DNA aptamers and use thereof

Abstract

The present disclosure relates to novel DNA aptamers and use thereof. In particular, the present disclosure relates to DNA aptamers selected from a DNA library using Cell-SELEX to bind specifically to cancer cells. The DNA aptamers of the present disclosure selected and optimized for high binding affinity to cancer cells can be effectively used for the diagnosis of cancer as they have enhanced targeting efficiencies for target cells and tissues.

Claims

1. A DNA aptamer consisting of the nucleotide sequence of SEQ ID NO: 6.

2. A DNA aptamer consisting of the nucleotide sequence of SEQ ID NO: 4.

3. A composition for targeting cancer tissues, comprising the DNA aptamer of claim 1.

4. A composition for diagnosing a cancer, comprising the DNA aptamer of claim 1.

5. A composition for treating a cancer, comprising the DNA aptamer of claim 1.

6. The composition of claim 5, wherein the cancer is pancreatic cancer, colon cancer, liver cancer, lung cancer, brain tumor, oral cavity cancer, or breast cancer.

7. The composition of claim 5, further comprising an anticancer agent conjugated with the DNA aptamer.

8. The composition of claim 7, wherein the anticancer agent is one or more selected from the group consisting of MMAE (monomethyl auristatin E), MMAF (monomethyl auristatin F), calicheamicin, mertansine, ravtansine, tesirine, doxorubicin, cisplatin, SN-38, duocarmycin, and pyrrolobenzodiazepine.

9. The composition of claim 5, wherein the DNA aptamer is conjugated with a polyethylene glycol (PEG) or its derivative, a diacylglycerol (DAG) or its derivative, a dendrimer, or a phosphorylcholine-containing polymer.

10. A method of targeting cancer tissues, comprising administering the DNA aptamer of claim 1 to a subject in need thereof.

11. A method of diagnosing a cancer, comprising administering the DNA aptamer of claim 1 which is conjugated with an imaging agent to a subject in need thereof, and detecting a signal released by the imaging agent to diagnose the cancer.

12. A method of treating a cancer, comprising administering the DNA aptamer of claim 1 which is conjugated with an anticancer agent to a subject in need thereof.

Description

BRIEF DESCRIPTION OF DRAWINGS

(1) FIG. 1 illustrates the format of the nucleotide sequences included in the DNA library of the present disclosure as well as the formats of the forward primer and reverse primer that can be used to amplify or identify the above nucleotide sequences. Specifically, the nucleotide sequences in the DNA library comprise 20 constant nucleotides at the 5-terminus, 40 random nucleotides in the middle, and additional 20 constant nucleotides at the 3-terminus. The forward primer is labeled with Cy5 at its 5-terminus (5-Cy5-sequence-3), and the reverse primer with biotin at its 5-terminus (5-biotin-sequence-3).

(2) FIG. 2 shows the results of enriching a ssDNA pool, out of the DNA library of the present disclosure, which has binding affinity to pancreatic cancer cells and determining with a flow cytometer (Fluorescence-activated cell sorting; FACS) whether the cell binding affinity of the pool is increased according to the number of rounds.

(3) FIG. 3 schematically illustrates the process of screening aptamers through Cell-SELEX technique using metastatic pancreatic cancer cells in the present disclosure.

(4) FIG. 4 shows the results from the determination of cell binding affinity of individual Cy5-labeled aptamer candidates obtained by screening aptamers through Cell-SELEX technique using metastatic pancreatic cancer cells in the present disclosure.

(5) FIG. 5 depicts the secondary structure determined for the SQ8 aptamer (Example 1) obtained by screening aptamers through Cell-SELEX technique using metastatic pancreatic cancer cells in the present disclosure.

(6) FIG. 6a shows the results from the determination of target cell binding affinity of the SQ8 aptamer of the present disclosure using a flow cytometer (FACS). Specifically, target cell binding was determined for Example 1 (SQ8 aptamer) as well as no-treatment control and Comparative Example 1 (DNA pool library).

(7) FIG. 6b shows the results from the determination of target cell binding affinity of the SQ8-4 aptamer of the present disclosure using a flow cytometer (FACS). Specifically, target cell binding was determined for Example 1 (SQ8 aptamer) and Example 2 (SQ8-4 aptamer) as well as no-treatment control and Comparative Example 1 (DNA pool library).

(8) FIG. 7 depicts the secondary structure of the SQ8-4 aptamer (Example 2), which was prepared based on the SQ8 aptamer (Example 1) of the present disclosure.

(9) FIG. 8 shows targeting profile of Example 1 (SQ8 aptamer) of the present disclosure for target cells determined with confocal microscopy. Gray ellipses represent nuclei, and the brightest looking, white areas represent aptamers that are bound to cell surfaces or internalized into cells.

(10) FIG. 9 shows targeting profile of Example 2 (SQ8-4 aptamer) of the present disclosure for target cells determined with confocal microscopy. Gray ellipses represent nuclei, and the brightest looking, white areas represent aptamers that are bound to cell surfaces or internalized into cells.

(11) FIG. 10 shows targeting profile of Example 1 (SQ8 aptamer) of the present disclosure for pancreatic cancer tissue determined with bioluminescence imaging in a xenograft mouse model for a human pancreatic cancer cell line.

(12) FIG. 11 shows targeting profile of Example 2 (SQ8-4 aptamer) of the present disclosure for pancreatic cancer tissue determined with bioluminescence imaging in a xenograft mouse model for a human pancreatic cancer cell line.

(13) FIG. 12 shows targeting profile of Example 2 (SQ8-4 aptamer) of the present disclosure for pancreatic cancer tissue determined with bioluminescence imaging in a xenograft mouse model for pancreatic cancer cells of a human pancreatic cancer patient.

(14) FIG. 13 shows binding affinities of the SQ8-4 aptamer of the present disclosure to various pancreatic cancer cell lines determined with a flow cytometer (FACS). Specifically, cell binding was determined for Example 2 (SQ8-4 aptamer) as well as no-treatment control and Comparative Example 3 (SQ8-4-Comp aptamer).

(15) FIG. 14 shows the geometric means of the relative fluorescence intensities of Example 2 over Comparative Example 3 in number of folds, based on the results given in FIG. 13.

(16) FIG. 15a and FIG. 15b show binding affinities of the SQ8-4 aptamer of the present disclosure to various cancer cell lines determined with a flow cytometer (FACS). Specifically, cell binding was determined for Example 2 (SQ8-4 aptamer) as well as no-treatment control and Comparative Example 3 (SQ8-4-Comp aptamer).

(17) FIG. 16 shows the geometric means of the relative fluorescence intensities of Example 2 over Comparative Example 3 in number of folds, based on the results given in FIG. 15a and FIG. 15b.

(18) FIG. 17 shows binding affinities of the SQ8-4 aptamer of the present disclosure to various PDOX-derived cell lines determined with a flow cytometer (FACS). Specifically, cell binding was determined for Example 2 (SQ8-4 aptamer) as well as no-treatment control and Comparative Example 3 (SQ8-4-Comp aptamer).

(19) FIG. 18 shows the geometric means of the relative fluorescence intensities of Example 2 over Comparative Example 3 in number of folds, based on the results given in FIG. 17.

DETAILED DESCRIPTION

(20) The present disclosure will be clearly understood from the aspects described above and Experimental Examples or Examples described below. In the following, the present disclosure will be explained in detail such that a person of ordinary skill in the art can easily understand and reproduce the disclosure, by way of working examples described in reference to accompanying tables. However, the Experimental Examples or Examples described below are given just to illustrate the present disclosure and the scope of the present disclosure is not limited to such Experimental Examples or Examples.

[Experimental Example 1] Aptamer Screening Using Cell-SELEX

(21) Experimental procedures for screening of aptamers that specifically bind to pancreatic cancer cells using the Cell-SELEX technique are schematically illustrated in FIG. 3.

(22) Specifically, to obtain a cell line expressing cell membrane proteins characteristic of pancreatic cancer, pancreatic cancer cells were transplanted into an animal model and pancreatic cancer cell line CMLu-1 was isolated from a tissue to which the cancer had metastasized (A of FIG. 3).

(23) A ssDNA library was prepared and then screened using cells of the pancreatic cancer cell line CMLu-1 as the target cells (positive cells) and hTERT/HPNE cells (Human Pancreatic Nestin Expressing cells) as the control cells (negative cells). Selection of ssDNA molecules which bind only to the pancreatic cancer cells and not to the control cells was iterated for multiple rounds, and the resulting enriched ssDNA pool was cloned and sequenced, followed by clustering.

(24) (1) Construction of a Metastatic Pancreatic Cancer Cell Line from a Xenograft Mouse Model of a Human Pancreatic Cancer Cell Line

(25) The metastatic pancreatic cancer cell line CMLu-1 was obtained as described below. An orthotopic mouse model was built using NOD/SCID mouse. First, to construct an animal model that can mimic metastasis of pancreatic cancer, a pancreatic cancer cell line stably expressing the firefly luciferase (CFPAC-1-Luci) was established and used to enable non-invasive monitoring of tumorigenesis over time. CFPAC-1-Luci pancreatic cancer cells were transplanted orthotopically into a NOD/SCID mouse. After 43 days, tumor tissue was removed from the lung tissue of the mouse where pancreatic cancer had metastasized, and the isolated tumor tissue was genotyped, showing that the genetic attributes of the metastatic tumor cells are identical to those of the pancreatic cancer cells. Then, single cells were prepared from the tumor tissue and cultured. CMLu-1 cells isolated from the metastatic tumor tissue were cultured and maintained in RPMI-1640 medium (Hyclone, Logan, UT, USA) plus 10% FBS (Thermo Fisher Scientific, USA) and 100 IU/mL of Anti-Anti (antibiotic-antimycotic; Gibco).

(26) The resulting CMLu-1 cells were used as the cells for positive selection in Cell-SELEX, and human pancreatic duct normal epithelial cells (HPNE) purchased from ATCC Inc. were used as the control cells for negative selection.

(27) (2) Preparation of a ssDNA Library and Primers for Cell-SELEX

(28) The DNA library used in Cell-SELEX for pancreatic cancer-specific aptamers was a pool of DNA sequences that are composed of a combination of constant and unique nucleotides. The DNA sequences comprised 20 constant nucleotides at the 5-terminus, 40 random nucleotides in the middle, and additional 20 constant nucleotides at the 3-terminus. 5-terminus of the DNA sequences was labeled with Cy5 in order to monitor enrichment of selection using a fluorescence-activated cell sorter (FACS; so-called flow cytometer), and the 3-terminus was labeled with biotin for purification of the ssDNA molecules (FIG. 1). In addition, the forward primer was labeled with Cy5 at its 5-terminus (5-Cy5-sequence-3), and the reverse primer with biotin at its 5-terminus (5-biotin-sequence-3). The compositions of DNAs included in the DNA library as well as the forward and reverse primers are as shown in Table 1 below.

(29) TABLE-US-00001 TABLE1 FormatofDNA 5-ATACCAGCTTATTCAATT- library [nucleotides40(N40)]- nucleotides AGATAGTAAGTGCAATCT-3 (SEQIDNO:1) Forwardprimer; 5-Cy5-ATACCAGCTTATTCAATT-3 5-primer (SEQIDNO:2) Reverseprimer; 5-biotin-AGATTGCACTTACTA 3-primer TCT-3 (SEQIDNO:3)

(30) PCR was used to amplify eluted DNA pools. ssDNAs were isolated by capturing biotinylated complementary strands using the streptavidin-biotin bond and denaturing double-stranded DNAs with NaOH. PCR mixes were prepared, and PCR was carried out as instructed by the manufacturer.

(31) (3) Library Screening Through Cell-SELEX

(32) The ssDNA library prepared as described above was screened using CMLu-1 cells as the target cells (positive cells) and hTERT/HPNE cells as the control cells (negative cells).

(33) 10 nmol of the DNA library was dissolved in 1,000 L of a binding buffer (Dulbecco's PBS (Hyclone, USA) with 5 mM MgCl.sub.2, 0.1 mg/mL tRNA, and 1 mg/mL BSA). The DNA library or enriched pool was denatured at 95 C. for 10 min and cooled on ice for 10 min, followed by incubation with CMLu-1 cells in an orbital shaker at 4 C. for 1 hour. The CMLu-1 cells were then washed 3 times to remove unbound DNA sequences, and the bound DNA molecules were eluted via centrifuge using 1,000 L of a binding buffer at 95 C. for 15 min. To carry out a counter selection, an aptamer pool was incubated with hTERT/HPNE cells for 1 hour, after which the supernatant was collected for negative selection. The enriched pools were monitored using FACS, and Quiagen's cloning kit for sequencing (Quiagen, Germany) was used for cloning into Escherichia coli to identify aptamer candidates.

(34) (4) Cloning and Sequencing of Enriched ssDNA Pool and Multiple Sequence Alignment

(35) For selection of candidate sequences, the enriched ssDNA pool after 5 rounds was cloned and sequenced. The ssDNA pool was amplified by PCR using unmodified primers, ligated to pGEM-T easy vector (Promega, USA), and then cloned into HIT-DH5a competent cells (Promega, USA). Thereafter, 200 cloned sequences were analyzed by Cosmogenetech Inc. (Seoul, Korea) and aligned using ClustalX 1.83.

(36) The extent of enrichment according to the number of rounds of selection is as illustrated in FIG. 2.

(37) The process described above in (1) to (4) is schematically illustrated in FIG. 3. Aptamers sequenced through the above process were clustered into aptamers with similar sequences. As a result, eleven Cy5-labeled aptamer family candidates (SQ1 to SQ11) were identified. The contents of individual aptamer families in the entire pool were as shown in Table 2 below.

(38) TABLE-US-00002 TABLE 2 Content in Aptamer enriched DNA family pool (%) SQ1 14.09 SQ2 13.42 SQ3 5.37 SQ4 4.70 SQ5 4.70 SQ6 3.36 SQ7 2.01 SQ8 2.68 SQ9 1.34 SQ10 1.34 SQ11 1.34

[Experimental Example 2] Determination of Target Cell Binding Specificity of Enriched Aptamer Family Candidates

(39) The CMLu-1 target cell binding specificities of the enriched aptamer family candidates obtained in (4) of Experimental Example 1 were determined with flow cytometry (FACS).

(40) Each Cy5-labeled aptamer family candidate was incubated, along with 310.sup.5 CMLu-1 cells and hTERT/HPNE cells, in the binding buffer used for Cell-SELEX at 4 C. for 1 hour. The cells were washed 3 times with binding buffer containing 0.1% NaN.sub.3, and the pellets having bound sequences were resuspended in the binding buffer. Fluorescence-based assay was carried out on 10,000 cells using BD FACSCallibur and FACSVerse (BD Biosciences, USA), and the data were analyzed using FlowJo software v10.0.7.

(41) The results from the determination of target cell binding affinity of individual Cy5-labeled aptamer family candidates are shown in FIG. 4. An aptamer with a high binding specificity for metastatic pancreatic cancer cells (CMLu-1), the target cells, was identified as SQ8, whose sequence is shown below.

(42) TABLE-US-00003 *SQ8aptamersequence (SEQIDNO:4) 5-AGCAGCACAGAGGTCAGATGCTTGGGCTATTTCTTATTCATGCTGT TCCACCGCTCTCGGCCTATGCGTGCTACCGTGAA-3

[Experimental Example 3] Analysis of SQ8 Aptamer and Functional Characterization of Aptamer Fragments

(43) The secondary structure determined for the SQ8 aptamer selected in Experimental Example 2 is as shown in FIG. 5. In addition, to confirm the cell binding affinity, target cell binding affinity was determined for the SQ8 aptamer (Example 1), no-treatment control, and Comparative Example 1 (DNA pool library) in the same manner as in Experimental Example 2 using FACS. As demonstrated in FIG. 6a, the results show that whereas the control and Comparative Example 1 had low binding affinities of similar levels, the SQ8 aptamer of Example 1 exhibited a remarkably superior target cell binding affinity.

(44) In order to determine whether some portions of the SQ8 aptamer are critical for the pancreatic cancer-specific binding, various aptamers comprising parts of SQ8 were prepared and their binding affinity to the target cell was investigated. If the length of an aptamer can be reduced while retaining its cell binding affinity, it is likely that aptamer production costs are reduced while cell penetration is enhanced. The results demonstrated that the SQ8-4 aptamer (Example 2) having the sequence indicated in Table 3 below is superior in terms of endocytosis while almost fully retaining the target cell binding affinity. Specifically, target cell binding affinities of Example 1, Example 2, no-treatment control, and Comparative Example 1 (DNA pool library) were determined in the same manner as in Experimental Example 2 using FACS. As demonstrated in FIG. 6b, the results show that whereas the control and Comparative Example 1 had low binding affinities of similar levels, the SQ8 aptamer of Example 1 exhibited a remarkably superior target cell binding affinity, and the SQ8-4 aptamer of Example 2 was superior even to Example 1.

(45) The nucleotide sequence of SQ8-4 is shown below (SEQ ID NO: 6), and the corresponding secondary structure is shown in FIG. 7. In addition, Comparative Example 2 (SQ8-Comp; an aptamer having a nucleotide sequence partly complementary to SQ8; SEQ ID NO: 5) and Comparative Example 3 (SQ8-4-Comp; an aptamer having a nucleotide sequence complementary to SQ8-4; SEQ ID NO: 7) were prepared in order to use them as controls for Examples 1 and 2 in subsequent experiments.

(46) TABLE-US-00004 TABLE3 Aptamer Sequence Example1 5-AGCAGCACAGAGGTCAGATGCTTGGGCTATTTCT (SQ8) TATTCATGCTGTTCCACCGCTCTCGGCCTATGCGTGC TACCGTGAA-3(SEQIDNO:4) Comparative 5-AGCAGCACAGAGGTCAGATGGAACCCGATAAAGA Example2 ATAAGTACGACAAGGTGGCGAGAGCCCCTATGCGTGC (SQ8-Comp) TACCGTGAA-3(SEQIDNO:5) Example2 5-AGCAGCACAGAGGTCAGATGCTTGGGCT-3 (SQ8-4) (SEQIDNO:6) Comparative 5-TCGTCGTGTCTCCAGTCTACGAACCCGA-3 Example3 (SEQIDNO:7) (SQ8-4- Comp)

[Experimental Example 4] Determination of Efficient Targeting of the Selected Aptamer into Cells and Tissues

(47) (1) Endocytosis Efficiencies of Selected Aptamers were Determined by Confocal Microscopy Imaging.

(48) 110.sup.4 cells/well of control cells (HPNE) and target cells (CMLu-1) were plated on 8-well chamber slides (Thermo scientific, USA) coated with poly-L-lysine (Sigma, USA) 4 hours prior to the experiment. Upon washing with a washing buffer, 250 nM of a Cy5-labeled aptamer (i.e., Example 1, Example 2, Comparative Example 2, and Comparative Example 3) or Comparative Example 1 (DNA pool library) was added to 200 l of binding buffer at 4 C. and incubated. After washing twice, the cells were fixed using 4% paraformaldehyde, followed by staining of the nucleus with Hoechst33342. Thereafter, the cells were subjected to imaging by confocal microscopy (LSM780, Carl Zeiss, Germany), and the images thus obtained were analyzed with the Zen blue software.

(49) Results of confocal microscopy on Examples 1 and 2 are as shown in FIGS. 8 and 9. The brightest looking, white areas in the pictures represent regions heavily populated with aptamers. As seen in FIGS. 8 and 9, the aptamers of Examples 1 and 2 targeted pancreatic cancer cells over the control cells and showed excellent levels of endocytosis (internalization) into the cells. The aptamers of Examples 1 and 2 were also remarkably superior to those of the Comparative Examples in targeting pancreatic cancer cells and showed superior levels of endocytosis into the cells.

(50) (2) Determination of Pancreatic Cancer Targeting by Aptamers Through In Vivo and Ex Vivo Fluorescence Imaging

(51) Female Hsd: Athymic nude-Foxn1 nude mice aged 6 weeks were purchased from Harlan Laboratories, Inc. (France). The mice were housed in a specific pathogen free (SPF) environment under controlled conditions of light and humidity, with their food and water supplied by the NCC animal facility. All animal studies were reviewed and approved by the Institutional Animal Care and Use Committee (IACUC) of the National Cancer Center Research Institute (NCCRI) (NCC-16-247). The NCCRI is a facility accredited by the Association for Assessment and Accreditation of Laboratory Animal Care International (AAALAC International).

(52) An orthotopic xenograft mouse model of pancreatic cancer was constructed by injecting CFPAC-1 cells (110.sup.6 cells) purchased from the ATCC into the tail of mouse pancreas. At 3 weeks after inoculation, mice were divided into two groups according to the treatment to be given, that is, Cy5.5-labeled Example 1 and Comparative Example 2 or Cy5.5-labeled Example 2 and Comparative Example 3, followed by intravenous administration of a Cy5.5-labeled aptamer (300 pmol/50 l PBS) mentioned above.

(53) For ex vivo experiments, mice were sacrificed 15 min or 3 hours after administration and then dissected. Tumor tissues were removed and subjected to bioluminescence imaging using IVIS Lumina (Caliper Life Science, Hopkinton, MA, USA). All image data were analyzed using Living Image Acquisition and Analysis software.

(54) The gray-scale pictures in FIGS. 10 and 11 show the results of bioluminescence imaging for Examples 1 and 2. Total flux obtained from the imaging results are plotted in FIGS. 10 and 11.

(55) In the imaging results presented at the top of the above drawings, the brighter (whiter) a region appears, the greater the amount of aptamers bound to the cells in that region is. It can be seen that the imaging results for the aptamers of Examples 1 and 2 appear whiter than those for Comparative Examples 2 and 3. In contrast, the imaging results for Comparative Examples 2 and 3 do not show any white regions.

(56) Thus, it has been demonstrated that the aptamers of the present disclosure move towards and bind specifically to pancreatic cancer tissue compared with aptamers of the Comparative Examples and have remarkably superior targeting efficiencies for pancreatic cancer tissues.

[Experimental Example 5] Determination of Targeting in a Mouse Orthotopic Xenograft Model for Human Patient Pancreatic Cancer Tissue (Patient-Derived Orthotopic Xenograft Model; PDOX Model)

(57) In order to determine whether the aptamers of the present disclosure exhibit excellent targeting efficiencies even in a PDOX model which can recapitulate the complexity and heterogeneity of patient tumor tissue, in vivo verification experiments were carried out using fluorescence imaging.

(58) With the approval of the Institutional Review Board (IRB) of the NCC, a patient-derived orthotopic xenograft (PDOX) model was established by collecting specimens from patients who submitted informed consent and directly transplanting them into the pancreas of a nude mouse (purchased from Harlan Laboratories, Inc. (France)). As for primary tumor specimens from pancreatic cancer patients (called HPTs below), right upon surgical resection, and in the case of patients with inoperable advanced pancreatic cancer, right after collection of specimens for liver metastasis tissue biopsy (called GUNS below) from the patients, specimens were transported in tubes containing a medium and transplanted as soon as possible into female Hsd: Athymic nude-Foxn1 nude mice (obtained from the same source as in Experimental Example 4), by making an incision in the tail of pancreas and then closing the incision after transplantation (PDOX 1.sup.st generation, F1). Thereafter, the size of tumor was measured periodically using abdominal palpation and MRI, and when the tumor attains a volume of 3000 mm.sup.3, the mouse was sacrificed to obtain tumor tissue. Tumor tissue fragments of a certain size (3 mm*3 mm*3 mm) were then orthotopically re-implanted into multiple nude mice subjects to generate subsequent generations (F2, F3, F4 . . . ) and increase the number of subjects.

(59) At the 4.sup.th generation (F4), the established PDOX mouse model was divided into two groups of three subjects, and the individual groups were given intravenously either Example 2 or Comparative Example 3, in the form of Cy5.5-labeled aptamer (300 pmol/50 l PBS). 15 min after the administration, the mice were sacrificed and dissected to remove tumor tissues, which were then subjected to bioluminescence imaging using IVIS Lumina (Caliper Life Science, Hopkinton, MA, USA). All image data were analyzed using Living Image Acquisition and Analysis software.

(60) The gray-scale picture in FIG. 12 shows the results of bioluminescence imaging for Example 2. Total flux obtained from the imaging results are plotted in FIG. 12.

(61) As in FIGS. 10 and 11, in the imaging results presented at the top of FIG. 12 also, the brighter (whiter) a region appears, the greater the amount of aptamers bound to the cells in that region is. It can be seen that the aptamer of Example 2 gives a much whiter image than the aptamer of Comparative Example 3. In contrast, the imaging result for Comparative Example 3 does not show any white regions.

(62) Thus, it has been demonstrated that the aptamers of the present disclosure have remarkably superior targeting efficiencies even in a PDOX model which retains the complexity and heterogeneity of patient tumor tissue.

[Experimental Example 6] Determination of Binding Affinity in Various Pancreatic Cancer Cell Lines

(63) Additional flow cytometry (FACS) assays were carried out to determine the binding affinity of the aptamers of the present disclosure to various pancreatic cancer cell lines.

(64) Flow cytometry was carried out in the same manner as in Experimental Example 2, using Cy5-labeled aptamers of Example 2 and Comparative Example 3 at a concentration of 250 nM. Cells from CFPAC-1 cell line, Capan-1 cell line, HPAF-II cell line, MIA PaCa cell line, BxPC-3 cell line, and PANC-1 cell line were used. All of the above-mentioned cell lines were purchased from the ATCC.

(65) Results from the determination of binding affinity of the aptamers to various pancreatic cancer cell lines are shown in FIGS. 13 and 14. FIG. 14 shows the geometric means of the relative fluorescence intensities of Example 2 over Comparative Example 3 in number of folds.

(66) According to the results shown in FIGS. 13 and 14, the aptamer of Example 2 of the present disclosure binds more efficiently and specifically to all the pancreatic cancer cell lines compared with the aptamer of Comparative Example 3. Taken together with the results of Experimental Examples 4 and 5 discussed above, it can be seen that the aptamers of the present disclosure would specifically bind to various types of pancreatic cancer cells.

(67) In addition, the aptamer of Example 1 similarly would specifically bind to various types of pancreatic cancer cells as it comprises the aptamer sequence of Example 2.

[Experimental Example 7] Determination of Binding Affinity in Various Tumor Cell Lines

(68) Additional flow cytometry (FACS) assays were carried out to determine the binding affinity of the aptamers of the present disclosure to various tumor cell lines.

(69) Flow cytometry was carried out in the same manner as in Experimental Example 2, using Cy5-labeled aptamers of Example 2 and Comparative Example 3 at a concentration of 250 nM. Cells from HTC116 cell line, Hep3B cell line, A549 cell line, U87 cell line, CAL27 cell line, MDA-MB231 cell line, MCF7 cell line, and KPL4 cell line were used. All of the above-mentioned cell lines were purchased from the ATCC.

(70) Results from the determination of binding affinity of the aptamers to various cancer cell lines are shown in FIGS. 15a, 15b, and 16. FIG. 16 shows the geometric means of the relative fluorescence intensities of Example 2 over Comparative Example 3 in number of folds.

(71) According to the results shown in FIGS. 15a, 15b, and 16, the aptamer of Example 2 of the present disclosure binds more efficiently and specifically to various cancer cell lines such as colon cancer, liver cancer, lung cancer, brain tumor, oral cavity cancer, and breast cancer cell lines, compared with the aptamer of Comparative Example 3. Taken together with the results of Experimental Examples 4 and 5 discussed above, it can be seen that the aptamers of the present disclosure would specifically bind to various types of cancer cells.

(72) In addition, the aptamer of Example 1 similarly would specifically bind to various types of cancer cells as it comprises the aptamer sequence of Example 2.

[Experimental Example 8] Determination of Binding Affinity in Pancreatic Ductal Adenocarcinoma PDOX-Derived Cell Lines

(73) Additional flow cytometry (FACS) assays were carried out to determine whether the aptamers of the present disclosure are likely to bind specifically to pancreatic cancer cells of clinical patients.

(74) Unlike normal cells, which only have a limited number of cell divisions before death, cancer cells have the characteristic of infinite divisions. Accordingly, cancer cells isolated from tumor tissue are believed to be able to form a cell line capable of proliferating infinitely even in the absence of transfection and recapitulate clinical and molecular biological characteristics of the patient. In this experiment, tumor tissue removed from a pancreatic cancer PDOX mouse was divided into 3 mm*4 mm fragments, mixed with a human cell dissociation kit (Miltenyi Biotech Inc.) comprising collagenase, and reacted in a tissue dissociator (Gentle Macs, Miltenyi Biotech Inc) for 1 hour to separate the cells from connective tissue. Upon completion of the reaction, RPMI medium containing fetal bovine serum (FBS) was added to inhibit enzymatic activities, followed by centrifugation, to give precipitates of cells dissociated from tissue. The precipitates were suspended in RPMI medium containing FBS, and the cells were then plated evenly on 10 cm petri dishes to a level of 210.sup.6 cells. The medium was replaced every other day while removing normal fibroblasts and dead cell, thereby establishing a PDOX-derived cancer cell line for each pancreatic cancer patient. The established cell lines were named in the same manner as the PDOX from which they were derived.

(75) On cancer cell lines isolated from tumor tissues of PDOX models using liver metastasis patient biopsy tissues (GUN #38 and GUN #41) and using surgical resection specimens (HPT #19, HPT #22, and HPT #43), flow cytometry was carried out in the same manner as in Experimental Example 2, using Cy5-labeled aptamers of Example 2 and Comparative Example 3 at a concentration of 250 nM.

(76) Results from the determination of binding affinity of the aptamers to various PDOX-derived cell lines are shown in FIGS. 17 and 18. FIG. 18 shows the geometric means of the relative fluorescence intensities of Example 2 over Comparative Example 3 in number of folds.

(77) According to the results shown in FIGS. 17 and 18, the aptamer of Example 2 of the present disclosure binds more efficiently and specifically to various PDOX-derived cell lines which have been derived from pancreatic cancer tissues collected from different patients, compared with the aptamer of Comparative Example 3. Taken together with the results of Experimental Examples 4 and 5 discussed above, it can be seen that the aptamers of the present disclosure would specifically bind to pancreatic cancer tissue of clinical patients.

(78) In addition, the aptamer of Example 1 similarly would specifically bind to pancreatic cancer tissue of patients as it comprises the aptamer sequence of Example 2.

(79) Although the technical idea of the present disclosure has been described above by referring to embodiments described in working examples and illustrated in the accompanying drawings, it should be noted that various substitutions, modifications, and changes can be made without departing from the technical idea and scope of the present disclosure which can be understood by a person of ordinary skill in the art to which the present disclosure pertains. In addition, it should be noted that that such substitutions, modifications and changes are intended to be encompassed by the scope of the appended claims.