside molecules (saponins) per effector moiety at the same time to the cytosol of cells, such as via the endocytic pathway of a cell.
[0362] A solution provided for by the invention comprises the covalent binding of at least one saponin to the first proteinaceous molecule. A further solution provided for by the invention comprises (first) polymerizing the glycoside molecules (saponins) using an oligomeric or polymeric scaffold, and providing the first proteinaceous molecule with a cluster of covalently bound saponins, enabling re-monomerization of the one or more saponins at the intracellular site where the mode of action of the saponin is desired, e.g. after endocytosis. Polymerizes in this context means the reversible and/or irreversible multiple conjugation of saponin molecules to the first proteinaceous molecule, either via linker, or directly or via a polymeric or oligomeric structure to form a scaffold or the reversible and/or irreversible multiple conjugation of (modified) saponins thereby forming a polymeric or oligomeric structure to form a scaffold. Re-monomerization in this context means the cleavage of the saponins from the first proteinaceous molecule, from the linker linking the saponin(s) to the first proteinaceous molecule or from the scaffold, for example after endocytosis, and regaining the (native) chemical state of the unbound saponins, which unbound saponins may or may not comprise additional chemical groups such as a chemical group for linking the saponin to a linker, an amino-acid residue of the first proteinaceous molecule or to the scaffold, and/or a (chemical) linker bound to a chemical group of the saponin such as an aldehyde group or carboxylic acid group. Due to the complex chemistry of the saponins for example the polymerization of saponins at a scaffold or other linking linker and their re-monomerization at a desired location such as intracellularly e.g. after endocytosis, was a challenging task. In particular, the chemical reactions used for providing the linkers and the scaffold comprising covalently linked glycosides for covalent binding to the first proteinaceous molecule, e.g. triterpenoid saponins (polymerization of the glycosides), normally occur in water-free organic solvents, but saponins and for example biocompatible polymers applied as a scaffold for bearing bound saponins, are water-soluble molecules. The chemical properties of the unmodified saponin further prohibited polymerization by itself and, one other possible solution, to bind multiple saponins (directly) to the effector molecule was estimated not to be very promising, as an effector molecule (drug, toxin, polypeptide or polynucleotide) does typically not provide sufficient binding sites and because the coupling product would become quite heterogeneous and/or coupling biologically active molecules such as a saponin and e.g. a peptide, a toxin, a nucleic acid together bears the risk for influencing and hampering the activity of one or even both molecules bound together in such saponin-comprising conjugate. Further, there was a considerable risk that the effector moiety comprised by the second proteinaceous molecule loses its function after coupling of a saponin to the e.g. ADC or antibodyoligonucleotide conjugate (AOC). Embodiments of the present invention solves at least one of these drawbacks.
[0363] As said before, the at least one saponin that is comprised by the first proteinaceous molecule according to the invention increases the efficacy of at least current and new effector moieties as defined in this invention. Potential side-effects will be decreased due to lowering of dosing of the effector moiety comprised by the second proteinaceous molecule, without lowering the efficacy. Therefore, the invention provides a first proteinaceous molecule according to the invention for use in medicine or for use as a medicament. Thus, an aspect of the invention relates to a first proteinaceous molecule according to the invention, the first proteinaceous molecule comprising at least a saponin, for use as a medicament. Also provided is the use of a first proteinaceous molecule according to the invention for manufacturing a medicament. Especially cancer medicines, and in particular the classical chemotherapy medicaments, are notorious for their side effects. Because of targeting and synchronization in time and place of both the pharmaceutically active substance comprised by the second proteinaceous molecule and the saponin comprised by the first proteinaceous molecule, since the first and second proteinaceous molecule bear different binding sites for different first and second epitopes on the first and second cell-surface molecules respectively, a therapeutic combination according to the invention is especially valuable for use as a medicament, in particular for use in a method of treating cancer. The invention thus provides a therapeutic combination according to the invention or a first proteinaceous molecule of the invention for use in a method of treating cancer. The invention also provides a therapeutic combination according to the invention or a first proteinaceous molecule of the invention for use in a method of treating acquired or hereditary disorders, in particular monogenic deficiency disorders. The therapeutic combination thus comprises the first and second proteinaceous molecule. Thus, an aspect of the invention relates to a therapeutic combination according to the invention, wherein the second proteinaceous molecule comprises a covalently bound effector moiety, for use in a method for the treatment of a cancer or an auto-immune disease.
[0364] A further application of the first and second proteinaceous molecules of the invention in medicine is the substitution of intracellular enzymes in target cells that produce these enzymes in insufficient amount or insufficient functionality. The resulting disease might be hereditary or acquired. In most cases, only symptomatic treatment is possible and for a number of rare diseases, insufficient treatment options lead to a shortened life span of concerned patients. An example for such a disease is phenylketonuria, which is an inborn error of metabolism that results in decreased metabolism of the amino acid phenylalanine. The disease is characterized by mutations in the gene for the hepatic enzyme phenylalanine hydroxylase. Phenylketonuria is not curable to date. The incidence is approximately 1:10,000 with the highest known incidence in Turkey with 1:2,600. A second proteinaceous molecule, preferably an antibody, with bound phenylalanine hydroxylase or with a bound polynucleotide that encodes phenylalanine hydroxylase can be used to target liver cells by use of a suitable specific antibody for binding to the second epitope, and to substitute the defect enzyme in hepatocytes. This is one example of use of the therapeutic combination of the invention comprising a first proteinaceous molecule with a saponin bound thereto and a second proteinaceous molecule with the enzyme or the oligonucleotide bound thereto according to the invention for substitution or gene therapy. In a preferred embodiment, a therapeutic combination according to the invention for use in a method of gene therapy or substitution therapy is provided.
[0365] The present invention also provides a method of treating cancer, the method comprising administering a medicament comprising a therapeutic combination according to the invention to a patient in need thereof, preferably administering an effective dose of said medicament to a patient in need thereof, preferably a human cancer patient.
[0366] Considerations concerning forms suitable for administration are known in the art and include toxic effects, solubility, route of administration, and maintaining activity. For example, pharmacological compositions injected into the bloodstream should be soluble.
[0367] Suitable dosage forms, in part depend upon the use or the route of entry, for example transdermal or by injection. Such dosage forms should allow the compound to reach a target cell whether the target cell is present in a multicellular host. Other factors are known in the art, and include considerations such as toxicity and dosage form which retard the compound or composition from exerting its effect.
[0368] An embodiment is the combination of an endosomal escape enhancing conjugate according to the invention, comprising the first proteinaceous molecule comprising at least one covalently bound saponin, and a binding moiety, wherein the binding moiety comprises at least one effector moiety, the binding moiety being the second proteinaceous molecule comprising the bound effector moiety, wherein the endosomal escape enhancing conjugate and the binding moiety are, independently from one another, able to specifically bind to a target cell-specific surface molecule or structure, thereby inducing receptor-mediated endocytosis of a complex of the endosomal escape enhancing conjugate and the target cell-specific first surface molecule, and of the complex of the binding moiety and the target cell-specific second surface molecule, wherein the endosomal escape enhancing conjugate and the binding moiety can bind to a first and a second target cell-specific surface molecule which are different, via their first and second binding site respectively, thus wherein the endosomal escape enhancing conjugate and the binding moiety can bind to the different first and second target cell-specific surface molecules via their different binding sites. An embodiment is the combination according to the invention, wherein the endosomal escape enhancing conjugate is able to compete with the binding moiety for binding to the target cell-specific surface molecule or structure. An embodiment is the combination according to the invention, wherein the endosomal escape enhancing conjugate and the binding moiety are, independently from one another, able to specifically bind to the different first and second epitope, thus to two different epitopes. An embodiment is the combination for use in a method for the treatment of an aberrancy such as a cancer according to the invention, wherein said endosomal escape enhancing conjugate and said binding moiety are to be administered concomitant or sequentially, preferably concomitant.
[0369] An aspect of the invention relates to a kit comprising a first container containing an endosomal escape enhancing conjugate according to the invention (i.e. the first proteinaceous molecule) and a second container containing a binding moiety according to the invention (i.e. the second proteinaceous molecule), the kit further comprising instructions for using the binding molecules (i.e. the therapeutic combination comprising the first and second pharmaceutical compositions).
TABLE-US-00001 TABLE A1 Saponins displaying (late) endosomal/lysosomal escape enhancing activity, and saponins comprising a structure reminiscent to such saponins displaying (late) endosomal/lysosomal escape enhancing activity Carbohydrate substituent Carbohydrate substituent Saponin Name Aglycon core at the C-3beta-OH group at the C-28-OH group NP-005236 2alpha- GlcA- Glc/Gal- Hydroxyoleanolic acid AMA-1 16alpha- Glc- Rha-(1.fwdarw.2)-[Xyl-(1.fwdarw.4)]-Rha- Hydroxyoleanolic acid AMR 16alpha- Glc- Rha-(1.fwdarw.2)-[Ara-(1.fwdarw.3)-Xyl-(1.fwdarw.4)]-Rha- Hydroxyoleanolic acid alpha-Hederin Hederagenin (23- Rha-(1.fwdarw.2)-Ara- Hydroxyoleanolic acid) NP-012672 16alpha,23- Ara/Xyl-(1.fwdarw.4)-Rha/Fuc- Ara/Xyl- Dihydroxyoleanolic (1.fwdarw.2)-Glc/Gal-(1.fwdarw.2)- acid Rha/Fuc-(1.fwdarw.2)-GlcA- NP-017777 Gypsogenin Gal-(1.fwdarw.2)-[Xyl-(1.fwdarw.3)]-GlcA- Xyl-(1.fwdarw.4)-Rha-(1.fwdarw.2)-[R-(.fwdarw.4)]-Fuc- (R = 4E- Methoxycinnamic acid) NP-017778 Gypsogenin Gal-(1.fwdarw.2)-[Xyl-(1.fwdarw.3)]-GlcA- Xyl-(1.fwdarw.4)-Rha-(1.fwdarw.2)-[R-(.fwdarw.4)]-Fuc- (R = 4Z- Methoxycinnamic acid) NP-017774 Gypsogenin Gal-(1.fwdarw.2)-[Xyl-(1.fwdarw.3)]-GlcA- Xyl-(1.fwdarw.4)-[Gal-(1.fwdarw.3)]-Rha-(1.fwdarw.2)-4-OAc-Fuc- NP-018110.sup.c, Gypsogenin Gal-(1.fwdarw.2)-[Xyl-(1.fwdarw.3)]-GlcA- Xyl-(1.fwdarw.4)-[Glc-(1.fwdarw.3)]-Rha-(1.fwdarw.2)-3,4-di-OAc-Fuc- NP-017772.sup.d NP-018109 Gypsogenin Gal-(1.fwdarw.2)-[Xyl-(1.fwdarw.3)]-GlcA- Xyl-(1.fwdarw.4)-[Glc-(1.fwdarw.3)]-Rha-(1.fwdarw.2)-[R-(.fwdarw.4)]- 3-OAc-Fuc- (R = 4E-Methoxycinnamic acid) NP-017888 Gypsogenin Gal-(1.fwdarw.2)-[Xyl-(1.fwdarw.3)]-GlcA- Glc-(1.fwdarw.3)-Xyl-(1.fwdarw.4)-[Glc-(1.fwdarw.3)]-Rha- (1.fwdarw.2)-4-OAc-Fuc- NP-017889 Gypsogenin Gal-(1.fwdarw.2)-[Xyl-(1.fwdarw.3)]-GlcA- Glc-(1.fwdarw.3)-Xyl-(1.fwdarw.4)-Rha-(1.fwdarw.2)-4-OAc-Fuc- NP-018108 Gypsogenin Gal-(1.fwdarw.2)-[Xyl-(1.fwdarw.3)]-GlcA- Ara/Xyl-(1.fwdarw.3)-Ara/Xyl-(1.fwdarw.4)-Rha/Fuc- (1.fwdarw.2)-[4-OAc-Rha/Fuc-(1.fwdarw.4)]-Rha/Fuc- SA1641.sup.a, Gypsogenin Gal-(1.fwdarw.2)-[Xyl-(1.fwdarw.3)]-GlcA- Xyl-(1.fwdarw.3)-Xyl-(1.fwdarw.4)-Rha-(1.fwdarw.2)-[Qui- AE X55.sup.b (1.fwdarw.4)]-Fuc- NP-017674 Quillaic acid Gal-(1.fwdarw.2)-[Xyl-(1.fwdarw.3)]-GlcA- Api-(1.fwdarw.3)-Xyl-(1.fwdarw.4)-[Glc-(1.fwdarw.3)]-Rha- (1.fwdarw.2)-Fuc- NP-017810 Quillaic acid Gal-(1.fwdarw.2)-[Xyl-(1.fwdarw.3)]-GlcA- Xyl-(1.fwdarw.4)-[Gal-(1.fwdarw.3)]-Rha-(1.fwdarw.2)-Fuc- AG1 Quillaic acid Gal-(1.fwdarw.2)-[Xyl-(1.fwdarw.3)]-GlcA- Xyl-(1.fwdarw.4)-[Glc-(1.fwdarw.3)]-Rha-(1.fwdarw.2)-Fuc- NP-003881 Quillaic acid Gal-(1.fwdarw.2)-[Xyl-(1.fwdarw.3)]-GlcA- Ara/Xyl-(1.fwdarw.4)-Rha/Fuc-(1.fwdarw.4)-[Glc/Gal- (1.fwdarw.2)]-Fuc- NP-017676 Quillaic acid Gal-(1.fwdarw.2)-[Xyl-(1.fwdarw.3)]-GlcA- Api-(1.fwdarw.3)-Xyl-(1.fwdarw.4)-[Glc-(1.fwdarw.3)]-Rha- (1.fwdarw.2)-[R-(.fwdarw.4)]-Fuc- (R = 5-O-[5-O-Ara/Api-3,5-dihydroxy-6- methyl-octanoyl]-3,5-dihydroxy-6-methyl- octanoic acid) NP-017677 Quillaic acid Gal-(1.fwdarw.2)-[Xyl-(1.fwdarw.3)]-GlcA- Api-(1.fwdarw.3)-Xyl-(1.fwdarw.4)-Rha-(1.fwdarw.2)-[R-(.fwdarw.4)]- Fuc- (R = 5-O-[5-O-Ara/Api-3,5-dihydroxy-6- methyl-octanoyl]-3,5-dihydroxy-6-methyl- octanoic acid) NP-017706 Quillaic acid Gal-(1.fwdarw.2)-[Xyl-(1.fwdarw.3)]-GlcA- Api-(1.fwdarw.3)-Xyl-(1.fwdarw.4)-Rha-(1.fwdarw.2)-[Rha- (1.fwdarw.3)]-4-OAc-Fuc- NP-017705 Quillaic acid Gal-(1.fwdarw.2)-[Xyl-(1.fwdarw.3)]-GlcA- Api-(1.fwdarw.3)-Xyl-(1.fwdarw.4)-[Glc-(1.fwdarw.3)]-Rha- (1.fwdarw.2)-[Rha-(1.fwdarw.3)]-4-OAc-Fuc- NP-017773 Quillaic acid Gal-(1.fwdarw.2)-[Xyl-(1.fwdarw.3)]-GlcA- 6-OAc-Glc-(1.fwdarw.3)-Xyl-(1.fwdarw.4)-Rha-(1.fwdarw.2)-[3- OAc-Rha-(1.fwdarw.3)]-Fuc- NP-017775 Quillaic acid Gal-(1.fwdarw.2)-[Xyl-(1.fwdarw.3)]-GlcA- Glc-(1.fwdarw.3)-Xyl-(1.fwdarw.4)-Rha-(1.fwdarw.2)-[3-OAc-- Rha-(1.fwdarw.3)]-Fuc- SA1657 Quillaic acid Gal-(1.fwdarw.2)-[Xyl-(1.fwdarw.3)]-GlcA- Xyl-(1.fwdarw.3)-Xyl-(1.fwdarw.4)-Rha-(1.fwdarw.2)-[Qui- (1.fwdarw.4)]-Fuc- AG2 Quillaic acid Gal-(1.fwdarw.2)-[Xyl-(1.fwdarw.3)]-GlcA- Glc-(1.fwdarw.3)-[Xyl-(1.fwdarw.4)]-Rha-(1.fwdarw.2)-[Qui- (1.fwdarw.4)]-Fuc- SO1861 Quillaic acid Gal-(1.fwdarw.2)-[Xyl-(1.fwdarw.3)]-GlcA- Glc-(1.fwdarw.3)-Xyl-(1.fwdarw.4)-Rha-(1.fwdarw.2)-[Xyl-(1.fwdarw.3)- 4-OAc-Qui-(1.fwdarw.4)]-Fuc- GE1741 Quillaic acid Gal-(1.fwdarw.2)-[Xyl-(1.fwdarw.3)]-GlcA- Xyl-(1.fwdarw.3)-Xyl-(1.fwdarw.4)-Rha-(1.fwdarw.2)-[3,4-di-OAc- Qui-(1.fwdarw.4)]-Fuc- SO1542 Quillaic acid Gal-(1.fwdarw.2)-[Xyl-(1.fwdarw.3)]-GlcA- Glc-(1.fwdarw.3)-[Xyl-(1.fwdarw.4)]-Rha-(1.fwdarw.2)-Fuc- SO1584 Quillaic acid Gal-(1.fwdarw.2)-[Xyl-(1.fwdarw.3)]-GlcA- 6-OAc-Glc-(1.fwdarw.3)-[Xyl-(1.fwdarw.4)]-Rha-(1.fwdarw.2)- Fuc- SO1658 Gypsogenin Gal-(1.fwdarw.2)-[Xyl-(1.fwdarw.3)]-GlcA- Glc-(1.fwdarw.3)-[Xyl-(1.fwdarw.3)-Xyl-(1.fwdarw.4)]-Rha- (1.fwdarw.2)-Fuc- SO1674 Quillaic acid Gal-(1.fwdarw.2)-[Xyl-(1.fwdarw.3)]-GlcA- Glc-(1.fwdarw.3)-[Xyl-(1.fwdarw.3)-Xyl-(1.fwdarw.4)]-Rha- (1.fwdarw.2)-Fuc- SO1832 Quillaic acid Gal-(1.fwdarw.2)-[Xyl-(1.fwdarw.3)]-GlcA- Xyl-(1.fwdarw.3)-Xyl-(1.fwdarw.4)-Rha-(1.fwdarw.2)-[Xyl-(1.fwdarw.3)- 4-OAc-Qui-(1.fwdarw.4)]-Fuc- QS-7 (also Quillaic acid Gal-(1.fwdarw.2)-[Xyl-(1.fwdarw.3)]-GlcA- Api/Xyl-(1.fwdarw.3)-Xyl-(1.fwdarw.4)-[Glc-(1.fwdarw.3)]-Rha- referred to as (1.fwdarw.2)-[Rha-(1.fwdarw.3)]-4OAc-Fuc- QS1861) QS-7 api (also Quillaic acid Gal-(1.fwdarw.2)-[Xyl-(1.fwdarw.3)]-GlcA- Api-(1.fwdarw.3)-Xyl-(1.fwdarw.4)-[Glc-(1.fwdarw.3)]-Rha- referred to as (1.fwdarw.2)-[Rha-(1.fwdarw.3)]-4OAc-Fuc- QS1862) QS-17 Quillaic acid Gal-(1.fwdarw.2)-[Xyl-(1.fwdarw.3)]-GlcA- Api/Xyl-(1.fwdarw.3)-Xyl-(1.fwdarw.4)-[Glc-(1.fwdarw.3)]-Rha- (1.fwdarw.2)-[R-(.fwdarw.4)]-Fuc- (R = 5-O-[5-O-Rha-(1.fwdarw.2)-Ara/Api-3,5- dihydroxy-6-methyl-octanoyl]-3,5-dihydroxy- 6-methyl-octanoic acid) QS-18 Quillaic acid Gal-(1.fwdarw.2)-[Xyl-(1.fwdarw.3)]-GlcA- Api/Xyl-(1.fwdarw.3)-Xyl-(1.fwdarw.4)-[Glc-(1.fwdarw.3)]-Rha- (1.fwdarw.2)-[R-(.fwdarw.4)]-Fuc- (R = 5-O-[5-O-Ara/Api-3,5-dihydroxy-6- methyl-octanoyl]-3,5-dihydroxy- 6-methyl-octanoic acid) QS-21 A-apio Quillaic acid Gal-(1.fwdarw.2)-[Xyl-(1.fwdarw.3)]-GlcA- Api-(1.fwdarw.3)-Xyl-(1.fwdarw.4)-Rha-(1.fwdarw.2)-[R-(.fwdarw.4)]- Fuc- (R = 5-O-[5-O-Ara/Api-3,5-dihydroxy-6- methyl-octanoyl]-3,5-dihydroxy-6-methyl- octanoic acid) QS-21 A-xylo Quillaic acid Gal-(1.fwdarw.2)-[Xyl-(1.fwdarw.3)]-GlcA- Xyl-(1.fwdarw.3)-Xyl-(1.fwdarw.4)-Rha-(1.fwdarw.2)-[R-(.fwdarw.4)]- Fuc- (R = 5-O-[5-O-Ara/Api-3,5-dihydroxy-6- methyl-octanoyl]-3,5-dihydroxy-6-methyl- octanoic acid) QS-21 B-apio Quillaic acid Gal-(1.fwdarw.2)-[Xyl-(1.fwdarw.3)]-GlcA- Api-(1.fwdarw.3)-Xyl-(1.fwdarw.4)-Rha-(1.fwdarw.2)-[R-(.fwdarw.3)]- Fuc- (R = 5-O-[5-O-Ara/Api-3,5-dihydroxy-6- methyl-octanoyl]-3,5-dihydroxy-6-methyl- octanoic acid) QS-21 B-xylo Quillaic acid Gal-(1.fwdarw.2)-[Xyl-(1.fwdarw.3)]-GlcA- Xyl-(1.fwdarw.3)-Xyl-(1.fwdarw.4)-Rha-(1.fwdarw.2)-[R-(.fwdarw.3)]- Fuc- (R = 5-O-[5-O-Ara/Api-3,5-dihydroxy-6- methyl-octanoyl]-3,5-dihydroxy-6-methyl- octanoic acid) beta-Aescin Protoaescigenin- Glc-(1.fwdarw.2)-[Glc-(1.fwdarw.4)]-GlcA- (described: Aescin Ia) 21(2-methylbut-2- enoate)-22-acetat Teaseed saponin I 23-Oxo- Glc-(1.fwdarw.2)-Ara-(1.fwdarw.3)-[Gal- barringtogenol C- (1.fwdarw.2)]-GlcA- 21,22-bis(2- methylbut-2-enoate) Teaseedsaponin J 23-Oxo- Xyl-(1.fwdarw.2)-Ara-(1.fwdarw.3)-[Gal- barringtogenol C- (1.fwdarw.2)]-GlcA- 21,22-bis(2- methylbut-2-enoate) Assamsaponin F 23-Oxo- Glc-(1.fwdarw.2)-Ara-(1.fwdarw.3)-[Gal- barringtogenol C- (1.fwdarw.2)]-GlcA- 21(2-methylbut-2- enoate)-16,22- diacetat Digitonin Digitogenin Glc-(1.fwdarw.3)-Gal-(1.fwdarw.2)-[Xyl- (1.fwdarw.3)]-Glc-(1.fwdarw.4)-Gal- Primula acid 1 3,16,28- Rha-(1.fwdarw.2)-Gal-(1.fwdarw.3)-[Glc- Trihydroxyoleanan- (1.fwdarw.2)]-GlcA- 12-en AS64R Gypsogenic acid Glc-(1.fwdarw.3)-[Glc-(1.fwdarw.6)]-Gal- Carbohydrate substituent at the C-23-OH group AS6.2 Gypsogenic acid Gal- Glc-(1.fwdarw.3)-[Glc-(1.fwdarw.6)]-Gal- .sup.a, bDifferent names refer to different isolates of the same structure .sup.c, dDifferent names refer to different isolates of the same structure
TABLE-US-00002 TABLE A2 ADCs which were previously investigated in the human clinical setting, and subsequently retracted from further clinical investigation Last Development Drug Name Indication Target Stage Monoclonal Oncology Cells Expressing Epidermal Growth Factor Discovery Antibody Receptor (Proto Oncogene c ErbB 1 or Conjugate to Receptor Tyrosine Protein Kinase erbB 1 Target EGFR for or HER1 or ERBB1 or EGFR or EC Oncology 2.7.10.1) Affilutin Multiple Myeloma (Kahler Disease) Discovery IMGN-779 Myelodysplastic Syndrome Cells Expressing Myeloid Cell Surface IND/CTA Filed Antigen CD33 (Sialic Acid Binding Ig Like Lectin 3 or gp67 or CD33) Neuradiab Non-Hodgkin Lymphoma Cells Expressing Tenascin (Cytotactin or Phase I GMEM or GP 150-225 or Glioma Associated Extracellular Matrix Antigen or Hexabrachion or JI or Myotendinous Antigen or Neuronectin or Tenascin C or TNC) IMGN-779 Refractory Acute Myeloid Leukemia; Cells Expressing Myeloid Cell Surface Phase I Relapsed Acute Myeloid Leukemia Antigen CD33 (Sialic Acid Binding Ig Like Lectin 3 or gp67 or CD33) AGS-67E Acute Myelocytic Leukemia (AML, Cells Expressing Leukocyte Antigen CD37 Phase I Acute Myeloblastic Leukemia) (Tetraspanin 26 or CD37) AGS-67E Hairy Cell Leukemia; Non-Hodgkin Cells Expressing Leukocyte Antigen CD37 Phase I Lymphoma; Refractory Chronic (Tetraspanin 26 or CD37) Lymphocytic Leukemia (CLL); Relapsed Chronic Lymphocytic Leukemia (CLL); T-Cell Leukemia ASG-15ME Metastatic Transitional (Urothelial) Cells Expressing SLIT And NTRK Like Phase I Tract Cancer Protein 6 (SLITRK6) vandortuzumab Metastatic Hormone Refractory Cells Expressing Metalloreductase Phase I vedotin (Castration Resistant, Androgen- STEAP1 (Six Transmembrane Epithelial Independent) Prostate Cancer Antigen Of The Prostate 1 or STEAP1 or EC 1.16.1.) CDX-014 Ovarian Cancer Cells Expressing Hepatitis A Virus Cellular Phase I Receptor 1 (Kidney Injury Molecule 1 or T Cell Immunoglobulin And Mucin Domain Containing Protein 1 or T-Cell Immunoglobulin Mucin Receptor 1 or T Cell Membrane Protein 1 or CD365 or HAVCR1) AGS-16M18 Liver Cancer; Renal Cell Carcinoma Phase I vorsetuzumab Non-Hodgkin Lymphoma; Renal Cell Cells Expressing CD70 Antigen (CD27 Phase I mafodotin Carcinoma Ligand or Tumor Necrosis Factor Ligand Superfamily Member 7 or CD70) denintuzumab Acute Lymphocytic Leukemia (ALL, Cells Expressing B Lymphocyte Antigen Phase I mafodotin Acute Lymphoblastic Leukemia); B- CD19 (B Lymphocyte Surface Antigen B4 Cell Non-Hodgkin Lymphoma; Burkitt or Differentiation Antigen CD19 or T Cell Lymphoma; Lymphoblastic Surface Antigen Leu 12 or CD19) Lymphoma; Mantle Cell Lymphoma SGN-CD70A Diffuse Large B-Cell Lymphoma; Cells Expressing CD70 Antigen (CD27 Phase I Follicular Lymphoma; Mantle Cell Ligand or Tumor Necrosis Factor Ligand Lymphoma; Metastatic Renal Cell Superfamily Member 7 or CD70) Carcinoma; Non-Hodgkin Lymphoma RG-7636 Metastatic Melanoma Endothelin B Receptor (Endothelin Phase I Receptor Non Selective Type or EDNRB) SC-006 Metastatic Colorectal Cancer Phase I MM-310 Breast Cancer; Endometrial Cancer; Ephrin Type A Receptor 2 (Epithelial Cell Phase I Esophageal Cancer; Gastric Cancer; Kinase or Tyrosine Protein Kinase Gastroesophageal (GE) Junction Receptor ECK or EPHA2 or EC 2.7.10.1) Carcinomas; Head And Neck Cancer Squamous Cell Carcinoma; Non-Small Cell Lung Cancer; Ovarian Cancer; Pancreatic Ductal Adenocarcinoma; Prostate Cancer; Small-Cell Lung Cancer; Soft Tissue Sarcoma; Solid Tumor; Transitional Cell Carcinoma (Urothelial Cell Carcinoma) PF-06647263 Metastatic Breast Cancer; Ovarian Cells Expressing Ephrin A4 (EPH Related Phase I Cancer Receptor Tyrosine Kinase Ligand 4 or EFNA4) PF-06263507 Solid Tumor Cells Expressing Trophoblast Glycoprotein Phase I (M6P1 or 5T4 Oncofetal Antigen or 5T4 Oncofetal Trophoblast Glycoprotein or Wnt Activated Inhibitory Factor 1 or TPBG) PF-06650808 Metastatic Breast Cancer; Non-Small Cells Expressing Neurogenic Locus Notch Phase I Cell Lung Cancer; Ovarian Cancer Homolog Protein 3 (NOTCH3) XMT-1522 Breast Cancer; Gastric Cancer; Non- Receptor Tyrosine Protein Kinase ERBB 2 Phase I Small Cell Lung Cancer (Metastatic Lymph Node Gene 19 Protein or Proto Oncogene Neu or Proto Oncogene C ErbB 2 or Tyrosine Kinase Type Cell Surface Receptor HER2 or p185erbB2 or HER2 or CD340 or ERBB2 or EC 2.7.10.1); Tubulin AMG-595 Anaplastic Astrocytoma; Recurrent Cells Expressing Epidermal Growth Factor Phase I Glioblastoma Multiforme (GBM) Receptor (Proto Oncogene c ErbB 1 or Receptor Tyrosine Protein Kinase erbB 1 or HER1 or ERBB1 or EGFR or EC 2.7.10.1) pinatuzumab Chronic Lymphocytic Leukemia (CLL) Cells Expressing B Cell Receptor CD22 (B Phase I vedotin Lymphocyte Cell Adhesion Molecule or Sialic Acid Binding Ig Like Lectin 2 or T Cell Surface Antigen Leu 14 or CD22) cantuzumab Colorectal Cancer; Non-Small Cell Phase I ravtansine Lung Cancer; Pancreatic Cancer; Solid Tumor AVE-9633 Acute Myelocytic Leukemia (AML, Cells Expressing Myeloid Cell Surface Phase I Acute Myeloblastic Leukemia) Antigen CD33 (Sialic Acid Binding Ig Like Lectin 3 or gp67 or CD33) BIWI-1.sup.(1) Breast Cancer; Carcinomas; Cells Expressing CD44 Antigen (CDw44 or Phase I Esophageal Cancer; Head And Neck Epican or Extracellular Matrix Receptor III Cancer Squamous Cell Carcinoma or GP90 Lymphocyte Homing/Adhesion Receptor or HUTCH I or Heparan Sulfate Proteoglycan or Hermes Antigen or Hyaluronate Receptor or Phagocytic Glycoprotein 1 or CD44) RG-7882 Epithelial Ovarian Cancer; Fallopian Cells Expressing Mucin 16 (Ovarian Phase I Tube Cancer; Pancreatic Cancer; Cancer Related Tumor Marker CA125 or Peritoneal Cancer Ovarian Carcinoma Antigen CA125 or MUC16) ASG-5ME Adenocarcinoma; Hormone Cells Expressing Choline Transporter Like Phase I Refractory (Castration Resistant, Protein 4 (Solute Carrier Family 44 Androgen-Independent) Prostate Member 4 or SLC44A4) Cancer; Metastatic Adenocarcinoma of The Pancreas DCDS-0780A B-Cell Non-Hodgkin Lymphoma Phase I SC-004 Endometrial Cancer; Epithelial Phase I Ovarian Cancer; Fallopian Tube Cancer; Peritoneal Cancer RG-7600 Ovarian Cancer; Pancreatic Ductal Phase I Adenocarcinoma sofituzumab Epithelial Ovarian Cancer; Fallopian Cells Expressing Mucin 16 (Ovarian Phase I vedotin Tube Cancer; Ovarian Cancer; Cancer Related Tumor Marker CA125 or Pancreatic Cancer; Peritoneal Cancer Ovarian Carcinoma Antigen CA125 or MUC16) IMGN-289 Breast Cancer; Esophageal Cancer; Cells Expressing Epidermal Growth Factor Phase I Gastric Cancer; Head And Neck Receptor (Proto Oncogene c ErbB 1 or Cancer Squamous Cell Carcinoma; Receptor Tyrosine Protein Kinase erbB 1 Non-Small Cell Lung Cancer; Solid or HER1 or ERBB1 or EGFR or EC Tumor 2.7.10.1) SAR-428926 Breast Cancer; Colorectal Cancer; Cells Expressing Lysosome Associated Phase I Gastric Cancer; Non-Small Cell Lung Membrane Glycoprotein 1 (CD107 Antigen Cancer; Ovarian Cancer; Prostate Like Family Member A or CD107a or Cancer; Solid Tumor LAMP1) SGNCD-19B B-Cell Non-Hodgkin Lymphoma; Cells Expressing B Lymphocyte Antigen Phase I Diffuse Large B-Cell Lymphoma; CD19 (B Lymphocyte Surface Antigen B4 Follicular Lymphoma or Differentiation Antigen CD19 or T Cell Surface Antigen Leu 12 or CD19) SGNCD-123A Refractory Acute Myeloid Leukemia; Cells Expressing Interleukin 3 Receptor Phase I Relapsed Acute Myeloid Leukemia Subunit Alpha (CD123 or IL3RA) SGNCD-352A Refractory Multiple Myeloma; Cells Expressing SLAM Family Member 6 Phase I Relapsed Multiple Myeloma (Activating NK Receptor or NK T B Antigen or CD352 or SLAMF6) RG-7841 Breast Cancer; Non-Small Cell Lung Cells Expressing Lymphocyte Antigen 6E Phase I Cancer; Solid Tumor (Retinoic Acid Induced Gene E Protein or Stem Cell Antigen 2 or Thymic Shared Antigen 1 or LY6E) IMGN-388 Solid Tumor Cells Expressing Integrin Alpha V Phase I (Vitronectin Receptor Subunit Alpha or CD51 or ITGAV) lorvotuzumab Refractory Multiple Myeloma; Cells Expressing Neural Cell Adhesion Phase I mertansine Relapsed Multiple Myeloma Molecule 1 (Antigen Recognized By Monoclonal Antibody 5.1H11 or CD56 or NCAM1) lorvotuzumab Neuroendocrine Carcinoma; Cells Expressing Neural Cell Adhesion Phase I mertansine Neuroendocrine Tumors; Non-Small Molecule 1 (Antigen Recognized By Cell Lung Cancer; Ovarian Cancer; Monoclonal Antibody 5.1H11 or CD56 or Skin Cancer NCAM1) BAY-794620 Lung Cancer; Solid Tumor Cells Expressing Carbonic Anhydrase 9 Phase I (Carbonate Dehydratase IX or pMW1 or Membrane Antigen MN or P54/58N or Renal Cell Carcinoma Associated Antigen G250 or CA9 or EC 4.2.1.1) RG-7598 Refractory Multiple Myeloma; Phase I Relapsed Multiple Myeloma Oncolysin B B-Cell Leukemia; Lymphoma Cells Expressing B Lymphocyte Antigen Phase I CD19 (B Lymphocyte Surface Antigen B4 or Differentiation Antigen CD19 or T Cell Surface Antigen Leu 12 or CD19) ADCT-502.sup.(1) Bladder Cancer; Breast Cancer; Cells Expressing Receptor Tyrosine Phase I Esophageal Cancer; Gastric Cancer; Protein Kinase ERBB 2 (Metastatic Lymph Non-Small Cell Lung Cancer Node Gene 19 Protein or Proto Oncogene Neu or Proto Oncogene C ErbB 2 or Tyrosine Kinase Type Cell Surface Receptor HER2 or p185erbB2 or HER2 or CD340 or ERBB2 or EC 2.7.10.1) AMG-172 Renal Cell Carcinoma Cells Expressing CD70 Antigen (CD27 Phase I Ligand or Tumor Necrosis Factor Ligand Superfamily Member 7 or CD70) ImmuRAIT-LL2 B-Cell Non-Hodgkin Lymphoma Cells Expressing B Cell Receptor CD22 (B Phase I/II Lymphocyte Cell Adhesion Molecule or Sialic Acid Binding Ig Like Lectin 2 or T Cell Surface Antigen Leu 14 or CD22) indusatumab Adenocarcinoma Of The Gastro- Cells Expressing Heat Stable Enterotoxin Phase I/II vedotin esophageal Junction; Gastric Cancer Receptor (Guanylyl Cyclase C or or Intestinal Guanylate Cyclase or GUCY2C or EC 4.6.1.2) clivatuzumab Pancreatic Cancer Cells Expressing Mucin 1 (Breast Phase I/II tetraxetan Carcinoma Associated Antigen DF3 or Episialin or H23AG or Krebs Von Den Lungen 6 or PEMT or Peanut Reactive Urinary Mucin or Polymorphic Epithelial Mucin or Tumor Associated Epithelial Membrane Antigen or Tumor Associated Mucin or CD227 or MUC1) depatuxizumab Recurrent Malignant Glioma Epidermal Growth Factor Receptor (Proto Phase I/II mafodotin.sup.(2) Oncogene c ErbB 1 or Receptor Tyrosine Protein Kinase erbB 1 or HER1 or ERBB1 or EGFR or EC 2.7.10.1) CDX-014 Metastatic Renal Cell Carcinoma; Cells Expressing Hepatitis A Virus Cellular Phase I/II Papillary Renal Cell Carcinoma Receptor 1 (Kidney Injury Molecule 1 or T Cell Immunoglobulin And Mucin Domain Containing Protein 1 or T-Cell Immunoglobulin Mucin Receptor 1 or T Cell Membrane Protein 1 or CD365 or HAVCR1) vadastuximab Refractory Acute Myeloid Leukemia; Cells Expressing Myeloid Cell Surface Phase I/II talirine.sup.(1) Relapsed Acute Myeloid Leukemia Antigen CD33 (Sialic Acid Binding Ig Like Lectin 3 or gp67 or CD33) vadastuximab Myelodysplastic Syndrome Cells Expressing Myeloid Cell Surface Phase I/II talirine Antigen CD33 (Sialic Acid Binding Ig Like Lectin 3 or gp67 or CD33) MLN-2704 Metastatic Hormone Refractory Cells Expressing Glutamate Phase I/II (Castration Resistant, Androgen- Carboxypeptidase 2 (Folate Hydrolase 1 or Independent) Prostate Cancer Prostate Specific Membrane Antigen or PSMA or Pteroylpoly Gamma Glutamate Carboxypeptidase or Cell Growth Inhibiting Gene 27 Protein or FOLH1 or EC 3.4.17.21) Oncolysin B AIDS-Related Lymphoma Cells Expressing B Lymphocyte Antigen Phase I/II CD19 (B Lymphocyte Surface Antigen B4 or Differentiation Antigen CD19 or T Cell Surface Antigen Leu 12 or CD19) coltuximab Diffuse Large B-Cell Lymphoma Cells Expressing B Lymphocyte Antigen Phase II ravtansine CD19 (B Lymphocyte Surface Antigen B4 or Differentiation Antigen CD19 or T Cell Surface Antigen Leu 12 or CD19) coltuximab Acute Lymphocytic Leukemia (ALL, Cells Expressing B Lymphocyte Antigen Phase II ravtansine Acute Lymphoblastic Leukemia) CD19 (B Lymphocyte Surface Antigen B4 or Differentiation Antigen CD19 or T Cell Surface Antigen Leu 12 or CD19) coltuximab Diffuse Large B-Cell Lymphoma Cells Expressing B Lymphocyte Antigen Phase II ravtansine CD19 (B Lymphocyte Surface Antigen B4 or Differentiation Antigen CD19 or T Cell Surface Antigen Leu 12 or CD19) indusatumab Adenocarcinoma Of The Gastro- Cells Expressing Heat Stable Enterotoxin Phase II vedotin.sup.(2) esophageal Junction; Gastric Cancer; Receptor (Guanylyl Cyclase C or or Metastatic Adenocarcinoma of The Intestinal Guanylate Cyclase or GUCY2C Pancreas or EC 4.6.1.2) depatuxizumab Squamous Non-Small Cell Lung Epidermal Growth Factor Receptor (Proto Phase II mafodotin Cancer Oncogene c ErbB 1 or Receptor Tyrosine Protein Kinase erbB 1 or HER1 or ERBB1 or EGFR or EC 2.7.10.1) depatuxizumab Anaplastic Astrocytoma; Anaplastic Epidermal Growth Factor Receptor (Proto Phase II mafodotin.sup.(2) Oligoastrocytoma; Gliosarcoma; Oncogene c ErbB 1 or Receptor Tyrosine High-Grade Glioma; Oligoden- Protein Kinase erbB 1 or HER1 or ERBB1 droglioma; Pediatric Diffuse Intrinsic or EGFR or EC 2.7.10.1) Pontine Glioma; Recurrent Glioblastoma Multiforme (GBM) lifastuzumab Non-Small Cell Lung Cancer Sodium Dependent Phosphate Transport Phase II vedotin Protein 2B (Sodium Phosphate Transport Protein 2B or NaPi3b or Sodium/Phosphate Cotransporter 2B or NaPi 2b or Solute Carrier Family 34 Member 2 or SLC34A2) lifastuzumab Ovarian Cancer Sodium Dependent Phosphate Transport Phase II vedotin Protein 2B (Sodium Phosphate Transport Protein 2B or NaPi3b or Sodium/Phosphate Cotransporter 2B or NaPi 2b or Solute Carrier Family 34 Member 2 or SLC34A2) Bismab-A Acute Myelocytic Leukemia (AML, Cells Expressing Myeloid Cell Surface Phase II Acute Myeloblastic Leukemia) Antigen CD33 (Sialic Acid Binding Ig Like Lectin 3 or gp67 or CD33) denintuzumab Diffuse Large B-Cell Lymphoma; Cells Expressing B Lymphocyte Antigen Phase II mafodotin Follicular Lymphoma CD19 (B Lymphocyte Surface Antigen B4 or Differentiation Antigen CD19 or T Cell Surface Antigen Leu 12 or CD19) Avicidin.sup.(1) Colorectal Cancer; Prostate Cancer Cells Expressing Epithelial Cell Adhesion Phase II Molecule (Adenocarcinoma Associated Antigen or Cell Surface Glycoprotein Trop 1 or Epithelial Cell Surface Antigen or Epithelial Glycoprotein 314 or KS 1/4 Antigen or KSA or Tumor Associated Calcium Signal Transducer 1 or CD326 or EPCAM) pinatuzumab Diffuse Large B-Cell Lymphoma; Cells Expressing B Cell Receptor CD22 (B Phase II vedotin Follicular Lymphoma Lymphocyte Cell Adhesion Molecule or Sialic Acid Binding Ig Like Lectin 2 or T Cell Surface Antigen Leu 14 or CD22) SGN-15 Metastatic Breast Cancer; Non-Small Cells Expressing Lewis Y Antigen (CD174) Phase II Cell Lung Cancer; Ovarian Cancer; Prostate Cancer cantuzumab Gastric Cancer; Gastroesophageal Phase II ravtansine (GE) Junction Carcinomas ASP-6183 Ovarian Cancer Phase II SAR-566658 Metastatic Breast Cancer Cells Expressing Sialoglycotope CA6 Phase II Antigen Oncolysin S Small-Cell Lung Cancer Cells Expressing Neural Cell Adhesion Phase II Molecule 1 (Antigen Recognized By Monoclonal Antibody 5.1H11 or CD56 or NCAM1) lorvotuzumab Small-Cell Lung Cancer Cells Expressing Neural Cell Adhesion Phase II mertansine Molecule 1 (Antigen Recognized By Monoclonal Antibody 5.1H11 or CD56 or NCAM1) glembatumumab Metastatic Melanoma; Metastatic Cells Expressing Transmembrane Phase II vedotin Uveal Melanoma; Osteosarcoma; Glycoprotein NMB (Transmembrane Squamous Non-Small Cell Lung Glycoprotein HGFIN or GPNMB) Cancer MM-302 Metastatic Breast Cancer Cells Expressing Receptor Tyrosine Phase II/III Protein Kinase ERBB 2 (Metastatic Lymph Node Gene 19 Protein or Proto Oncogene Neu or Proto Oncogene C ErbB 2 or Tyrosine Kinase Type Cell Surface Receptor HER2 or p185erbB2 or HER2 or CD340 or ERBB2 or EC 2.7.10.1) Neuradiab Brain Cancer; Glioblastoma Cells Expressing Tenascin (Cytotactin or Phase III Multiforme (GBM) GMEM or GP 150-225 or Glioma Associated Extracellular Matrix Antigen or Hexabrachion or JI or Myotendinous Antigen or Neuronectin or Tenascin C or TNC) clivatuzumab Metastatic Adenocarcinoma of The Cells Expressing Mucin 1 (Breast Phase III tetraxetan Pancreas Carcinoma Associated Antigen DF3 or Episialin or H23AG or Krebs Von Den Lungen 6 or PEMT or Peanut Reactive Urinary Mucin or Polymorphic Epithelial Mucin or Tumor Associated Epithelial Membrane Antigen or Tumor Associated Mucin or CD227 or MUC1) depatuxizumab Glioblastoma Multiforme (GBM) Epidermal Growth Factor Receptor (Proto Phase III mafodotin.sup.(2) Oncogene c ErbB 1 or Receptor Tyrosine Protein Kinase erbB 1 or HER1 or ERBB1 or EGFR or EC 2.7.10.1) vadastuximab Acute Myelocytic Leukemia (AML, Cells Expressing Myeloid Cell Surface Phase III talirine.sup.(1) Acute Myeloblastic Leukemia) Antigen CD33 (Sialic Acid Binding Ig Like Lectin 3 or gp67 or CD33) glembatumumab Metastatic Breast Cancer Cells Expressing Transmembrane Phase III vedotin.sup.(2) Glycoprotein NMB (Transmembrane Glycoprotein HGFIN or GPNMB) Oncolysin B B-Cell Leukemia; Lymphoma Cells Expressing B Lymphocyte Antigen Phase III CD19 (B Lymphocyte Surface Antigen B4 or Differentiation Antigen CD19 or T Cell Surface Antigen Leu 12 or CD19) ImmuRAIT-LL2 B-Cell Leukemia Cells Expressing B Cell Receptor CD22 (B Preclinical Lymphocyte Cell Adhesion Molecule or Sialic Acid Binding Ig Like Lectin 2 or T Cell Surface Antigen Leu 14 or CD22) indusatumab Metastatic Colorectal Cancer Cells Expressing Heat Stable Enterotoxin Preclinical vedotin Receptor (Guanylyl Cyclase C or or Intestinal Guanylate Cyclase or GUCY2C or EC 4.6.1.2) ASG-15ME Lung Cancer Cells Expressing SLIT And NTRK Like Preclinical Protein 6 (SLITRK6) HTI-1511 Bile Duct Cancer Cells Expressing Epidermal Growth Factor Preclinical (Cholangiocarcinoma); Breast Cancer; Receptor (Proto Oncogene c ErbB 1 or Colorectal Cancer; Non-Small Cell Receptor Tyrosine Protein Kinase erbB 1 Lung Cancer or HER1 or ERBB1 or EGFR or EC 2.7.10.1) ZW-33 Gastric Cancer; Metastatic Breast Cells Expressing Receptor Tyrosine Preclinical Cancer Protein Kinase ERBB 2 (Metastatic Lymph Node Gene 19 Protein or Proto Oncogene Neu or Proto Oncogene C ErbB 2 or Tyrosine Kinase Type Cell Surface Receptor HER2 or p185erbB2 or HER2 or CD340 or ERBB2 or EC 2.7.10.1) ZW-33 Ovarian Cancer Cells Expressing Receptor Tyrosine Preclinical Protein Kinase ERBB 2 (Metastatic Lymph Node Gene 19 Protein or Proto Oncogene Neu or Proto Oncogene C ErbB 2 or Tyrosine Kinase Type Cell Surface Receptor HER2 or p185erbB2 or HER2 or CD340 or ERBB2 or EC 2.7.10.1) SGNCD-352A Non-Hodgkin Lymphoma Cells Expressing SLAM Family Member 6 Preclinical (Activating NK Receptor or NK T B Antigen or CD352 or SLAMF6) HuMax-CD74-ADC Oncology Cells Expressing HLA Class II Preclinical Histocompatibility Antigen Gamma Chain (HLA DR Antigens Associated Invariant Chain or Ia Antigen Associated Invariant Chain or p33 or CD74) sacituzumab Pancreatic Ductal Adenocarcinoma Cells Expressing Tumor Associated govitecan Calcium Signal Transducer 2 (Cell Surface Glycoprotein Trop 2 or Membrane Component Chromosome 1 Surface Marker 1 or Pancreatic Carcinoma Marker Protein GA733-1 or TACSTD2) sacituzumab Adenocarcinoma; Cervical Cancer; Cells Expressing Tumor Associated govitecan Colorectal Cancer; Endometrial Calcium Signal Transducer 2 (Cell Surface Cancer; Epithelial Ovarian Cancer; Glycoprotein Trop 2 or Membrane Esophageal Cancer; Follicular Thyroid Component Chromosome 1 Surface Cancer; Gastric Cancer; Glioblastoma Marker 1 or Pancreatic Carcinoma Marker Multiforme (GBM); Head And Neck Protein GA733-1 or TACSTD2) Cancer Squamous Cell Carcinoma; Hepatocellular Carcinoma; Kidney Cancer (Renal Cell Cancer); Metastatic Hormone Refractory (Castration Resistant, Androgen- Independent) Prostate Cancer; Metastatic Transitional (Urothelial) Tract Cancer; Transitional Cell Cancer (Urothelial Cell Cancer) sacituzumab Hepatocellular Carcinoma Cells Expressing Tumor Associated govitecan Calcium Signal Transducer 2 (Cell Surface Glycoprotein Trop 2 or Membrane Component Chromosome 1 Surface Marker 1 or Pancreatic Carcinoma Marker Protein GA733-1 or TACSTD2) sacituzumab Metastatic Breast Cancer; Transitional Cells Expressing Tumor Associated govitecan Cell Cancer (Urothelial Cell Cancer) Calcium Signal Transducer 2 (Cell Surface Glycoprotein Trop 2 or Membrane Component Chromosome 1 Surface Marker 1 or Pancreatic Carcinoma Marker Protein GA733-1 or TACSTD2) sacituzumab Non-Small Cell Lung Cancer; Small- Cells Expressing Tumor Associated govitecan Cell Lung Cancer Calcium Signal Transducer 2 (Cell Surface Glycoprotein Trop 2 or Membrane Component Chromosome 1 Surface Marker 1 or Pancreatic Carcinoma Marker Protein GA733-1 or TACSTD2) sacituzumab Metastatic Breast Cancer Cells Expressing Tumor Associated govitecan Calcium Signal Transducer 2 (Cell Surface Glycoprotein Trop 2 or Membrane Component Chromosome 1 Surface Marker 1 or Pancreatic Carcinoma Marker Protein GA733-1 or TACSTD2) .sup.(1)Discontinued due to adverse events .sup.(2)Discontinued due to lack of efficacy
TABLE-US-00003 TABLE A3 ADCs that reached phase III clinical development Last Development Development Drug Name Indication Stage Stage Reason for Discontinuation trastuzumab emtansine Gastric Cancer Marketed Phase II/III Unspecified MM-302 Metastatic Breast Discontinued Phase II/III Business/Strategic Decision Cancer trastuzumab emtansine Metastatic Breast Marketed Phase III Unspecified Cancer trastuzumab emtansine Gastric Cancer Marketed Phase III Unspecified ibritumomab tiuxetan Diffuse Large B- Marketed Phase III Cell Lymphoma inotuzumab ozogamicin Follicular Lymphoma Marketed Phase III inotuzumab ozogamicin Diffuse Large B- Marketed Phase III Lack of Efficacy Cell Lymphoma; Non-Hodgkin Lymphoma rovalpituzumab tesirine Small-Cell Lung Phase III Phase III Cancer rovalpituzumab tesirine Small-Cell Lung Phase III Phase III Cancer Neuradiab Brain Cancer; Inactive Phase III Unspecified Glioblastoma Multiforme (GBM) clivatuzumab tetraxetan Metastatic Inactive Phase III Unspecified Adenocarcinoma of The Pancreas depatuxizumab mafodotin Glioblastoma Inactive Phase III Lack of Efficacy Multiforme (GBM) vadastuximab talirine Acute Myelocytic Discontinued Phase III Adverse Events Leukemia (AML, Acute Myeloblastic Leukemia) glembatumumab vedotin Metastatic Breast Discontinued Phase III Lack of Efficacy Cancer Oncolysin B B-Cell Leukemia; Discontinued Phase III Business/Strategic Decision Lymphoma
TABLE-US-00004 TABLE A4 Tumor-specific cell-surface receptor targets which can be targeted by immunoglobulins according to the invention, and antibodies that can be used for the ADCs and the antibodies provided with a saponin, and the ADCs provided with a saponin, of the present invention (not presented as a limitation; further immunoglobulins are equally suitable for the invention) Target cell-surface receptor Example monoclonal antibodies HER2 anti-HER2 monoclonal antibody such as trastuzumab and pertuzumab CD20 anti-CD20 monoclonal antibody such as rituximab, ofatumumab, tositumomab and ibritumomab CA125 anti-CA125 monoclonal antibody such as oregovomab EpCAM (17-1A) anti-EpCAM (17-1A) monoclonal antibody such as edrecolomab EGFR anti-EGFR monoclonal antibody such as cetuximab, panitumumab and nimotuzumab CD30 anti-CD30 monoclonal antibody such brentuximab CD33 anti-CD33 monoclonal antibody such as gemtuzumab and huMy9-6 vascular integrin alpha-v anti-vascular integrin alpha-v beta-3 monoclonal antibody such as etaracizumab beta-3 CD52 anti-CD52 monoclonal antibody such as alemtuzumab CD22 anti-CD22 monoclonal antibody such as epratuzumab CEA anti-CEA monoclonal antibody such as labetuzumab CD44v6 anti-CD44v6 monoclonal antibody such as bivatuzumab FAP anti-FAP monoclonal antibody such as sibrotuzumab CD19 anti-CD19 monoclonal antibody such as huB4 CanAg anti-CanAg monoclonal antibody such as huC242 CD56 anti-CD56 monoclonal antibody such huN901 CD38 anti-CD38 monoclonal antibody such as daratumumab CA6 anti-CA6 monoclonal antibody such as DS6 IGF-IR anti-IGF-IR monoclonal antibody such as cixutumumab and 3B7 integrin anti-integrin monoclonal antibody such as CNTO 95 syndecan-1 anti-syndecan-1 monoclonal antibody such as B-B4
TABLE-US-00005 TABLE A5 RIPs from plants* Plant Family Plant Species Proteins Classification Adoxaceae Sambucus ebulus L. Ebulitin , Ebulitin , Ebulitin RIP 1 Ebulin f, Ebulin I, Ebulin r1, Ebulin r2, SEA RIP 2 SEAII, SELfd, SELId, SELIm lectin Sambucus nigra L. -Nigritin, -Nigritin, -Nigritin, Nigritin f1, Nigritin f2 RIP 1 basic Nigrin b, Nigrin b = SNA-V, Nigrin f = SNA-Vf, RIP 2 Nigrin I1, Nigrin I2, Nigrin s, SNA-I, SNA-I, SNA-If, SNAflu-I, SNLRP1, SNLRP2 SNA-Id, SNA-Im, SNA-II, SNA-III, SNA-IV = SNA-IVf, lectin SNA-IVl, SNApol-I, SNApol-II, TrSNA-I, TrSNA-If Sambucus racemosa L. basic racemosin b, SRA RIP 2 SRLbm = SRAbm lectin Sambucus sieboldiana SSA = SSA-b-1, Sieboldin-b = SSA-b-2 RIP 2 (Miq.) Blume ex Graebn. SSA-b-3, SSA-b-4 lectin Aizoaceae Mesembryanthemum RIP1 RIP 1 crystallinum L. Amaranthaceae Amaranthus caudatus L. Amaranthin = ACA lectin Amaranthus cruentus L. ACL lectin Amaranthus A. leucocarpus lectin lectin hypochondriacus L. [Syn.: Amaranthus leucocarpus S. Watson] Amaranthus mangostanus L. Amaramangin RIP 1 Amaranthus tricolor L. AAP-27 RIP 1 Amaranthus viridis L. Amaranthin RIP 1 Beta vulgaris L. Beetin-27 = BE27, Beetin-29 = BE29, Betavulgin RIP 1 Celosia argentea L. [Syn.: CCP-25, CCP-27 RIP 1 Celosia cristata L.] Chenopodium album L. CAP30 RIP 1 Spinacia oleracea L. SoRIP1 = BP31 RIP 1 SoRIP2 RIP 1 candidate Araliaceae Aralia elata (Miq.) Seem. Aralin RIP 2 Panax ginseng C. A. Mey Panaxagin peculiar RIP 1 candidate/RNase Panax quinquefolius L. Quinqueginsin peculiar RIP 1 candidate/RNase Asparagaceae Asparagus officinalis L. Asparin 1, Asparin 2 RIP 1 Drimia maritima (L.) Stearn Charybdin RIP 1 [Syn.: Charybdis maritima (L.) Speta] Muscari armeniacum Musarmin 1, Musarmin 2, Musarmin 3, Musarmin 4 RIP 1 Leichtlin ex Baker Polygonatum multiflorum PMRIPm, PMRIPt RIP 2 (L.) All. Yucca gloriosa var. tristis Yucca leaf protein = YLP RIP 1 Carrire [Syn.: Yucca recurvifolia Salisb.] Basellaceae Basella rubra L. Basella RIP 2a, Basella RIP 2b, Basella RIP 3 RIP 1 Caryophyllaceae Agrostemma githago L. Agrostin 2, Agrostin 5, Agrostin 6, Agrostin RIP 1 Dianthus barbatus L. Dianthin 29 RIP 1 Dianthus caryophyllus L. Dianthin 30, Dianthin 32 RIP 1 Dianthus chinensis L. [Syn.: D. sinensis RIP RIP 1 Dianthus sinensis Link] Gypsophila elegans M. Bieb. Gypsophilin RIP 1 Silene chalcedonica (L.) Lychnin RIP 1 E. H. L. Krause [Syn.: Lychnis chalcedonica L.] Silene glaucifolia Lag. [Syn.: Petroglaucin 1, Petroglaucin 2 RIP 1 Petrocoptis glaucifolia (Lag.) Boiss.] Silene laxipruinosa Mayol & Petrograndin RIP 1 Rossell [Syn.: Petrocoptis grandiflora Rothm.] Saponaria ocymoides L. Ocymoidin RIP 1 Saponaria officinalis L. Saporin-L1 = SO-L1, Saporin-L2 = SO-L2, Saporin-L3 = RIP 1 SO-L3, Saporin-I = SO-I = SO-4, Saporin-R1 = SO-R1, Saporin-R2 = SO-R2, Saporin-R3 = SO-R3, SO3a, SO3b, Saporin-S5 = Saporin 5 = SO-S5, Saporin-S6 = Saporin 6 = SO-6 = SO-S6, Saporin-S8 = SO-S8, Saporin-S9 = Saporin 9 = SO-S9, SAP-C, SAP-S Myosoton aquaticum (L.) Stellarin RIP 1 Moench [Syn.: Stellaria aquatica (L.) Scop.] Stellaria media (L.) Vill. RIP Q3 RIP 1 Vaccaria hispanica (Mill.) Pyramidatin RIP 1 Rauschert [Syn.: Vaccaria pyramidata Medik.] Cucurbitaceae Benincasa hispida (Thunb.) Hispin RIP 1 Cogn. -benincasin, -benincasin sRIP 1 Bryonia cretica subsp. Bryodin 1 = BD1, Bryodin 2, Bryodin-L, Bryodin-R RIP 1 dioica (Jacq.) Tutin. [Syn.: BDA lectin/RIP 2 like Bryonia dioica L.] Citrullus colocynthis (L.) Colocin 1, Colocin 2 RIP 1 Schrad. Cucurbita foetidissima Foetidissimin peculiar RIP 2 Kunth Foetidissimin II RIP 2 Cucumis ficifolius A. Rich. Cucumis figarei RIP = CF-RIP RIP 1 candidate [Syn.: Cucumis figarei Delile ex Naudin] Cucurbita maxima Cucurmoschin sRIP 1 candidate Duchesne Cucurbita moschata Cucurmosin, Cucurmosin 2, C. moschata RIP, RIP 1 Duchesne [Syn.: Cucurbita Moschatin, PRIP 1, PRIP 2 moschata (Duchesne ex -moschin, -moschin sRIP 1 candidate Lam.) Duchesne ex Poir.] Cucurbita pepo L. Pepocin RIP 1 Cucurbita pepo var. texana Texanin RIP 1 (Scheele) D. S. Decker [Syn.: Cucurbita texana (Scheele) A. Gray] Gynostemma pentaphyllum Gynostemmin RIP 1 (Thunb.) Makino Lagenaria siceraria (Molina) Lagenin RIP 1 candidate Standl. Luffa acutangula (L.) Roxb. Luffaculin-1, Luffaculin-2 RIP 1 Luffangulin sRIP 1 Luffa acutangula fruit lectin lectin Luffa cylindrica (L.) M. Roem Luffin, Luffin-a, Luffin-b, -luffin, -luffin, LRIP RIP 1 [Syn.: Luffa aegyptiaca Mill.] Luffacylin, Luffin P1 sRIP 1 Luffin-S, LuffinS(1), LuffinS(2) = luffin S2, LuffinS(3) sRIP 1 candidate Marah oreganus (Torr. & A. MOR-I, MOR-II RIP 1 Gray) Howell Momordica balsamina L. Balsamin, MbRIP-1, Momordin II RIP 1 Momordica charantia L. MAP 30, -momorcharin = -MC = -MMC, - RIP 1 momorcharin = -MC = -MMC, -momorcharin = - MMC, Momordin, Momordin = Momordica charantia inhibitor, Momordin II, Momordin-a, Momordin-b -momorcharin = -MMC, Charantin sRIP 1 RIP 1 candidate RIP 1 candidate MCL = M. charantia lectin, anti-H Lectin, Momordica lectin agglutinin, Momordin, protein fraction 1, protein fraction 2 MCL = Momordica charantia seed lectin = Momordica RIP 2 charantia lectin, MCL1 Momordica cochinchinensis Cochinin B, Momorcochin, Momorcochin-S RIP 1 Spreng. Siraitia grosvenorii (Swingle) Momorgrosvin RIP 1 C. Jeffrey ex A. M. Lu & Zhi Y. Zhang [Syn.: Momordica grosvenorii Swingle] Sechium edule (Jacq.) Sw. Sechiumin RIP 1 Sechium edule fruit lectin lectin Trichosanthes anguina L. Trichoanguin RIP 1 SGSL lectin/RIP 2 like Trichosanthes cordata TCA-I, TCA-II lectin Roxb. Trichosanthes cucumerina L. TCSL lectin/RIP 2 candidate Trichosanthes -trichosanthin = -TCS RIP 1 cucumeroides (Ser.) Maxim. Trichosanthes kirilowii -kirilowin, -kirilowin, TAP 29, TK-35, Trichobitacin, RIP 1 Maxim. Trichokirin, Trichomislin = TCM, Trichosanthin = Trichosanthes antiviral protein = TAP = TCS = - trichosanthin = -TCS = GLQ223, Trichosanthin, - trichosanthin = -TCS, -trichosanthin = -TCS Trichokirin S1, S-Trichokirin, Trichosanthrip sRIP 1 TKL-1 = Trichosanthes kirilowii lectin-1 lectin/RIP 2 candidate TK-I, TK-II, TK-III, Trichosanthes kirilowii lectin lectin Trichosanthes kirilowii Karasurin-A, Karasurin-B, Karasurin-C RIP 1 Maximovicz var. japonica (Miquel) Kitamura Trichosanthes lepiniate Trichomaglin RIP 1 Trichosanthes dioica Roxb. TDSL lectin/RIP 2 candidate Trichosanthes sp. Bac Kan Trichobakin RIP 1 8-98 Cupressaceae Thuja occidentalis L. Arborvitae RIP RIP candidate Euphorbiaceae Croton tiglium L. Crotin I RIP 1 candidate Crotin 2 RIP 1 Euphorbia characias L. E. characias lectin lectin Suregada multiflora Gelonin = GAP 31 RIP 1 (A. Juss.) Baill. [Syn.: Gelonium multiflorum A. Juss.] Hura Crepitans L. Hura crepitans RIP, Hura crepitans RIP-5 RIP 1 Hura crepitans latex lectin RIP 2 Crepitin, Hurin, Hura crepitans seed lectin lectin Jatropha curcas L. Curcin, Curcin 2, Curcin-L, Jc-SCRIP RIP 1 Manihot palmata Mll. Arg. Mapalmin RIP 1 Manihot esculenta Crantz. Manutin 1, Manutin 2 RIP 1 [Syn.: Manihot utilissima Pohl] Ricinus communis L. Ricin = crystalline Ricin = Ricin D, Ricin E, RCA = RIP 2 Ricinus communis agglutinin = RCAI = RCA120 = R. communis hemagglutinin = RCB-PHA I, RCAII = RCA60 = RCB-PHA II Ricinus communis, USA Ricin 1, Ricin 2, Ricin 3 RIP 2 Ricinus communis, India Ricin I, Ricin II, Ricin III RIP 2 Ricinus sanguienus, France Ricin.sub.11, Ricin.sub.12, Ricin.sub.2 RIP 2 Fabaceae Abrus precatorius L. Abrin, Abrin-a = Abrin C = Abrin-III, Abrin-b, Abrin-c = RIP 2 Abrin A = Abrin-I, Abrin-d, Abrin-II, APA = Abrus precatorius agglutinin = Abrus lectin = AAG, APA-I, APA-II Abrus pulchellus Thwaites Pulchellin, Pulchellin PI, Pulchellin PII, Pulchellin PIII RIP 2 Pisum sativum subsp. -pisavin, -pisavin RIP 1 sativum L. [Syn.: Pisum sativum var. arvense (L.) Poir.] Pisum sativum var. Sativin RIP 1 candidate macrocarpon Iridaceae Iris hollandica var. Professor IrisRIP = IRIP, IrisRIP.A1, IrisRIP.A2, IrisRIP.A3 RIP 1 Blaauw IRA, IRAb, IRAr RIP 2 Lamiaceae Clerodendrum aculeatum (L.) CA-SRI RIP 1 candidate Schltdl. Clerodendrum inerme (L.) CIP-29 RIP 1 Gaertn. CIP-34 RIP 1 candidate Leonurus japonicus Houtt. Leonurin RIP candidate Lauraceae Cinnamomum bodinieri H. Bodinierin RIP 2 Lv. Cinnamomum camphora (L.) Camphorin RIP 1 J. Presl Cinnamomin, Cinnamomin 1, Cinnamomin 2, RIP 2 Cinnamomin 3 Cinphorin sRIP 2 Cinnamomum Porrectin RIP 2 parthenoxylon (Jack) Meisn. [Syn.: Cinnamomum porrectum (Roxb.) Kosterm.] Malvaceae Abelmoschus esculentus Abelesculin RIP 1 (L.) Moench Nyctaginaceae Boerhaavia diffusa L. Boerhaavia inhibitor RIP 1 candidate Bougainvillea spectabilis BAP I, Bouganin = Bougainvillea RIP I RIP 1 Willd. Bougainvillea buttiana cv. BBP-24, BBP-28 RIP 1 Enid Lancester Bougainvillea buttiana cv. BBAP1 RIP 1 Mahara Mirabilis expansa (Ruiz & ME1, ME2 RIP 1 Pav.) Standl. Mirabilis jalapa L. MAP, MAP-2, MAP-3, MAP-4, MAP-S RIP 1 Olacaceae Malania oleifera Chun & Malanin lectin/RIP 2 S. K. Lee candidate Ximenia americana L. Riproximin = Rpx, Rpx-I, Rpx-II RIP 2 Passifloraceae Adenia digitata (Harv.) Engl. Modeccin = Modeccin 4B, Modeccin 6B RIP 2 Adenia ellenbeckii Harms A. ellenbeckii lectin RIP 2 candidate Adenia fruticosa Burtt Davy A. fruticosa lectin lectin Adenia glauca Schinz A. glauca lectin RIP 2 candidate Adenia goetzei Harms A. goetzei lectin RIP 2 (unresolved name) Adenia keramanthus Harms A. keramanthus lectin RIP 2 candidate Adenia lanceolata Engl. Lanceolin RIP 2 Adenia racemosa W. J. de A. racemosa lectin lectin Wilde Adenia spinosa Burtt Davy A. spinosa lectin RIP 2 candidate Adenia stenodactyla Harms Stenodactylin RIP 2 Adenia venenata Forssk. A. venenata lectin RIP 2 candidate Adenia volkensii Harms Volkensin RIP 2 Phytolaccaceae Phytolacca americana L. -PAP, PAP = Phytolacca americana protein = RIP 1 pokeweed antiviral protein, PAP-I, PAP-II, PAP-III, PAP-C, PAP-H, PAP-R, PAP-S, PAP-S1, PAP-S2 Phytolacca dioica L. Diocin 1, Diocin 2, PD-L1, PD-L2, PD-L3, PD-L4, PD- RIP 1 S1, PD-S2, PD-S3 Phytolacca dodecandra Dodecandrin, Dodecandrin C RIP 1 L'Hr. Phytolacca heterotepala Heterotepalin 4, Heterotepalin 5b RIP 1 H. Walter Phytolacca insularis Nakai Insularin = PIP = Phytolacca insularis antiviral protein, RIP 1 PIP2 = P. insularis antiviral protein 2 Poaceae Hordeum vulgare L. Barley toxin = Barley translation inhibitor = Barley RIP 1 Protein Synthesis Inhibitor = BPSI = RIP 30, Barley toxin I = Barley translation inhibitor I, Barley toxin II = Barley translation inhibitor II = Barley Protein Synthesis Inhibitor II = BPSI II, Barley toxin III = Barley translation inhibitor III, JIP60 Oryza sativa L. Oryza sativa RIP RIP 1 Secale cereale L. RPSI RIP 1 Triticum aestivum L. Tritin, Tritin 1, Tritin 2, Tritin 3, Tritin-S, Tritin-L RIP 1 Zea mays L. b-32 = maize RIP = maize proRIP1, Maize proRIP2 RIP 3/peculiar RIP 1 Ranunculaceae Eranthis hyemalis (L.) EHL RIP 2 Salisb. Santalaceae Phoradendron californicum PCL RIP 2 Nutt. Viscum album L. HmRip, HmRip 1, HmRip 2, HmRip 3, HmRip 4 RIP 2 (Himalayan mistletoe) Viscum album L. ML-I = Mistletoe lectin I = Viscumin = Eu-ML = EML-1 = RIP 2 (European mistletoe) VAA-I, ML-II = Mistletoe lectin II = VAA-II, ML-III = Mistletoe lectin III = VAA-III Viscum articulatum Burm. f. Articulatin-D RIP 2 Viscum coloratum (Kom.) KML, KML-C, KML-IIL, KML-IIU, VCA RIP 2 Nakai [Syn.: Viscum album subsp. coloratum Kom.] Solanaceae Nicotiana tabacum L. CIP31 RIP-like protein TRIP RIP 1 candidate Thymelaeaceae Phaleria macrocarpa P. macrocarpa RIP RIP candidate (Scheff.) Boerl. *Schrot J, Weng A, Melzig M F, et al. Ribosome-inactivating and related proteins. Toxins (Basel). 2015 May 8; 7(5): 1556-615.
[0370] It is part of the invention that the therapeutic combination, the first pharmaceutical composition, the first proteinaceous molecule, the second pharmaceutical composition or the second proteinaceous molecule of the invention is further combined with a covalent conjugate (complex) of a binding molecule or a binding moiety and a saponin, or is further combined with a pharmaceutical compound, an antibody, etc., therewith providing a composition comprising three or more enhancers, pharmaceutically active ingredients, etc., e.g. a conjugate of the invention (e.g. a first proteinaceous molecule and/or a second proteinaceous molecule) combined with a binding moiety complexed with an effector molecule, further combined with a pharmaceutical, which is either or not linked to a saponin, and which is either or not coupled to a ligand such as a targeting immunoglobulin, a domain or a fragment thereof. Furthermore, an embodiment is the therapeutic combination, the first pharmaceutical composition, the first proteinaceous molecule, the second pharmaceutical composition or the second proteinaceous molecule of the invention, wherein the second proteinaceous molecule is provided with two or more effector moieties such as a toxin or immunotoxin, wherein the two or more effector moieties are the same or different. Of course, combinations such as pharmaceutical combinations comprising the first and/or second pharmaceutical composition of the invention comprising the first or second proteinaceous molecule respectively, may further comprise any one or more of the saponins of any of the aforementioned embodiments and those saponins listed in Table A1 and Scheme 1, in free form, i.e. not covalently bound to a carrier protein. Of course, combinations such as pharmaceutical combinations comprising the first and/or second pharmaceutical composition of the invention comprising the first or second proteinaceous molecule respectively, may further comprise any one or more of the effector moieties of any of the aforementioned embodiments and those toxins listed in Tables A2, A3, A5, in free form, i.e. not covalently bound to a carrier protein. It is also part of the invention that such free saponin and/or free effector moiety is covalently conjugated or clusters by binding to an oligomeric or polymeric scaffold according to the invention.
EXEMPLARY EMBODIMENTS
[0371] An embodiment is the endosomal escape enhancing conjugate of the invention, wherein the saponin is a bisdesmosidic triterpene saponin belonging to the type of a 12,13-dehydrooleanane with an aldehyde function, in position 23, and wherein the saponin is preferably a saponin that can be isolated from Gypsophila or Saponaria species, more preferably the saponin is the saponin SO1861 or any of its diastereomers.
[0372] An embodiment is the endosomal escape enhancing conjugate of the invention, wherein the first binding site is at least a ligand, such as an immunoglobulin, with at least an effector moiety bound thereto.
[0373] An embodiment is the endosomal escape enhancing conjugate of the invention, wherein the first binding site is an immunoglobulin or at least a binding domain thereof for binding to a cell surface molecule, wherein preferably the cell surface molecule is selected from any of HER2, EGFR, CD20, CD22, Folate receptor 1, CD146, CD56, CD19, CD138, CD27L, PSMA, CanAg, integrin-alphaV, CA6, CD33, mesothelin, Cripto, CD3, CD30, CD33, CD239, CD70, CD123, CD352, DLL3, CD25, ephrinA4, MUC1, Trop2, CEACAM5, HER3, CD74, PTK7, Notch3, FGF2, C4.4A, FLT3, CD71.
[0374] An embodiment is the endosomal escape enhancing conjugate of the invention, wherein a linker is coupled to the glycoside via a cleavable bond, and wherein the ligand is an immunoglobulin, wherein preferably said cleavable bond is subject to cleavage under acidic, reductive, enzymatic or light-induced conditions, and preferably the cleavable bond is a covalent bond, preferably an imine bond, a hydrazone bond, an oxime bond, a 1,3-dioxolane bond or an ester bond, wherein preferably the cleavable bond is a disulfide bond or a peptide bond.
[0375] An embodiment is the endosomal escape enhancing conjugate of the invention, wherein the saponin moiety is a terminal saponin, preferably the saponin SO1861, the linker is a chemical linker covalently linking the saponin to the binding site of the first proteinaceous molecule, and the first binding site of the first proteinaceous molecule is an immunoglobulin such as trastuzumab or cetuximab, the linker preferably providing a cleavable bond between the terminal saponin moiety and the first binding site comprised by the first proteinaceous molecule.
[0376] An embodiment is the combination of an endosomal escape enhancing conjugate (i.e. the first proteinaceous molecule) according to the invention and a binding moiety (i.e. the second proteinaceous molecule), wherein the binding moiety comprises at least one effector moiety, wherein the endosomal escape enhancing conjugate and the binding moiety are, independently from one another, able to specifically bind to a target first and second cell-specific surface molecule or structure respectively, thereby inducing receptor-mediated endocytosis of a complex of the endosomal escape enhancing conjugate and the target cell-specific surface molecule, and of the complex of the binding moiety and the target cell-specific surface molecule.
[0377] An embodiment is the combination according to the invention, wherein the endosomal escape enhancing conjugate is able to compete with the binding moiety for binding to the target first and second cell-specific surface molecule or structure, wherein the first and second binding site are different.
[0378] An embodiment is the combination according to the invention, wherein the endosomal escape enhancing conjugate and the binding moiety are able to specifically bind to different target first and second cell-specific surface molecules or structures respectively, when the binding moiety is the second proteinaceous molecule.
[0379] An embodiment is the combination according to the invention, wherein the target cell-specific surface molecule or structure is selected from HER2, EGFR, CD20, CD22, Folate receptor 1, CD146, CD56, CD19, CD138, CD27L, PSMA, CanAg, integrin-alphaV, CA6, CD33, mesothelin, Cripto, CD3, CD30, CD33, CD239, CD70, CD123, CD352, DLL3, CD25, ephrinA4, MUC1, Trop2, CEACAM5, HER3, CD74, PTK7, Notch3, FGF2, C4.4A, FLT3, CD71.
[0380] An embodiment is the combination according to the invention, wherein the glycoside molecule is a bisdesmosidic triterpene, preferably a saponin.
[0381] An embodiment is the combination according to the invention, wherein the glycoside molecule is a bisdesmosidic triterpene saponin.
[0382] An embodiment is the combination according to the invention, wherein the saponin is a bisdesmosidic triterpene saponin belonging to the type of a 12,13-dehydrooleanane with an aldehyde function in position 23.
[0383] An embodiment is the combination according to the invention, wherein the saponin is a saponin that can be isolated from Gypsophila or Saponaria species.
[0384] An embodiment is the combination according to the invention, wherein the saponin is a SO1861 or any of its diastereomers.
[0385] An embodiment is the combination according to the invention, wherein the at least one glycoside is bound to the ligand (binding site for the first epitope on the cell-surface molecule) via a cleavable bond, wherein preferably said cleavable bond is subject to cleavage under acidic, reductive, enzymatic or light-induced conditions, and wherein the cleavable bond preferably is a disulfide bond or a peptide bond.
[0386] An embodiment is the combination according to the invention, wherein the cleavable bond is a covalent bond, preferably an imine bond, a hydrazone bond, an oxime bond, a 1,3-dioxolane bond or an ester bond.
[0387] An embodiment is the combination according to the invention, wherein the endosomal escape enhancing conjugate comprises a defined number of glycosides or a defined range.
[0388] An embodiment is the combination according to the invention, wherein the defined range is between 1-30 glycoside(s), preferably between 1-20, more preferably between 1-10, more preferably between 1-6, more preferably between 2-6, more preferably between 2-5, more preferably between 3-5, more preferably between 3-4 glycosides.
[0389] An embodiment is the combination according to the invention, wherein the effector moiety is a pharmaceutically active substance, such as a toxin such as a proteinaceous toxin, a drug, a polypeptide or a polynucleotide.
[0390] An embodiment is the combination according to the invention, wherein the target cell is a diseased cell or a disease-related cell, preferably a tumor cell or a tumor-associated cell (e.g. tumor vascular cell), or an immune cell (e.g. a T regulatory cell), or an autoimmune cell.
[0391] An embodiment is the combination according to the invention, wherein the at least one effector moiety is bound to the binding moiety (second proteinaceous molecule) via a cleavable bond, wherein preferably said cleavable bond is subject to cleavage under acidic, reductive, enzymatic or light-induced conditions, and/or wherein the cleavable bond is a disulfide bond or a peptide bond.
[0392] An embodiment is the combination according to the invention, wherein the glycoside (saponin) is capable of augmenting endosomal escape of the effector molecule.
[0393] An embodiment is the combination according to the invention, for use as a medicament.
[0394] An embodiment is the pharmaceutical composition comprising a combination according to the invention (previous embodiments) and a pharmaceutically acceptable excipient.
[0395] An embodiment is the pharmaceutical composition according to the invention, further comprising at least one further active pharmaceutically ingredient, such as a further immunoglobulin.
[0396] An embodiment is the combination for use according to the invention, or pharmaceutical composition according to the invention, for use in a method of treating cancer or an autoimmune disease.
[0397] An embodiment is the combination for use according to the invention, wherein the endosomal escape enhancing conjugate (first proteinaceous molecule) and the binding moiety (second proteinaceous molecule) are to be administered concomitant or sequentially, preferably concomitant. An embodiment is a method of treating cancer, the method comprising administering a combination according to the invention to a patient in need thereof.
[0398] An embodiment is the method of treating cancer, the method comprising administering a pharmaceutical composition according to the invention, to a patient in need thereof.
[0399] An embodiment is a kit comprising a first container containing an endosomal escape enhancing conjugate according to the invention and a second container containing a binding moiety according to the invention, the kit further comprising instructions for using the binding molecules.
[0400] The first proteinaceous molecule is suitable for use as a semi-finished product for the manufacture of a functionalized ADC or a functionalized AOC wherein the functionalized ADC or the functionalized OAC comprises at least one covalently coupled saponin of the invention and at least one effector moiety of the invention, either directly or via a linker and/or via a scaffold of the invention. An embodiment is the first proteinaceous molecule of the invention further comprising a payload or effector moitety of the invention such as a toxin or an oligonucleotide covalently bound to the first proteinaceous molecule of the invention, either directly or via a linker of the invention, preferably a cleavable linker of the invention, and/or via an oligomeric or polymeric scaffold according to the invention. For example, such a functionalized ADC or OAC comprises 2-4 saponins covalently coupled to e.g. a cysteine side chain in the first proteinaceous molecule such as a ligand or an antibody (fragment), either directly or via a (cleavable) linker, or comprises for example a dendron comprising 1-16 covalently coupled saponins bound thereto, the dendron covalently coupled to e.g. a cysteine side chain and/or a lysine side chain of the first proteinaceous molecule according to the invention.
[0401] The invention is further illustrated by the following examples, which should not be interpreted as limiting the present invention in any way.
EXAMPLES
Example a-Treating a Mammalian Tumor-Bearing Animal with a Conjugate of The Invention in Combination with an Adc Results in Survival and Tumor Regression
[0402] Female Balb/c nude mice were injected subcutaneously with a suspension of human A431 tumor cells. Under the skin of the mice, a human epidermal carcinoma developed in the xenograft animal tumor model. After injection of the tumor cells, the xenograft tumor was allowed to develop to a size of approximately 170-180 mm.sup.3. The A431 tumor cells have the following characteristics: high EGFR expressors, medium CD71 expressors, low HER2 expressors. A431 tumor cells result in an aggressively and rapidly growing tumor, when left untreated.
[0403] In Table A, the results of the treatment of control mice and tumor-bearing mice are presented. Tumor-bearing mice were treated with the indicated antibodies directed to either human Her2/neu, human EGFR, or human CD71, which are cell-surface receptors on the xenograft tumor. Cetuximab was covalently conjugated with saponin SO1861. The SO1861 was first provided with the linker EMCH (N--maleimidocaproic acid hydrazide), which EMCH is a maleimide-and-hydrazide crosslinker for covalently conjugating sulfhydryls (reduced cysteines of the antibody)) to carbonyls (aldehyde or ketones; here the carbonyl of the aldehyde at position C-23 of the saponin). The saponin-EMCH was covalently coupled to reduced cysteines of the Cetuximab, forming a covalent thio-ether bond between the EMCH and the cysteine side chain. The ADCs trastuzumab-saporin (covalent conjugate) and anti-CD71 mAb (OKT-9, IgG)-saporin (covalent conjugate) were tested for their tumor-attacking efficacy in the mice, measured as tumor volume in time after start of the treatment with the ADCs. The dose of the ADCs was sub-optimal in the tumor model. That is to say, from previous experiments, it was established at which sub-optimal dose of the ADCs no tumor-regression or arrest of tumor growth would be observable.
TABLE-US-00006 TABLE A RESULTS OF TREATING A MAMMALIAN TUMOR-BEARING ANIMAL WITH A CONJUGATE OF THE INVENTION IN COMBINATION WITH AN ADC RESULTS IN SURVIVAL AND TUMOR REGRESSION tumor size (volume in mm.sup.3 or + for growth, for Treatment Patient/healthy regression, and stable for group animal treatment growth nor regression) 1 xenograft vehicle 2000 mm.sup.3 (death/euthanasia) 2 xenograft Trastuzumab-saporin 2000 mm.sup.3 (death/euthanasia) 3 xenograft Anti-CD71 mAb 2000 mm.sup.3 (death/euthanasia) OKT-9-saporin (covalent conjugate) 4 xenograft Cetuximab-SO1861 2000 mm.sup.3 (death/euthanasia) (covalent conjugate) 5 xenograft Cetuximab >170 mm.sup.3, but <2000 mm.sup.3 (death/euthanasia) 6 xenograft Trastuzumab-saporin Tumor regression from 180 mm.sup.3 (covalent conjugate) + at the start of treatment back to Cetuximab-SO1861 80 mm.sup.3 (survival) (covalent conjugate) 7 xenograft Anti-CD71 mAb Tumor regression from 180 mm.sup.3 OKT-9-saporin at the start of treatment back to (covalent conjugate) + 40 mm.sup.3 (survival) Cetuximab-SO1861 (covalent conjugate)
[0404] These results demonstrate that the combination therapy of an ADC at a dose which is ineffective when treatment of tumor-bearing mice with the ADC alone is considered (tumor growths, death of the mice is not prevented (euthanasia)), with a conjugate of the invention consisting of a tumor-cell specific receptor targeting antibody covalently bound to a saponin, i.e. SO1861, the covalent conjugate administered to the mice suffering from cancer, at a non-effective dose when administered alone (tumor growths, death of the mice is not prevented (euthanasia)), provides an efficient and efficacious treatment regimen, expressed as tumors in regression and prolonged survival of the treated animals (beyond the duration of the experiment). The sub-optimal dose of ADC combined with a covalently bound saponin-comprising conjugate of the invention which has no anti-tumor activity when administered alone, thus provide for an effective treatment option for cancer patients, wherein a relative low dose of the ADC is efficacious. A lower dose of ADC bears the promise of less risk for adverse events, or even no side effects at all. In addition, the stimulatory effect of the saponin-bearing conjugate of the invention when the efficacy of the ADC is considered, shows that ADCs which previously have proven to lack efficacy when tumor patient treatment is concerned, may gain renewed attention and value, since ADC efficacy is improved in combination therapy setting, as the current example demonstrated. Reference is made to Table A2 and Table A3, summarizing ADCs which were previously investigated in the human clinical setting, but then were for some ADCs retracted from further clinical investigation. Especially the ADCs for which clinical development was terminated due to observed lack of efficacy and/or due to occurrence of unacceptable adverse event are ADCs which may gain renewed value for cancer patients when combined with a covalently bound saponin-comprising conjugate of the invention, such as the cetuximab-saponin tested.
Example B-Saponins Mixture of Quillaja Saponaria Comprising QS-21, with Endosomal/Lysosomal Escape Enhancing Activity
[0405] Scheme I displays the common molecular structure of a series of QS-21 saponins (in part adapted from: Conrado Pedebos, Laercio Pol-Fachin, Ramon Pons, Cilaine V. Teixeira Hugo Verli, Atomic Model and Micelle Dynamics of QS-21 Saponin, Molecules 2014, 19, 3744-3760). A mixture of water-soluble saponins obtained from Quillaja saponaria (Sigma-Aldrich, product No. S4521; Roth, Item No. 6857; InvivoGen, product Quil-A) may be applied in the endosomal/lysosomal escape enhancing conjugate, composition, combination of the invention, based on endosomal/lysosomal escape enhancing properties of at least one individual saponin present in the mixture, e.g. QS-21, or based on a combination of two or more of the saponins comprised by the mixture, such as QS-21 and QS-7.
[0406] The inventors demonstrated that the mixture of saponins from Quillaja saponaria at 2.5 microgram/ml dose was capable of enhancing endosomal escape of dianthin, as tested with mammalian tumor cells in a cell-based bioassay. The effector moiety exposed to the cells was dianthin covalently coupled to the ligand EGF: EGF-dianthin. Cells tested were tumor cell lines HeLa for free saponins, and A431, MDA-MB-468, CaSki and A2058 for testing the saponins when covalently coupled to cetuximab.
Example 1. 2 Target 2-Component System (In Vivo)
[0407] The 2 target 2-components system (2T2C) is the combination treatment of mAb1-SO1861 and mAb2-protein toxin, (
Example 2. 2 Target 2-Component System (In Vitro)
Results
[0408] The 2 target 2-components system (2T2C) is the combination treatment of mAb1-SO1861 and mAb2-protein toxin, (
[0409] Next, trastuzumab-saporin was titrated on a fixed concentration of 75 nM cetuximab-(Cys-L-SO1861) 3,7 and targeted protein toxin mediated cell killing on EGFR/HER2 expressing cells was determined. This revealed that 75 nM cetuximab-(Cys-L-SO1861) 3,7 in combination with low concentrations trastuzumab-saporin induced already efficient cell killing in EGFR/HER2 expressing cells (A431: IC50=5 pM; and CaSKi: IC50=1 pM;
[0410] Next, cetuximab-(Cys-L-SO1861) 3,7 was titrated on a fixed concentration of 50 pM trastuzumab-saporin and targeted protein toxin-mediated cell killing on HeLa (EGFR.sup.+//HER2.sup.+/) or A2058 (EGFR-/HER2.sup.+/) was determined as illustrated in
[0411] Next, SO1861-EMCH was conjugated via cysteine residues (Cys) to trastuzumab (monoclonal antibody recognizing and binding human HER2), with a DAR 4 (trastuzumab-(Cys-L-SO1861).sup.4). Trastuzumab-(Cys-L-SO1861).sup.4 was titrated on a fixed concentration of 1.5 pM EGFdianthin (EGFR targeted ligand toxin fusion protein) and targeted protein toxin mediated cell killing on HER2/EGFR expressing cells (SK-BR-3: HER2.sup.++/EGFR.sup.+/) was determined. This revealed strong cell killing at low concentrations of trastuzumab-(Cys-L-SO1861).sup.4+1.5 pM EGFdianthin (SK-BR-3: IC50=1 nM;
[0412] Next, EGFdianthin was titrated on a fixed concentration of 2.5 nM trastuzumab-(Cys-L-SO1861).sup.4 and targeted protein toxin mediated cell killing on SK-BR-3 (HER2.sup.++/EGFR.sup.+/) expressing cells was determined. This revealed that 2.5 nM trastuzumab-(Cys-L-SO1861).sup.4 in combination with low concentrations EGFdianthin induced already efficient cell killing in HER2/EGFR expressing cells (SK-BR-3: IC50=1 pM) (
[0413] Next, trastuzumab-(Cys-L-SO1861).sup.4 was titrated on a fixed concentration of 1.5 pM EGFdianthin and targeted protein toxin mediated cell killing on JIMT-1 (HER2.sup.+//EGFR.sup.+/) or MDA-MB-468: HER2-/EGFR.sup.++) was determined. Both cell lines were not sensitive for any combination of trastuzumab-(Cys-L-SO1861).sup.4+1.5 pM EGFdianthin (JIMT-1: IC50>1000 nM; MDA-MB-468: IC50>1000 nM;
[0414] Next, EGFdianthin was titrated on a fixed concentration of 2.5 nM trastuzumab-(Cys-L-SO1861).sup.4 and targeted protein toxin mediated cell killing on JIMT-1 (HER2.sup.+//EGFR.sup.+/) or MDA-MB-468 (HER2-/EGFR.sup.++) was determined. Both cell lines showed cell killing at high EGFdianthin concentrations with or without 2.5 nM trastuzumab-(Cys-L-SO1861).sup.4 (JIMT-1: IC50=10.000 pM; MDA-MB-468: IC50=200 PM
[0415] All this shows that cells with low or no HER2 receptor expression are not susceptible for the combination of trastuzumab-(Cys-L-SO1861) 3,7+1.5 pM EGFdianthin, due to a lack of sufficient HER2 receptor that facilitates the antibodymediated delivery of sufficient SO1861 (threshold) to ensure endosomal escape of the toxin within the cytoplasm of the cell.
[0416] Next, SO1861-EMCH was conjugated via cysteine residues (Cys) to trastuzumab (monoclonal antibody recognizing and binding human HER2), with a DAR 4, (trastuzumab-(Cys-L-SO1861).sup.4). Trastuzumab-(Cys-L-SO1861).sup.4 was titrated on a fixed concentration of 5 pM cetuximab-saporin (EGFR targeting antibodyprotein toxin conjugate) and targeted protein toxin mediated cell killing on HER2/EGFR expressing cells (SK-BR-3: HER2.sup.++/EGFR.sup.+/) was determined as illustrated in
[0417] HER2.sup.++/EGFR.sup.+/ expressing cells. This shows that trastuzumab conjugated SO1861 efficiently enhances endosomal escape of the cetuximab conjugated protein toxin (at non-effective concentrations), thereby inducing cell killing of HER2.sup.++/EGFR.sup.+/ expressing cells.
[0418] Next, cetuximab-saporin was titrated on a fixed concentration of 2.5 nM trastuzumab-(Cys-L-SO1861).sup.4 and 75 nM trastuzumab-(Cys-L-SO1861).sup.4 and targeted protein toxin mediated cell killing on
[0419] HER2/EGFR expressing cells (SK-BR-3: HER2.sup.++/EGFR.sup.+/) was determined. This revealed that 2.5 nM trastuzumab-(Cys-L-SO1861).sup.4 in combination with low concentrations cetuximab-saporin induced already efficient cell killing in SK-BR-3 cells (SK-BR-3: IC50=1 pM;
[0420] Next, trastuzumab-(Cys-L-SO1861).sup.4 was titrated on a fixed concentration of 5 pM cetuximab-saporin and targeted protein toxin mediated cell killing on JIMT-1 (HER2.sup.+//EGFR.sup.+/) and MDA-MB-468 (HER2-/EGFR.sup.++) cells was determined. Both cell lines were not sensitive for the combination of trastuzumab-(Cys-L-SO1861).sup.4+5 PM cetuximab-saporin (JIMT-1: IC50>1000 nM; MDA-MB-468: IC50>1000 nM;
[0421]
[0422] Next, cetuximab-saporin was titrated on a fixed concentration of 2.5 nM trastuzumab-(Cys-L-SO1861).sup.4 and targeted protein toxin mediated cell killing on JIMT-1 (HER2.sup.+//EGFR.sup.+/) and MDA-MB-468 (HER2/EGFR.sup.++ cells was determined. Both cell lines showed cell killing at similar cetuximab-saporin concentrations with or without 2.5 nM trastuzumab-(Cys-L-SO1861).sup.4 (JIMT-1: IC50=80 pM; MDA-MB-468: IC50=100 pM;
[0423] All this shows that cells with low or no HER2 receptor expression are not susceptible for the combination of trastuzumab-(Cys-L-SO1861).sup.4+ cetuximab-saporin, due to a lack of sufficient HER2 receptor that facilitates the antibodymediated delivery of sufficient SO1861 (threshold) to ensure endosomal escape of the toxin within the cytoplasm of the cell.
Example 3
[0424] In order to show that the activity of the conjugated SO1861 is driven by the acidification of the endosomal compartments, the 2T2 components system, according to the invention was tested in combination with an endosomal acidification inhibitor, chloroquine. Trastuzumab-saporin+77 nM cetuximab-(Cys-L-SO1861).sup.3,9 or trastuzumab-dianthin+77 nM cetuximab-(Cys-L-SO1861).sup.3,9 showed strong cell killing activity in A431 (EGFR.sup.++/HER2.sup.+/) cells, whereas this 2T2C activity, according to the invention, was inhibited when 800 nM chloroquine was co-administrated to both combinations (
Example 4
[0425] The 2 target 2-components system (2T2C) is also the combination treatment of mAb1-SO1861 and mAb2-antisense BNA oligo nucleotide, (
[0426] Next, Trastuzumab-(Lys-L-HSP27BNA).sup.4,4 was titrated on a fixed concentration of Cetuximab-(Cys-L-SO1861).sup.3,9 and targeted HSP27BNA-mediated gene silencing activity was determined in A431 (EGFR.sup.++/HER2.sup.+/) cells and A2058 (EGFR-/HER2.sup.+/) cells as illustrated in
[0427]
Example 5
[0428] The 2 target 2-components system (2T2C) can also be the combination treatment of mAb1-(dendron(SO1861).sup.n).sup.n and mAb2-protein toxin (
[0429] Next, dendron(L-SO1861).sup.4 was conjugated to the anti-HER2 antibody, trastuzumab via cysteine conjugation (Cys) with a DAR4, trastuzumab-Cys-(dendron(L-SO1861).sup.4).sup.4 and tested for enhanced cell killing activity in combination with an anti-CD71 antibody protein toxin conjugate (CD71mab-saporin) in SK-BR-3 cells (HER2.sup.++/CD71.sup.+) expressing cells. Trastuzumab-Cys-(dendron(L-SO1861).sup.4).sup.4+10 pM CD71mab-saporin efficiently induces toxin-mediated cell killing in SK-BR3 cells (IC50=3 nM,
Example 6
[0430] The clinical approved ADC, trastuzumab-emtansine (T-DM1) is a conjugate of the anti-Her2 antibody, trastuzumab and the small molecule toxin emtansine (DAR3-4). T-DM1 was tested within the 2T2C system, according to the invention in combination with cetuximab-(Cys-L-SO1861).sup.4. T-DM1+77 nM cetuximab-(Cys-L-SO1861).sup.3,9 showed no enhanced cell killing activity compared to T-DM1 alone or T-DM1+77 nM cetuximab (IC50=80.000 pM,
Example 7
Results
[0431] The 2 target 2-components system (1T2C) can also be the combination treatment of mAb1-QSmix (mixture of saponins from Quillaja Saponaria) and mAb2-protein toxin.
[0432] QSmix-EMCH was conjugated via cysteine residues (Cys) to cetuximab (monoclonal antibody recognizing and binding human EGFR), with a DAR 4,1 (cetuximab-(Cys-L-QSmix).sup.4,1). Cetuximab-(Cys-L-QSmix).sup.4,1 was titrated on a fixed concentration of 10 pM trastuzumab-saporin or CD71mab-saporin and targeted protein toxin mediated cell killing on A431 (EGFR.sup.++/HER2.sup.+//CD71.sup.+) and CaSKi (EGFR+/HER2.sup.+//CD71.sup.+) was determined. This revealed strong cell killing at low concentrations of Cetuximab-(Cys-L-QSmix) 4,1+10 pM trastuzumab-saporin (A431: IC50=100 nM;
[0433] This shows that relatively low concentrations of cetuximab-QSmix conjugate efficiently enhances endosomal escape of the trastuzumab conjugated protein toxin as well as the CD71mab conjugated protein toxin (at non-effective concentrations), thereby inducing efficient cell killing of EGFR.sup.++/HER2.sup.+//CD71.sup.+ or EGFR+/HER2.sup.+//CD71.sup.+ expressing cells. When the same experiment was performed on A2058 cells (EGFR-/HER2.sup.+//CD71.sup.+) no activity of cetuximab-(Cys-L-QSmix) 4,1+10 pM trastuzumab-saporin or cetuximab-(Cys-L-QSmix) 4,1+10 pM CD71mab-saporin could be observed (
Example 8
[0434]
[0435] Trastuzumab and cetuximab do not or hardly influence cell viability for most of the cell lines when exposed to these antibodies, with some effect on cell growth inhibition via blocking the function of the HER2 growth factor receptor when SK-BR-3 cells are exposed to trastuzumab at relatively high dose and with some effect on cell growth inhibition via blocking the function of the EGFR growth factor receptor when MDA-MB-468 cells are exposed to cetuximab at relatively high dose.
[0436] TDM-1, or ado-trastuzumab emtansine, is a targeted therapy approved by the U.S. Food and Drug Administration to treat: HER2-positive metastatic breast cancer that has previously been treated with Herceptin (chemical name: trastuzumab) and taxane chemotherapy; early-stage HER2-positive breast cancer after surgery if residual disease was found after neoadjuvant (before surgery) treatment with Herceptin and taxane chemotherapy. The TDM-1 is a combination of Herceptin (Trastuzumab) and the chemotherapy medicine emtansine.
[0437] The free toxins saporin and dianthin and the toxin saporin coupled to a control IgG with no affinity for any of the cell surface molecules on the cell lines tested, do not or hardly have any influence on cell viability over a wide range of concentrations toxin tested, up to 100.000 pM (
Example 9
dendron(L-SO1861).sup.n synthesis (
Materials and Methods
Abbreviations
[0438] DCM dichloromethane [0439] DIPEA N, N-diisopropylethylamine [0440] DMF N, N-dimethylformamide [0441] EDCI.HCl 3-((Ethylimino) methyleneamino)-N,N-dimethylpropan-1-aminium chloride [0442] EMCH.TFA N-(&-maleimidocaproic acid) hydrazide, trifluoroacetic acid salt [0443] min minutes [0444] r.t. retention time [0445] TCEP tris (2-carboxyethyl) phosphine hydrochloride [0446] Temp temperature [0447] TFA trifluoroacetic acid [0448] THF tetrahydrofuran
Analytical methods
LC-MS method 1, 1
[0449] Apparatus: Agilent 1200 Bin. Pump: G1312A, degasser; autosampler, ColCom, DAD: Agilent G1316A, 210, 220 and 220-320 nm, PDA: 210-320 nm, MSD: Agilent LC/MSD G6130B ESI, pos/neg 100-1000; ELSD Alltech 3300 gas flow 1.5 ml/min, gas temp: 40 C.; column: Waters XSelect CSH C18, 302.1 mm, 3.5 m, Temp: 35 C., Flow: 1 mL/min, Gradient: t.sub.0=5% A, t.sub.1.6 min=98% A, t.sub.3 min=98% A, Posttime: 1.3 min, Eluent A: 0.1% formic acid in acetonitrile, Eluent B: 0.1% formic acid in water.
LC-MS method 2, 2
[0450] Apparatus: Agilent 1260 Bin. Pump: G7112B, Multisampler, Column Comp, DAD: Agilent G7115A, 210, 220 and 220-320 nm, PDA: 210-320 nm, MSD: Agilent LC/MSD G6130B ESI, mass ranges depending on the molecular weight of the product: [0451] .sup.Apos/neg 100-1000 [0452] .sup.Bpos/neg 100-1400;
[0453] ELSD Alltech 3300 gas flow 1.5 ml/min, gas temp: 40 C.; column: Waters XSelect C18, 302.1 mm, 3.5 m, Temp: 40 C., Flow: 1 mL/min, Gradient: t.sub.0=5% A, t.sub.1.6 min=98% A, t.sub.3 min=98% A, Posttime: 1.3 min, Eluent A: 0.1% formic acid in acetonitrile, Eluent B: 0.1% formic acid in water.
LC-MS method 3, 3
[0454] Apparatus: Waters IClass; Bin. Pump: UPIBSM, SM: UPISMFTN with SO; UPCMA, PDA: UPPDATC, 210-320 nm, SQD: ACQ-SQD2 ESI, pos/neg 800-1500; ELSD: gaspressure 40 psi, drift tube temp: 50 C.; column: Waters XSelect CSH C18, 502.1 mm, 2.5 m Temp: 25 C., Flow: 0.6 mL/min, Gradient: to =5% A, t.sub.2.0 min=98% A, t.sub.2.7 min=98% A, Posttime: 0.3 min, Eluent A: acetonitrile, Eluent B: 10 mM ammonium bicarbonate in water (pH=9.5).
LC-MS method 4, 4
[0455] Apparatus: Waters IClass; Bin. Pump: UPIBSM, SM: UPISMFTN with SO; UPCMA, PDA: UPPDATC, 210-320 nm, SQD: ACQ-SQD2 ESI, pos/neg 1500-2500; ELSD: gaspressure 40 psi, drift tube temp: 50 C.; column: Waters XSelect CSH C18, 502.1 mm, 2.5 m Temp: 25 C., Flow: 0.6 mL/min, Gradient: to =15% A, t.sub.2.0 min=60% A, t.sub.2.7 min=98% A, Posttime: 0.3 min, Eluent A: acetonitrile, Eluent B: 10 mM ammonium bicarbonate in water (pH=9.5).
LC-MS method 5, 5
[0456] Apparatus: Waters IClass; Bin. Pump: UPIBSM, SM: UPISMFTN with SO; UPCMA, PDA: UPPDATC, 210-320 nm, SQD: ACQ-SQD2 ESI, mass ranges depending on the molecular weight of the product: Apos/neg 1500-2500 Bneg 2000-3000; ELSD: gaspressure 40 psi, drift tube temp: 50 C.; column: Acquity C18, 502.1 mm, 1.7 m Temp: 60 C., Flow: 0.6 mL/min, Gradient: t.sub.0=2% A, t.sub.5.0 min=50% A, t.sub.6.0 min=98% A, Posttime: 1.0 min, Eluent A: acetonitrile, Eluent B: 10 mM ammonium bicarbonate in water (pH=9.5).
Preparative methods
Preparative MP-LC method 1, 1
[0457] Instrument type: Reveleris prep MPLC; column: Waters XSelect CSH C18 (14525 mm, 10u); Flow: 40 mL/min; Column temp: room temperature; Eluent A: 10 mM ammoniumbicarbonate in water pH=9.0); Eluent B: 99% acetonitrile+1% 10 mM ammoniumbicarbonate in water; Gradient: t.sub.0min=5% B, timin=5% B, t.sub.2 min=10% B, t.sub.17 min=50% B, t.sub.18 min=100% B, t.sub.23 min=100% B; Detection UV: 210, 225, 285 nm.
Preparative MP-LC method 2, 2
[0458] Instrument type: Reveleris prep MPLC; Column: Phenomenex LUNA C18 (3) (15025 mm, 10u); Flow: 40 mL/min; Column temp: room temperature; Eluent A: 0.1% (v/v) Formic acid in water, Eluent B: 0.1% (v/v) Formic acid in acetonitrile; Gradient: t.sub.0min=5% B, t.sub.1 min=5% B, t.sub.2 min=10% B, t.sub.17 min=50% B, t.sub.18 min=100% B, t.sub.23 min=100% B; Detection UV: 210, 225, 285 nm.
Preparative LC-MS method 1, 3
[0459] MS instrument type: Agilent Technologies G6130B Quadrupole; HPLC instrument type: Agilent Technologies 1290 preparative LC; Column: Waters XSelect CSH (C18, 10030 mm, 10u); Flow: 25 ml/min; Column temp: room temperature; Eluent A: 100% acetonitrile; Eluent B: 10 mM ammonium bicarbonate in water pH=9.0; lin. gradient depending on the polarity of the product: [0460] .sup.At.sub.0=20% A, t.sub.2 min=20% A, t.sub.8.5 min=60% A, t.sub.10 min=100% A, t.sub.13 min=100% A [0461] .sup.Bt.sub.0=5% A, t.sub.2 min=5% A, t.sub.8.5 min=40% A, t.sub.10 min=100% A, t.sub.13 min=100% A
[0462] .sup.Ct.sub.0=10% A, t.sub.2 min=10% A, t.sub.8.5 min=50% A, t.sub.10 min=100% A, t.sub.13 min=100% A; Detection: DAD (220-320 nm); Detection: MSD (ESI pos/neg) mass range: 100-800; Fraction collection based on DAD.
Preparative LC-MS method 2, 4
[0463] MS instrument type: Agilent Technologies G6130B Quadrupole; HPLC instrument type: Agilent Technologies 1290 preparative LC; column: Waters XBridge Shield (C18, 15019 mm, 5u); Flow: 25 ml/min; Column temp: room temperature; Eluent A: 100% acetonitrile; Eluent B: 10 mM ammonium bicarbonate in water pH=9.0; lin. gradient: t.sub.0=5% A, t.sub.2.5 min=5% A, t.sub.11 min=40% A, t.sub.13 min=100% A, t.sub.17 min=100% A; Detection: DAD (220-320 nm); Detection: MSD (ESI pos/neg) mass range: 100-800; Fraction collection based DAD
Flash chromatography
[0464] Grace Reveleris X2 C.-815 Flash; Solvent delivery system: 3-piston pump with auto-priming, 4 independent channels with up to 4 solvents in a single run, auto-switches lines when solvent depletes;
[0465] maximum pump flow rate 250 mL/min; maximum pressure 50bar (725 psi); Detection: UV 200-400 nm, combination of up to 4 UV signals and scan of entire UV range, ELSD; Column sizes: 4-330g on instrument, luer type, 750g up to 3000g with optional holder.
SO1861-EMCH synthesis (
[0466] To SO1861 (121 mg, 0.065 mmol) and EMCH.TFA (110 mg, 0.325 mmol) was added methanol (extra dry, 3.00 mL) and TFA (0.020 mL, 0.260 mmol). The reaction mixture stirred at room temperature. After 1.5 hours the reaction mixture was subjected to preparative MP-LC.1 Fractions corresponding to the product were immediately pooled together, frozen and lyophilized overnight to give the title compound (120 mg, 90%) as a white fluffy solid. Purity based on LC-MS 96%. [0467] LRMS (m/z): 2069 [M1] 1 [0468] LC-MS r.t. (min): 1.084
[0469] Quillaja Saponaria Saponin-EMCH (as depicted in
Dendron(L-SO1861).sup.4 synthesis (
Intermediate 1:
di-tert-butyl (((6-azidohexanoyl) azanediyl)bis(ethane-2,1-diyl)) dicarbamate
[0470] 6-azidohexanoic acid (0.943 g, 6.00 mmol), EDCI.HCl (1.21 g, 6.30 mmol) and Oxyma Pure (0.938 g, 6.60 mmol) were dissolved in DMF (10.0 mL) and the mixture was stirred for 5 min. Next a solution of di-tert-butyl (azanediylbis (ethane-2,1-diyl)) dicarbamate (1.82 g, 6.00 mmol) in DMF (5.00 mL) was added and the reaction mixture was stirred at room temperature. After 5 hours the reaction mixture was evaporated in vacuo and the residue was dissolved in ethyl acetate (50 mL). The resulting solution was washed with 1N potassium bisulphate solution (50 mL), saturated sodium bicarbonate solution (250 mL) and brine (50 mL), dried over Na.sub.2SO4, filtered and evaporated in vacuo. The residue was purified by flash chromatography (ethyl acetate-heptane gradient, 10:90 rising to 100:0) to give the title compound (2.67 g, 100%) as a white solid. Purity based on LC-MS 98%.
[0471] LRMS (m/z): 287/343/465 [M-155/M-99/M+23] 1.sup.+
[0472] LC-MS r.t. (min): 2.022A
Intermediate 2:
N,N-bis(2-aminoethyl)-6-azidohexanamide dihydrochloride
[0473] To di-tert-butyl (((6-azidohexanoyl) azanediyl)bis(ethane-2,1-diyl)) dicarbamate (2.66 g, 6.00 mmol) was added HCl in isopropanol (5-6 N, 20.0 mL, 110 mmol) and the reaction mixture was stirred at room temperature. After 4 hours, the reaction mixture was evaporated in vacuo and the resulting crude product was co-evaporated with DCM (320 mL) to give the crude title product (1.49 g, 79%) as a white solid.
[0474] LRMS (m/z): 243 [M+1] 1+
Intermediate 3:
tetra-tert-butyl ((5S,5'S)-((((6-azidohexanoyl) azanediyl)bis(ethane-2,1-diyl)) bis (azanediyl)) bis (6-oxohexane-6,1,5-triyl)) tetracarbamate
[0475] To a solution of N,N-bis(2-aminoethyl)-6-azidohexanamide dihydrochloride (1.19 g, 3.76 mmol) in DMF (30.0 mL) and DIPEA (2.62 mL, 15.1 mmol) was added Boc-Lys (Boc)-ONp (3.69 g, 7.90 mmol) and the mixture was stirred at room temperature overnight. The reaction mixture was evaporated in vacuo and the residue was dissolved in ethyl acetate (100 mL). The resulting solution was washed with 1N potassium bisulphate solution (100 mL) and saturated sodium bicarbonate solution (5100 mL), dried over Na.sub.2SO4, filtered and evaporated in vacuo. The residue was purified by flash chromatography (DCM-methanol/DCM (1/9, v/v) gradient 100:0 rising to 0:100) to give the give the title product (3.07 g, 91%) as a slightly yellowish solid. Purity based on LC-MS 94%.
[0476] LRMS (m/z): 800/900/922 [M-99/M+1/M+23] 1.sup.+
[0477] LC-MS r.t. (min): 2.172A
Intermediate 4:4
nitrophenyl 3-(acetylthio) propanoate 4-Nitrophenyl trifluoroacetate (5.17 g, 22.0 mmol) and 3-(Acetylthio) propionic Acid (2.96 g, 20.0 mmol) were dissolved in DCM (50.0 mL). Next, DIPEA (6.97 mL, 40.0 mmol) was added and the reaction mixture was stirred at room temperature overnight. The reaction mixture was evaporated in vacuo and the residue was dissolved in ethyl acetate (50 mL). The resulting solution was washed with 1N potassium bisulphate solution (50 mL), saturated sodium bicarbonate solution (550 mL) and brine (50 mL), dried over Na.sub.2SO4, filtered and evaporated in vacuo. The residue was purified by flash chromatography (DCM-methanol/DCM (1/9, v/v) gradient 100:0 rising to 0:100) to give the give the title product (4.90 g, 91%) as a slightly yellowish solid. Purity based on LC-MS 99%.
[0478] LRMS (m/z): 292 [M+23] 1+
[0479] LC-MS r.t. (min): 1.942A
Intermediate 5:
(S)-2,6-diamino-N-(2-(6-azido-N-(2-((S)-2,6
[0480] diaminohexanamido) ethyl) hexanamido) ethyl) hexanamide tetrahydrochloride tetra-tert-butyl ((5S,5'S)-((((6-azidohexanoyl) azanediyl)bis(ethane-2,1-diyl)) bis (azanediyl)) bis (6-oxohexane-6,1,5-triyl)) tetracarbamate (1.80 g, 2.00 mmol) was dissolved in HCl in isopropanol (5-6N, 50.0 ml, 275 mmol) and the reaction mixture was stirred at room temperature overnight. The reaction mixture was evaporated in vacuo and the resulting crude product was co-evaporated with DCM (320 mL) to give the crude title product as a white solid.
[0481] LRMS (m/z): 250 [M+2] 2+, 500 [M+1] 1+
Intermediate 6:
(2S)-2,6-bis[3-(acetylsulfanyl) propanamido]-N-[2-(6-azido-N-{2-[(2S)-2,6-bis[3-(acetylsulfanyl) propanamido] hexanamido] ethyl} hexanamido) ethyl] hexanamide
[0482] To a solution of(S)-2,6-diamino-N-(2-(6-azido-N-(2-((S)-2,6-diaminohexanamido) ethyl) hexanamido) ethyl) hexanamide tetrahydrochloride (1.29 g, 2.00 mmol) in DMF (30 mL) and DIPEA (3.48 mL, 20.0 mmol) was added 4-nitrophenyl 3-(acetylthio) propanoate (2.26 g, 8.40 mmol) and the reaction mixture was stirred at room temperature over the weekend. The reaction mixture was evaporated in vacuo and the residue was dissolved in DCM/methanol (95:5, v/v, 100 mL). The resulting solution was washed with 1N potassium bisulphate solution (100 mL), 1 N sodium hydroxide solution (3100 mL) and brine (100 mL), dried over Na.sub.2SO4, filtered and evaporated in vacuo. The residue was purified by flash chromatography (DCM-methanol/DCM (1/9, v/v) gradient 100:0 rising to 0:100) to give the title product (1.33 g, 65%) as a white solid. On LC-MS an impurity (15%) was found with m/z values corresponding to the product with one deprotected thioacetate group. The impurity was formed during or after work-up. Purity based on LC-MS 85%.
[0483] LRMS (m/z): 510 [M+2] 2+, 1019/1041 [M+1/M+23] 1+
[0484] LC-MS r.t. (min): 1.862B
Intermediate 7:
N,N-((9S,19S)-14-(6-aminohexanoyl)-1-mercapto-9-(3-mercaptopropanamido)-3,10,18-trioxo-4,11,14,17-tetraazatricosane-19,23-diyl) bis(3-mercaptopropanamide) formate
[0485] Scaffold 2 (102 mg, 0.100 mmol) was dissolved in methanol (1.00 ml). Next, a freshly prepared 1 N Sodium hydroxide solution (0.440 ml, 0.440 mmol) was added and the reaction mixture was stirred at room temperature. After 30 min a 1.0 M trimethylphosphine solution in THF (0.500 ml, 0.500 mmol) was added and the resulting mixture was stirred at room temperature. After 30 min the reaction mixture was evaporated in vacuo and co-evaporated with methanol (210 mL). The residue was dissolved in a mixture of methanol/water (9:1, v/v, 1.00 mL) and the resulting solution was subjected to preparative MP-LC.2 Fractions corresponding to the product were immediately pooled together, frozen and lyophilized overnight to give the title compound (75.6 mg, 87%) as a colorless sticky oil. Purity based on LC-MS 96%.
[0486] LRMS (m/z): 513 [M+2] 2+, 825 [M+1] 1.sup.+
[0487] LC-MS r.t. (min): 1.422A
Intermediate 8:
dendron(L-SO1861).sup.4-amine
[0488] N,N-((9S, 19S)-14-(6-aminohexanoyl)-1-mercapto-9-(3-mercaptopropanamido)-3,10,18-trioxo-4,11,14,17-tetraazatricosane-19,23-diyl) bis(3-mercaptopropanamide) formate (2.73 mg, 3.13 mol) was dissolved in a mixture of 20 mM NH.sub.4HCO.sub.3 with 0.5 mM TCEP/acetonitrile (3:1, v/v, 3.00 mL). Next, SO1861-EMCH (29.2 mg, 0.014 mmol) was added and the reaction mixture was stirred at room temperature. After 1.5 hours the reaction mixture was subjected to preparative LC-MS..sup.3B Fractions corresponding to the product were immediately pooled together, frozen and lyophilized overnight to give the title compound (12.3 mg, 43%) as a white fluffy solid. Purity based on LC-MS 97%. LRMS (m/z): 1517 [M-6] 6-, 1821 [M-5] 5-, 2276 [M-4] 4
[0489] LC-MS r.t. (min): 4.395A
Intermediate 9:
dendron(L-SO1861).sup.4-azide
[0490] Dendron (SO1861).sup.4-amine (6.81 mg, 0.748 mol) and 2,5-dioxopyrrolidin-1-yl 1-azido-3,6,9,12-tetraoxapentadecan-15-oate (2.90 mg, 7.48 mol) were dissolved in DMF (1.00 mL). Next, DIPEA (1.302 uL, 7.48 mol) was added and the mixture was shaken for 1 min and left standing at room temperature. After 2 hours the reaction mixture was subjected to preparative LC-MS.30 Fractions corresponding to the product were immediately pooled together, frozen and lyophilized overnight to give the title compound (5.86 mg, 84%) as a white fluffy solid. Purity based on LC-MS 90%.
[0491] LRMS (m/z): 2344 [M-4] 4-LC-MS r.t. (min): 4.785B Intermediate 10:
[0492] dendron(L-SO1861).sup.4-maleimide1
[0493] Dendron (SO1861).sup.4-amine (8.12 mg, 0.891 mol) and 2,5-dioxopyrrolidin-1-yl 1-(2,5-dioxo-2,5-dihydro-1H-pyrrol-1-yl)-3,6,9,12-tetraoxapentadecan-15-oate (3.94 mg, 8.91 mol) were dissolved in DMF (1.00 mL). Next, DIPEA (1.55 L, 8.91 mol) was added and the mixture was shaken for 1 min and left standing at room temperature. After 3 hours the reaction mixture was subjected to preparative LC-MS..sup.3C Fractions corresponding to the product were immediately pooled together, frozen and lyophilized overnight to give the title compound (6.76 mg, 80%) as a white fluffy solid. Purity based on LC-MS 66%.
[0494] LRMS (m/z): 2358 [M-4] 4
[0495] LC-MS r.t. (min): 2.136 C.
Intermediate 11:
dendron(L-SO1861).sup.4-maleimide2
[0496] Scaffold 2 (5.10 mg, 5.00 mol) was dissolved in methanol (100 uL). Next, a freshly prepared 1 N Sodium hydroxide solution (22.0 L, 22.0 mol) was added and the mixture was shaken for 1 min and left standing at room temperature. After 30 min a 1.0 M trimethylphosphine solution in THF (25.0 L, 25.0 mol) was added and the resulting mixture was shaken for 1 min and left standing at room temperature. After 30 min the reaction mixture was evaporated in vacuo and co-evaporated with methanol (25 mL). The resulting residue was dissolved in a mixture of 20 mM NH.sub.4HCO.sub.3 with 0.5 mM TCEP/acetonitrile (3:1, v/v, 3.242 mL). From this solution, directly, 1000 L was added to SO1861-EMCH (14.4 mg, 6.94 mol, 4.5 equiv. compared to the scaffold) and the mixture was shaken for 1 min and left standing at room temperature. After 10 min the reaction mixture was lyophilized overnight. To the resulting residue 2,5-Dioxopyrrolidin-1-yl 3-(2-(2-(3-(2,5-dioxo-2h-pyrrol-1 (5h)-yl) propanamido) ethoxy) ethoxy) propanoate (5.84 mg, 0.014 mmol) and DMF (1.00 mL) were added. Next, DIPEA (2.39 L, 0.014 mmol) was added and the suspension was shaken for 1 min and left standing at room temperature. After 2 hours the reaction mixture was subjected to preparative LC-MS.30 Fractions corresponding to the product were immediately pooled together, frozen and lyophilized overnight to give the title compound (10.9 mg, 85%) as a white fluffy solid. Purity based on LC-MS 80%.
[0497] LRMS (m/z): 2354 [M-4] 4
[0498] LC-MS r.t. (min): 4.165B
Dendron(L-SO1861) 8 synthesis (
Intermediate 1:
tert-butyl N-[(1S)-1-{[(1S)-1-{[2-(6-azido-N-{2-[(2S)-2,6-bis[(2S)-2,6-bis ({[(tert-butoxy) carbonyl]amino}) hexanamido] hexanamido] ethyl} hexanamido) ethyl]carbamoyl}-5-[(2S)-2,6-bis ({[(tert-butoxy) carbonyl]amino}) hexanamido] pentyl]carbamoyl}-5-{[(tert-butoxy) carbonyl]amino} pentyl]carbamate
[0499] (S)-2,6-diamino-N-(2-(6-azido-N-(2-((S)-2,6-diaminohexanamido) ethyl) hexanamido) ethyl) hexanamide tetrahydrochloride (964 mg, 1.50 mmol) was dissolved in DMF (25.0 mL) and triethylamine (2.08 mL, 15.0 mmol). Next, Boc-Lys (Boc)-ONp (3.36 g, 7.18 mmol) was added and the reaction mixture was stirred at room temperature overnight. The reaction mixture was evaporated in vacuo and the residue was purified by flash chromatography (DCM-methanol/DCM (1/9, v/v) gradient 100:0 rising to 0:100) to give the title product (2.71 g, 100%) as a white solid. Purity based on
[0500] LC-MS 97%.
[0501] LRMS (m/z): 807 [M-198] 2.sup.+
[0502] LC-MS r.t. (min): 2.352B
Intermediate 2:
(2S,2'S)-N,N-((5S,15S,22S)-22,26-diamino-10-(6-azidohexanoyl)-15-((S)-2,6-diaminohexanamido)-6,14,21-trioxo-7,10,13,20-tetraazahexacosane-1,5-diyl) bis(2,6-diaminohexanamide) octahydrochloride
[0503] Intermediate 1 (2.71 g, 1.50 mmol) was dissolved in HCl in isopropanol (5-6N, 25.0 ml, 138 mmol) and the reaction mixture was stirred at room temperature overnight. Next, the reaction mixture was evaporated in vacuo and the resulting crude product was co-evaporated with DCM (320 mL) to give the crude title product as a white solid.
[0504] LRMS (m/z): 203/254 [M-200/M+4] 4+, 338 [M+3] 3+, 507 [M+2] 2+, 1012 [M+1] 1+
Intermediate 3:
(2S)-2,6-bis[3-(acetylsulfanyl) propanamido]-N-[(1S)-1-{[2-(6-azido-N-{2-[(2S)-2,6-bis[(2S)-2,6-bis [3-(acetylsulfanyl) propanamido] hexanamido] hexanamido] ethyl} hexanamido) ethyl]carbamoyl}-5-[(2S)-2,6-bis[3-(acetylsulfanyl) propanamido] hexanamido] pentyl] hexanamide
[0505] To (2S,2'S)-N,N-((5S, 15S,22S)-22,26-diamino-10-(6-azidohexanoyl)-15-((S)-2,6-diaminohexanamido)-6, 14,21-trioxo-7, 10, 13,20-tetraazahexacosane-1,5-diyl) bis(2,6-diaminohexanamide) octahydrochloride (300 mg, 0.230 mmol) was added DMF (20.0 mL), triethylamine (320 ul, 2.30 mmol) and 4-nitrophenyl 3-(acetylthio) propanoate (595 mg, 2.21 mmol). The resulting suspension was sonicated at 60 C. for 30 min and left stirring at room temperature overnight. The reaction mixture was evaporated in vacuo and the residue was purified by first performing flash chromatography (DCM-methanol/DCM (1/9, v/v) gradient 100:0 rising to 0:100), followed by preparative MP-LC2 to give the title product (70 mg, 15%) as a white solid. Purity based on LC-MS 100%.
[0506] LRMS (m/z): 685 [M+3] 3.sup.+
[0507] LC-MS r.t. (min): 1.912A
Intermediate 4:
(2S)-N-[(1S)-1-{[2-(6-amino-N-{2-[(2S)-2,6-bis[(2S)-2,6-bis (3-sulfanylpropanamido) hexanamido] hexanamido] ethyl} hexanamido) ethyl]carbamoyl}-5-[(2S)-2,6-bis (3-sulfanylpropanamido) hexanamido] pentyl]-2,6-bis (3-sulfanylpropanamido) hexanamide formate
[0508] Scaffold 4 (10.0 mg, 4.87 mol) was dissolved methanol (200 uL). Next, a freshly prepared 1 N Sodium hydroxide solution (42.9 L, 0.043 mmol) was added and the resulting mixture was shaken for 1 min and left standing at room temperature. After 30 min a 1.0 M trimethylphosphine solution in THF (24.4 L, 0.024 mmol) was added and the resulting mixture was shaken for 1 min and left standing at room temperature. After 30 min the reaction mixture was diluted with water (1 mL) and directly subjected to preparative MP-LC.2 Fractions corresponding to the product were immediately pooled together, frozen and lyophilized overnight to give the title compound (4.02 mg, 48%) as a white fluffy solid.
[0509] LRMS (m/z): 564 [M+3] 3+, 846 [M+2] 2.sup.+
[0510] LC-MS r.t. (min): 1.542C
Intermediate 5:
dendron(L-SO1861) 8-amine
[0511] Scaffold 5 (0.52 mg, 0.299 mol) and SO1861-EMCH (29.2 mg, 0.014 mmol) were dissolved in a mixture of 20 mM NH.sub.4HCO.sub.3 with 0.5 mM TCEP/acetonitrile (3:1, v/v, 1.00 mL) and the resulting mixture was shaken for 1 min and left standing at room temperature. After 30 min TCEP (0.30 mg, 1.05 mol) was added and the reaction mixture was shaken for 1 min. Next, the mixture was directly subjected to preparative LC-MS.3B Fractions corresponding to the product were immediately pooled together, frozen and lyophilized overnight to give the title compound (2.17 mg, 40%) as a white fluffy solid. Purity based on LC-MS 97%.
[0512] LRMS (m/z): 2282 [M-8] 8-, 2607 [M-7] 7
[0513] LC-MS r.t. (min): 4.415A
Example 10
[0514] Tumor sample gene silencing analysis HSP27BNA oligo
[0515] HSP27BNA with linkers oligos (sequence 5-GGCacagccagtgGCG-3) 39 were ordered at Bio-Synthesis Inc. (Lewisville, Texas) RNA isolation and gene expression analyses
[0516] RNA from cells was isolated and analysed according to standard protocols (Biorad)
[0517] RNA isolation and gene expression analyses of tumor samples from mice
[0518] Total RNA was isolated from tumors using TriZol (Thermo Fisher) according to the manufacturer's instructions. Isolated RNA was resuspended in nuclease-free water (NFW). RNA samples were checked for their RNA integrity on the gel. To prepare cDNA, first 100 ng total RNA was mixed with Random Hexamers (Qiagen; final concentration 2 M) in a final volume of 12.5 l in NFW, denatured for 5 min at 70 C. and immediately cooled on ice. Next, 7.5 l of a cDNA synthesis mix was added, consisting of 4 l 5RT Buffer (Promega), 0.4 l 25 mM dNTPs (Promega), 1 l 200 U/L MMLV RT-enzyme (Promega), 0.5 L 40 U/L RNAse Inhibitor (Promega) and 1.6 L NFW. The following cDNA synthesis protocol was used: 1) 10 minutes 25 C. 2) 60 minutes 37 C. 3) 5 minutes 85 C. 4) 4 C.
[0519] For a single qPCR reaction the following mix was prepared: 1 L cDNA, 0.05 L forward primer (250 M), 0.05 L reverse primer (250 M), 8.9 l LNFW, 10 l SYBR Green (Bio-Rad). The following qPCR protocol was used: 1 cycle: 5 minutes 95 C., 40 cycles: 15s 95 C. +30s 60 C.
[0520] HSP27 gene expression was calculated using 2-(CtHSP27-GEOMEAN (Ctref1;Ctref2;Ctrer3;tref4), where ref1, ref2, ref3 and ref4 are the reference genes IMMT, EIF2S2, GUSB and UBC for the analysis of the tumors. Four reference genes were chosen based on the performance of a GeNORM analysis among nine reference genes tested to choose the most ideal and stable reference gene for this tumor samples. To do so, qPCR results were imported in Qbase+software program by which two quality measures are calculated: the coefficient of variation of the normalized reference gene expression levels (V); and the geNorm stability M-value (M) 1. A reference gene with an M<0.2 and a V<0.15 is considered very stable. Based on this analysis IMMT and EIF2S2 were chosen as the most stable reference genes. However, UBC and GUSB were also added to the group of reference genes to further enhance the accuracy of the normalization. Each sample was analyzed as technical triplicate on a CFX96 Real-Time qPCR machine (Bio-Rad).
TABLE-US-00007 TABLE1 PrimersusedinqPCRareshownbelow: Gene Primer Sequence(5-3) UBC Forward CAGCCGGGATTTGGGTCG Reverse CACGAAGATCTGCATTGTCAAGT GUSB Forward TGCGTAGGGACAAGAACCAC Reverse GGGAGGGGTCCAAGGATTTG IMMT Forward AACCCACACCTGCACTTTCA Reverse TTTTCCTGTTGTGCAAGGCG EIF2S2 Forward CCACAAGTCGTCCGAGTAGG Reverse GGAGATGTTTGGGCTGACGA HSP27 Forward GCAGTCCAACGAGATCACCA Reverse TAAGGCTTTACTTGGCGGCA
Example 11
Conjugate synthesis
[0521] Trastuzumab (Herceptin), cetuximab (Erbitux) and T-DM1 (Kadcyla) were purchased from the pharmacy (Charite, Berlin). CD71 monoclonal antibody was purchased from BioCell (Okt9, #BE0023). SO1861 was isolated and purified by Analyticon Discovery GmbH from raw plant extract obtained from Saponaria officinalis L. Quillaja Saponaria saponin extract (QSmix) was purchased (Sigma Aldrich, #S4521) materials
[0522] Trastuzumab (Tras, Herceptin, Roche), Cetuximab (Cet, Erbitux, Merck KGaA), Tris (2-carboxyethyl) phosphine hydrochloride (TCEP, 98%, Sigma-Aldrich), 5,5-Dithiobis (2-nitrobenzoic acid) (DTNB, Ellman's reagent, 99%, Sigma-Aldrich), Zeba Spin Desalting Columns (2 mL, Thermo-Fisher), NuPAGE 4-12% Bis-Tris Protein Gels (Thermo-Fisher), NuPAGE MES SDS Running Buffer (Thermo-Fisher), Novex Sharp Pre-stained Protein Standard (Thermo-Fisher), PageBlue Protein
[0523] Staining Solution (Thermo-Fischer), Pierce BCA Protein Assay Kit (Thermo-Fisher), N-Ethylmaleimide (NEM, 98%, Sigma-Aldrich), 1,4-Dithiothreitol (DTT, 98%, Sigma-Aldrich), Sephadex G25 (GE Healthcare), Sephadex G50 M (GE Healthcare), Superdex 200P (GE Healthcare), Isopropyl alcohol (IPA, 99.6%, VWR), Tris (hydroxymethyl) aminomethane (Tris, 99%, Sigma-Aldrich), Tris (hydroxymethyl) aminomethane hydrochloride (Tris.HCL, Sigma-Aldrich), L-Histidine (99%, Sigma-Aldrich), D-(+)-Trehalose dehydrate (99%, Sigma-Aldrich), Polyethylene glycol sorbitan monolaurate (TWEEN 20, Sigma-Aldrich), Dulbecco's Phosphate-Buffered Saline (DPBS, Thermo-Fisher), Guanidine hydrochloride (99%, Sigma-Aldrich), Ethylenediaminetetraacetic acid disodium salt dihydrate (EDTA-Na2, 99%, Sigma-Aldrich), sterile filters 0.2 m and 0.45 m (Sartorius), Succinimidyl 4-(N-maleimidomethyl) cyclohexane-1-carboxylate (SMCC, Thermo-Fisher), Dianthin-Cys (Dia-Cys, Dianthin mutant with a single C-terminal cysteine function, Proteogenix), Vivaspin T4 and T15 concentrator (Sartorius), Superdex 200PG (GE Healthcare), Tetra (ethylene glycol) succinimidyl 3-(2-pyridyldithio) propionate (PEG.sub.4-SPDP, Thermo-Fisher), HSP27 BNA disulfide oligonucleotide (Biosynthesis), [O-(7-Azabenzotriazol-1-yl)-N,N,N,N-tetramethyluronium-hexafluorphosphat] (HATU, 97%, Sigma-Aldrich), Dimethyl sulfoxide (DMSO, 99%, Sigma-Aldrich), N-(2-Aminoethyl) maleimide trifluoroacetate salt (AEM, 98%, Sigma-Aldrich), L-Cysteine (98.5%, Sigma-Aldrich), deionized water (DI) was freshly taken from Ultrapure Lab Water Systems (MilliQ, Merck), Nickel-nitrilotriacetic acid agarose (Ni-NTA agarose, Protino), Glycine (99.5%, VWR), 5,5-Dithiobis (2-nitrobenzoic acid (Ellman's reagent, DTNB, 98%, Sigma-Aldrich), S-Acetylmercaptosuccinic anhydride Fluorescein (SAMSA reagent, Invitrogen) Sodium bicarbonate (99.7%, Sigma-Aldrich), Sodium carbonate (99.9%, Sigma-Aldrich), PD MiniTrap desalting columns with Sephadex G-25 resin (GE Healthcare), PD10 G25 desalting column (GE Healthcare), Zeba Spin Desalting Columns in 0.5, 2, 5, and 10 mL (Thermo-Fisher), Vivaspin Centrifugal Filters T4 10 kDa MWCO, T4 100 kDa MWCO, and T15 (Sartorius), Biosep s3000 aSEC column (Phenomenex), Vivacell Ultrafiltration Units 10 and 30 kDa MWCO (Sartorius), Nalgene Rapid-Flow filter (Thermo-Fisher),
Methods
MALDI-TOF-MS
[0524] Matrix-assisted laser desorption/ionization time of flight (MALDI-TOF) spectra were recorded on a MALDI-Mass Spectrometer (Bruker Ultrafex III). Typically, the sample dissolved in MilliQ water in nanomole to micromole range was spotted on the target (MTP 384 target plate polished steel T F, Bruker Daltons) using either super-DHB (99%, Fluka) or sinapinic acid (SA, 99%, Sigma-Aldrich) as the matrix that was dissolved in acetonitrile (MADLI-TOF-MS tested, Sigma)/0.1% TFA (7:3 v/v) via the dried-droplet-method. PepMix (Peptide Calibration Standard, Bruker Daltons) or ProteoMass (Protein Calibration Standard, Sigma-Aldrich) served as calibration standards. RP mode refers to reflector positive mode. RN mode refers to reflector negative mode. LP mode refers to linear positive mode.
Dialysis
[0525] Regenerated cellulose membranes: MWCO=1 and 2 kDa (Spectra/Por), and MWCO=12-14 kDa (Carl Roth) were used to perform dialysis. Typically, dialysis was carried out for 24 h with 1 L of solvent that was exchanged after first 6 h of the process.
Lyophilization
[0526] Freeze-drying was performed on an Alpha 1-2 LD plus (Martin Christ Gefriertrocknungsanlagen GmbH). Typically, samples were frozen with liquid nitrogen and placed into the freeze-dryer at high vacuum. UV-Vis
[0527] Absorbance measurements were performed on a Perkin Elmer Lambda 25 UV-Vis or on a Thermo NanoDrop ND-2000 spectrophotometer in the spectral range of 200-750 nm.
[0528] Concentrations were determined using a Thermo Nanodrop 2000 or Lambda 25 spectrometer using the following parameters: [0529] Trastuzumab OD.sub.280=1.5 (mg/ml).sup.1 cm.sup.1 [0530] Cetuximab OD.sub.280=1.4 (mg/ml).sup.1 cm.sup.1 [0531] HSP27 Oligonucleotide OD.sub.260=153,000 M.sup.1 cm.sup.1; RZ260: 280=1.819 [0532] Dia-Cys OD.sub.280=0.57 (mg/ml).sup.1 cm.sup.1 [0533] PEG.sub.4-SPDP (PDT) OD.sub.343=8,080 M.sup.1 cm.sup.1 [0534] SAMSA-Fluorescein OD.sub.495=64,500 M.sup.1 cm.sup.1; RZ280: 495=0.232 [0535] Ellmans (TNB) OD.sub.412=14,150 M.sup.1 cm.sup.1
Immobilized metal ion affinity chromatography (IMCA)
[0536] Nickel-nitrilotriacetic acid (Ni-NTA) chromatography was performed to purify histidine-tagged protein and protein-conjugates. Briefly, Ni-NTA agarose (10 mL) was pipetted into a gravity flow column for 5 mL bed volume. The resin was washed with 20 mL deionized water and recharged with 5 mL of 100 mM NiSO4 solution. The resin was washed again five times with 5 mL deionized water and equilibrated five times with DPBS. The protein solution was incubated with the washed Ni-NTA agarose rotating at 4 C. for 30 min. Afterwards, the Ni-NTA protein solution was pipetted back into the gravity flow column.
[0537] The flow through was collected and the resin was washed three times with 5 mL DPBS. The immobilized sample was then eluted by increasing the imidazole concentration from 50 mL of 125 mM, pH 8 to 50 mL of 250 mM, pH 8. Elution fractions were dialyzed against PBS pH 7.4 to obtain the purified sample. Size Exclusion Chromatography
[0538] Size exclusion chromatography (SEC) was carried out on an AKTA purifier. Samples were analyzed by SEC using either a Biosep SEC-S3000 column or an Sephadex G50M column (1040 cm) eluting with TBS/isopropyl alcohol solution (85:15 v/v). Sample purities were determined by integration of the antibody sample peak with respect to the trace aggregate peaks.
Ellman's assay
[0539] Ellman's test (or Ellman's assay) was carried out to quantitatively determine thiol concentration in a sample via spectrophotometry. Presence of thiols was indicated via the stoichiometric release of the 2-nitro-5-thiobenzoate (TNB) from Ellman's reagent in the presence of thiols. TNB obtains an absorption maximum at 412 nm and an extinction coefficient of OD.sub.412=14, 150 M.sup.1 cm.sup.1 in buffered systems. Briefly, 2 L of a 0.5 mg/mL solution of the Ellman's reagent (5,5-Dithiobis (2-nitrobenzoic acid), DTNB) in phosphate buffer (0.1 M, 1 mM EDTA, pH 7.4) was mixed with 20 L of a thiol containing sample in buffer. The mixture was vortexed for 5 sec. Then, UV-Vis absorbance at 412 nm was measured on a Thermo Nanodrop 2000 to determine TNB concentration and thus thiol content of the sample.
Dianthin production
[0540] Dianthin was expressed in a bacterium culture and the protein was purified following conventional cell culturing and protein purification steps known in the art.
Production of Saporin conjugates
[0541] Custom trastuzumab-saporin cetuximab-saporin, CD71mab-saporin conjugates were produced and purchased from Advanced Targeting Systems (San Diego, CA). IgG-saporin and saporin was purchased from Advanced Targeting Systems Conjugate Syntheses
Antibody-(Cys-dendron-(L-SO1861) ) synthesis
[0542] Trastuzumab and Cetuximab are referred hereafter as Ab. Ab was conjugated to dendritic saponin [dendron-(L-SO1861).sup.4-maleimide] via a tetra (ethylene glycol) succinimidyl 3-(2-pyridyldithio) propionate (PEG.sub.4-SPDP) linker conducting a thiole-ene Michael-type reaction between Ab and dendritic saponin. The procedure is exemplary described for Cetuximab-(S-dendron-(L-SO1861).sup.4) 4:
[0543] Cetuximab was desalted into DPBS pH 7.5 buffer and then normalized to 2.50 mg/ml. To an aliquot of Ab (9.19 mg, 61 nmol) was added an aliquot of freshly prepared PEG.sub.4-SPDP solution (5.0 mg/ml, 6.70 mole equivalents, 411 nmol), the mixture vortexed briefly then incubated for 60 minutes at 20 C. with roller-mixing. After incubation, the reaction was quenched with the addition of glycine (20 mg/ml, 7.7 l), then the SPDP moiety reduced in situ by the addition of TCEP (5.0 mg/ml, 4.0 mole equivalents per SPDP, 1.64 mol). This mixture was roller-mixed for 15 minutes at 20 C. with roller-mixing. The resulting Ab-SH was purified by gel filtration using a zeba spin desalting column into TBS pH 7.5. The Ab-SH was characterized by UV-vis analysis and Ellman's assay (thiol to Ab ratio=5.4). To the bulk Ab-SH (7.41 mg, 1.93 mg/ml, 49 nmol) was added an aliquot of freshly prepared dendron-(L-SO1861).sup.4-maleimide solution in DMSO (10 mg/ml, 8.0 mole equivalents per Ab, 0.4 mol, 3.16 mg, 0.32 ml), the mixture vortexed briefly then incubated overnight at 20 C. Besides the conjugation reaction, two aliquots of the desalted Ab-SH (0.25 mg, 1.67 nmol) were removed prior to conjugation, and were reacted with NEM (8.0 mole equivalents per Ab, 13.3 nmol, 6.7 l of a 0.25 mg/ml solution) or TBS pH 7.5 buffer (6.7 l) overnight at 20 C., as positive and negative controls, respectively. After incubation for 18 hours (prior to addition of NEM), the crude conjugate mixture was centrifuged briefly and 100 l aliquot removed for analysis by UV-vis and alongside positive and negative controls were characterized by Ellman's assay to obtain dendron-(L-SO1861).sup.4 incorporation. To the bulk Ab-dendron-(L-SO1861).sup.4 mixture was added an aliquot of freshly prepared NEM solution (2.5 mg/ml, 5.0 mole equivalents, 0.25 mol) and the mixture purified by 1.630 cm Sephadex G50 column eluting with DPBS pH 7.5 to give purified Cetuximab-(S-dendron-(L-SO1861).sup.4).sup.4 conjugate. The product was filtered to 0.2 m to clarify and then concentrated carefully to ca. 3 mg/ml using a vivaspin T15 concentrator (3,000 g, 5 minute intervals, 5 C.) to give the final Cetuximab-(S-dendron (L-SO1861).sup.4).sup.4 conjugate. Yield: 4.41 mg, 48%. Dendron(L-SO1861).sup.4 to Ab ratio=4.4.
TABLE-US-00008 TABLE 2 Summarized reaction outcomes PEG.sub.4- Dendron(SO1861).sup.4- Purity by Ab feed SPDP mol maleimide mol Obtained analytical Batch (mg) equivalents equivalents DAR SEC Yield Trastuzumab- 9.0 6.81 8 4.7 99.2% 2.34 mg (Cys-dendron- (26%) (L-SO1861).sup.4).sup.4 Cetuximab- 9.2 6.7 8 4.4 96.7% 4.41 mg (Cys-dendron- (48%) (L-SO1861).sup.4).sup.4
Antibody-(L-SO1861).sup.4 (as illustrated in
[0544] Trastuzumab, Cetuximab, are referred hereafter as Ab. Ab was conjugated to the saponin SO18161-EMCH via Michael-type thiol-ene conjugation reaction at DARs of 1, 2, 3, 4, 5, and 6. The SO1861-EMCH molecule obtains a labil (L) hydrazone bond between its structure and its maleimide function generating a labil bond between the saponin and Ab. The procedure is exemplary described for Trastuzumab-(L-SO1861) 4:
[0545] To a solution of Cetuximab (40 mg, 8.0 ml) was added 10 l/ml each of Tris concentrate (127 mg/ml, 1.05M), Tris.HCl concentrate (623 mg/ml, 3.95M) and EDTA-Na2 concentrate (95 mg/ml, 0.26M) to give a 50 mM TBS, 2.5 mM EDTA buffer pH 7.5.
[0546] To Cetuximab divided into four portions (each of 9.73 mg, 4.864 mg/ml, 65 nmol) was added an aliquot of freshly prepared TCEP solution (0.5-2.0 mg/ml, 1.15-7.02 mole equivalents, 75-455 nmol), the mixtures vortexed briefly then incubated for 300 minutes at 20 C. with roller-mixing. After incubation (prior to addition of SO1861-EMCH), a ca. 1 mg (0.210 ml) aliquot of Ab-SH was removed from each mixture and purified by gel filtration using a zeba spin desalting column into TBS pH 7.5. These aliquots were characterized by UV-vis analysis and Ellman's assay (thiol to Ab ratio=2.0, 4.2, 5.9 and 6.8 respectively). To each of the bulk Ab-SH was added an aliquot of freshly prepared SO1861-EMCH solution (2 mg/ml, 1.3 mole equivalents per thiol, 0.15-0.61 mol, 0.16-0.63 ml), the mixtures vortexed briefly then incubated for 120 minutes at 20 C. Besides each conjugation reaction, two aliquots of desalted Ab-SH (0.25 mg, 1.67 nmol) were reacted with NEM (1.3 mole equivalents per thiol, 4.3-17.4 nmol, 2.2-8.7 l of a 0.25 mg/ml solution) or TBS pH 7.5 buffer (2.2-8.7 l) for 120 minutes at 20 C., as positive and negative controls, respectively. After incubation (prior to addition of NEM), a 0.200 ml aliquot of Ab-SO1861-EMCH mixture was removed and purified by gel filtration using zeba spin desalting column into TBS pH 7.5. This aliquot was characterized by UV-vis and alongside positive and negative controls were characterized by Ellman's assay to obtain SO1861-EMCH incorporations. To the bulk Ab-SO1861-EMCH mixture was added an aliquot of freshly prepared NEM solution (2.5 mg/ml, 2.5-10 mole equivalents, 0.15-0.58 mol) and the mixtures purified by zeba spin desalting columns eluting with DPBS pH 7.5 to give purified Cetuximab-(L-SO1861) conjugates. The products were normalized to 2.5 mg/ml and filtered to 0.2 m prior to dispensing for biological evaluation.
TABLE-US-00009 TABLE 3 Summarized reaction conditions and results for Trastuzumab-L-SO1861 conjugates TCEP Purity by feed mole SO1861- Obtained analytical Yield Batch Ab feed equivalents EMCH feed DAR SEC (%) (%) Tras- 9.91 mg 1.10 0.15 mol 1.6 99.2 79 (L-SO1861).sub.2 66 nmol Tras- 9.91 mg 2.35 0.31 mol 3.0 99.0 81 (L-SO1861).sub.3 66 nmol Tras- 9.91 mg 3.83 0.46 mol 4.0 98.4 81 (L-SO1861)4 66 nmol Tras- 9.91 mg 5.77 0.62 mol 5.3 98.5 79 (L-SO1861).sub.5 66 nmol
TABLE-US-00010 TABLE 4 Summarized reaction conditions and results for Cetuximab-L-SO1861 conjugates TCEP Purity by feed mole SO1861- Obtained analytical Yield Batch Ab feed equivalents EMCH feed DAR SEC (%) (%) Cet- 9.73 mg 1.15 0.15 mol 1.4 99.7 74 (L-SO1861).sub.1 65 nmol Cet- 9.73 mg 2.49 0.31 mol 2.8 99.6 80 (L-SO1861).sub.3 65 nmol Cet- 9.73 mg 4.19 0.46 mol 4.1 99.0 77 (L-SO1861).sub.4 65 nmol Cet- 9.73 mg 7.02 0.61 mol 5.6 98.3 80 (L-SO1861).sub.6 65 nmol
Antibody-(S-SO1861).sup.n synthesis
SO1861-S-Mal
[0547] SO1861 from Saponaria officinalis L (15.4 mg, 8.28 mol) and HATU (140 mg, 368 mol, 44.5 mole equivalents) were placed as solid into a 20 mL glas vial with magnetic stirrer and 5 mL DMSO was added to dissolve the materials. The dissolved mixture was stirred for 30 min at room temperature. After 30 min, 1 mL of freshly prepared AEM solution (65 mg, 256 mol, 31 mole equivalents) in DMSO was added to the stirring SO1861-HATU mixture. The reaction mixture was stirred for 17 hours at room temperature. After stirring for 17 hours, the mixture was diluted with deionized water and dialyzed extensively for 24 h against deionized water using regenerated cellulose membrane tubes (Spectra/Por 7) with a MWCO of 1 kDa. After dialysis, the solution was lyophilized to obtain a white powder. Yield: 7.22 mg (44%).
[0548] Dried aliquots were further used for characterization via MALDI-TOF-MS.
[0549] MALDI-TOF-MS (RN mode): m/z 1983 Da ([M-H]-, SO1861-S-Mal conjugate), 2136 Da ([M-H]-, saponin-S-Mal conjugate).
[0550] MALDI-TOF-MS (RP mode): m/z 2007 Da ([M+Na].sup.+, SO1861-S-Mal conjugate), 2107 Da ([M-Na].sup.+, saponin-S-Mal conjugate).
[0551] Maleimide functionality was verfied by mixing the purified SO1861-S-Mal with a freshly prepared L-cysteine solution (1000 mole excess) and observing the expected mass shift in MALDI-TOF-MS yielding a cysteine-conjugate at m/z 2103 Da.
Antibody conjugation
[0552] Trastuzumab and Cetuximab are referred hereafter as Ab. Ab was conjugated to the saponin SO18161-S-Mal via Michael-type thiol-ene conjugation reaction. The saponin obtains a stable(S) amide bond between its structure and its maleimide function generating a stable bond between the saponin and Ab. 5 mg of Ab dissolved in phosphate buffer saline (PBS) was buffer exchanged into tris (hydroxymethyl)-aminomethan buffer saline (TBS) pH 7.5 via zeba spin desalting column and normalized to a concentration of 3 mg/mL. To Ab was added an aliquot of freshly prepared tris (2-carboxyethyl) phosphine (TCEP) solution (0.25 mg/mL, 2.92 mole equivalents), the mixture vortexed briefly then incubated for 90 min at 20 C. After, the resulting Ab-SH was purified by gel filtration using zeba spin desalting column into TBS pH 7.5. An aliquot was analyzed by Ellman's assay to ascertain sulfhydryl content. The Ab-SH obtained was split into a single portion for conjugation and two aliquots of 0.25 mg for controls. To the main portion of AB-SH was added an aliquot of freshly prepared SO1861-S-Mal solution (2 mg/mL, 2 mol equivalents with respect to sulhydryl content), to the second control aliquot was added buffer TBS pH 7.5. Each mixture was vortexed briefly then incubated for 2 hours at 20 C. After, an aliquot from each was analyzed by Ellman's assay to ascertain sulfhydryl content remaining in the conjugate with respect to controls. After purification by gel filtration via zeba spin desalting column into Dulbecco's PBS pH 7.1, Ab-S-SO1861 was obtained. The conjugate was further analyzed by SEC to ascertain % purity. For the Trastuzumab-(S-SO1861).sup.4 sample a purity of 99% was determined. For the Cetuximab-(S-SO1861).sup.4 sample a purity of 98.3% was determined. Retention volumes for Trastuzumab-(S-SO1861).sup.4 (9.1 mL) and Cetuximab-(S-SO1861).sup.4 (8.8 mL) were noted to be similar and are consistent with a non-modified Ab (e.g. IgG).
Antibody-(L-HSP27 BNA) n
[0553] Trastuzumab-(L-HSP27).sup.4,, Cetuximab-(L-HSP27).sup.4, synthesis via PEG.sub.4-SPDP with a DAR4 and Cetuximab-(L-HSP27) 2 synthesis via PEG.sub.4-SPDP with a DAR2
[0554] Trastuzumab, Cetuximab, are referred hereafter as Ab. Ab was conjugated to HSP27 BNA disulfide via a tetra (ethylene glycol) succinimidyl 3-(2-pyridyldithio) propionate (PEG.sub.4-SPDP) linker forming a labil (L) disulfide bond between Ab and HSP27 BNA. The procedure is exemplary described for Trastuzumab-(L-HSP27 BNA) 4:
[0555] HSP27 BNA disulfide oligo (2.7 mg, 470 nmol, 6.10 mg/ml) was reacted with TCEP (10 mole equivalents, 4.7 mol, 1.34 mg, 50 mg/ml) for 30 minutes at 20 C. with roller mixing. After, the oligo-SH was purified by PD10 G25 desalting column eluting into TBS pH 7.5 and used promptly. Oligo-SH was obtained (2.48 mg, 90%, 1.24 mg/ml, SH to oligo ratio=0.8)
[0556] Trastuzumab (1.5 mg, 10.3 nmol, 2.50 mg/ml) was reacted with an aliquot of freshly prepared PEG.sub.4-SPDP solution (6.81 mole equivalents, 70.1 nmol, 39 ug) in DMSO (1 mg/ml) for 60 minutes at 20 C. with roller mixing. After, the reaction was quenched with glycine (15.1 l of 2 mg/ml freshly prepared solution in TBS pH 7.5) and then desalted via zeba desalting column eluting with TBS pH 7.5. An aliquot of the resulting Tras-S-PEG.sub.4-SPDP was taken out and tested by UV-Vis analysis. SPDP incorporation was determined using TCEP to liberate pyridiyl-2-thione (PDT) and by UV-vis analysis at 343 nm (SPDP to Ab ratio: 4). The remaining Tras-(S-PEG.sub.4-SPDP).sup.4 was reacted with an aliquot of freshly prepared HSP27 oligonucleotide (oligo-SH) (8 mole equivalents, 82.4 nmol, 1.24 mg/ml) and incubated overnight at 20 C. with roller mixing. After 17 hours, the conjugate was analysed by UV-vis analysis to ascertain incorporation of HSP27 by displacement of pyridiyl-2-thione (PDT) at 343 nm. The crude conjugate was purified using a 1.633 cm Sephadex G50 column eluting with DPBS pH 7.5. The resulting Trastuzumab-(L-HSP27).sup.4 was obtained as a single fraction. Yield: n.d . . . . Purity: 96%, HSP27 BNA to Ab ratio=4.4
TABLE-US-00011 TABLE 5 Summarized reaction conditions and results PEG.sub.4- HSP27 SPDP (oligo- mol SH) mol Purity by equiv- equiv- Obtained analytical Yield Batch alents alents DAR SEC (%) (%) Tras- 6.81 8 4.4 96.0 n.d. (L-HSP27 BNA).sup.4 Cet- 6.70 8 3.9 93.9 n.d. (L-HSP27 BNA).sup.4 Cet- 2.3 3.6 1.5 94.9 87 (L-HSP27).sup.2 n.d. = not determined
Antibody-(L-HSP27 BNA-L-blocked).SUP.n
Trastuzumab-(L-HSP27-L-blocked).SUP.4.,, Cetuximab-(L-HSP27-L-blocked)
[0557] Trastuzumab and Cetuximab are referred hereafter as Ab. Ab was conjugated a maleimido (Mal) bearing HSP27 derivate which is referred hereafter as HSP27-Mal. Ab was conjugated to the HSP27-Mal via Michael-type thiol-ene conjugation reaction. The HSP17-Mal obtains a labile (L) hydrazone bond between its structure and its maleimide function generating a labile bond between the HSP27 BNA and Ab. The procedure is exemplary described for Trastuzumab-(L-HSP27 BNA-L-blocked) n:
[0558] Trastuzumab was reconstituted to 21 mg/ml with deionized water (DI), then diluted to 5 mg/ml using histidine buffer pH 6. To a 20 mg (4.0 ml) aliquot was added 10 l/ml each of Tris concentrate (127 mg/ml, 1.05M), Tris.HCl concentrate (623 mg/ml, 3.95M) and EDTA-Na2 concentrate (95 mg/ml, 0.26M) to give a 50 mM TBS, 2.5 mM EDTA buffer pH 7.5. To Trastuzumab (20.30 mg, 4.920 mg/ml, 0.14 mol) was added an aliquot of freshly prepared TCEP solution (1.00 mg/ml, 2.35 mole equivalents, 0.32 mol), the mixture vortexed briefly then incubated for 90 minutes at 20 C. with roller-mixing. After incubation (prior to addition of HSP27-Mal), a ca. 2 mg (0.439 ml) aliquot of Ab-SH was removed from each mixture and purified by gel filtration using a zeba spin desalting column into TBS pH 7.5. This aliquot was characterized by UV-vis analysis and Ellman's assay (thiol to ab ratio=4.0). To the bulk Ab-SH (5.1 mg, 35 nmol) was added an aliquot of the HSP27-Mal derivative (freshly prepared in TBS pH 7.5, 2 mg/ml, 1.3 mole equivalents per thiol, 182 nmol), the mixture vortexed briefly then incubated for 120 minutes at 20 C. Besides the Trasuzumab-HSP27 BNA derivative conjugation reaction, two aliquots of desalted Ab-SH (0.5 mg, 3.3 nmol) were reacted with NEM (1.3 mole equivalents per thiol, 17.3 nmol, 6.7 l of a 0.25 mg/ml solution) or TBS pH 7.5 buffer (6.7 l) for 120 minutes at 20 C., as positive and negative controls, respectively. After incubation (prior to addition of NEM), a 0.100 ml aliquot of AbHSP27 BNA mixture was removed and purified by gel filtration using zeba spin desalting column into TBS pH 7.5. This aliquot was characterized by UV-vis and alongside positive and negative controls was characterized by Ellman's assay to obtain HSP27 incorporation. To the bulk Ab-HSP27 mixture was added an aliquot of freshly prepared NEM solution (0.25 mg/ml, 2.5 mole equivalents, 89 nmol) and the mixture purified by gel filtration using a 1.630 cm Sephadex G50M eluting with DPBS pH 7.5 followed by repeated centrifugal filtration and washing using a 100 KDa MWCO concentrator to give purified Trastuzumab-(L-HSP27-L-blocked).sup.4 conjugate. The products were filtered to 0.2 m prior to dispensing for biological evaluation.
TABLE-US-00012 TABLE 6 Summarized reaction conditions and results Thiol HSP27- Purity by Ab-SH to Ab Mal Obtained analytical Yield Batch feed ratio feed DAR SEC (%) (%) Tras- 5.1 mg 3.98 1.36 mg 3.6 99.4 40 (L-HSP27 35 nmol BNA- L-blocked).sup.4 Cet- 5.1 mg 4.16 1.36 mg 3.6 97.9 50 (L-HSP27 35 nmol BNA- L-blocked).sup.4
Antibody-[Cys-Trifunctional linker-(L-SO1861)-(L-HSP27 BNA)] n
Trastuzumab-[S-Tri-(L-SO1861)-(L-HSP27)] 4, Trastuzumab-[S-Tri-(blocked)-(L-HSP27)] 4, Cetuximab-[S-Tri-(L-SO1861)-(L-HSP27)] 4, Cetuximab-[S-Tri-(blocked)-(L-HSP27)] 4
[0559] Trastuzumab and Cetuximab are referred hereafter as Ab. Ab was conjugated via Michael-type thiol-ene reaction to two different maleimide (Mal) bearing HSP27 BNA derivatives which are referred hereafter as HSP27-Mal. These HSP27-Mal derivatives were namely: 1) Mal-Trifunctional linker-(L-SO1861)-(L-HSP27), 2) Mal-Trifunctional linker-(blocked)-(L-HSP27). The procedure is exemplary described for Trastuzumab-[S-Trifunctional linker-(L-SO1861)-(L-HSP27 BNA)] 4:
[0560] Trastuzumab was reconstituted to 21 mg/ml with deionized water (DI), then diluted to 5 mg/ml using histidine buffer pH 6. To a 20 mg (4.0 ml) aliquot was added 10 l/ml each of Tris concentrate (127 mg/ml, 1.05M), Tris.HCl concentrate (623 mg/ml, 3.95M) and EDTA-Na2 concentrate (95 mg/ml, 0.26M) to give a 50 mM TBS, 2.5 mM EDTA buffer pH 7.5.
[0561] To Trastuzumab (20.30 mg, 4.920 mg/ml, 0.14 mol) was added an aliquot of freshly prepared TCEP solution (1.00 mg/ml, 2.35 mole equivalents, 0.32 mol), the mixture vortexed briefly then incubated for 90 minutes at 20 C. with roller-mixing. After incubation (prior to addition of construct), a ca. 2 mg (0.439 ml) aliquot of Ab-SH was removed from each mixture and purified by gel filtration using a zeba spin desalting column into TBS pH 7.5. These aliquots were characterized by UV-vis analysis and Ellman's assay (thiol to ab ratio=4.0). The bulk Ab-SH was split into two aliquots (1.1 mg, 7.6 nmol and 1.2 mg, 8.3 nmol), and to each aliquot was added an aliquot of each of the HSP27 BNA-Mal derivatives 1-2 (freshly prepared in TBS pH 7.5, 2 mg/ml, 1.3 mole equivalents per thiol, 40 nmol and 43 nmol), the mixtures vortexed briefly then incubated for 120 minutes at 20 C. Besides the Trasuzumab-HSP27
[0562] BNA derivatives 2 conjugation reaction, two aliquots of desalted Ab-SH (0.5 mg, 3.3 nmol) were reacted with NEM (1.3 mole equivalents per thiol, 17.3 nmol, 6.7 l of a 0.25 mg/ml solution) or TBS pH 7.5 buffer (6.7 l) for 120 minutes at 20 C., as positive and negative controls, respectively. After incubation (prior to addition of NEM), a 0.100 ml aliquot of Ab-construct 2 mixture was removed and purified by gel filtration using zeba spin desalting column into TBS pH 7.5. This aliquot was characterized by UV-vis and alongside positive and negative controls was characterized by Ellman's assay to obtain HSP27 BNA derivatives 2 incorporation. To each bulk Ab-construct mixture was added an aliquot of freshly prepared NEM solution (0.25 mg/ml, 2.5 mole equivalents, 19 and 21 nmol) and the mixtures purified by gel filtration using a 1.630 cm Sephadex G50M eluting with DPBS pH 7.5 followed by repeated centrifugal filtration and washing using a 100 KDa MWCO concentrator to give purified Trastuzumab-construct 1-2 conjugates. The products were filtered to 0.2 m prior to dispensing for biological evaluation.
TABLE-US-00013 TABLE 7 Summarized reaction conditions and results TCEP Thiol Purity by Ab-SH equiv- to ab analytical Yield Batch feed alents ratio SEC (%) (%) Tras-[S-Trifunctional 1.1 mg 2.35 3.98 97.0 57 linker-(L-SO1861)- 7.6 nmol (L-HSP27 BNA)].sup.4 Tras-[S-Trifunctional 1.2 mg 2.35 3.98 96.6 33 linker-(blocked)- 8.3 nmol (L-HSP27 BNA)].sup.4 Cet-[S-Trifunctional 1.1 mg 2.72 4.16 98.9 47 linker-(L-SO1861)- 7.6 nmol (L-HSP27 BNA)].sup.4 Cet-[S-Trifunctional 1.2 mg 2.72 4.16 99.1 50 linker-(blocked)- 8.3 nmol (L-HSP27 BNA)].sup.4
Antibody-(L-SO1861).SUP.n.-(L-HSP27 BNA) n
[0563] Trastuzumab-(L-SO1861).sup.4-(L-HSP27).sup.4, Cetuximab-(L-SO1861).sup.4-(L-HSP27).sup.4 synthesis via PEG.sub.4-SPDP with a DAR4 Cetuximab-(L-SO1861).sup.4-(L-HSP27) 2 (FBR703 STB17/7-8) synthesis via PEG.sub.4-SPDP with a DAR2
[0564] Trastuzumab-(L-SO1861).sup.4, Cetuximab-(L-SO1861).sup.4 are referred hereafter as Ab. Ab was conjugated to HSP27 BNA disulfide via a tetra (ethylene glycol) succinimidyl 3-(2 pyridyldithio) propionate (PEG.sub.4-SPDP) linker forming a labil (L) disulfide bond between Ab and HSP27 BNA. The procedure is exemplary described for Trastuzumab-(L-SO1861).sup.4-(L-HSP27).sup.4: HSP27 BNA disulfide oligo (2.7 mg, 470 nmol, 6.10 mg/ml) was reacted with TCEP (10 mole equivalents, 4.7 mol, 1.34 mg, 50 mg/ml) for 30 minutes at 20 C. with roller mixing. After, the oligo-SH was purified by PD10 G25 desalting column eluting into TBS pH 7.5 and used promptly. Oligo-SH was obtained (2.48 mg, 90%, 1.24 mg/ml, SH to oligo ratio=0.8)
[0565] Trastuzumab-(L-SO1861).sup.4 (1.3 mg, 8.7 nmol, 2.50 mg/ml) was reacted with an aliquot of freshly prepared PEG.sub.4-SPDP solution (9.26 mole equivalents, 80.3 nmol, 45 ug) in DMSO (1 mg/ml) for 60 minutes at 20 C. with roller mixing. After, the reaction was quenched with glycine (15.1 l of 2 mg/ml freshly prepared solution in TBS pH 7.5) and then desalted via zeba desalting column eluting with TBS pH 7.5. An aliquot of the resulting Tras-(L-SO1861)-(L-PEG.sub.4-SPDP) was taken out and tested by UV-Vis analysis. SPDP incorporation was determined using TCEP to liberate pyridiyl-2-thione (PDT) and by UV-vis analysis at 343 nm (SPDP to Ab ratio=4). The remaining Tras-(L-SO1861)-(L-PEG.sub.4-SPDP) was reacted with an aliquot of freshly prepared HSP27 oligonucleotide (oligo-SH) (8 mole equivalents, 54.8 nmol, 0.32 mg, 1.24 mg/ml) and incubated overnight at 20 C. with roller mixing. After 17 hours, the conjugate was analyzed by UV-vis analysis to ascertain incorporation of HSP27 by displacement of pyridiyl-2-thione (PDT) at 343 nm. The crude conjugate was purified using a 1.633 cm Sephadex G50 column eluting with DPBS pH 7.5. The resulting Trastuzumab-(L-SO1861).sup.4-(L-HSP27 BNA).sup.4 was obtained as a single fraction. Yield: 0.47 mg, 45% (0.49 mg/ml), HSP27 to Ab ratio=3.5
TABLE-US-00014 TABLE 8 Summarized reaction conditions and results PEG.sub.4- HSP27 SPDP (oligo- mol SH) mol Purity by equiv- equiv- Obtained analytical Yield Batch alents alents DAR SEC (%) (%) Tras- 9.26 8 3.5 85.1 45 (L-SO1861).sup.4- (L-HSP27 BNA).sup.4 Cet- 7.21 8 3.8 80.8 n.d. (L-SO1861).sub.4- (L-HSP27 BNA).sup.4 Cet- 3.34 3.6 1.8 76.2 81 (L-SO1861).sub.4- (L-HSP27 BNA).sup.2 n.d. = not determined
[0566] Antibody-(L-QS Mix) n
[0567] Trastuzumab, Cetuximab, are referred hereafter as Ab. Ab was conjugated to the saponin QS Mix-EMCH via Michael-type thiol-ene conjugation reaction. The procedure is exemplary described for Trastuzumab-L-QS Mix:
[0568] Trastuzumab (Ab, 600 mg) was reconstituted to 21 mg/mL with deionized water (DI), then diluted to 5 mg/mL using freshly prepared histidine buffer pH 6 (5 mM histidine pH 6, 2% trehalose, 0.01% Tween 20). 10 L/mL each of Tris concentrate (127 mg/mL, 1.05M), Tris.HCL concentrate (623 mg/ml, 3.95M) and EDTA-Na2 concentrate (95 mg/ml, 0.26M) was added to give a 50 mM TBS, 2.5 mM EDTA buffer pH 7.5. To Trastuzumab (603.8 mg, 4.887 mg/mL, 4.0 mol) was added an aliquot of freshly prepared TCEP solution (1 mg/mL, 2.35 mole equivalents, 9.5 mol, 2.72 mg), the mixture swirled by hand to mix then incubated for 90 minutes at 20 C. with roller-mixing. After incubation (prior to addition of QS Mix-EMCH), a 2 mg (0.409 mL) aliquot of Ab-SH was removed and purified by gel filtration using zeba spin desalting column into TBS pH 7.5. This aliquot was characterized by UV-vis analysis and Ellman's assay. To the bulk Ab-SH was added an aliquot of freshly prepared QS Mix-EMCH solution (2 mg/mL, 5.2 mole equivalents, 21 mol, 21.6 mL), the mixtures vortexed briefly then incubated for 120 minutes at 20 C. Besides the conjugation reaction, two aliquots of desalted Ab-SH (0.5 mg, 0.134 mL, 3.33 nmol) were reacted with NEM (8.00 equivalents, 26.6 nmol, 3.3 ug, 13.3 L of a 0.25 mg/mL solution) or TBS pH 7.5 buffer (13.3 pL) for 120 minutes at 20 C., as positive and negative controls, respectively. After incubation (prior to addition of NEM), a ca. 2 mg (0.481 mL) aliquot of Ab-QS Mix-EMCH mixture was removed and purified by gel filtration using zeba spin desalting column into TBS pH 7.5. This aliquot was characterized by UV-vis and alongside positive and negative controls were characterized by
[0569] Ellman's assay to obtain QS Mix-EMCH incorporations. To the bulk Ab-QS Mix-EMCH mixture was added an aliquot of freshly prepared NEM solution (2.5 mg/mL, 5 mole equivalents, 20 moL, 2.51 mg) and the mixture stored at 2-8 C. overnight. The conjugate was purified by 1040 cm Sephadex G50M column eluting with DPBS pH 7.5 to give purified Trastuzumab-(L-QS Mix) conjugate. The product as a whole was concentrated then normalized to 5 mg/mL using a vivacell 100 concentrator (2,000 g, 4 C., 200 minutes). The product were filtered to 0.2 m and dispensed for biological evaluation. Yield: n.d. QS Mix to Ab ratio=4.1.
TABLE-US-00015 TABLE 9 Summarized reaction outcomes Method Measure Result Analytical SEC Purity n.d. Yield Mass (percent) n.d. Ellman's assay QS Mix-EMCH incorpoation 4.1
Antibody-(L-HSP27 BNA-L-SO1861) n
[0570] Trastuzumab-(L-HSP27-L-SO1861).sup.4, Cetiximab-(L-HSP27-L-SO1861).sup.4 with a DAR4
[0571] Trastuzumab and Cetuximab are referred hereafter as Ab. Ab was conjugated a saponin SO1861 and maleimido (Mal) bearing HSP27 derivate which is referred hereafter as HSP27-Mal. Ab was conjugated to the HSP27-Mal via Michael-type thiol-ene conjugation reaction. The HSP17-Mal obtains a labile (L) hydrazone bond between its structure and its maleimide function generating a labile bond between the HSP27 BNA and Ab. The procedure is exemplary described for Trastuzumab-(L-HSP27 BNA-L-SO1861) 4:
[0572] Trastuzumab was reconstituted to 21 mg/ml with deionized water (DI), then diluted to 5 mg/ml using histidine buffer pH 6. To a 20 mg (4.0 ml) aliquot was added 10 l/ml each of Tris concentrate (127 mg/ml, 1.05M), Tris.HCl concentrate (623 mg/ml, 3.95M) and EDTA-Na2 concentrate (95 mg/ml, 0.26M) to give a 50 mM TBS, 2.5 mM EDTA buffer pH 7.5. To Trastuzumab (20.30 mg, 4.920 mg/ml, 0.14 mol) was added an aliquot of freshly prepared TCEP solution (1.00 mg/ml, 2.35 mole equivalents, 0.32 mol), the mixture vortexed briefly then incubated for 90 minutes at 20 C. with roller-mixing. After incubation (prior to addition of HSP27-Mal), a ca. 2 mg (0.439 ml) aliquot of Ab-SH was removed from each mixture and purified by gel filtration using a zeba spin desalting column into TBS pH 7.5. This aliquot was characterized by UV-vis analysis and Ellman's assay (thiol to ab ratio=4.0). To the bulk Ab-SH (4.7 mg, 32 nmol) was added an aliquot of the HSP27-Mal derivative (freshly prepared in TBS pH 7.5, 2 mg/ml, 1.3 mole equivalents per thiol, 166 nmol), the mixture vortexed briefly then incubated for 120 minutes at 20 C. Besides the Trasuzumab-HSP27 BNA derivative conjugation reaction, two aliquots of desalted Ab-SH (0.5 mg, 3.3 nmol) were reacted with NEM (1.3 mole equivalents per thiol, 17.3 nmol, 6.7 l of a 0.25 mg/ml solution) or TBS pH 7.5 buffer (6.7 l) for 120 minutes at 20 C., as positive and negative controls, respectively. After incubation (prior to addition of NEM), a 0.100 ml aliquot of AbHSP27 BNA mixture was removed and purified by gel filtration using zeba spin desalting column into TBS pH 7.5. This aliquot was characterized by UV-vis and alongside positive and negative controls was characterized by Ellman's assay to obtain HSP27 incorporation. To the bulk Ab-HSP27 mixture was added an aliquot of freshly prepared NEM solution (0.25 mg/ml, 2.5 mole equivalents, 80 nmol) and the mixture purified by gel filtration using a 1.630 cm Sephadex G50M eluting with DPBS pH 7.5 followed by repeated centrifugal filtration and washing using a 100 KDa MWCO concentrator to give purified Trastuzumab-(L-HSP27 BNA-L-SO1861).sup.4 conjugate. The products were filtered to 0.2 m prior to dispensing for biological evaluation.
TABLE-US-00016 TABLE 10 Summarized reaction conditions and results Thiol HSP27- Purity by Ab-SH to Ab Mal analytical Yield Batch feed ratio feed SEC (%) (%) Tras- 4.7 mg 3.98 1.57 mg 99.4 40 (L-HSP27 32 nmol BNA- L-SO1861).sup.4 Cet- 4.7 mg 4.16 1.57 mg 97.9 50 (L-HSP27 32 nmol BNA- L-SO1861).sup.4
Example 12
Materials and Methods
[0573] In our current work, we investigated a model scaffold consisting of four molecular arms for saponin binding via a Schiff base (imine) and one arm for click chemistry. The polymeric structure (
[0574] trifluoroacetic acid followed by 70% methanol for further 60 min) [31]. Aliquots of the fractions were analyzed for their SA1641 content by electrospray ionization mass spectrometry (ESI-MS). Fractions containing pure SA1641 were pooled and methanol evaporated. The aqueous solution was frozen as a thin film in a rotating round-bottom flask by use of dry ice. After storage for 16 h at 80 C., the sample was lyophilized. To produce the scaffold as defined in the invention, the polymeric structure (0.2 mM) and SA1641 (3.2 mM) were solved in water (approx. pH 8) and equal volumes mixed and shaken for 24 h at 26 C. Then sodium cyanoborohydride (NaCNBH.sub.3; 0.1 M) was added in 4-fold molar excess referred to SA1641 and the sample incubated for further 24 h. The structure was then verified by ultra performance liquid chromatography (UPLC)/ESI-MS. The samples were applied to a RP-C4-column and eluted with a methanol gradient (25% methanol to 80% methanol within 15 min in water supplemented with 0.01% trifluoroacetic acid followed by 80% methanol for further 10 min). The fractions were analyzed by use of LockSpray that is an ion source designed specifically for exact mass measurement with electrospray ionization using LC-time-of-flight (LC-TOF) mass spectrometers from Waters Corporation.
Results
[0575] The inset of
Example 9
Materials and methods
[0576] As an example for a pharmaceutical active substance, we used the targeted toxin dianthin-Epidermal Growth Factor (dianthin-EGF). The plasmid His-dianthin-EGF-pET11d (100 ng) was added to 20 L Escherichia coli Rosetta 2 (DE3) pLysS Competent Cells (Novagen, San Diego, CA, USA). Cells were transformed by a heat-shock (30 min on ice, 90 s at 42 C. and 1 min on ice). Thereafter, 300 L lysogeny broth (LB) was added and the suspension incubated for 1 h at 37 C. while shaking at 200 rpm. A preheated lysogeny broth agar plate with 50 g/mL ampicillin was inoculated with 100 l bacteria suspension and the plate incubated overnight at 37 C. Lysogeny broth (3 mL) with 50 g/mL ampicillin was inoculated with a colony from the plate and the bacteria were incubated for 8 h at 37 C. and 200 rpm. The suspension (50 L) was added to 500 mL of lysogeny broth with 50 g/mL ampicillin and incubated overnight at 37 C. and 200 rpm. Subsequently, the volume was scaled-up to 2.0 L and bacteria grew under the same conditions until an optical density at wavelength 600 nm of 0.9 was reached. Thereafter, protein expression was induced by the addition of isopropyl -D-1-thiogalactopyranoside (IPTG) at a final concentration of 1 mM. Protein expression lasted for 3 h at 37 C. and 200 rpm. Finally, the bacterial suspension was centrifuged at 5,000g and 4 C. for 5 min, resuspended in 20 mL PBS (137 mM NaCl, 2.7 mM KCl, 8.1 mM Na.sub.2HPO.sub.4, 1.47 mM KH.sub.2PO.sub.4) and stored at 20 C. until use. For purification, bacterial suspensions were thawed and lysed by sonication. Lysates were centrifuged (15,800g, 4 C., 30 min) and imidazole added to a final concentration of 20 mM. The supernatant was incubated with 2 mL of Ni-nitrilotriacetic acid agarose under continuous shaking for 30 min at 4 C. in the presence of 20 mM imidazole. Subsequently, the material was poured into a 20-mL-column and washed three times with 10 mL wash buffer (50 mM NaH.sub.2PO.sub.4, 300 mM NaCl, 20 mM imidazole) and dianthin-EGF eluted by 10-mL-portions of increasing concentrations of imidazole (31, 65, 125 and 250 mM) in wash buffer. Eluate fractions (2 mL) were dialyzed overnight at 4 C. against 2.0 L PBS. Desalted dianthin-EGF was concentrated by an Amicon Ultra-15 (10 kDa) and the protein concentration quantified.
[0577] To introduce a suitable click chemistry group into dianthin-EGF, alkyne-PEG5-N-hydroxysuccinimidyl ester in 8-fold molar excess referred to dianthin-EGF was solved in dimethyl sulfoxide and added to 9 volumes of dianthin-EGF (1 mg in 0.2 M NaH.sub.2PO.sub.4/Na.sub.2HPO.sub.4, pH 8). After incubation at room temperature for 4 h, non-bound alkyne was separated by use of a PD10 column (GE-Healthcare, Freiburg, Germany). Click chemistry with the polymeric structure was conducted by copper (I)-catalyzed alkyne-azide cycloaddition. Alkyne-dianthin-EGF (0.02 mM), dendrimer (0.05 mM), CuSO.sub.4 (0.1 mM), tris (3-hydroxypropyltriazolylmethyl) amine (0.5 mM) and sodium ascorbate (5 mM) were incubated under gentle agitation for 1 h at room temperature in 0.1 M NaH.sub.2PO.sub.4/Na.sub.2HPO.sub.4, pH 8. Low molecular mass substances were then separated using a PD10 column.
[0578] To test the efficacy of the invention, we conducted a viability assay with HER14 cells. These cells are fibroblasts stably transfected with the human epidermal growth factor receptor and therefore target cells for the targeted toxin dianthin-EGF. HER14 cells (2,000 cells/100 L/well) were seeded into wells of 96-well-cell culture plates and incubated for 24 h in DMEM medium supplemented with 10% fetal calf serum and 1% penicillin/streptomycin at 37 C., 5% CO.sub.2 and 98% humidity. The different test substances (see results and
Results
[0579] The polymeric structure, in the example a pentameric dendrimer (pentrimer), does not have any cytotoxic effect on the target cells, neither in absence nor in presence of SA1641 (
Example 10
Materials
[0580] The following chemicals were used as purchased: methanol (MeOH, LiChrosolv, Merck), N--maleimidocaproic acid hydrazide (EMCH, 95%, TCI Chemicals), trifluoroacetic acid (TFA, 99.8%, Carl Roth), 2-mercaptoethanol (98%, Sigma-Aldrich), poly (amidoamine) ((PAMAM dendrimer, ethylenediamine core, generation 5.0 solution, Sigma-Aldrich), cyanine 3 carboxylic acid (Cy3-COOH, 95%, Lumiprobe), 1-[Bis(dimethylamino)methylene]-1H-1,2,3-triazolo[4,5-b]pyridinium 3-oxid hexafluorophosphate, N-[(Dimethylamino)-1H-1,2,3-triazolo-[4,5-b]pyridin-1-ylmethylene]-N-methylmethanaminium hexafluorophosphate N-oxide (HATU, 97%, Sigma-Aldrich), bovine serum albumin fraction V (BSA, Carl Roth), dimethylsulfoxide (DMSO, 99%, Carl Roth), 2-Iminothiolane hydrochloride (98%, Sigma-Aldrich), rhodamine b (RhodB, 95%, Merck), Dulbecco's phosphate buffered saline (PBS, Gibco), hydrochloric acid (HCl, 37%, Merck), NHS-PEG13-DBCO (Click Chemistry Tools), Alexa Fluor 488 5-TFP (Thermo-Fischer), azido-PEG3-SS-NHS (Conju-Probe), sodium cyanoborohydride (NaCNBH3, 95%, Sigma-Aldrich), ammonium persulfate (APS, 98%, Sigma-Aldrich), N,N,N, N-tetramethylethylenediamine (TMEDA, 99%, Sigma-Aldrich), customized peptide SESDDAMFCDAMDESDSK (95%, PeptideSynthetics), azido-dPEG12-NHS (95%, Quanta Biodesign), PFd-G4-Azide-NH-BOC Dendron (G4-dendron, 95%, Polymer Factory), Cyanin5-DBCO (Cy5-DBCO, 95%, Lumiprobe), Chloroform (CHCI3, 99.5%, Sigma), Amicon Ultra 0.5 mL centrifugal filters (3 kDa MWCO, Sigma), mPEG-SCM (mPEG2k-NHS, 95.6%, Creative PEG Works), Amicon Ultra 15 ml centrifugal filters (10 kDa MWCO, Sigma).
Methods
MALDI-TOF-MS
[0581] MALDI-TOF spectra were recorded on a MALDI-Mass Spectrometer (Bruker Ultrafex III). Typically, the sample dissolved in MilliQ water in nanomolar to micromolar range was spotted on the target (MTP 384 target plate polished steel T F, Bruker Daltons) using either super-DHB (99%, Fluka) or sinapinic acid (SA, 99%, Sigma-Aldrich) as the matrix dissolved in acetonitrile (MADLI-TOF-MS tested, Sigma)/0.1% TFA (7:3 v/v) via the dried-droplet-method. PepMix (Peptide Calibration Standard, Bruker Daltons) or
[0582] ProteMass (Protein Calibration Standard, Sigma-Aldrich) served as calibration standards. RP mode refers to reflector positive mode. RN mode refers to reflector negative mode. LP mode refers to linear positive mode.
H-NMR
[0583] 1H NMR analysis was performed using a Bruker 400 MHZ NMR spectrometer. The sample preparation, in which 2 mg of sample had been dissolved in 0.8 mL of methanol-D4 (99%, Deutero), was performed 24 h prior to the measurement.
UV-Vis
[0584] UV-Vis measurements were performed on a NanoDrop ND-1000 spectrophotometer in the spectral range of 200-750 nm.
Size Exclusion Chromatography
[0585] Size exclusion chromatography (SEC) was performed with Sephadex G 25 Superfine from GE Healthcare and on prepacked PD10 columns (GE Healthcare, Sephadex G 25 M). The material was activated by swelling in the respective eluent prior to performing chromatography.
Dialysis
[0586] Regenerated cellulose membranes: MWCO=1 and 2 kDa (Spectra/Por), and MWCO=12-14 kDa (Carl Roth) were used to perform dialysis. Typically, dialysis was carried out for 24 h with 1 L of solvent that was exchanged after first 6 h of the process.
Lyophilization
[0587] Freeze-drying was performed on an Alpha 1-2 LD plus (Martin Christ Gefriertrocknungsanlagen GmbH). Typically, samples were frozen with liquid nitrogen and placed into the freeze-dryer at high vacuum. SO1861-EMCH synthesis
[0588] SO1861 from Saponaria officinalis L (59 mg, 31.7 mol) and EMCH (301 mg, 888 mol) were placed in a round flask with stirrer and dissolved in 13 mL methanol. TFA (400 L, cat.) was added to the solution and the reaction mixture was stirred for 3 h at 800 rpm and room temperature on a RCT B magnetic stirrer (IKA Labortechnik). After stirring for 3 h, the mix was diluted either with MilliQ water or PBS and dialyzed extensively for 24 h against either with MilliQ water or PBS using regenerated cellulose membrane tubes (Spectra/Por 7) with a MWCO of 1 kDa. After dialysis, the solution was lyophilized to obtain a white powder. Yield 62.4 mg (95%). Dried aliquots were further used for characterization via 1H NMR and MALDI-TOF-MS.
[0589] 1H NMR (400 MHZ, methanol-D4) (
[0590] 1H NMR (400 MHZ, methanol-D4) (
[0591] MALDI-TOF-MS (RP mode) (
[0592] MALDI-TOF-MS (RN mode) (
SO1861-EMCH-mercaptoethanol
[0593] To SO1861-EMCH (0.1 mg, 48 nmol) 200 UL mercaptoethanol (18 mg, 230 mol) was added and the solution was shaken for 1 h at 800 rpm and room temperature on a ThermoMixer C (Eppendorf). After shaking for 1 h, the solution was diluted with methanol and dialyzed extensively for 4 h against methanol using regenerated cellulose membrane tubes (Spectra/Por 7) with a MWCO of 1 kDa. After dialysis, an aliquot was taken out and analyzed via MALDI-TOF-MS.
[0594] MALDI-TOF-MS (
[0595] BSA-SO1861 synthesis 2-iminothiolane (231 ug, 1.1 mol) dissolved in 47 L PBS was added to a BSA-RhodB solution (10 mg, 0.15 mol) in 200 L PBS and the mix was shaken for 40 min at 800 rpm and room temperature on a
[0596] ThermoMixer C (Eppendorf). After shaking for 40 min, the reaction mix was immediately run through a Sephadex G25 superfine size exclusion column (16 mL column volume) and SO1861-EMCH (1 mg, 0.5 mol) dissolved in 100 L PBS was added to the collected BSA-SH fraction. The reaction mixture was shaken for 12 h at 800 rpm and room temperature on a ThermoMixer C (Eppendorf). After shaking for 12 h the BSA-SO1861 concentrated using centrifugal filtration at 4,000 rpm (15 C.) via Amicon Ultra 15 filters with a MWCO of 3 kDa. The conjugate was stored as solution in the fridge and aliquots were taken for analysis. Yield: not determined.
[0597] MALDI-TOF-MS (
[0598] ([M+H].sup.2+, BSA-SO1861 with 3 SO1861 attached), 34.7 kDa ([M+H].sup.2+, BSA-SO1861 with 2 SO1861 attached).
Cy3-PAMAM
[0599] 720 L PAMAM dissolved in methanol (30 mg, 1.04 mol) was placed into a 250 mL round flask and methanol was removed via a rotary evaporator (20 mbar, 60 C.). Remaining PAMAM was dissolved in 9 mL DMSO. HATU (7.6 mg, 20 mol) dissolved in 0.5 mL DMSO was added to a Cy3-COOH (0.6 mg, 1.2 mol) solution in DMSO and the mix was shaken for 1 h at 800 rpm at room temperature on a ThermoMixer C (Eppendorf). After shaking for 1 h, the HATU-Cy3 solution was added to the stirring PAMAM solution and the reaction mix was stirred for 12 h at room temperature. After stirring for 12 h, the reaction mix was diluted with MilliQ water and dialyzed extensively for 24 h against MilliQ water using regenerated cellulose membrane tubes (Spectra/Por 6) with a MWCO of 2 kDa. After dialysis, the volume of the conjugate solution was reduced via a rotary evaporator (20 mbar, 60 C.) and the concentrated conjugate solution was run through a Sephadex G25 superfine size exclusion column (16 mL column volume). The first fraction was collected and lyophilized to obtain the viscous pink PAMAM-Cy3 conjugate. PAMAM-Cy3 conjugate formation was confirmed by chromatography on thin layer chromatography (methanol/water, v/v 1:1), and the appearance of a faster band on a Sephadex G 25 superfine column. Yield 21.3 mg (63%). The dye per PAMAM molar ratio determined by UV-Vis spectrophotometry was 0.43.
[0600] MALDI-TOF-MS (
Cy3-PAMAM-SO1861 synthesis
[0601] Procedure is described exemplary for Cy3-PAMAM(SO1861) 5. 2-iminothiolane (1 mg, 6.7 mol) dissolved in 250 L MilliQ water was added to a PAMAM-Cy3 solution (0.5 mg, 17 nmol) in 125 L MilliQ water and the mix was shaken for 40 min at 800 rpm and room temperature on a ThermoMixer C (Eppendorf). After shaking for 40 min, the reaction mix was immediately run through a Sephadex G25 superfine size exclusion column (16 mL column volume) and SO1861-EMCH (176 ug, 85 nmol) dissolved in 40 L MilliQ water was added to the collected Cy3-PAMAM-SH fraction. The reaction mixture was shaken for 12 h at 800 rpm and room temperature on a ThermoMixer C (Eppendorf). After shaking for 12 h, the reaction mix was diluted with MilliQ water and dialyzed extensively for 24 h against MilliQ water using regenerated cellulose membrane tubes (ZelluTrans, Carl Roth) with a MWCO of 12-14 kDa. After dialysis, the Cy3-PAMAM-SO1861 solution was concentrated using centrifugal filtration at 4000 rpm (15 C.) via Amicon Ultra 15 filters with a MWCO of 3 kDa. The conjugate was stored as solution in the fridge and aliquots were taken for analysis. Yield: 0.5 mg (75%).
[0602] MALDI-TOF-MS spectra are illustrated in
[0603] The synthesis of Cy3-PAMAM(SO1861) 5, Cy3-PAMAM(SO1861) 13, Cy3-PAMAM(SO1861) 51, and Cy3-PAMAM(SO1861) 27, has been performed via the above described methodology but differ in the feed equivalents of the starting materials 2-iminothiolane and SO1861-EMCH. The respective feed equivalents of the starting materials and the respective mass of the conjugates are highlighted in Table 11.
TABLE-US-00017 TABLE 11 Reaction parameter for Cy3-PAMAM-SO1861 synthesis. SO1861 2-Iminothiolane SO1861-EMCH Mass of molecules feed equivalents feed equivalents conjugate via attached per Resulting to Cy3-PAMAM to Cy3-PAMAM MALDI-TOF-MS PAMAM conjugate 384 6 38.7 kDa ~5 Cy3-PAMAM- (SO1861).sub.6, FIG. 36 B 384 20 53.9 kDa ~13 Cy3-PAMAM- (SO1861).sub.13, FIG. 36 C 384 57 133.9 kDa ~51 Cy3-PAMAM- (SO1861).sub.51, FIG. 36 D 8 5 37.7 kDa ~5 Cy3-PAMAM- (SO1861).sub.5, FIG. 37 A 32 30 87.0 kDa ~27 Cy3-PAMAM- (SO1861).sub.27, FIG. 37 B
Cy3-PAMAM-NC-SO1861 synthesis
[0604] Cy3-PAMAM (0.5 mg, 18 nmol), SO1861 (2.3 mg, 1.24 mol), and HATU (64.6 mg, 170 mol) were dissolved separately in 200 L DMSO. SO1861 and HATU solutions were mixed and shaken for 20 min at 800 rpm and room temperature on a ThermoMixer C (Eppendorf). After shaking for 20 min, Cy3-PAMAM solution was added to the shaking SO1861-HATU solution and the reaction mixture was allowed to shake for 12 h at 800 rpm and room temperature on a ThermoMixer C (Eppendorf). After shaking for 12 h, the reaction mix was diluted with MilliQ water and dialyzed extensively for 24 h against MilliQ water using regenerated cellulose membrane tubes (ZelluTrans, Carl Roth) with a MWCO of 12-14 kDa. After dialysis, the Cy3-PAMAM-NC-SO1861 solution was concentrated using centrifugal filtration at 4,000 rpm (15 C.) via Amicon Ultra 15 filters with a MWCO of 3 kDa. The Cy3-PAMAM-NC-(SO1861) 17 conjugate was stored as solution in the fridge and aliquots were taken for analysis. Yield: 0.77 mg (69%).
[0605] MALDI-TOF-MS (
G4-dendron dye labeling and deprotection
[0606] PFd-G4-Azide-NH-BOC (G4-dendron) (9.75 mg, 2.11 mol) was placed into a 2 mL reaction tube (Eppendorf) and dissolved in 200 L DMSO. 100 L of a Cy5-DBCO solution in DMSO (1.72 mol * mL-1, 170 nmol) was added to the G4-dendron solution and the mix was shaken for 12 hours at room temperature and 800 rpm on a ThermoMixer C (Eppendorf). After shaking for 12 h, the reaction mix was diluted with MilliQ water and dialyzed extensively for 24 h against MilliQ water using regenerated cellulose membrane tubes (Spectra/Por 7) with a MWCO of 1 kDa. After dialysis, the solution was lyophilized to obtain a blue powder. The crude product was used as obtained from lyophilization for the deprotection step.
[0607] Partially Cy5 labeled lyophilized G4-dendron was dissolved in 12 mL CHCI3 in 50 mL round flask with stirrer. 12 mL TFA was added and the reaction mix was stirred for 3 h at 800 rpm and room temperature on a RCT B magnetic stirrer (IKA Labortechnik). After stirring for 3 h, the solvent was removed under reduced pressure (50 C., 30 mbar) on a rotary evaporator (Heidolph WB 2000). After evaporation, the batch was dissolved in MilliQ water and run through a PD10 size exclusion column. G4-dendron conjugate formation was confirmed by chromatography on thin layer chromatography (methanol/water, v/v 1:1), and the appearance of a faster band on a PD10 column. Obtained fraction of size exclusion chromatography was lyophilized to obtain a blue powder.
[0608] Yield 5.7 mg (93%). The dye per G4-dendron molar ratio determined by UV-Vis spectrophotometry was 0.012.
[0609] MALDI-TOF-MS (
G4-dendron-SO1861 synthesis
[0610] Procedure is described exemplary for the lowest G4-dendron to SO1861-EMCH ratio. 2-iminothiolane (2.65 mg, 19.2 mol) dissolved in 300 UL MilliQ water was added to a partially Cy5 labeled G4-dendron solution (0.577 mg, 192 nmol) in 252 L MilliQ water and the mix was shaken for 40 min at 800 rpm and room temperature on a ThermoMixer C (Eppendorf). After shaking for 40 min, the reaction mix was immediately run through a PD10 size exclusion column and SO1861-EMCH (1.19 mg, 575 nmol) dissolved in 100 L MilliQ water was added to the collected G4-dendron-SH fraction. The reaction mixture was shaken for 12 h at 800 rpm and room temperature on a ThermoMixer C (Eppendorf). After shaking for 12 h, the reaction mix was concentrated via centrifugal filtration using Amicon Ultra centrifugal filters (3 kDa MWCO). The conjugate was stored as solution in the fridge and aliquots were taken for analysis. Yield: 90 nmol (47%).
[0611] MALDI-TOF-MS spectra are illustrated in
[0612] The synthesis of other G4-dendron-(SO1861) n conjugates has been performed via the above described methodology but differs in the feed equivalents of the starting material SO1861-EMCH. The respective feed equivalents of the starting materials and the respective mass of the conjugates are highlighted in Table 12.
TABLE-US-00018 TABLE 12 Reaction parameter for G4-dendron-SO1861 synthesis. 2- SO1861 Iminothiolane Mass of molecules feed SO1861-EMCH conjugates via attached Resulting equivalents to feed equivalents MALDI- per G4- MS G4-dendron to G4-dendron TOF-MS dendron spectrum 100 3 5.07-10.18 kDa ~1-3 FIG. 52 C 100 10 5.07-11.64 kDa ~1-4 FIG. 52 B 100 22 6.20-22.02 kDa ~1-9 FIG. 52 A
PAMAM thiolation
[0613] Procedure is described exemplary for the highest PAMAM to 2-iminothiolane ratio. To a PAMAM (333 ug, 12.8 nmol) solution dissolved in 30 UL methanol 2-iminothiolane (0.53 mg, 3.84 mol) dissolved in 128 L MilliQ water was added. The reaction mixture was shaken for 12 h at 800 rpm and room temperature on a ThermoMixer C (Eppendorf). After shaking for 12 h, the reaction mix was washed 4 times with MilliQ water via centrifugal filtration using Amicon Ultra centrifugal filters (3 kDa MWCO) at 15 C. and 13500 rpm. After washing the sample was lyophilized to obtain a white solid. Yield was not determined.
[0614] MALDI-TOF-MS spectra are illustrated in
[0615] The synthesis of other PAMAM-iminothiolane conjugates has been performed via the above described methodology but differs in the feed equivalents of the starting material 2-iminothiolane. For the lowest 2-iminothiolane feed reaction Cy3-PAMAM has been used.
[0616] The respective feed equivalents of the starting materials and the respective mass of the conjugates are highlighted in Table 13.
TABLE-US-00019 TABLE 13 Reaction parameter for PAMAM-SH synthesis. Iminothiolane 2-Iminothiolane Mass of molecules feed equivalents conjugates via attached per Resulting to PAMAM MALDI-TOF-MS PAMAM MS spectrum 50 34.4 kDa ~16 FIG. 54 C 100 35.9 kDa ~65 FIG. 54 D 300 41.5 kDa ~108 FIG. 54 E
PAMAM PEGylation
[0617] Procedure is described exemplary for the lowest PAMAM to mPEG2k ratio. To a PAMAM (333 ug, 12.8 nmol) solution dissolved in 10 L DMSO mPEG2k-NHS (0.268 mg, 128 nmol) dissolved in 13 L DMSO was added. The reaction mixture was shaken for 12 h at 800 rpm and room temperature on a ThermoMixer C (Eppendorf). After shaking for 12 h, the reaction mix was diluted with MilliQ water and dialyzed extensively for 24 h against MilliQ water using regenerated cellulose membrane tubes (Spectra/Por 6) with a MWCO of 2 kDa. After dialysis, the batch was concentrated via centrifugal filtration using Amicon Ultra 15 mL centrifugal filters (10 kDa MWCO). The concentrated batch was run through a PD10 size exclusion column followed by lyophilization to obtain a white fluffy powder. Yield was not determined.
[0618] MALDI-TOF-MS spectra are illustrated in
[0619] The synthesis of other PAMAM-mPEG2k conjugates has been performed via the above described methodology but differs in the feed equivalents of the starting material mPEG2k-NHS. The respective feed equivalents of the starting materials and the respective mass of the conjugates are highlighted in Table 14.
TABLE-US-00020 TABLE 14 Reaction parameter for PAMAM-mPEG.sub.2k synthesis. mPEG.sub.2k mPEG.sub.2k-NHS Mass of molecules feed equivalents conjugates via attached per Resulting to PAMAM MALDI-TOF-MS PAMAM MS spectrum 10 28.5 kDa ~3 FIG. 55 C 20 43.0 kDa ~8 FIG. 55 D 100 62.8 kDa ~18 FIG. 55 E
Cy3-PAMAM-SO1861-DBCO synthesis
[0620] Procedure is described exemplary for Cy3-PAMAM(SO1861) 27-(DBCO) 10. Cy3-PAMAM(SO1861) 27 (0.41 mg, 4.71 nmol) was freeze-fried and dissolved in 100 L DMSO. DBCO-PEG13-NHS ester (0.197 mg, 188 nmol) dissolved in DMSO was added to the Cy3-PAMAM-SO1861 solution and the mixture was shaken at 800 rpm and room temperature on a ThermoMixer C (Eppendorf). After shaking for 3 h, the reaction mix was diluted with MilliQ water and dialyzed extensively for 24 h against MilliQ water using regenerated cellulose membrane tubes (ZelluTrans, Carl Roth) with a MWCO of 12-14 kDa. After dialysis, the Cy3-PAMAM-SO1861-DBCO solution was concentrated using centrifugal filtration at 4,000 rpm (15 C.) via Amicon Ultra 15 filters with a MWCO of 3 kDa. The conjugate was stored as solution in the fridge and aliquots were taken for analysis. Yield: 0.1 mg (22%).
[0621] MALDI-TOF-MS (
[0622] The synthesis of Cy3-PAMAM(SO1861) 5-(DBCO) 38, and Cy3-PAMAM(SO1861) 27-(DBCO) 10, have been performed via the above described methodology. The respective feed equivalents of the starting material and the respective mass of the conjugates are highlighted in Table 15.
TABLE-US-00021 TABLE 15 Reaction parameter for Cy3-PAMAM-SO1861-DBCO synthesis. DBCO- DBCO Used Cy3- PEG13- Mass via molecules PAMAM- NHS feed MALDI- attached per Resulting saponin batch equivalents TOF-MS PAMAM conjugate Cy3-PAMAM- 40 76.3 kDa ~38 Cy3-PAMAM- (SO1861).sub.5 (SO1861).sub.5- (DBCO).sub.38, FIG. 39 C Cy3-PAMAM- 40 92.5 kDa ~10 Cy3-PAMAM- (SO1861).sub.27 (SO1861).sub.27- (DBCO).sub.10, FIG. 39 D
Cy3-PAMAM-NC-SO1861-DBCO synthesis
[0623] Cy3-PAMAM-NC-(SO1861) 17 (0.3 mg, 4.8 nmol) was freeze-fried and dissolved in 100 L DMSO. DBCO-PEG13-NHS ester (0.202 mg, 194 nmol) dissolved in DMSO was added to the Cy3-PAMAM-NC-SO1861 solution and the mixture was shaken at 800 rpm and room temperature on a ThermoMixer C (Eppendorf). After shaking for 3 h, the reaction mix was diluted with MilliQ water and dialyzed extensively for 24 h against MilliQ water using regenerated cellulose membrane tubes (ZelluTrans, Carl Roth) with a MWCO of 12-14 kDa. After dialysis, the Cy3-PAMAM-SO1861-DBCO solution was concentrated using centrifugal filtration at 4,000 rpm (15 C.) via Amicon Ultra 15 filters with a MWCO of 3 kDa. The conjugate was stored as solution in the fridge and aliquots were taken for analysis. Yield: 0.1 mg (22%). Mass spectrometry indicates the conjugation of 30 DBCO moieties per PAMAM molecule.
[0624] MALDI-TOF-MS (
EGFDianthin and dianthin expression
[0625] Plasmid-DNA (His-dianthin-EGF-pET11d or His-dianthin-pET11d) was transformed into chemically competent Escherichia coli NiCo21 (DE3) (New England Biolabs, Inc.) and grown in 3 mL lysogeny broth supplemented with 50 g/mL ampicillin at 37 C. for 5 h at 200 rpm. These bacteria were used to inoculate 500 mL lysogeny broth supplemented with 50 g/mL ampicillin for overnight culture at 37 C. Subsequently, the culture volume was scaled up to 2 L and bacteria were grown until an optical density (A600) of 0.9. Protein expression was induced by the addition of isopropyl B-D-1-thiogalactopyranoside (IPTG) at a final concentration of 1 mM. Cells were further grown for 3 h at 37 C. and 200 rpm. After centrifugation (5 min, 5,000 g, 4 C.) cell pellets were resuspended in 20 mL phosphate buffered saline (Dulbecco's phosphate-buffered saline (PBS) with Ca.sup.2+ and Mg.sup.2+, pH 7.4) and stored at 20 C. After thawing, proteins were released by ultrasound device (Branson Sonifier 250, G. Heinemann). The solution was centrifuged (15,800g, 30 min, 4 C.) and adjusted to 20 mM imidazole concentration. The construct contained an N-terminal His-tag and was purified by nickel nitrilotriacetic acid chromatography (Ni-NTA Agarose, Qiagen, Hilden, Germany). After elution with imidazole (20-250 mM) the eluates were analyzed by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) (12%). Fractions containing dianthin-EGF or dianthin were dialyzed against 2 L chitin binding domain buffer (20 mM tris (hydroxymethyl)-aminomethane/HCl, 500 mM NaCl, 1 mM EDTA, 0.1% Tween-20, pH 8.0) at 4 C. Further purification by chitin column affinity chromatography served to remove bacterial proteins with binding activity for Ni-NTA agarose. After elution with chitin binding domain buffer, the fractions were analyzed by SDS-PAGE (12%). Fractions containing dianthin-EGF or dianthin were dialyzed against 5 L PBS at 4 C. Purified proteins were concentrated by Amicon centrifugal filter devices (10 kDa, Millipore, Eschborn, Germany). The protein concentration was determined by a bicinchoninic acid assay (Pierce, Rockford, USA).
Dianthin-EGF-Alexa488 synthesis
[0626] Dianthin-EGF (240 ug, 6.7 nmol) solution in PBS was placed into an Amicon Ultra 15 filter with a MWCO of 3 kDa and centrifuged at 4,000 rpm and 4 C. for 30 min three times. After each cycle, the Amicon filter was refilled with 0.1 M sodium carbonate buffer at pH 9. After the third centrifugation cycle, the volume was reduced to 0.5 mL via centrifugation. The dianthin-EGF sodium carbonate solution was placed into a 2 mL reaction tube and Alexa Fluor 488 5-TFP (50 ug, 56 nmol) dissolved in 10 L DMSO was added to the protein solution. The mix was shaken at 800 rpm and room temperature on a ThermoMixer C (Eppendorf) for 80 min. After shaking, the mix was run through a Sephadex G25 M size exclusion column (GE Healthcare, PD10 column). The dianthin-EGF-Alexa488 conjugate was stored in solution in 0.1 M sodium carbonate buffer at pH 9 in the fridge and aliquots were taken for analysis. Yield: 210 ug (85%).
[0627] MALDI-TOF-MS (
Dianthin-Alexa488 synthesis
[0628] Dianthin (184 ug, 6.2 nmol) solution in PBS was placed into an Amicon Ultra 15 filter with a MWCO of 3 kDa and centrifuged at 4,000 rpm and 4 C. for 30 min three times. After each cycle, the Amicon filter was refilled with 0.1 M sodium carbonate buffer at pH 9. After the third centrifugation cycle, the volume was reduced to 0.5 mL via centrifugation. The dianthin sodium carbonate solution was placed into a 2 mL reaction tube and Alexa Fluor 488 5-TFP (16.7 ug, 19 nmol) dissolved in 3.5 L DMSO was added to the protein solution. The mix was shaken at 800 rpm and room temperature on a ThermoMixer C (Eppendorf) for 80 min. After shaking, the mix was run through a Sephadex G25 M size exclusion column (GE Healthcare, PD 10 column). The dianthin-Alexa488 conjugate was stored in solution in 0.1 M sodium carbonate buffer at pH 9 in the fridge and aliquots were taken for analysis. Yield: not determined MALDI-TOF-MS (
[0629] Dianthin-EGF-Alexa488SS-PEG-N.sub.3, and Dianthin-EGF-Alexa488-PEG12-N.sub.3 synthesis Procedure is described exemplary for dianthin-EGF-Alexa488SS-PEG-N.sub.3. Dianthin-EGF-Alexa488 (70 ug, 1.9 nmol) sodium carbonate solution was placed into a 2 mL reaction tube and azido-PEG3SS-NHS (120 ug, 272 nmol) dissolved in 9 L DMSO was added to the protein solution. The mix was shaken at 800 rpm and 15 C. on a ThermoMixer C (Eppendorf) for 12 h. After shaking, the reaction mix was diluted with PBS and was washed with PBS via centrifugal filtration at 4,000 rpm and 4 C. using Amicon Ultra 15 filter with a MWCO of 3 kDa.
Yield: 54 ug (70%).
[0630] MALDI-TOF-MS (
[0631] The synthesis of dianthin-EGF-Alexa488SS-PEG-N.sub.3, and dianthin-EGF-Alexa488-PEG12-N.sub.3 have been performed via the above described methodology but differed in the used azido-PEG linker. The respective azido-PEG linker, their feed equivalents, and the respective mass of the conjugates are highlighted in Table 16.
TABLE-US-00022 TABLE 16 Reaction parameter for dianthin-EGF-Alexa488-PEG-N.sub.3 synthesis Mass of conjugate Azido-PEG via Used toxin Azido-PEG linker feed MALDI- Resulting batch linker used equivalents TOF-DMS conjugate Dianthin- Azido-PEG.sub.3- 135 40.8 ka Dianthin-EGF- EGF- S-S-NHS Alexa488-S-S- Alexa488 PEG.sub.3-N.sub.3 Dianthin- Azido- 135 43.3 kDa Dianthin-EGF- EGF- PEG.sub.12-NHS Alexa488- Alexa488 PEG.sub.12-N.sub.3
Dianthin-Alexa488SS-PEG-N.SUB.3
[0632] Dianthin-Alexa488 (24.5 g, 0.8 nmol) sodium carbonate solution was placed into a 2 mL reaction tube and azido-PEG3SS-NHS (34 ug, 78 nmol) dissolved in 9 L DMSO was added to the protein solution. The mix was shaken at 800 rpm and 15 C. on a ThermoMixer C (Eppendorf) for 12 h. After shaking, the reaction mix was diluted with PBS and was washed with PBS via centrifugal filtration at 4,000 rpm and 4 C. using Amicon Ultra 15 filter with a MWCO of 3 kDa.
[0633] Yield: 10.3 ug (39%).
[0634] MALDI-TOF-MS (
Cy3-PAMAM-Saponin-Toxin conjugate synthesis
[0635] Procedure is described exemplary for Cy3-PAMAM(SO1861) 27-DBCO. Cy3-PAMAM(SO1861) 27-DBCO (17 ug, 0.184 nmol) solution in MilliQ water was mixed with a dianthin-EGF-Alexa488-SS-PEG3-N.sub.3 (3.6 ug, 0.089 nmol) solution in PBS in a 1.5 mL reaction tube and the reaction mix was shaken at 800 rpm and 15 C. on a ThermoMixer C (Eppendorf) for 2 h. After shaking, small aliquots were taken out for analysis via SDS-PAGE and fluorescence imaging on a Molecular Imager VersaDoc MP 4000 imaging system (Bio-Rad) (
[0636] The synthesis of Cy3-PAMAM(SO1861) 5-S-S-Dianthin-EGF-Alexa488, Cy3-PAMAM(SO1861) 27SS-Dianthin-EGF-Alexa488, Cy3-PAMAM-NC-(SO1861) 17-S-S-Dianthin-EGF-Alexa488, Cy3-PAMAM-NC-(SO1861) 17-S-S-Dianthin-Alexa488, and Cy3-PAMAM-NC-(SO1861) 17-Dianthin-EGF-Alexa488, have been performed via the above described methodology but differ in the used PAMAM-saponin-DBCO batch, the used azido-toxin batch, and their feed equivalents. The respective feed equivalents of the starting materials are highlighted in Table 17.
TABLE-US-00023 TABLE 17 Reaction parameter for Cy3-PAMAM-saponin-toxin synthesis. PAMAM- PAMAM- Azido- saponin- saponin- toxin DBCO DBCO feed Azido-toxin feed Resulting batch used equivalents batch used equivalents conjugate Cy3- 3 Dianthin- 1 Cy3-PAMAM- PAMAM- EGF- (SO1861).sub.5- (SO1861).sub.5- Alexa488- S-S-Dianthin- (DBCO).sub.38 S-S-PEG.sub.3-N.sub.3 EGF-Alexa488 Cy3- 2.1 Dianthin- 1 Cy3-PAMAM- PAMAM- EGF- (SO1861 ).sub.27- (SO1861).sub.27- Alexa488- S-S-Dianthin- (DBCO).sub.10 S-S-PEG.sub.3-N.sub.3 EGF-Alexa488 Cy3- 2.3 Dianthin- 1 Cy3-PAMAM- PAMAM- EGF- NC- NC- Alexa488- (SO1861).sub.17- (SO1861).sub.17- S-S-PEG.sub.3-N.sub.3 S-S-Dianthin- (DBCO).sub.30 EGF-Alexa488 Cy3- 7.1 Dianthin- 1 Cy3-PAMAM- PAMAM- Alexa488- NC- NC- S-S-PEG.sub.3-N.sub.3 (SO1861).sub.17- (SO1861).sub.17- S-S-Dianthin- (DBCO).sub.30 Alexa488 Cy3- 2.3 Dianthin- 1 Cy3-PAMAM- PAMAM- EGF- NC- NC- Alexa488- (SO1861).sub.17- (SO1861).sub.17- PEG.sub.12-N.sub.3 Dianthin- (DBCO).sub.30 EGF-Alexa488
Cy3-PAMAM-NC-SO1861 synthesis via reductive amination
[0637] Cy3-PAMAM (0.19 mg, 13 nmol) and SO1861 (0.73 mg, 0.39 mol) were dissolved separately in 200 L 0.1 M acetate buffer at pH 5. SO1861 and Cy3-PAMAM solutions were mixed and shaken for 20 min at 800 rpm and room temperature on a ThermoMixer C (Eppendorf). After shaking for 20 min, NaCNBH3 (5 mg, 81 mol) was added to the shaking reaction solution and the reaction mixture was allowed to shake for 12 h at 800 rpm and room temperature on a ThermoMixer C (Eppendorf). After shaking for 12 h, the reaction mix was diluted with MilliQ water and dialyzed extensively for 24 h against MilliQ water using regenerated cellulose membrane tubes (ZelluTrans, Carl Roth) with a MWCO of 12-14 kDa. After dialysis, the Cy3-PAMAM-NC-SO1861 solution was concentrated using centrifugal filtration at 4,000 rpm (15 C.) via Amicon Ultra 15 filters with a MWCO of 3 kDa. The conjugate was stored as solution in the fridge and aliquots were taken for analysis. Yield: not determined MALDI-TOF-MS (
[0638] The synthesis of Cy3-PAMAM-NC-(SO1861) 30, and Cy3-PAMAM-NC-(SO1861) 10, have been performed via the above described methodology but differed in the time after which the reducing agent NaCNBH3 was added to the reaction batch. The respective time of the NaCNBH3 addition and the respective mass of the conjugates are highlighted in Table 18.
TABLE-US-00024 TABLE 18 Reaction parameter Cy3-PAMAM-NC-SO1861 synthesis via reductive amination. Time of shaking SO1861 reaction mix Mass via molecules before NaCNBH.sub.3 MALDI- attached per addition TOF-MS PAMAM Resulting conjugate 20 min 88.8 kDa ~30 Cy3-PAMAM-NC- (SO1861).sub.30, FIG. 43 C 12 h 48.0 kDa ~10 Cy3-PAMAM-NC- (SO1861).sub.10, FIG. 43 B
Poly (SO1861) synthesis
[0639] SO1861-EMCH (0.13 mg, 63 nmol) was dissolved in 30 L degased MilliQ water. APS (0.2 ug, 0.8 nmol) dissolved in 4 L degased MilliQ water was added to the SO1861-EMCH solution and the solution was placed into a ThermoMixer C (Eppendorf) at 60 C. Then, TMEDA (cat., 0.5 L) was added to the mix and the mix was shaken at 800 rpm and 60 C. on a ThermoMixer C (Eppendorf) for 2 h. After 2 h, a small aliquot was taken out for analysis via mass spectrometry.
[0640] MALDI-TOF-MS (
[0641] Customized peptide with the sequence SESDDAMFCDAMDESDSK (0.6 mg, 0.3 mol) and SO1861-EMCH (0.8 mg, 0.39 mol) were dissolved separately in 200 L PBS. SO1861-EMCH and peptide solutions were mixed and shaken for 12 h at 800 rpm and room temperature on a ThermoMixer C (Eppendorf). After shaking small aliquots were taken out for analysis. Yield: not determined MALDI-TOF-MS (
Results
[0642] Considering available chemical groups for conjugation reactions to the SO1861 molecule, four chemical groups have been identified. The alcohols and diols of the sugar residues, the aldehyde group on the triterpenoid backbone, the carboxylic acid on one of the sugar residues (glucuronic acid), and the alkene group on the triterpenoid backbone as highlighted in
[0643] In view of the pros and cons of each identified chemical group (Table 19), the aldehyde and alcohol groups are best suitable for reversible conjugation reactions, while the alkene and the carboxylic acid (glucuronic acid) are the groups best suitable for irreversible/stable conjugation reactions. The aldehyde group within the molecule structure of SO1861, however, is the most suitable for reversible conjugation reactions over the alcohols. On the one hand, because there is only one aldehyde present in the structure that allows chemoselective reactions. On the other hand, because the aldehyde can perform reversible conjugation reactions with a variety of chemical groups such as amines, hydrazides, and hydroxylamines forming acid-cleavable moieties like imines, hydrazones, and oximes. This factor enables a freedom of choice over the chemical group for the desired reversible conjugation reaction. Contrary, the alcohols are good candidates for reversible conjugation reaction via the formation of acetals and ketals as well, but lack in chemoselectivity since they are present in a large quantity on the glycosidic structure.
[0644] For the formation of an irreversible and stable bond the carboxylic acid is the most suitable since it can form amides and esters with the common tools used in peptide chemistry (e.g. reaction with amines via carbodiimide mediated amide formation).
TABLE-US-00025 TABLE 19 Functional groups that are available for saponin conjugation reactions Functional Group Pros Cons Alcohol Suitable for reversible Acetal/ketal formation (Diols) acetal/ketal formation without chemoselectivity Suitable for ester formations Ester formation without with activated carboxylic chemoselectivity acids Aldehyde Suitable for chemoselective Not suitable for acetal reversible hydrazone formation in the presence formation with hydrazides of unprotected saponin Suitable for chemoselective sugar diols reversible imine formation with amines Suitable for chemoselective reversible oxime formation with hydroxylamines Alkene Suitable for chemoselective Not suitable for reversible irreversible radical reactions conjugation reactions Not suitable for reactions involving a hydrogenation step Carboxylic Suitable for chemoselective Not suitable for reversible acid amide/ester formation with conjugation reactions amines and alcohols after under mild conditions activation
[0645] Thus, for the development of an endosomal escape enhancing saponin (such as SO1861) a methodology has been established that allows the generation of a non-cleavable and cleavable ready to conjugate saponins (
[0646] For producing cleavable ready to conjugate saponins the aldehyde group of SO1861 is reacted with an EMCH (E-maleimidocaproic acid hydrazide) linker. The hydrazide group of EMCH forms an acid cleavable hydrazone bond with the aldehyde of SO1861. At the same time the EMCH linker presents a maleimide group that is thiol (sulfhydryl group) reactive and thus can be conjugated to thiols (
[0647] The maleimide group of SO1861-EMCH performs a rapid and specific Michael addition reaction with thiols and thiol bearing polymeric structures when carried out in a pH range of 6.5-7.5 (
[0648] Regarding an ideal EMCH spacer length for conjugation to a polymeric structure, computer simulation (PerkinElmer, ChemBio3D, Ver. 13.0.0.3015) shows that the maleimide group on SO1861-EMCH is located at the periphery of the molecule and thus should be accessible for thiol bearing polymeric structures (
[0649] To synthesize the SO1861-EMCH, a strategy has been developed that allows the conversion of the aldehyde group on the SO1861 to EMCH (
[0650] For testing the pH dependent hydrolysis of the hydrazone bond, SO1861-EMCH was dissolved in an HCl solution at pH 3 and MALDI-TOF-MS spectra were recorded at two different points in time (
[0651] Da that corresponds to SO1861-EMCH is visible in
[0652] In order to conjugate SO1861-EMCH to a polymeric structure, accessible amines of the polymeric structure are converted into thiols with the aid of the agent 2-iminothiolane. The generated free thiols on the polymeric structure act then as the nucleophile for the thiol-ene Michael-type addition to the maleimide group of SO1861-EMCH (
[0653] First proof of concept for conjugation of ready-to conjugate saponins to a polymeric structure was obtained by use of the amine of a protein (poly amino acid scaffold example), bovine serum albumin (BSA). After conjugation, mass spectrometry obtained the corresponding peaks of BSA-SO1861 at m/z 70, 72, and 74 kDa (
[0654] (
[0655] Next proof of concept for conjugation of ready-to conjugate saponins to a polymeric structure was obtained by the use of the amine bearing generation 5 (G5) dendrimer poly (amidoamine) (PAMAM with covalently coupled red-fluorescent dye (Cy3)). PAMAM-Cy3 was utilized as the polymeric structure for the conjugation to both SO1861-EMCH and SO1861-HATU and served as a model for conjugation of SO1861 to a polymeric structure (
[0656] All accessible amine groups of Cy3-PAMAM were converted into thiols using a 3 fold excess of 2-iminothiolane per Cy3-PAMAM amines followed by the reaction with SO1861-EMCH. Three different feed equivalents (5, 20 and 57) of SO1861-EMCH were used for the three reaction batches. After reaction, the recorded masses of the Cy3-PAMAM-SO1861 conjugates at MALDI-TOF-MS show an increment of the corresponding masses with increasing the SO1861-EMCH feed (
[0657] In another reaction, only a certain number of PAMAM amines were converted into thiols prior to reaction with SO1861-EMCH. Here, two different feed equivalents of 2-Iminothiolane (8 and 32) and two different feed equivalents of SO1861-EMCH (5 and 30) were used, respectively. After reaction, the respective spectra of the Cy3-PAMAM-SO1861 conjugates at MALDI-TOF-MS show peaks at m/z 37.7 kDa (5 feed equivalents of SO1861-EMCH) and at m/z 87.0 kDa (30 feed equivalents of SO1861-EMCH) as shown on
[0658] For the generation of a non-pH-cleavable saponin conjugate the carboxylic acid of SO1861 was activated with HATU and then reacted with the amines of Cy3-PAMAM forming a pH stable amide bound between Cy3-PAMAM and SO1861. The resulting mass of the conjugate was detected via MALDI-TOF-MS with a mass of m/z 62.3 kDa that corresponds to Cy3-PAMAM-NC-SO1861 (NC=non-cleavable) conjugate with 17.5 SO1861 molecules attached per PAMAM (
[0659] Next, the saponin conjugated scaffolds were conjugated to linking points for a possible conjugation to targeted therapeutics (e.g. targeted toxins) via the so-called strain-promoted alkyne-azide cycloaddition (SPAAC, click chemistry) to obtain a functionalized scaffold. For this reaction, Cy3-PAMAM-SO1861 (
[0660] Dianthin-EGF served as a model targeted toxin and dianthin served as a non-targeted toxin. Both toxins were labeled with Alexa Fluor 488 using the tetrafluorophenyl ester (TFP) derivative of the dye. The dye labeled proteins were then conjugated to a heterobifunctional NHSSS-PEG3-azide linker to obtain the corresponding chemical moiety for the SPAAC to the PAMAM-saponin conjugates. Maldi-TOF-MS measurements showed that one Alexa Fluor 488 dye and 9 NHSSS-PEG3-azide molecules were attached per dianthin-EGF molecule (
[0661] The Cy3-PAMAM-NC-SO1861-DBCO and Cy3-PAMAM-SO1861-DBCO conjugates were reacted with Alexa Fluor 488 labeled azido-toxins to perform a strain-promoted alkyne-azide cycloaddition. The conjugation between the reacting agents was indicated via gel electrophoresis and the co-localization of the fluorescent signals of Cy3 that is only attached on the PAMAM polymer and Alexa Fluor 488 that is only attached on the toxins on a polyacrylamide gel after gel electrophoresis (
[0662] As an alternative polymeric structure to the PAMAM dendrimer, a G4-dendron (PFd-G4-Azide-NH-BOC, Polymer Factory) with 16 functional amino end groups and an azido group at the focal point was utilized for the conjugation to SO1861 (
[0663] The previous examples demonstrate that a methodology has been developed that allows the conjugation of a determined amount of SO1861 molecules or other endosomal escape enhancer molecules to a polymeric structure for enhanced cytoplasmic delivery of therapeutic substances such as targeted toxins.
[0664] To further test other conjugation methodologies of SO1861 to a polymeric structure, the reductive amination pathway was used. For this, the aldehyde group of SO1861 was directly conjugated to PAMAM amines forming an imine bound. The imine bond formation was followed a reductive amination step through the addition of the reductive agent sodium cyanoborohydride forming a pH-stable amine bond between SO1861 and PAMAM (
[0665] Another approach for the development of a SO1861 scaffold among the discussed polymer, and protein approach is the poly (SO1861) approach. The idea of this approach is to generate a polymer that consists of SO1861 molecules only, with pH sensitive cleavable bonds that release the SO1861. In addition, the poly (SO1861) should be able to perform conjugation reactions to toxins and biopolymers. The main goal with this approach is to keep it as simple and cost effective as possible. Since a protocol for the generation of acid cleavable SO1861 has been developed already (SO1861-EMCH approach) it would be interesting to see if it is possible to polymerize the SO1861-EMCH through simple addition of a polymerization initiator without further modifying the SO1861 or identifying other conjugation sites on the SO1861 molecule. In the past, several papers have discussed the polymerization of maleimide groups by using radical initiators which attack the double bond of the maleimide group and thus initiate a radical polymerization along the double bonds of the maleimides (29-31). Since SO1861-EMCH reveals a maleimide group in its structure this group could potentially be explored for radical polymerization reactions to yield a poly (SO1861) with acid cleavable function. If the polymerization reaction has a reasonable reaction time the generated SO1861 polymers could be quenched with a radical quencher that not only quenches the reaction but also generates a functional group for toxin or biopolymer conjugation. Such a reaction scheme is illustrated in
[0666] In free radical polymerization the reaction conditions have a huge influence on the polymer properties and the reaction outcome. For instance, temperature, monomer concentration, and initiator concentration play a major role for forming the polymer and have to be fine-tuned according to the desired polymer properties. As radical polymerizations are usually carried out at temperatures above 50 C., the first reactions have been performed at a temperature of 60 C. It was interesting to see if the SO1861-EMCH polymerization can be initiated spontaneously and if APS and TMEDA would have an influence on the polymerization degree. Thus, three reactions have been carried out, using the same SO1861-EMCH concentration, but differ in their APS/TMEDA composition. In the first reaction only the SO1861-EMCH was heated up to 60 C. for 3 h, while the second reaction contained SO1861-EMCH and APS, and the third reaction contained SO1861-EMCH, APS, and TMEDA. (For these experiments the same amount and concentration of starting materials have been used which are mentioned in the Materials and Methods section Poly (SO1861) synthesis). The batches have been analyzed via MALDI-TOF-MS as shown on
[0667] To further fine-tune the reaction conditions, other initiators such as azo-initiators like 2,2-azobis [2-methyl-N-(2-hydroxyethyl) propionamide] and azobisisobutyronitrile will be tested, as well as other polymerization techniques such as controlled radical polymerization (atom-transfer radical-polymerization, reversible addition-fragmentation chain transfer, etc). Moreover, another hydrazide linker as a substitute for EMCH could be considered which obtains a functional group (such as an acryl or acrolyol residue) that is more suitable for radical polymerization than the maleimide group.
[0668] Another approach for the development of a SO1861 scaffold is the DNA approach. The idea of this approach is to utilize the concept of the so-called DNA-origami (32, 33). DNA-origami as the polymeric or assembled polymeric structure to conjugate saponins to it, can offer several inherent advantages including stability, scalability, and precise control of the final size and shape of the resulting DNA-saponin scaffold. Since these DNA nanocarriers are comprised of natural DNA, they are biocompatible and do not show toxicity to living cells, and can ease the release of cargo from internal cellular compartments. The multivalency of such a structure can further allow fine-tuning targeting capabilities and high capacity for a variety of payloads such as fluorophores and toxins. Thus, in this approach DNA strands are identified that offer chemical functional groups on the 3 and 5 endings respectively, and that are able to hybridize only in certain wanted areas of the sequence that allow a control over the final shape of the construct. The chemical groups should be utilized to couple saponins, for instance though a thiol-ene reaction between the already developed SO1861-EMCH and a thiol group on one of the 3 and 5 DNA strands. The complementary DNA strand can offer a click function group that can be used for coupling to a targeted toxin. The concept is illustrated in
[0669] A similar approach is imaginable by using a specific peptide sequence instead of DNA strands that is able to bind and release saponins and that can be polymerized forming a large poly (peptide)-like structure. In this approach, a peptide sequence has been identified and purchased that has a length fitting the calculated size of a SO1861-EMCH molecule, that offers a cysteine residue in the middle of the sequence, and that obtains an amine group at both the N-terminus and C-terminus. The cysteine residue can be utilized to conjugate SO1861-EMCH via a thiol-ene reaction of the maleimide group of SO1861-EMCH and the thiol group of the cysteine residue. The two amine groups can be utilized to polymerize the peptide-SO1861 conjugate with a suitable crosslinker as shown on
[0670] Conjugation studies have shown that the conjugation of SO1861-EMCH to the customized peptide (sequence: SESDDAMFCDAMDESDSK) was successful. The peptide that bears a maleimide reactive cysteine in the middle of the sequence and its conjugation to SO1861-EMCH was analyzed via MALDI-TOF-MS (
Cell viability assay
[0671] Hela cells were seeded in DMEM (PAN-Biotech GmbH) supplemented with 10% fetal bovine serum (PAN-Biotech GmbH) and 1% penicillin/streptomycin (PAN-Biotech GmbH), in a 96 well plate at 5,000 c/w in 100 L/well and incubated overnight at 37 C. and 5% CO.sub.2. The next day 20 concentrated stocks of the PAMAM, PAMAM-conjugates, G4-dendron (prepared in Example 3) or chloroquine (Sigma Aldrich) samples were prepared in DMEM. The media was removed from the cell culture plate and replaced by 160 L culture media, followed by the addition of 10 L sample/well (from the 20 concentrated stocks) and a 45 min incubation at 37 C. During this incubation the SO1861 concentration curve was prepared. The SO1861 master stock was heated for 10 min at 50 C., while shaking at 1,250 rpm. Followed by 15 sec sonication and a brief re-heating at 50 C. for 1 min, while shaking at 1,250 rpm. Subsequently a serial dilution of SO1861 was prepared in PBS. The SO1861 concentration curve was prepared as 10 concentrated stock, from which 20 L was added/well. After a 15 min incubation at 37 C., 10 UL dianthin-EGF (prepared in Example 2) diluted in DMEM to 30 pM) or DMEM containing an equal amount of PBS was added/well, to obtain a final dianthin-EGF concentration of 1.5 pM as well as the indicated SO1861 and the different polymeric structures or chloroquine concentrations in a final volume of 200 L/well.
[0672] After treatment the cells were incubated for 72 hr at 37 C. before the cell viability was determined by a MTS-assay, performed according to the manufacturer's instruction (CellTiter 96 AQueous One Solution Cell Proliferation Assay, Promega). Briefly, the MTS solution was diluted 20x in DMEM without phenol red (PAN-Biotech GmbH) supplemented with 10% FBS. The cells were washed once with 200 L/PBS well, after which 100 L diluted MTS solution was added/well. The plate was incubated for approximately 20-30 minutes at 37 C. Subsequently, the OD at 492 nm was measured on a Thermo
[0673] Scientific Multiskan FC plate reader (Thermo Scientific). For quantification the background signal of medium only wells was subtracted from all other wells, before the cell viability percentage of treated/untreated cells was calculated, by dividing the background corrected signal of treated wells over the background corrected signal of the untreated wells (x 100).
FACS analysis
[0674] HeLa cells were seeded in DMEM (PAN-Biotech GmbH) supplemented with 10% fetal calf serum (PAN-Biotech GmbH) and 1% penicillin/streptomycin (PAN-Biotech GmbH), at 500,000 c/plate in 10 cm dishes and incubated for 48 hrs (5% CO.sub.2, 37 C.), until a confluency of 90% was reached. Next, the cells were trypsinized (TrypIE Express, Gibco Thermo Scientific) to single cells. 0.75106 Cells were transferred to a 15 mL falcon tube and centrifuged (1,400 rpm, 3 min). The supernatant was discarded while leaving the cell pellet submerged. The pellet was dissociated by gentle tapping the falcon tube on a vortex shaker and the cells were washed with 4 mL cold PBS (Mg.sup.2+ and Ca.sup.2+ free, 2% FBS). After washing the cells were resuspended in 3 mL cold PBS (Mg.sup.2+ and Ca.sup.2+ free, 2% FBS) and divided equally over 3 round bottom FACS tubes (1 mL/tube). The cells were centrifuged again and resuspended in 200 L cold PBS (Mg.sup.2+ and Ca.sup.2+ free, 2% FBS) or 200 L antibody solution; containing 5 L antibody in 195 L cold PBS (Mg.sup.2+ and Ca.sup.2+ free, 2% FBS). APC Mouse IgG1, K Isotype Ctrl FC (#400122, Biolegend) was used as isotype control, and APC anti-human EGFR (#352906, Biolegend) was used to stain the EGFR receptor. Samples were incubated for 30 min at 4 C. on a tube roller mixer. Afterwards, the cells were washed 3 with cold PBS (Mg.sup.2+ and Ca.sup.2+ free, 2% FBS) and fixated for 20 min at room temperature using a 2% PFA solution in PBS. Cells were washed 2 with cold PBS, and resuspended in 250-350 L cold PBS for FACS analysis. Samples were analyzed with a BD FACSCanto Il flow cytometry system
[0675] (BD Biosciences) and FlowJo software. In Table AA, expression levels of EGFR, HER2 and CD71 of various cells are tabulated.
TABLE-US-00026 TABLE AA Expression levels of EGFR, HER2 and CD71 of various cells EGFR HER2 CD71 expression expression expression Cell line level (MFI) level (MFI) level (MFI) MDA-MB-468 1656 1 186 A431 1593 10 322 CaSki 481 12 189 SK-BR-3 28 1162 331 JIMT-1 58 74 107 HeLa 91 7 312 A2058 1 5 59
REFERENCES
[0676] Weng, A.; Thakur, M.; Beceren-Braun, F.; Bachran, D.; Bachran, C.; Riese, S.B.; Jenett-Siems, K.; Gilabert-Oriol, R.; Melzig, M. F.; Fuchs, H. The toxin component of targeted anti-tumor toxins determines their efficacy increase by saponins. Molecular oncology 2012, 6, 323-332. saponinum album in a synergistic way. Journal of immunotherapy 2009, 32, 713-725. [0677] Sama, S.; Jerz, G.; Schmieder, P.; Joseph, J. F.; Melzig, M. F.; Weng, A. Plant derived triterpenes from Gypsophila elegans M.Bieb. enable non-toxic delivery of gene loaded nanoplexes. Journal of Biotechnology 2018, 284, 131-139 [0678] Kolb, H. C.; Finn, M. G.; Sharpless, K. B. Click Chemistry: Diverse Chemical Function from a Few Good Reactions. Angewandte Chemie 2001, 40, 2004-2021. [0679] Bird, R. E.; Hardmann, K. D.; Jacobson, J. W.; Johnson, S.; Kaufman, B. M.; Lee, S. M.; Lee, T.; Pope, S. H.; Riordan, G. S.; Whitlow, M. Single-chain antigen-binding proteins. Science 1988, 242, 423-426. [0680] Y Zhang, Z Qu, S Kim, V Shi, B Liao1, P Kraft, R Bandaru, Y Wu, LM Greenberger and ID Horak, Down-modulation of cancer targets using locked nucleic acid (LNA)-based antisense oligonucleotides without transfection, Gene Therapy (2011) 18, 326-333