Recombinant herpesvirus of turkeys (HVT) and preparation method and use thereof

Abstract

The present disclosure provides a recombinant herpesvirus of turkeys (HVT) and a preparation method and use thereof. The present disclosure specifically provides a recombinant HVT, where an exogenous gene is inserted in a spacer region between an HVT005 region and an HVT006 region of an HVT genome; and the exogenous gene is selected from a gene derived from the group consisting of a Newcastle disease virus (NDV), an avian influenza virus (AIV), and an infectious bursal disease virus (IBDV); the spacer region between an HVT005 region and an HVT006 region of an HVT genome is located between 8,867 nt and 9,319 nt of the HVT genome, and has a nucleotide sequence set forth in SEQ ID NO: 1.

Claims

1. A recombinant herpesvirus of turkeys (HVT), wherein an exogenous gene is inserted in a site located at a sequence between nucleotide position 8,867 and position 9,319 of the HVT genome, the sequence having the nucleotide sequence of SEQ ID NO: 1; and wherein the exogenous gene is selected from: a Newcastle disease virus (NDV) F gene, an avian influenza virus (AIV) HA gene, and an infectious bursal disease virus (IBDV) VP2 gene; and the AIV is selected from an H9N2 subtype AIV, an H5N1 subtype AIV, an H7N7 subtype AIV, and H5N2 subtype AIV, an H7N2 subtype AIV, and an H9N1 subtype AIV; and the NDV is selected from a VII type NDV, a II type NDV, and a III type NDV.

2. The recombinant HVT according to claim 1, wherein the NDV F gene has the nucleotide sequence of SEQ ID NO:2, wherein SEQ ID NO:2 is comprised in an expression cassette, and wherein SEQ ID NO:2 in the expression cassette is operably linked to an mCMV promoter and an SV40 poly A.

3. The recombinant HVT according to claim 1, wherein the AIV HA gene has the nucleotide sequence of SEQ ID NO:3, wherein SEQ ID NO:3 is comprised in an expression cassette, and wherein SEQ ID NO:3 in the expression cassette is operably linked to an mCMV promoter and an SV40 poly A.

4. A vaccine for preventing avian influenza, Newcastle disease, or infectious bursal disease in a chicken, comprising the recombinant HVT according to claim 1.

5. The vaccine according to claim 4, wherein the NDV F gene has the nucleotide sequence of SEQ ID NO:2, wherein SEQ ID NO:2 is comprised in an expression cassette, and wherein SEQ ID NO:2 in the expression cassette is operably linked to an mCMV promoter and an SV40 poly A.

6. The vaccine according to claim 4, wherein the AIV HA gene has the nucleotide sequence of SEQ ID NO:3, wherein SEQ ID NO:3 is comprised in an expression cassette, and wherein SEQ ID NO:3 in the expression cassette is operably linked to an mCMV promoter and an SV40 poly A.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIGS. 1a-1f show a schematic diagram of construction of a donor plasmid;

(2) FIG. 2 shows a schematic diagram of construction of a recombinant virus rHVT-F;

(3) FIG. 3 shows a schematic diagram of construction of a recombinant virus rHVT-HA;

(4) FIG. 4 shows a PCR electrophoresis identification map of a pX330-HVT005/006-sgRNA plasmid;

(5) FIG. 5 shows a fluorescence image of a recombinant virus rHVT-GFP-F;

(6) FIG. 6 shows a fluorescence image of a recombinant virus rHVT-GFP-HA;

(7) FIG. 7 shows a fluorescence image of the recombinant virus rHVT-F identified by indirect immunofluorescence (IFA);

(8) FIG. 8 shows a fluorescence image of the recombinant virus rHVT-HA identified by IFA;

(9) FIG. 9 shows a PCR electrophoresis image of PCR identification of passage stability of the recombinant virus rHVT-F; and

(10) FIG. 10 shows a PCR electrophoresis image of PCR identification of passage stability of the recombinant virus rHVT-HA.

DETAILED DESCRIPTION OF THE EMBODIMENTS

(11) The present disclosure will be described in detail below by taking construction of rHVT-F and rHVT-HA as an example.

EXAMPLE

1. Materials

(12) 1.1. Strains, Plasmids and Antibodies

(13) An HVT FC-126 vaccine strain, an NDV genotype VII JS strain and an AIV H9N2 (2019) strain were identified and preserved by the Key Laboratory of Avian Preventive Medicine, Ministry of Education, Yangzhou University. All the strains were purchased therefrom.

(14) Plasmids: pX330, pX459, pcDNA3.1 and pcDNA3.1-Cre plasmids were purchased from a website of Hunan Keai Medical Equipment Co., Ltd. (YouBio). The pGEM-T Easy Vector Systems were purchased from Promega. A plasmid pCMV-N-GFP was purchased from Beyotime Biotechnology. A plasmid pX459-sgA was constructed and preserved by the Key Laboratory of Avian Preventive Medicine, Ministry of Education, Yangzhou University; the plasmid pX459-sgA was obtained by ligating an sgA sequence into the pX459 plasmid through a BbsI restriction site (referring to Knock-in of large reporter genes in human cells via CRISPR/Cas9-induced homology-dependent and independent DNA repair, doi.org/10.1093/nar/gkw064).

(15) Antibodies: anti-HA (H9) monoclonal antibody 2G4 (referring to Identification and Analysis of Critical Amino Acids Mutations in Epitopes in Hemagglutinin and Neuraminidase of H9N2 Influenza Virus in the Pressure of Antibody, Zhimin Wan) and anti-F (NDV) monoclonal antibody 1D10 (referring to Characteristics and Preliminary Application of Anti-Newcastle Disease Virus Fusion Protein Monoclonal Antibody, Qianqian Wang) were prepared and preserved by the Key Laboratory of Avian Preventive Medicine, Ministry of Education, Yangzhou University.

2. Methods

(16) 2.1. Target Site Design and sgRNA Sequence Synthesis

(17) An exogenous gene was inserted into an HVT005-HVT006 spacer region within the HVT; referring to an HVT005-HVT006 spacer region sequence of a full gene sequence of an HVT FC126 strain (accession number: AF291866) registered in the GenBank, a target-site-based sgRNA was designed using a sgRNA design website (crispr.mit.edu/) to obtain a sgRNA sequence.

(18) TABLE-US-00003 Name Sequence HVT005/006-SgRNA TCATATACTGAATCGTAGGG SEQIDNO:7

(19) A base CACC was added at 5-end of the sgRNA guide sequence, and a first base T was replaced with G to form a plus-strand sgRNA sequence; the designed sgRNA sequence was reverse-complemented, and a base AAAC was added to the 5-end to form a minus-strand sgRNA sequence.

(20) TABLE-US-00004 Name Sequence HVT005/006-sgRNA-F caccgCATATACTGAATCGTAGGG SEQIDNO:8 HVT005/006-sgRNA-R aaacCCCTACGATTCAGTATATGc SEQIDNO:9
2.2. Construction of a Targeting Vector: (1) synthesized HVT005/006-sgRNA-F and HVT005/006-sgRNA-R sequences were annealed to form a dsDNA, in which a reaction system was as follows:

(21) TABLE-US-00005 Name Volume HVT005/006-sgRNA-F(10 M) 1 L HVT005/006-sgRNA-R(10 M) 1 L Annealing buffer (10) 1 L ddH.sub.2O 7 L

(22) The above system was shaken, centrifuged and placed in a PCR instrument. The PCR protocol consisted of 30 min at 37 C., 5 min at 95 C., gradient cooling at 5 C./min, and then 10 min at 4 C. (2) The pX330 vector was digested with a BbsI enzyme for linearization, in which a reaction system was as follows:

(23) TABLE-US-00006 Name Volume Vector pX330 1 g 10 NEB Buffer 2 L BbsI enzyme 1 L ddH.sub.2O Adding to 20 L

(24) After incubation at 37 C. for 2 h, a linearized vector pX330 was excised and recovered. (3) An annealed dsDNA was ligated with the linearized vector pX330, in which a reaction system was as follows:

(25) TABLE-US-00007 Name Volume Linearized vector pX330 0.1 g dsDNA 0.2 L 10 ligation buffer 2 L T4 DNA ligase 1 L ddH.sub.2O Adding to 20 L

(26) The above system was shaken, centrifuged, and ligated at 16 C. overnight to obtain a ligated product. (4) 50 L of DH5 competent cells (purchased from Nanjing Vazyme Biotech Co., Ltd.) were mixed well with 10 L of the ligated product, followed by conducting incubation on ice for 30 min. The above mixture was treated in a water bath at 42 C. for 90 sec, and a tube was quickly inserted into ice and allowed to stand for 3 min. 800 L of an anti-LB-free medium was added to the tube, followed by incubation on a shaker (37 C./150 rpm) for 1 h; 200 L of a bacterial solution was pipetted and spread evenly on a solid medium containing ampicillin (50 g/mL) prepared in advance, followed by inverted incubation at 37 C., and transformed clones were formed at 14 h to 16 h. (5) A plasmid was extracted, and primers were designed according to the vector pX330 and the sgRNA sequence for PCR identification.

(27) TABLE-US-00008 Name Sequence U6-F GACTATCATATGCTTACCGT SEQIDNO:10 HVT005/006-SgRNA-R aaacCCCTACGATTCAGTATATGc SEQIDNO:11
PCR System

(28) TABLE-US-00009 Name Volume U6-F 1 L HVT005/006-sgRNA-R 1 L Plasmid 1 L ddH.sub.2O 7 L Green Taq Mix (Vazyme Biotech) 10 L

(29) The reaction program was as follows: 95 C. for 5 min; 35 cycles of 95 C. for 30 sec, 60 C. for 30 sec, and then 72 C. for 30 sec; and 72 C. for 10 min.

(30) After the reaction, electrophoresis was conducted with 1% agarose gel (FIG. 3).

(31) 2.2. Construction of a Donor Vector pT-sgA-GFP-F

(32) 2.2.1. Amplification of NDV F Gene

(33) Overlap PCR primers were designed for an F gene sequence of an NDV genotype VII and an F gene cleavage site sequence of an NDV La Sota strain. Primer sequences were as follows:

(34) TABLE-US-00010 Name Sequence F(overlap)left-F ATGGGCTCCAAACTTTCTACSEQIDNO:12 F(overlap)left-R GCGCCCCTGTCTCCCTCCTCCAGACGTGGACACSEQIDNO:13 F(overlap)right-F GAGGGAGACAGGGGCGCCTTATAGGTGCTGTTATTGGCAG SEQIDNO:14 F(overlap)right-R TCATGCTCTTGTAGTGGCTCSEQIDNO:15

(35) PCR amplification was conducted on a left fragment of the F gene and a right fragment of the F gene taking a reverse-transcribed cDNA of the NDV genotype VII as a template, and using F(overlap)left-F and F(overlap)left-R, F(overlap)right-F and F(overlap)right-R as primers, respectively; and overlap PCR amplification was conducted on an F gene fragment after replacement of the cleavage site using the left fragment of the F gene and the right fragment of the F gene as templates, and using F(overlap)left-F and F(overlap)right-R were used as primers. The F gene fragment after replacement of the cleavage site had a nucleotide sequence set forth in SEQ ID NO: 2.

(36) Primers were designed with Primer Premier 5.0 software, and an NotI restriction sites were introduced upstream and downstream. Primer sequences were as follows:

(37) TABLE-US-00011 Name Sequence NotI-F-F ATTTGCGGCCGCATGGGCTCCAAACTTTCTACCA SEQIDNO:16 NotI-F-R ATTTGCGGCCGCTCATGCTCTTGTAGTGGCTCTCA SEQIDNO:17

(38) The PCR amplification was conducted on the F gene using the F gene fragment after replacement of the cleavage site as a template, and using NotI-F-F and NotI-F-R as primers; electrophoresis was conducted with 1% agarose gel after the reaction, and a target band was recovered for later use.

(39) 2.2.2. Construction of an Eukaryotic Expression Vector pcDNA3.1-SfiI-F

(40) 2.2.2.1. Construction of a Plasmid pcDNA3.1-SfiI

(41) An mCMV+polyA element for gene sequence synthesis (NheI+SfiI+mCMV+NotI+SV40ployA+SfiI+PmeI) was synthesized, in which an mCMV sequence referred to a mouse cytomegalovirus genome (Murid herpesvirus 1 strain Smith, complete genome, GenBank: GU305914.1, 184,336 nt to 182,946 nt), and the entire element had a nucleotide sequence set forth in SEQ ID NO: 6.

(42) The sequence fragment of mCMV+polyA for gene synthesis was double-digested with NheI and PmeI, and ligated into a pcDNA3.1 plasmid through NheI and PmeI restriction sites to obtain a plasmid pcDNA3.1-SfiI.

(43) 2.2.2.2. Construction of a Plasmid pcDNA3.1-SfiI-F

(44) PCR gel recovery products of the F gene in 2.2.1 and the plasmid pcDNA3.1-SfiI were digested with the NotI; after conducting 1% gel electrophoresis, the gel was cut to recover a linearized pcDNA3.1-SfiI-NotI vector and an NotI-F gene fragment. The recovered pcDNA3.1-SfiI-NotI fragment and the NotI-F gene fragment were ligated to construct the plasmid pcDNA3.1-SfiI-F.

(45) 2.2.3. Construction of a Donor Vector pT-sgA-GFP-F

(46) 2.2.3.1. Construction of a Plasmid pT-sgA

(47) A gene sequence (sgA+loxP+PacI+LoxP+SfiI+spacer+SfiI+sgA) was synthesized, in which primers were as follows; sgA-SfiI-F and sgA-SfiI-R were annealed to form dsDNA fragments, and the fragments were ligated into a pGEM-T-easy vector to obtain a pT-sgA vector.

(48) TABLE-US-00012 Name Sequence sgA- GAGATCGAGTGCCGCATCACCGGATAACTTCGTATAATGTATGCTATACGAA SfiI-F GTTATTTAATTAAATAACTTCGTATAATGTATGCTATACGAAGTTATGGCCGC CTAGGCCGGCGCGCCGTTTAAACGGCCATTATGGCCGAGATCGAGTGCCG CATCACCGGASEQIDNO:18 sgA- CCGGTGATGCGGCACTCGATCTCGGCCATAATGGCCGTTTAAACGGCGCGC SfiI-R CGGCCTAGGCGGCCATAACTTCGTATAGCATACATTATACGAAGTTATTTAAT TAAATAACTTCGTATAGCATACATTATACGAAGTTATCCGGTGATGCGGCAC TCGATCTCASEQIDNO:19
2.2.3.2. Construction of a Plasmid pT-sgA-GFP

(49) The following primers were designed for a GFP expression cassette:

(50) TABLE-US-00013 Name Sequence PacI-GFP-F CCTTAATTAAGGTTAATTAATTTGCTGGCCTTTTGCTCACSEQID NO:20 PacI-GFP-R CCTTAATTAAGGTTAATTAAGCCGATTTCGGCCTATTGGTSEQID NO:21

(51) The GFP expression cassette (PacI+CMV promoter+GFP+SV40PolyA+PacI) was amplified using a pCMV-N-GFP plasmid as a template, and using PacI-GFP-F and PacI-GFP-R as primers, and then ligated through a PacI restriction site into a pT-sgA plasmid to obtain the pT-sgA-GFP plasmid.

(52) 2.2.3.3. Construction of a Plasmid pT-sgA-GFP-F

(53) The plasmids pcDNA3.1-SfiI-F and pT-sgA-GFP were digested with the SfiI, followed by conducting 1% gel electrophoresis, and an SfiI-F fragment in the pcDNA3.1-SfiI-F vector and a linearized pT-sgA-GFP vector were recovered by gel cutting. The recovered SfiI-F fragment and the pT-sgA-GFP-SfiI fragment were ligated to construct the plasmid pT-sgA-GFP-F.

(54) 2.3. Construction of a Donor Vector pT-sgA-GFP-HA

(55) 2.3.1. Amplification of AIV HA Gene

(56) Primers were designed with Primer Premier 5.0 software, and an NotI restriction sites were introduced upstream and downstream. Primer sequences were as follows:

(57) TABLE-US-00014 Name Sequence NotI-HA-F ATTTGCGGCCGCATGGAGGCAGTATCACTAATAACSEQIDNO:22 NotI-HA-R ATTTGCGGCCGCTTATATACAAATGTTGCATCTGCSEQIDNO:23

(58) The PCR amplification was conducted on the HA gene using an AIV H9N2 (2019) strain cDNA as a template, and using NotI-HA-F and NotI-HA-R as primers; 1% agarose gel electrophoresis was conducted after the reaction, and a target band was recovered for later use. The HA gene had a nucleotide sequence set forth in SEQ ID NO: 3.

(59) 2.3.2. Construction of an Eukaryotic Expression Vector pcDNA3.1-SfiI-HA

(60) PCR gel recovery products of the HA gene in 2.3.1 and the plasmid pcDNA3.1-SfiI (referring to 2.2.2.1 in Example) were digested with the NotI; after conducting 1% gel electrophoresis, the gel was cut to recover a linearized pcDNA3.1-SfiI vector and an NotI-HA gene fragment. The recovered pcDNA3.1-SfiI-NotI fragment and the NotI-HA fragment were ligated to construct the plasmid pcDNA3.1-SfiI-HA.

(61) 2.3.3. Construction of a Donor Vector pT-sgA-GFP-HA

(62) The plasmids pcDNA3.1-SfiI-HA and pT-sgA-GFP (referring to 2.2.3.2 in Example) were digested with the SfiI, followed by conducting 1% gel electrophoresis, and an SfiI-HA fragment in the pcDNA3.1-SfiI-HA vector and a linearized pT-sgA-GFP vector were recovered by gel cutting. The recovered SfiI-HA fragment and the pT-sgA-GFP-SfiI fragment were ligated to construct the plasmid pT-sgA-GFP-HA.

(63) 2.4. Construction of a Recombinant HVT for Expressing GFP and F Proteins, rHVT-GFP-F

(64) 2.4.1. Cell Transfection

(65) Before transfection, primary CEF cells were prepared, in which the cells were grown in a 24-well cell culture plate with an M199 medium containing 5% fetal bovine serum; when the cells grew to 80% of a monolayer, they were transfected with TransIT-X2 according to instructions of the TransIT-X2 transfection reagent (Mirusbio), in which a transfection system of each well included 0.25 g of plasmid pX459-sgA, 0.25 g of plasmid pT-sgA-GFP-F and 0.25 g of plasmid pX330-HVT005/006-sgRNA.

(66) 2.4.2. Virus Infection

(67) 8 h to 12 h after the transfection, the cells were infected with the HVT, in which the virus in each well had an amount of 5,000 PFU. After incubation for 2 d to 3 d at 37 C. and 5% CO.sub.2, cells in 1 well were digested with trypsin and inoculated on 2 new CEF 6-well cell culture plates. After incubation for 3 d to 4 d at 37 C. and 5% CO.sub.2, the cells were observed under a fluorescence microscope, and viral plaques were selected with green fluorescence.

(68) 2.4.3. Purification of a Recombinant Virus rHVT-GFP-F

(69) The cells were observed under the fluorescence microscope, the viral plaques with green fluorescence were marked using a marker, and labeled green fluorescence-containing cells were selected by trypsin digestion, and inoculated on a secondary CEF monolayer cells, followed by incubation at 37 C. and 5% CO.sub.2 for 3 d to 4 d; the above steps were repeated until all plaques showed fluorescence, and a completely-purified recombinant virus was named rHVT-GFP-F (shown in FIG. 5).

(70) 2.5. Construction of a Recombinant HVT for Expressing GFP and HA Proteins, rHVT-GFP-HA

(71) 2.5.1. Cell Transfection

(72) Before transfection, primary CEF cells were prepared, in which the cells were grown in a 24-well cell culture plate with an M199 medium containing 5% fetal bovine serum; when the cells grew to 80% of a monolayer, they were transfected with TransIT-X2 according to instructions of the TransIT-X2 transfection reagent (Mirusbio), in which a transfection system of each well included 0.25 g of plasmid pX459-sgA, 0.25 g of plasmid pT-sgA-GFP-HA and 0.25 g of plasmid pX330-HVT005/006-sgRNA.

(73) 2.5.2. Virus Infection

(74) 8 h to 12 h after the transfection, the cells were infected with the HVT, in which the virus in each well had an amount of 5,000 PFU. After incubation for 2 d to 3 d at 37 C. and 5% CO.sub.2, cells in 1 well were digested with trypsin and inoculated on 2 new CEF 6-well cell culture plates. After incubation for 3 d to 4 d at 37 C. and 5% CO.sub.2, the cells were observed under a fluorescence microscope, and viral plaques were selected with green fluorescence.

(75) 2.5.3. Purification of a Recombinant Virus rHVT-GFP-HA

(76) The cells were observed under the fluorescence microscope, the viral plaques with green fluorescence were marked using a marker, and labeled green fluorescence-containing cells were selected by trypsin digestion, and inoculated on a secondary CEF monolayer cells, followed by incubation at 37 C. and 5% CO.sub.2 for 3 d to 4 d; the above steps were repeated until all plaques showed fluorescence, and a completely-purified recombinant virus was named rHVT-GFP-HA (shown in FIG. 6).

(77) 2.6. Construction of a Recombinant HVT for Expressing an F Protein, rHVT-F

(78) 2.6.1. Cell Transfection

(79) Before transfection, primary CEF cells were prepared, where the cells were grown in a 24-well cell culture plate with an M199 medium containing 5% fetal bovine serum; when the cells grew to 80% of a monolayer, they were transfected with TransIT-X2 according to instructions of the TransIT-X2 transfection reagent (Mirusbio), in which a transfection system of each well included 0.5 g of plasmid pcDNA3.1-Cre.

(80) 2.6.2. Virus Infection

(81) 8 h to 12 h after the transfection, the cells were infected with the rHVT-GFP-F, in which the virus in each well had an amount of 5,000 PFU. After incubation for 2 d to 3 d at 37 C. and 5% CO.sub.2, cells in 1 well were digested with trypsin and inoculated on 2 new CEF 6-well cell culture plates. After incubation for 3 d to 4 d at 37 C. and 5% CO.sub.2, the cells were observed under a fluorescence microscope, and viral plaques were selected without green fluorescence.

(82) 2.6.3. Purification of a Recombinant Virus rHVT-F

(83) The cells were observed under the fluorescence microscope, the viral plaques without green fluorescence were marked using a marker, and labeled pathological cells were selected by trypsin digestion, and inoculated on a secondary CEF monolayer cells, followed by incubation at 37 C. and 5% CO.sub.2 for 3 d to 4 d; the above steps were repeated until all plaques showed no fluorescence, and a completely-purified recombinant virus was named rHVT-F.

(84) 2.7. Construction of a Recombinant HVT for Expressing an HA Protein, rHVT-HA

(85) 2.7.1. Cell Transfection

(86) Before transfection, primary CEF cells were prepared, in which the cells were grown in a 24-well cell culture plate with an M199 medium containing 5% fetal bovine serum; when the cells grew to 80% of a monolayer, they were transfected with TransIT-X2 according to instructions of the TransIT-X2 transfection reagent (Mirusbio), in which a transfection system of each well included 0.5 g of plasmid pcDNA3.1-Cre.

(87) 2.7.2. Virus Infection

(88) 8 h to 12 h after the transfection, the cells were infected with the rHVT-GFP-HA, in which the virus in each well had an amount of 5,000 PFU. After incubation for 2 d to 3 d at 37 C. and 5% CO.sub.2, cells in 1 well were digested with trypsin and inoculated on 2 new CEF 6-well cell culture plates. After incubation for 3 d to 4 d at 37 C. and 5% CO.sub.2, the cells were observed under a fluorescence microscope, and viral plaques were selected without green fluorescence.

(89) 2.7.3. Purification of a Recombinant Virus rHVT-HA

(90) The cells were observed under the fluorescence microscope, the viral plaques without green fluorescence were marked using a marker, and labeled pathological cells were selected by trypsin digestion, and inoculated on a secondary CEF monolayer cells, followed by incubation at 37 C. and 5% CO.sub.2 for 3 d to 4 d; the above steps were repeated until all plaques showed no fluorescence, and a completely-purified recombinant virus was named rHVT-HA.

(91) 2.8. Identification of the Recombinant Virus and Detection of Passage Stability

(92) 2.8.1. Indirect Immunofluorescence Assay (IFA)

(93) The recombinant virus rHVT-F strain, the recombinant virus rHVT-HA strain and an HVT parental virus were inoculated into a 24-well cell culture plate covered with monolayer CEF, followed by incubation at 37 C. and 5% CO.sub.2; after the cells had typical plaques, the medium was discarded, and the cells were fixated with a cold fixative solution of acetone:ethanol (3:2) for 10 min, and washed twice with a PBS; 500 L (1:200 dilution) of a 1D10 monoclonal antibody was added to the wells inoculated with the rHVT-F strain, 500 L (1:200 dilution) of a 2G4 monoclonal antibody was added to the wells inoculated with the rHVT-HA strain, 500 L (1:200 dilution) of the 1D10 monoclonal antibody was added to one well inoculated with the HVT strain, and 500 L (1:200 dilution) of the 2G4 monoclonal antibody was added to the other well inoculated with the HVT strain. The cells were incubated for 1 h in a constant-temperature incubator at 37 C., and washed three times with the PBS; 500 L (1:800 dilution) of an Alexa Fluor 594 goat anti-mouse IgG antibody was added to each well, followed by incubation in a 37 C. incubator for 1 h, and then washing three times with the PBS; the cells were observed under a fluorescence microscope. It was showed that specific red fluorescence appeared in the wells infected with the rHVT-F and rHVT-HA strains (shown in FIG. 7 and FIG. 8), while HVT-infected wells had no fluorescence, indicating that the F gene of rHVT-F strain and the HA gene of rHVT-HA strain were correctly expressed.

(94) 2.8.2. PCR Detection of the Passage Stability

(95) The rHVT-F strain and the rHVT-HA strain were continuously passed on CEF for 15 generations, and the genome of the recombinant virus was extracted every 5 generations; PCR was conducted using the extracted genome as a template and HVT-005/006-F and HVT-005/006-R as primers, and target bands of about 3,500 bp were amplified, respectively (shown in FIG. 9 and FIG. 10). The results showed that the F gene and the HA gene were successfully inserted into the HVT genome without gene loss.

(96) TABLE-US-00015 Name Sequence HVT-005/006-F tcgtttgcgcgtagtaacatt SEQIDNO:24 HVT-005/006-R taactgtgagcaatgcagggg SEQIDNO:25

3. The rHVT-F Strain as a Vaccine

(97) 3.1. Amplification of the rHVT-F Strain

(98) CEFs were inoculated into several T75 cell flasks, and inoculated with rHVT-F after 1 d of incubation, and each flask was inoculated with 50,000 PFU of the virus. After inoculation, the virus growth was observed every day; generally, 48 h to 72 h after inoculation, when more than 70% of the monolayer cells had typical cytopathic effects, the cell medium was discarded, and after washing with PBS once, the cells were digested with an appropriate amount of trypsin; when the monolayer cells shrank and were about to separate from the bottle wall, the trypsin was discarded, and the digestion was terminated using an equal amount of a cell medium containing 5% bovine serum. The cells were pipetted with a pipette to make the cells all detached from the bottle wall; after being collected by centrifugation, the cells were resuspended with a cryoprotectant (a cell medium containing 15% bovine serum and 10% DMSO), divided into cryovials at 70 C., and transferred to liquid nitrogen for storage on a second day.

(99) 3.2. Immunization of the rHVT-F Strain

(100) 18 1-day-old SPF chickens were randomly divided into two groups, namely an rHVT-F group and a challenge control group; in which the rHVT-F group was inoculated with 2,000 PFU/chicken of an rHVT-F recombinant vaccine by intraperitoneal injection at 1 day old, while the challenge control group was inoculated with a vaccine dilution. The two groups of chickens were challenged with a virulent NDV F48E8 strain by intramuscular injection at 28-day-old, with a challenge dosage of 10.sup.5 ELD.sub.50/chicken. After the challenge, the incidence and mortality of the chickens in each group were observed and counted every day for two weeks.

(101) 3.3. Challenge Protection Effects of rHVT-F Strain-Immunized Chickens

(102) The incidence and mortality of the chickens in each group are shown in the table below. It could be seen that the chickens in the rHVT-F group had a challenge protection rate reaching 100%, while the challenge control group had a challenge protection rate of 0%.

(103) TABLE-US-00016 Challenge protection Group Mortality (%) efficiency rHVT-F 0/9 100% Challenge control group 9/9 0%

(104) The results of immune protection evaluation showed that the chickens had a desirable immune protection effect against the virulent NDV strain after immunization with the recombinant HVT, rHVT-F strain.