Nitrilase mutant and use thereof in catalytic synthesis of 2-chloronicotinic acid
12516359 ยท 2026-01-06
Assignee
Inventors
- Renchao Zheng (Hangzhou, CN)
- Andi Dai (Hangzhou, CN)
- Zheming Wu (Hangzhou, CN)
- Yuguo Zheng (Hangzhou, CN)
Cpc classification
C12N9/78
CHEMISTRY; METALLURGY
International classification
Abstract
The present invention discloses a nitrilase mutant and application thereof in catalytic synthesis of 2-chloronicotinic acid, and belongs to the technical field of enzyme engineering. The nitrilase mutant has an amino acid sequence shown in SEQ ID NO. 4, that is, 167th tryptophan W of a parent nitrilase is mutated into glycine G. According to the nitrilase mutant provided by the present invention, the hydration activity of the parent nitrilase to 2-chloronicotinonitrile is eliminated, a byproduct of 2-chloronicotinamide is not generated in the catalytic process, the nitrile hydrolysis activity is greatly improved, and 2-chloronicotinonitrile can be specifically subjected to catalytic hydrolysis to synthesize 2-chloronicotinic acid. Therefore, the nitrilase mutant has an important potential in enzymatic industrial synthesis of 2-chloronicotinic acid.
Claims
1. A nitrilase mutant having the amino acid sequence of SEQ ID NO: 4.
2. A gene having the nucleotide sequence of SEQ ID NO: 3.
3. A recombinant plasmid comprising the gene according to claim 2.
4. The recombinant plasmid according to claim 3, wherein the recombinant plasmid is a pET-28b (+) vector that comprises the gene.
5. A recombinant engineered bacterium comprising the recombinant plasmid according to claim 3.
6. The recombinant engineered bacterium according to claim 5, wherein the recombinant engineered bacterium is a Escherichia coli BL21 cell that comprises the recombinant plasmid.
7. A method of catalytic hydrolysis of 2-chloronicotinonitrile to synthesize 2-chloronicotinic acid, comprising: culturing a cell transformed with a nucleic acid encoding the protein of SEQ ID NO: 4 to express the protein of SEQ ID NO: 4; sonicating the cell to obtain the protein of SEQ ID NO: 4; reacting the protein of SEQ ID NO: 4 with 2-chloronicotinonitrile in a reaction medium that is a NaH.sub.2PO.sub.4Na.sub.2HPO.sub.4 buffer solution at a pH between 6 and 8 at a temperature of 25-45 C. to produce 2-chloronicotinic acid, and purifying the 2-chloronicotinic acid.
8. The method according to claim 7, wherein the concentration of 2-chloronicotinonitrile in the reaction medium is 50-500 mM.
9. The method according to claim 8, wherein the NaH.sub.2PO.sub.4Na.sub.2HPO.sub.4 buffer solution used as the reaction medium has a pH value of 7, the concentration of 2-chloronicotinonitrile in the reaction medium is 300 mM, and the reaction is performed at 30 C. for 30-40 hours.
10. A recombinant engineered bacterium comprising the recombinant plasmid according to claim 4.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2)
DETAILED DESCRIPTION OF THE EMBODIMENTS
(3) The present invention is further described below in conjunction with the specific examples, but the protection scope of the present invention is not limited thereto.
Example 1 Construction of Nitrilase Mutant Library
(4) A pET-RZ plasmid containing a nitrilase gene (nucleotide sequence SEQ ID NO. 1 and amino acid sequence SEQ ID NO. 2) from Rhodococcus zopfii was used as a template, primers T7 F and T7 R (Table 1) were used for PCR amplification, and the mutation was introduced randomly.
(5) PCR reaction system (50 L): 0.5-20 ng of template pET-RZ, 1Taq Buffer (without Mg.sup.2+), 0.2 mM of dNTP, 0.3 mM of MnCl.sub.2, 2 mM of MgCl.sub.2, 0.2 M of each of upstream and downstream primers T7 F and T7 R, and 5 U of a Taq DNA polymerase.
(6) PCR conditions: (1) pre-denaturation at 95 C. for 5 min; (2) denaturation at 95 C. for 15 s; (3) annealing at 60 C. for 5 s; (4) extension at 72 C. for 30 s, and a total of 30 cycles of steps (2)-(4); and (5) finally, extension at 72 C. for 3 min and preservation at 4 C.
(7) A PCR product was analyzed by an agarose gel electrophoresis and a gel was cut for recovery.
(8) Subsequently, the gel recovery product was used as primers for amplification to obtain complete a plasmid.
(9) PCR system (50 L): 2Phanta Max buffer, 0.2 mM of dNTPs, 2.5 U of a Phanta Max high-fidelity polymerase, 50 ng of the gel recovery product, and 20 ng of the pET RZ plasmid.
(10) PCR conditions: (1) pre-denaturation at 95 C. for 5 min; (2) denaturation at 95 C. for 15 seconds, annealing at 60 C. for 5 seconds, and extension at 72 C. for 3.5 min, and a total of 35 cycles of step (2); and (3) finally, extension at 72 C. for 5 min and preservation at 4 C.
(11) The amplified PCR product was digested by an endonuclease DpnI at 37 C. for 3 hours, the enzyme was inactivated at 65 C. for 10 min, and the digested product was transformed into E. coli BL21 (DE3) which was coated on an LB plate containing kanamycin (50 g/mL) and cultured overnight at 37 C.
(12) TABLE-US-00001 TABLE1 Primerdesign Sequenceofprimers Nameofprimers (5to3) T7F TAATACGACTCACTATAGGG (SEQIDNO:5) T7R TGCTAGTTATTGCTCAGCGG (SEQIDNO:6) W167F GGCGCGCTGAACTGCNNKGA ACACTTCCAGACC (SEQIDNO:7) W167R GGTCTGGAAGTGTTCMNNGC AGTTCAGCGCGCC (SEQIDNO:8)
Example 2 High-Throughput Screening of Mutants
(13) A single colony in example 1 was picked and cultured in a 96-deep well plate, 1 mL of an LB culture medium (containing kanamycin at a final concentration of 50 g/mL) was added to each well plate, the bacteria were cultured at 37 C. for 12 hours, 200 L of a bacterial solution was transferred to 800 L of a fresh LB medium (at final concentration of 50 g/mL of kanamycin, 0.1 mM IPTG), and the bacteria were cultured at 28 C. for 18 hours. The bacterial cells in the 96-deep well plate were centrifuged for 30 min (3,000 rpm, 4 C.), the supernatant was discarded, the residue was washed with a NaH.sub.2PO.sub.4Na.sub.2HPO.sub.4 buffer solution (200 mM, pH 7.0), and the bacterial cells were resuspended with 600 L of the buffer solution. A substrate 2-chloronicotinonitrile (at a final concentration of 100 mM) was added into each well and reaction was performed at 30 C. for 12 hours. After the reaction, a reaction solution in the 96-deep well plate was centrifuged for 30 min (3,000 rpm, 4 C.), 20 L of a supernatant was transferred to a 96-well micro-reaction plate where each well contains 150 L of a mixed solution of phthalaldehyde and mercaptoethanol, and the plate was placed at 37 C. for insulation for 30 min. The fluorescence intensity was measured with a microplate reader (excitation wavelength of 412 nm and emission wavelength of 467 nm). The stronger fluorescence indicated the higher nitrile hydrolysis activity and produced more NH.sub.3 and 2-chloronicotinic acid. After verification by a liquid chromatography, a sequence analysis was performed. A mobile phase of the liquid chromatography is acetonitrile:water:phosphoric acid=250:750:1, the flow rate is 1 mL/min, and the detection wavelength is 210 nm. A mutant W167A (Table 2) was obtained by screening, that is, the codon at position 167 was mutated from TGG to GCC.
Example 3 Site-Directed Mutagenesis
(14) A plasmid pET-W167A was used as a template for site-directed mutagenesis by full plasmid amplification.
(15) PCR system (50 L): 0.5-20 ng of a template pET-W167A, 10-15 pmol of each of primers W167 F and W167 R, 2Phanta Max buffer, 0.2 mM of dNTP, and 2.5 U of Phanta Max high-fidelity polymerase.
(16) PCR conditions: (1) pre-denaturation at 95 C. for 5 min; (2) denaturation at 95 C. for 15 s, annealing at 60 C. for 5 s, and extension at 72 C. for 3.5 min, and a total of 35 cycles of step (2); and (3) finally, extension at 72 C. for 5 min and preservation at 4 C.
(17) The amplified PCR product was digested by an endonuclease DpnI at 37 C. for 3 h, the enzyme was inactivated at 65 C. for 10 min, and the digested product was transformed into E. coli BL21 (DE3) which was coated on an LB plate containing kanamycin (50 g/mL) and cultured overnight at 37 C.
(18) A total of 200-300 monoclones were generated by saturation mutagenesis at position 167, and after sequencing, all 20 kinds of natural amino acids were included.
(19) After preliminary screening by the high-throughput screening method in example 2, secondary screening and verification were performed by using liquid chromatography. It was determined that the mutants without nitrile hydration activity and with improved nitrile hydrolysis activity were W167S (i.e. the codon at position 167 mutated from TGG to TCC), W167C (i.e. the codon at position 167 mutated from TGG to TGC), and W167G (i.e. the codon at position 167 mutated from TGG to GGC), as shown in Table 2.
(20) The parent nitrilase had the hydratase activity when hydrolyzing 2-chloronicotinonitrile, and produced a large amount of a byproduct of 2-chloronicotinamide (
(21) TABLE-US-00002 TABLE 2 Comparison of relative activity of nitrilase Mutants Proportion of amide (%) Relative activity (%) WT 90.55 100 W167A 0.54 185 W167S 0 427 W167C 0 459 W167G 0 2052
Example 4 Induction and Expression of Nitrilase
(22) 10 L of the bacterial solution preserved in a glycerin tube was inoculated into 10 mL of a liquid LB medium (containing 50 g/mL of kanamycin) and cultured at 37 C. and 200 rpm overnight, the cultured bacteria were transferred to 100 mL of a fresh LB medium (containing 50 g/mL kanamycin) with an inoculum size of 2% and continuously cultured until OD.sub.600 was 0.4-0.8, IPTG with a final concentration of 0.1 mM was added, and the bacteria were subjected to induced culture at 28 C. for 12 hours. After the culture, the bacterial cells were collected by centrifugation at 8,000 rpm and 4 C. for 10 min and washed twice with 0.9% normal saline to obtain wet bacterial cells.
Example 5 Preparation of 2-Chloronicotinic Acid by Using Recombinant Nitrilase Mutant
(23) The collected wet bacterial cells of the preferred mutant W167G in example 3 subjected to the induced culture by using the method in example 4 were used as a catalyst to be added into the reaction system (total system: 10 mL, and substrate: 300 mM of 2-chloronicotinonitrile, 200 mM of a NaH.sub.2PO.sub.4Na.sub.2HPO.sub.4 buffer solution at a pH of 7, and 0.02 g of bacterial cells (dry weight)), and reaction was performed at 30 C. 100 L of the reaction solution was sampled at regular intervals, 10 L of 6 M HCl was added to terminate the reaction, and the content of the product was determined by HPLC.
(24) It can be seen from