METHODS FOR MODIFICATION OF TARGET NUCLEIC ACIDS
20230107997 · 2023-04-06
Inventors
- Leendert W. NEUTEBOOM (Research Triangle Park, NC, US)
- John A. McElver (Research Triangle Park, NC, US)
- Rosa De Pinho Barroco (Gent (Zwijnaarde), BE)
- Chris De Wilde (Gent (Zwijnaarde), BE)
- Max Fabian Felle (Ludwigshafen, DE)
Cpc classification
C12N2310/20
CHEMISTRY; METALLURGY
C12N15/111
CHEMISTRY; METALLURGY
C12N15/8509
CHEMISTRY; METALLURGY
C12N15/70
CHEMISTRY; METALLURGY
C12N15/11
CHEMISTRY; METALLURGY
International classification
C12N15/11
CHEMISTRY; METALLURGY
C12N15/10
CHEMISTRY; METALLURGY
C12N15/70
CHEMISTRY; METALLURGY
C12N15/82
CHEMISTRY; METALLURGY
Abstract
Methods for modification of target nucleic acids. The method involves a construct in which guide RNA is covalently linked to donor RNA (fusion NA) to be introduced into the target nucleic acid by homologous recombination and is based on the introduction of a nuclease, e.g. CRISPR or TALEN, into the cell containing the target nucleic acid. The fusion NA may be introduced as a DNA vector.
Claims
1. A method for the treatment of a genetic disease comprising administering a composition comprising: a. a recombinant fusion nucleic acid (fuNA) molecule comprising a guide nucleic acid (gNA) molecule covalently linked to at least one donor nucleic acid (doNA) molecule, and b. a component selected from one or more of: i. a nucleic acid molecule encoding a site directed nucleic acid modifying polypeptide, or ii. a site directed nucleic acid modifying polypeptide. to an organism in need thereof.
2. The method of claim 1, wherein wherein the gNA comprises a spacer nucleic acid (spacer NA) molecule, wherein said spacer NA molecule comprises at least 12 bases which are 100% complementary to the same number of consecutive bases of the target NA molecule.
3. The method of claim 2, wherein said spacer NA molecule comprises at least 13 bases, at least 14 bases, at least 15 bases, at least 16 bases, at least 17 bases, at least 18 bases, at least 19 bases, or at least 20 bases complementary to the target NA molecule.
4. The method of claim 1, wherein said doNA molecule and gNA molecule consist of RNA, DNA, or PNA.
5. The method of claim 1, wherein the doNA molecule consists of DNA and the gNA molecule consists of RNA, or wherein the fuNA consists of RNA.
6. The method of claim 1, wherein the at least one doNA molecule comprises two homology arms, wherein each of said two homology arms independently comprises at least 15 bases complementary to a different area of at least 15 consecutive bases of the target NA molecule from the other homology arm, and wherein both homology arms have the same length or different lengths.
7. The method of claim 1, wherein the two homology arms are separated by at least one or more bases, or wherein both homology arms are directly adjacent to each other.
8. The method of claim 1, wherein the gNA molecule further comprises a scaffold nucleic acid (scaffold NA) molecule, wherein said scaffold NA forms a secondary structure comprising at least one hairpin.
9. The method of claim 1, wherein the gNA comprises a scaffold NA and wherein said scaffold NA molecule is covalently bound to the gNA molecule.
10. The method of claim 1, wherein the site directed nucleic acid modifying polypeptide is a nucleic acid guided nucleic acid modifying polypeptide or a functional fragment thereof.
11. The method of claim 1, wherein said site directed nucleic acid modifying polypeptide has a nickase function or is an inactivated site directed nucleic acid modifying polypeptide or an inactivated site directed nucleic acid modifying polypeptide linked to other functional groups.
12. The method of claim 1, further comprising a cell comprising a target NA molecule, wherein said cell is a microbial, animal, human or plant cell.
13. The method of claim 1, wherein the composition consists of (i) the recombinant fusion nucleic acid (fuNA) molecule according to claim 1, wherein the gNA molecule comprises a spacer nucleic acid (spacer NA) molecule, which comprises at least 12 bases, at least 13 bases, at least 14 bases, at least 15 bases, at least 16 bases, at least 17 bases, at least 18, at least 19 bases, or at least 20 bases which are 100% complementary to the same number of consecutive bases of the target NA molecule, and (ii) a component selected from one or more of (a) a nucleic acid molecule encoding a site directed nucleic acid modifying polypeptide, wherein said site directed nucleic acid modifying polypeptide has a nickase function or is an inactivated site directed nucleic acid modifying polypeptide or an inactivated site directed nucleic acid modifying polypeptide linked to other functional groups and wherein said nucleic acid molecule consists of RNA Or (b) a site directed nucleic acid modifying polypeptide, wherein said site directed nucleic acid modifying polypeptide has a nickase function or is an inactivated site directed nucleic acid modifying polypeptide or an inactivated site directed nucleic acid modifying polypeptide linked to other functional groups and and (iii) a cell comprising a target nucleic acid (target NA) molecule.
14. The method of claim 13, wherein said site directed nucleic acid modifying polypeptide is a nucleic acid guided nucleic acid modifying polypeptide or a functional fragment thereof.
15. The method of claim 13, wherein the cell is a microbial, animal, human or plant cell.
16. The method of claim 8, wherein said scaffold NA forms a secondary structure comprising at least two hairpins.
17. The method of claim 1, wherein the disease is selected from one or more of: (i) viral infections, (ii) hematologic disorders, (iii) neuromuscular disorders, (iv) skin disorders, (v) ocular disorders, or (vi) respiratory disorders.
18. The method of claim 17, wherein the disease is selected from one or more of: (i) wherein the viral infection is HIV, Hepatitis B virus, Herpes simplex virus, and/or Human papilloma virus, (ii) wherein the hematologic disorder is X-SCID, ADA-SCID, RS-SCID, sickle cell disease, and/or/β-thalessemia, (iii) wherein the neuromuscular disorder is Duchenne muscular dystrophy, (iv) wherein the skin disorder is epidermolysis bullosa, (v) wherein the ocular disorder is Leber's Congenital Amaurosis type 10, and/or (vi) wherein the respiratory disorder is cystic fibrosis.
19. The method of claim 17, wherein the doNA molecule comprises two homology arms and wherein both homology arms are directly adjacent to each other.
Description
FIGURES
[0130]
[0131]
[0132] Fusion NA molecule comprising from 5′ to 3′: the guide NA (spacer followed by scaffold), homology arm 1 and 2 optionally separated by an additional nucleic acid region.
[0133]
[0134] Fusion NA molecule comprising from 5′ to 3′: homology arm 2 and 1 optionally separated by an additional nucleic acid region, and the guide NA (scaffold followed by spacer)
[0135]
[0136] Fusion NA molecule comprising from 5′ to 3′: the guide NA (spacer followed by scaffold), homology arm 2 and 1 optionally separated by an additional nucleic acid region.
[0137]
[0138] Fusion NA molecule comprising from 5′ to 3′: homology arm 1 and 2 optionally separated by an additional nucleic acid region, and the guide NA (scaffold followed by spacer).
[0139]
[0140] Fusion NA molecule comprising from 5′ to 3′: homology arm 1 and 2 optionally separated by an additional nucleic acid region, and the guide NA (spacer followed by scaffold).
[0141]
[0142] Fusion NA molecule comprising from 5′ to 3′: the guide NA (scaffold followed by spacer), homology arm 1 and 2 optionally separated by an additional nucleic acid region.
[0143]
[0144] Fusion NA molecule comprising from 5′ to 3′: homology arm 2 and 1 optionally separated by an additional nucleic acid region, and the guide NA (spacer followed by scaffold).
[0145]
[0146] Fusion NA molecule comprising from 5′ to 3′: the guide NA (scaffold followed by spacer), homology arm 2 and 1 optionally separated by an additional nucleic acid region.
[0147]
[0148] Fusion NA molecules comprising from 5′ to 3′: guide NA (comprising spacer and first molecule of the scaffold), homology arm 1 and 2 optionally separated by an additional nucleic acid region. The second molecule of the scaffold is hybridizing to the first molecule of the scaffold.
[0149]
[0150] Fusion NA molecules comprising from 5′ to 3′: homology arm 1 and 2 optionally separated by an additional nucleic acid region, guide NA (comprising first molecule of the scaffold and spacer). The second molecule of the scaffold is hybridizing to the first molecule of the scaffold.
[0151]
[0152] Fusion NA molecules comprising from 5′ to 3′: guide NA (comprising spacer and first molecule of the scaffold), homology arm 2 and 1 optionally separated by an additional nucleic acid region. The second molecule of the scaffold is hybridizing to the first molecule of the scaffold.
[0153]
[0154] Fusion NA molecules comprising from 5′ to 3′: homology arm 2 and 1 optionally separated by an additional nucleic acid region, guide NA (comprising first molecule of the scaffold, spacer, and second molecule of the scaffold hybridizing to the first molecule of the scaffold).
[0155]
[0156] Vector RWL121.
[0157]
[0158] Vector Cas003.
[0159]
[0160] Vector Cas018.
[0161]
[0162] Vector Cas006.
[0163]
[0164] Vector RWL137.
[0165]
[0166] Vector Cas019.
[0167]
[0168] Vector RLW138.
[0169]
[0170] Vector Cas020.
[0171]
[0172] Vector RLW139.
[0173]
[0174] shows the amylase amyE locus of B. subtilis ATCC6051 strain (A) with the location of the homology regions HomA and HomB as indicated. The location of the protospacer sequence PS within in the amyE gene is indicated (A) and the sequence of the PS high-lighted (black with white letters, B)(top strand is SEQ ID NO: 74; bottom strand is SEQ ID NO: 75).
[0175]
[0176] shows the vector map of the pCC004 plasmid—the derivative of the 00E8999 plasmid carrying the amyE protospacer and the homology regions HomA and HomB of the region adjacent to the amyE gene. PS=protospacer; PvanP*=hemisynthetic promoter; ‘gRNA=guideRNA; lambda TO terminator; PmanP=promoter of the manP gene B. subtilis; Cas9=endonuclease from S. pyrogenes; KanR=kanamycin resistance gene; origin of pUC for replication in E. coli, origin of pE194 for replication in Bacillus.
[0177]
[0178] shows the schematic drawing of the EcoRI/Xbal fragment of the various plasmids used in this study (as exemplified in
[0179]
[0180] The gene knockout efficiency as exemplified for the amylase gene for each gene deletion construct (pJ0E8999, p00005-p00008) relative to pCC004 is plotted against the deletion constructs as indicated.
[0181]
[0182] shows 0.8% agarose gels of PCR reactions with oligonucleotides Seq ID NO: 60 and 61 on genomic DNA of 13 individual clones from gene deletion reactions with indicated plasmids pCC004, pCC005, pCC006, pCC007, pCC008. The amplification of a DNA fragment of 1.4 kb indicates gene knockout by recombination whereas a DNA fragment of 3.4 kb indicates amylase gene inactivation by rather a SOS repair mechanism. The 3.4 kb band for WT indicates wildtype amylase locus of B—.subtilis WT ATCC6051. C denotes water control with no genomic DNA added. M indicates DNA ladder ‘Perfect plus 1 kb DNA ladder’ (roboklon) with the size of three bands indicated (1.0 kb, 1.5 kb. 4.0 kb).
EXAMPLES
[0183] Chemicals and Common Methods
[0184] Unless indicated otherwise, cloning procedures carried out for the purposes of the present invention including restriction digest, agarose gel electrophoresis, purification of nucleic acids, ligation of nucleic acids, transformation, selection and cultivation of bacterial cells are performed as described (Sambrook J, Fritsch E F and Maniatis T (1989)). Sequence analyses of recombinant DNA are performed with a laser fluorescence DNA sequencer (Applied Biosystems, Foster City, Calif., USA) using the Sanger technology (Sanger et al., 1977). Unless described otherwise, chemicals and reagents are obtained from Sigma Aldrich (Sigma Aldrich, St. Louis, USA), from Promega (Madison, Wis., USA), Duchefa (Haarlem, The Netherlands) or Invitrogen (Carlsbad, Calif., USA). Restriction endonucleases are from New England Biolabs (Ipswich, Mass., USA) or Roche Diagnostics GmbH (Penzberg, Germany). Oligonucleotides are synthesized by Eurofins MWG Operon (Ebersberg, Germany).
[0185] Introduction to Experimental Procedures
[0186] A yeast codon-optimized version of the Cas9 protein bearing a C-terminus SV40 nuclear localization signal (SEQ ID NO: 1) was synthetized and cloned into a yeast expression vector. The same vector included one or more guide RNAs (gRNAs) expressed from the Saccharomyces cerevisiae SNR52 polymerase III promoter.
[0187] Cas9 binds DNA and cleaves both strands upon recognition of a target sequence by the gRNA, but only if the correct protospacer-adjacent motif (PAM) is present at the 3′ end. Theoretically, any sequence of the form GN2OGG can be targeted. So, a second vector was constructed for co-expression in yeast of a reporter system (GAL4-UAS (SEQ ID NO: 7)) to be targeted by the designed CRISPR system. gRNA-donor fusions (fusion NA) were used to target and repair several non-functional Gal4 targets (SEQ ID NOs: 9-15). Gal4 (SEQ ID NO: 8) is a yeast transcriptional activator consisting of two-components: the DNA binding domain located N-terminus and the region for transcriptional activation at C-terminus. Gal4 binds to the specific recognition sequence UAS (upstream activating sequence) of marker genes in the yeast genome, activating their transcription. The MaV203 yeast strain contains single copies of each of three reporter genes (HIS3, URA3 and lacZ) that are stably integrated at different loci in the yeast genome. The promoter regions of URA3, HIS3, and lacZ are unrelated (except for the presence of GAL4 binding sites).
[0188] Several non-functional (deleted and/or disrupted by insertion of a STOP codon) versions of Gal4 were synthesized (SEQ ID NOs: 9-15) and transformed into yeast cells, so that they could be targeted and repaired by the co-expressed CRISPR machinery. Restoration of the full-length Gal4 by homologous recombination (HR) with the appropriate repair donor sequence provided with the CRISPR components results in activation of lacZ and HIS3 reporter genes. Gal4 gene repair and consequent transcription activation can be monitored by cell growth on plates lacking histidine, whereas induction of the lacZ gene results in a blue color when assayed with X-gal (5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside).
[0189] The employed yeast strain contains two additional auxotrophic mutations (leu2 and trpl) to allow selection for both expression constructs.
[0190] To verify repair efficacy increase of the fusion system disclosed here, all experiments were performed in parallel with non-fused cassettes, in which donor and guide RNA are transcribed separately.
[0191] Yeast Strain, Media and Cultivation Conditions
[0192] The Saccharomyces cerevisiae strain used in the examples described is MaV203 (MATα, leu2-3,112, trpl-901, his3 Δ200, ade2-101, ga14 Δ, ga180 Δ, SPAL10::URA3, GAL1::lacZ, HIS3UAS GAL1::HIS3@LYS2, can1R, cyh2R), commercialized by Life Technologies. Yeast was grown in Synthetic Minimal Media (SD Media) based upon Yeast Nitrogen Base supplemented with 2% glucose and lacking the appropriate auxotrophic compounds (ForMedium, United Kingdom). Cultures were grown at 30° C., either in a shaker or incubation oven.
[0193] Escherichia coli was used as propagation microorganism for all the plasmids used in our experiments, as well as for further propagation and maintenance of the modified targets. E. coli was grown according standard microbiological practices (Molecular Cloning: A Laboratory Manual, 3rd ed., Vols 1,2 and 3. J. F. Sambrook and D. W. Russell, ed., Cold Spring Harbor Laboratory Press, 2001). Plasmids containing the Cas9, guide RNA and donor NA included a pUC-based replication origin and ampicillin resistance gene for replication and maintenance in E. coli. Whereas GAL4 target plasmids contained a gentamicin resistance gene (Gmr).
Example 1 Plasmid Construction
[0194] The Cas9 gene was a yeast codon-optimized version of the Streptococcus pyogenes Cas9 (SpCas9; WO2007/025097) originally constructed for expression in eukaryotic cells (Mali et al (2013) Science 339(6121); Cong et al (2013) Science 339(6121)). This Cas9 gene was tagged with a SV40 nuclear localization signal at both ends and synthesised. Also, the gRNA and donor expression cassette containing the SNR52 promoter for in vivo RNA synthesis were synthesised.
[0195] The GAL4-AD coding sequence in pDEST22 (Life Technologies) was replaced by the synthetic Cas9 via Seamless Cloning (Life Technologies). This vector contains the constitutive moderate-strength promoter and transcription terminator of the yeast Alcohol Dehydrogenase gene (ADH1) for expression in yeast as well as a TRP1 gene for selection in yeast on medium lacking tryptophan.
[0196] The same vector contains two recombination sites, attR1 and attR2, flanking a chloramphenicol resistance gene (Cmr) and a ccdB gene, allowing the designed gRNA and donor expression cassettes (as fusion or dual molecule) to be introduced in the same expression vector via Gateway Cloning (Life Technologies). Following the LR recombination reaction, the Cmr and ccdB genes were replaced by the fusion NA cassette or non-fused donor and guide expression cassettes.
[0197] Modified GAL4 coding sequences used as targets for CRISPR repair in yeast were synthesized. The pDEST32 plasmid for expression in yeast (Life Technologies) was cut with HindlIl and Sacll and the backbone, containing the ADH1 promoter and terminator, was gel purified. The GAL4 synthesized inserts were assembled into the vector using Seamless Cloning. This vector included a LEU2 gene for selection in yeast on medium lacking tryptophan.
[0198] Target-sites for recognition by Cas9 in the GAL4 sequence were empirically selected by choosing 20-mer regions preceding potential PAM (NGG) sequences within the GAL4 gene (Sternberg et al (2014); Nature 507(7490)).
[0199] To facilitate Cas9 binding and R-loop formation, we chose a single guide RNA design with the secondary structure containing a dangling spacer, an extended hairpin region and a long 3′ end, as initially designed by Jinek et al (2012) Science;337(6096)).
Example 2 Yeast Transformation
[0200] Simultaneous transformation of the CRISPR editing tools (Cas9 enzyme and fusion NA expressing cassette) and GAL4 target plasmid was performed by heat-shock as described in the manufacture's protocol (Life Technologies) and propagated in the appropriate synthetic complete (SC) media lacking the auxotrophic compounds complemented by the plasmids being introduced (leucine and tryptophan). The transformed cells were allowed to propagate overnight and equal amounts of transformants (according to OD measurement) were transferred to solid plates containing synthetic complete (SC) media lacking histidine with 100 mM 3-Amino-1,2,4-triazole (3-AT; ForMedium, UK). Expression of HIS3 (for allowing yeast grow in medium without histidine) is GAL4-dependent and therefore transformants are only able to grow if GAL4 repair had occurred. More above, 3-AT is a competitive inhibitor of the product of the HIS3 gene, by applying 3-AT to the yeast transformants which are dependent upon HIS3 to produce histidine, an increased level of HIS3 expression is required in order for the yeast cells to survive.
[0201] Additionally the yeast strain used contained a lacZ marker gene under the control of GAL4, which allowed for blue/white selection of GAL4-repaired transformants. Induction of the lacZ gene results in a blue color when assayed with X-gal (5-bromo-4-chloro-3-indolyl-/3 -D-galactopyranoside).
Example 3 X-Gal Assay
[0202] Transformants growing in plates lacking histidine were replica plated onto a nitrocellulose membrane (Hybond, GE Healthcare) placed on the surface of a plate with YPAD medium (Complex yeast media containing a homogeneous blend of Peptone, Yeast Extract and Glucose; ForMedium, UK). Assay was performed after 18-24 h incubation of the YPAD plates containing a membrane. For each membrane, 5 mg X-gal were dissolved in 50 μl DMF and combined with 30,u 12-mercaptoethanol and 5 ml Z buffer. This solution was used to saturate two round filter papers (Whatman 541) in a 15-cm petri dish. Using forceps, the membrane was carefully remove from the surface of the YPAD plate and completely immersed in liquid nitrogen for about 20 seconds. The frozen membrane was placed on top of the soaked Whatman filters (colony side up). The plates were tightly covered and incubate at 37° C. Appearance of blue color was monitored after 24 hours.
Example 4 Sequencing of Target (CRISPR Repaired) Plasmids
[0203] Four each experiment, at least eight GAL4-repaired positive transformants (colonies able to grow in medium without histidine) were sub-cultured overnight in liquid medium and the GAL4 containing plasmid was isolated (using Zymoprep Yeast Plasmid Miniprep II, Zymo Research). The isolated plasmids were introduced in E. coli for further propagation and commercial sequencing. GAL4 sequencing allowed verification of the sequence repair and assembly with the donor molecules.
[0204] Sanger sequencing of Gal4 gene in the positive clones further validated the sequence specificity of this targeting process, and showed no difference in repair of cells expressing the donor and gRNA as fusion or non-fused, even if cells transformed with fusion NA exhibit a much higher number of successful HR events.
Example 5 Deleting Int with 15 bp Homology Arms
[0205] Fusion of donor (donor 1; SEQ ID NO: 26) to the guide RNA resulted in repaired transformants (able to grow on medium lacking histidine), whereas no growth was observed for transformants with non-fused guide and donor RNA. The low efficiency of gene repair is consistent with the reduced sequence overlap available for homologous recombination.
Example 6 Deleting Int with 50 bp Homology Arms
[0206] Fusion of donor (donor 2; SEQ ID NO: 27) to the guide RNA resulted in at least 50 times more transformants than with non-fused donor and guide NA.
[0207] Sequencing of the Gal4 gene in the positive clones showed that repair results only or very largely from HR (no evidence of NHEJ for all sequenced clones).
Example 7 Inserting 20nt with 50/26 Bp Homology Arms
[0208] The same fusion NA as above was used to repair a similar target where 20nt were removed (target 3; SEQ ID NO: 11), and as a consequence one homology arm was reduced. Fusion resulted in about 5 times more transformants than with non-fused donor and guide NA. Sequencing of the Gal4 gene in the positive clones showed that repair results exclusively from homologous recombination.
Example 8 Inserting Missing 400 bp with 50 bp Homology Arms (while Testing Two Target Sequences 3nt Apart)
[0209] We tested for simultaneous targeting of two sequences (spacer 2 and spacer 3; SEQ ID NOs: 20 and 21) located in close proximity (3nt gap between the two 20 nt target), both independently and together (multiplexed targeting). The multiplex fusion cassette consisted of promoter followed by two tandem fusion NA sequences, resulting in production of a single molecule composed of two gRNAs and repair templates. Our experiments clearly showed that fusion NA is also amenable for targeting two sequences simultaneously.
[0210] For both targets repair in the presence of the donor-guide fusion was largely more efficient than with non-fused version (up to 10 times more for targeting with space 2 and five times for spacer 3).
Example 9 Inserting Full GAL4 Gene (960 bp) Except HR Ends with 120 bp Homology Arms
[0211] In order to test if fusion CRISPR could be effective for introduction full length coding sequences, we have tested introducing the full length GAL4 gene (SEQ ID NO: 7). As example, we have selected for 120 bp homology arms as to keep the ratio of donor/homology arm length already found to be effective in example 4. Insertion of full-length GAL4 gene is about four times more effective with Fusion construct.
[0212] Our results show that targeted editing is at least 50 times more efficient when the repair donor sequence was fused to the gRNA. The experiments performed indicate a broad Fusion-related improved effectiveness from a single base removal up to full gene insertion. The examples reported show that this CRISPR fusion system is suitable to carry relatively large Donor molecules fused to the guide RNA.
Example 10a Constructs for Expression in Rice
[0213] To accommodate the CRISPR/Cas system to Agrobacterium-mediated plant transformation, Gateway binary T-DNA vectors have been designed for co-expression of Cas9 nuclease and guide RNA-donor expression cassette (either as single or dual RNA molecules). A version of the Streptococcus pyogenes Cas9 (SpCas9) codon-optimized for expression in rice (Oryza sativa), attached to SV40 nuclear localization signals (NLS) at both ends (Seq ID NO: 6), was synthesized The synthesized cassette includes the maize polyubiquitin (Ubi) promoter (Seq ID NO: 32) for constitutive expression located up-stream the Cas9, and the nopaline synthase (nos) terminator (Seq ID NO: 33) at the 3′-end. This gene cassette has been cloned via Seamless into a vector, which contained as functional elements within the T-DNA borders: a plant selectable marker; a screenable marker expression cassette; and a Gateway cassette intended for LR recombination with the gRNA-donor expression cassette in an entry clone.
[0214] Three gRNA have been designed, which targeted the rice Protoporphyrinogen Oxidase (PPO) gene (WO/2015/092706; WO/2015/022640 (Seq ID NO: 35), resulting in genomic double-strand cleavage at selected target sites (spacer 8, spacer 9 and spacer 10 (Seq ID NO: 36, 37 and 38)). Modifications aim two amino acid substitutions (L419F, F442V; single site mutations and double site mutation), which have been previously identified as potential hotspots for Saflufenacil survival.
[0215] The RNA expressing cassette (including gene-specific spacer sequences for the selected locations in the PPO gene) containing either fusion or non-fusion NA were synthesized and cloned into entry vectors, which was cloned (via Gateway) into the destination vector containing the CAS9 expression cassette. RNA expression of gRNA and donor is driven by pol III type promoter of U3 snRNA.
[0216] After the LR recombination step, the resulting expression vector is transformed into Agrobacterium strain LBA4044 according to methods well known in the art.
Example 10b Constructs for Expression in Rice
[0217] An identical vector as described in Example 10a was synthesized with the exception that the NLS derived from SV40 was replaced with plant nuclear localization signals (NLS) (MSERKRREKL, SEQ ID NO: 71) at the N-terminal end and importin NLS (KRPAATKKAGQAKKKK SEQ ID NO: 72) at the C-terminal end and the promoter driving the RNA expression of gRNA and donor was rice pol III type promoter of U3 snRNA (SEQ ID NO: 73).
[0218] The RNA expressing cassette (including gene-specific spacer sequences for the selected locations in the PPO gene) containing either fusion or non-fusion NA were synthesized and cloned into entry vectors, which was cloned (via Gateway) into the destination vector containing the CAS9 expression cassette.
[0219] The vector used as non fusion control contains PRO0231::U3 RNA pol III promoter::spacer::sgRNA scaffold::TTTTTTTT terminator::U3 RNA pol III promoter::template::TTTTTTTT terminator.
[0220] After the LR recombination step, the resulting expression vector is transformed into Agrobacterium strain LBA4044 according to methods well known in the art.
Example 11 Rice Transformation and Selection of Herbicide-Tolerant Calli
[0221] The Agrobacterium containing the expression vector is used to transform scutellum-derived callus of indica rice (Oryza sativa L.). Sterilization of mature seeds has been carried out by incubating for one minute in 70% ethanol, followed by 40 minutes in 6% sodium hypochlorite, followed by a 3 to 5 times wash with sterile MQ water. The sterilized seeds are then germinated on a medium containing 2,4-D (callus induction medium). After 6 days of incubation in the light, scutellum-derived calli are incubated for 90 seconds in bacterial solution (OD.sub.600=0,1), drained, dried on sterile filter paper and then co-cultured with bacteria for 3 days in the dark at 25° C. The co-cultivated calli are transferred to selection medium containing G418 for 4 weeks in the light at 32° C. Anti-biotic-resistant callus pieces are transferred to selection medium containing 25 or 50 μM saflufenacil (Kixor™) for 2 weeks in the light at 32° C. These herbicide selection conditions have been established through the analysis of tissue survival in kill curves with saflufenacil. After transfer of herbicide-resistant material to a regeneration medium and incubation in the light, the embryogenic potential is released and shoots developed in the next four to five weeks. Shoots are excised from the calli and incubated for 2 to 3 weeks on an auxin-containing medium until shoots are well rooted for transfer to soil. Hardened shoots are grown under high humidity and short days in a greenhouse.
Example 12 Molecular Characterization of the Herbicide Tolerant Transformants
[0222] Leaf tissue collected from each individual plant transformant is used for copy number analysis and molecular characterization of PPO gene sequence mutations. Genomic DNA is extracted using a Wizard 96 Magnetic DNA Plant System kit (Promega, U.S. Pat. No. 6,027,945 & U.S. Pat. No. 6,368,800) as directed by the manufacturer. Isolated DNA was PCR amplified using the appropriate probe, together with forward and reverse primers. Following this quantitative PCR analysis to verify copy number of the T-DNA insert, only low copy transgenic plants that exhibit tolerance to the selection agent are kept for harvest of T1 seeds. Seeds are then harvested three to five months after transplanting. PCR amplification of PPO genomic sequences is performed using Fusion Taq DNA Polymerase (Thermo Scientific) using thermocycling program as follows: 96° C. for 15 min, followed by 35 cycles (96° C., 30 sec; 58° C., 30 sec; 72° C., 3 min and 30 sec), 10 min at 72° C. PCR products are verified for concentration and fragment size via agarose gel electrophoresis, and send for sequencing using the PCR primers. Sequence analysis is performed on the representative chromatogram trace files and corresponding AlignX alignment with default settings and edited to call secondary peaks.
[0223] Mutations identified in several individuals, based on sequence information, show that the technology described in this invention, which involves fusion of NA to the CRISPR components, is applicable to plant organisms. Homologous recombination repair with the provided donors confers tolerance to Saflufenacil (single site mutation and multiple site mutation).
Example 13 Controlled Gene Knockout in Escherichia Co/i
[0224] In this example FusionCRISPR is being used to knockout target gene RecA in E coil strain K-12 substr. MG1655. The bacterial strain is inoculated in 10 ml SOB in a 100 ml Erlenmeyer flask and grown overnight at 37° C. (SOB: 2% bacto-tryptone, 0.5% yeast extract, 10 mM NaCl, 2.5 mM KCl, 10 mM MgCl.sub.210 mM MgSO.sub.4). 3 ml of the overnight culture is diluted in 250 ml SOB in a 1 liter Erlenmeyer flask and grown at 18° C. with vigorous shaking (200-250 rpm) until the OD.sub.660nm is 0.6. Subsequently the culture is transferred to precooled 50 ml tubes and centrifuge at 5000 rpm for 5 min at 4° C. The pellet is resuspend in ⅓ of the original volume of ice-cold TB (TB: 250 mM KCl, 10 mM PIPES free acid, 15 mM CaCl.sub.2.Math.2H.sub.2O, 55 mM MnCl.sub.2.Math.2H.sub.2O) and incubated on ice for 10 min. The cells are centrifuged at 5000 rpm for 5 min at 4° C. and the pellet resuspended in 1/12 of the original volume of ice-cold TB. DMSO is added with gentle mixing to a final concentration of 7%. The competent cells are alliquoted in 200 μl portions and freezed in liquid nitrogen. One aliquot of competent cells is added together with 0.1-0.5 μg of plasmid containing a chloramphenicol selectable marker and Cas9 expression cassette as present in pCas9 [Jiang W, Bikard D, Cox D, Zhang F, Marraffini L (2013) RNA-guided editing of bacterial genomes using CRISPR-Cas systems. Nat Biotechnol] and a cassette for expression of fusion RNA [Zhao D, Yuan S, Xiong B, Sun H, Ye L, Li J, Zhang X, Bi C. (2016) Development of a fast and easy method for Escherichia coli genome editing with CRISPR/Cas9. Microb Cell Fact. 15(1):205] with the following Fusion-CRISPR sequence and RecA spacer:
TABLE-US-00002 (SEQ ID NO: 42) gatgtggaaaccatctctacGTTTTAGAGCTAGAAATAGCAAGTTAAAAT AAGGCTAGTCCGT-TATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTT CCATGGATGTGGAAAC-CATCGCTTTCACTGGATATCGCG
[0225] in which the spacer recognizing RecA is in lowercase (i.e., gatgtggaaaccatctctac), the essential sequences for the sgRNA is capitalized, not underlined, homology arm 1 with RecA is double underlined and homology arm 2 with RecA is single underlined. Promoters and terminators for the FusionCRISPR construct and Cas9 can be chosen from world wide web at parts.igem.org/Promoters/Catalog/Constitutive and world wide web at parts.igem.org/Terminators/Catalog. The targeted RecA gene has the following sequence:
TABLE-US-00003 (SEQ ID NO: 43) ATGGCTATCGACGAAAACAAACAGAAAGCGTTGGCGGCAGCACTGGGCCA GATTGA-GAAACAATTTGGTAAAGGCTCCATCATGCGCCTGGGTGAAGAC CGTTCCATGGATGTG-GAAACCATCTCTAC TTCGCTTTCACTGGATA TCGCGCTTGGGG-CAGGTGGTCTGCCGATGGGCCGTATCGTCGAAATCTA CGGACCGGAATCTTCCGG-TAAAACCACGCTGACGCTGCAGGTGATCGCC GCAGCGCAGCGTGAAGGTAAAAC-CTGTGCGTTTATCGATGCTGAACACG CGCTGGACCCAATCTACGCAC-GTAAACTGGGCGTCGATATCGACAACCT GCTGTGCTCCCAGCCGGACACCGGCGAG-CAGGCACTGGAAATCTGTGAC GCCCTGGCGCGTTCTGGCGCAGTAGAC-GTTATCGTCGTTGACTCCGTGG CGGCACTGACGCCGAAAGCG-GAAATCGAAGGCGAAATCGGCGACTCTCA CATGGGCCTTGCGGCAC-GTATGATGAGCCAGGCGATGCGTAAGCTGGCG GGTAACCTGAAGCAGTCCAACAC-GCTGCTGATCTTCATCAACCAGATCC GTATGAAAATTGGTGTGATGTTCGGTAACCCG-GAAACCACTACCGGTGG TAACGCGCTGAAATTCTAC-GCCTCTGTTCGTCTCGACATCCGTCGTATC GGCGCGGTGAAAGAGGGCGAAAAC-GTGGTGGGTAGCGAAACCCGCGTGA AAGTGGTGAA-GAACAAAATCGCTGCGCCGTTTAAACAGGCTGAATTCCA GATCCTCTAC-GGCGAAGGTATCAACTTCTACGGCGAACTGGTTGACCTG GGCGTAAAAGAGAA-GCTGATCGAGAAAGCAGGCGCGTGGTACAGCTACA AAGGTGAGAAGATCGGTCAGGG-TAAAGCGAATGCGACTGCCTGGCTGAA AGATAACCCGGAAACCGCGAAAGAGATCGA-GAAGAAAGTACGTGAGTTG CTGCTGAGCAACCCGAACTCAACGCCGGATTTCTCTG-TAGATGATAGCG AAGGCGTAGCAGAAACTAACGAAGATTTTTAA
[0226] in which the PAM sequence is in italics, homology arm 1 is double underlined, homology arm 2 is single underlined, and the protospacer is the following portion of the sequence:
TABLE-US-00004 GATGTGGAAACCATCTCTAC.
DNA and cells are kept on ice for 30 minutes prior to a 90 seconds heat shock at 42° C. Cells and DNA are transferred to ice and 1 ml LB is added after 1 minute (LB: 1% tryptone, 1% NaCl, 0.5% yeast extract, pH 7.0). Cells are allowed to recover for 1 hour at 37° C. The recovery phase can be extended to 16 hours to allow the FusionCRISPR components more time to edit the E. coli genome. 25 μg/ml chloramphenicol should be added after 1 hour to prevent loss of the plasmid. Cells are plated on LB medium with 25 μg/ml chloramphenicol and incubated at 37° C. for 1 day. Single colonies are selected from plate and grown overnight in LB with chloramphenicol at 37° C. after which genomic DNA is extracted [He, F. (2011) E. coli Genomic DNA Extraction. Bio-protocol Bio101: e97]. PCR with a forward primer upstream from the first homology arm (ATGGCTATCGACGAAAACAAA) (SEQ ID NO: 44) and reverse primer down-stream from the second homology arm (CGTCAGCGTGGTTTTACCGGA) (SEQ ID NO: 45) is performed to identify colonies in which the 11 nucleotides shown in bold in the RecA sequence (SEQ ID 43) are no longer present due to homologous recombination repair with the FusionCRISPR template. PCR fragments can be sequenced (expected size 220 bp) or, in this case, subjected to Agel digestions (the deleted sequence around PAM contains the Agel recognition site ACCGGT) to verify modification of the locus after standard gel electrophoresis. Deletion of 11 nucleotides ensures a disruption of the open reading frame.
Example 14 Controlled Knockout of the PRDM9 Gene in Human-Induced Pluripotent Stem Cells (hiPSCs) and HEK293 Cells
[0227] Cell culture maintenance, plasmid construction, transfection methods and molecular analysis of genome editing in hiPSCs and HEK293 cells are described in great detail in Yang L, Yang J L, Byrne S, Pan J, Church G (2014) CRISPR/Cas9-directed genome editing of cultured cells. Current Protocols in Molecular Biology 31.1.1-31.1.17. For knock-out of the PRDM9 gene, all steps are followed as described therein, with only a minor change in the gRNA plasmid design. The synthesized gRNA should have the following sequence:
TABLE-US-00005 (SEQ ID NO: 46) TGTACAAAAAAGCAGGCTTTAAAGGAACCAATTCAGTCGACTGGATCCGG TAC-CAAGGTCGGGCAGGAAGAGGGCCTATTTCCCATGATTCCTTCATAT TTGCATATAC-GATACAAGGCTGTTAGAGAGATAATTAGAATTAATTTGA CTGTAAACACAAAGATATTAG-TACAAAATACGTGACGTAGAAAGTAATA ATTTCTTGGGTAGTTTGCAG-TTTTAAAATTATGTTTTAAAATGGACTAT CATATGCTTACCGTAACTT-GAAAGTATTTCGATTTCTTGGCTTTATATA TCTTGTGGAAAGGACGAAACACCgg-catccctcaggctgggctGTTTTA GAGCTAGAAATAGCAAGTTAAAATAAGGCTAG-TCCGTTATCAACTTGAA AAAGTGGCACCGAGTCGGTGCTGGCCATCAGGCATCCCTCAG-TATGGAA TGAGGCATCTGATtttttt
[0228] in which the U6 promoter is shown in italics, the spacer recognizing PRDM9 exon ENSE00001804383 is in lowercase (i.e., ggcatccctcaggctgggct), the essential sequences for the sgRNA is capitalized not underlined or in italics, homology arm 1 with PRDM9 is double underlined, homology arm 2 with PRDM9 is single underlined and the terminator is in small case. The targeted PRDM9 exon ENSE00001804383 has the sequence:
TABLE-US-00006 (SEQ ID NO: 47) ATTGTGAGATGTGTCAGAACTTCTTCATT-GACAGCTGTGCTGCCCATGG GCCCCCTACATTTGTAAAGGACAGTGCAGTG-GACAAGGGGCACCCCAAC CGTTCAGCCCTCAGTCTGCCCCCAGGGCTGAGAATT-GGGCCATCAGGCA TCCCTCAGGCTGGGCT
AG-TATGGAATGAGGCATCTGATCTGCCGCT GGGTCTGCACTTT-GGCCCTTATGAGGGCCGAATTACAGAAGACGAAGAG GCAGCCAACAATGGA-TACTCCTGGCTGTGG
[0229] in which the PAM sequence is in italics, homology arm 1 is double underlined, homology arm 2 is single underlined, and the protospacer is the following portion of the sequence:
TABLE-US-00007 GGCATCCCTCAGGCTGGGCT.
The nucleotides shown in boldface are deleted upon homologous recombination with the FusionCRISPR construct resulting in a frame shift as shown using PCR amplifying the respective genomic region from genomic DNA and subsequent sequencing of the resulting PCR products.
Example 15: Introduction of Point Mutations in Rice Plants Leading to Cyclohexanedione (DIM) and/or Aryloxyphenoxypropionate (FOP) in Rice
[0230] Mutations I1781L and G2096S in plastidic Acetyl Coenzyme A Carboxylase (ACCase) are known to confer tolerance to DIM and FOP herbicides. These mutations can be introduced at the endogenous ACCase locus using the following vectors. Vector RLW137 SEQ ID NO: 66
[0231] The backbone of this vector is the gateway-enabled construct RLW121 SEQ ID NO: 62. ENTR vectors for RLW137 are vectors CC003 SEQ ID NO: 63 (selectable marker for the incoming T-DNA), CC018 SEQ ID NO: 64 (producing the FusionCRISPR construct which targets and introduces G2096S after cutting upstream from the DNA that corresponds to G2096) and CC006 SEQ ID NO: 65 (providing Cas9).
[0232] CC018 (short for CRISPRCas018) contains—300 nt homology arms flanking the incoming nucleotides (in this case encoding G20965). Additional mutations are co-introduced to avoid self-cleavage of the T-DNA (mutated PAM, alternatively or in addition the spacer could include many mutations which are preferably silent in parts that correspond with exons and do not affect intron/exon borders if present) and early termination of transcription on long stretches of T present either in the homology arms or incoming nucleotides.
[0233] A control vector is synthesized which is identical except that the donor molecule is expressed as separate molecule which is not linked to the guide RNA.
[0234] Vector RLW137 and the control vector are transformed into rice using the protocol described above. Initial selection is for the presence of the ZmAHAS A122T S553N marker. Analysis of the transformed plants is performed as described in example 12.
[0235] Similar to the procedure described above for RLW137, RLW138 introduces the same mutation, but this time using an alternative, downstream protospacer site. RLW138 consists of the RLW121 backbone with the CC003, CC019 (SEQ ID NO: 67) and CC006. The mutation I1781L is introduced by RLW139 (SEQ ID NO: 70) consisting of RLW121, CC003, CCO20 (SEQ ID NO: 69) and CC006.
Example 16 Application of Fusion CRISPR in Bacillus
[0236] Electrocompetent Bacillus subtilis cells and electroporation
[0237] Transformation of DNA into B. subtilis ATCC 6051 is performed via electroporation. Preparation of electrocompetent B. subtilis ATCC 6051 cells and transformation of DNA is performed as essentially described by Xue et al (Xue, G.-P., 1999, Journal of Micro-biological Methods 34, 183-191) with the following modification: Upon transformation of DNA, cells are recovered in 1 ml LBSPG buffer and incubated for 60 min at 37° C. (Vehmaanpera J., 1989, FEMS Microbio. Lett., 61: 165-170) following plating on selective LB-agar plates. For plasmids containing the temperature-sensitive pE194 replication origin, cells are recovered for 3h at 33° C.
[0238] Plasmid Isolation
[0239] Plasmid DNA was isolated from Bacillus and E. coli cells by standard molecular biology methods described in (Sambrook,J. and Russell, D. W. Molecular cloning. A laboratory manual, 3rd ed, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. 2001.) or the the alkaline lysis method (Birnboim, H. C., Doly, J. (1979). Nucleic Acids Res 7(6): 1513-1523). Bacillus cells were in comparison to E. coli treated with 10 mg/ml lysozyme for 30 min at 37° C. prior to cell lysis.
[0240] Annealing of oligonucleotides to form oligonucleotide-duplexes.
[0241] Oligonucleotides were adjusted to a concentration of 100 μM in water. 5 μl of the forward and 5 μl of the corresponding reverse oligonucleotide were added to 90 μl 30 mM Hepes-buffer (pH 7.8). The reaction mixture was heated to 95° C. for 5 min following annealing by ramping from 95° C. to 4° C. with decreasing the temperature by 0.1° C./sec (Cobb, R. E., Wang, Y., & Zhao, H. (2015). High-Efficiency Multiplex Genome Editing of Streptomyces Species Using an Engineered CRISPR/Cas System. ACS Synthetic Biology, 4(6), 723-728).
[0242] Molecular biology methods and techniques
[0243] Plasmid pJ0E8999:
[0244] Altenbuchner J. 2016. Editing of the Bacillus subtilis genome by the CRISPR-Cas9 system. Appl Environ Microbio) 82:5421-5.
[0245] Plasmid pCC001
[0246] The pJ0E8999 and the synthetic gene fragment Seq ID 048 provided in a standard E. coli cloning vector (pUC derivative) are cut with Avrll and Xbal following isolation of the pJ0E8999 plasmid backbone and the smaller Avrll/Xbal fragment of Seq ID 048. The two fragments are ligated using with T4-DNA ligase (NEB) following transformation into E. coli XL1-Blue competent cells (Stratagene). The correct plasmid was recovered and named pCC001.
[0247] Plasmid pCC002
[0248] The pJ0E8999 and the synthetic gene fragment Seq ID 049 provided in a standard E. coli cloning vector (pUC derivative) are cut with Avrll and Xbal following isolation of the pJ0E8999 plasmid backbone and the smaller Avrll/Xbal fragment of Seq ID 049. The two fragments are ligated using with T4-DNA ligase (NEB) following transformation into E. coli XL1-Blue competent cells (Stratagene). The correct plasmid was recovered and named pCC002.
[0249] Plasmid pCC003
[0250] The oligonucleotides SeqID 050 and Seq ID 051 with 5′ phosphorylation are annealed to form an oligonucleotide duplex encoding for the protospacer sequence targeting the amylase gene amyE of B.subtilis ATCC6051. The plasmid pJ0E8999 is cut with Bsal following ligation of the oligonucleotide duplex to recover plasmid pCC003.
[0251] Plasmid pCC004
[0252] The 5′homology region (also referred to as HomA) and the 3′ homology region (also referred to as HomB) adjacent to the amylase amyE gene of B. subtilis ATCC6051 were PCR-amplified on isolated genomic DNA with oligonucleotides Seq ID NO: 52, Seq ID NO: 53 and SeqID NO: 54, Seq ID NO: 55 respectively. The two homology regions HomA and HomB were fused and amplified using overlap PCR with oligonucleotides Seq ID NO: 52 and Seq ID NO: 55 to recover the HomAB PCR fragment of the homology regions of the amyE gene. The plasmid pCC003 and the HomAB-amyE PCR fragment were cut with Sfil following ligation with T4-DNA ligase (NEB). The reaction mixture was transformed into E. coli XL1-Blue competent cells (Stratagene). The correct plasmid containing the amyE protospacer and the HomAB of amyE was recovered and named pCC004 (
[0253] Plasmid pCC005
[0254] The plasmid pCC001 was cut with Bsal following cloning of the amyE protospacer oligonucleotide duplex (SeqID 050/Seq ID051) as described for pCC003. The resulting plasmid and the PCR-fragment of the homology regions HomAB of the amyE gene as described for construction of pCC004 were cut with Sfil following ligation with T4-DNA ligase (NEB). The reaction mixture was transformed into E. coli XL1-Blue competent cells (Stratagene). The correct plasmid containing the amyE protospacer and the HomAB of amyE was recovered and named pCC005.
[0255] Plasmid pCC006 The 5′ homology region (also referred to as HomA) and the 3′ homology region (also referred to as HomB) adjacent to the amylase amyE gene of B. subtilis ATCC6051 were PCR-amplified on isolated genomic DNA with oligonucleotides Seq ID NO: 56, Seq ID NO: 57 and SeqID NO: 58, Seq ID NO: 59 respectively. The two homology regions HomA and HomB were fused and amplified using overlap PCR with oligonucleotides Seq ID NO: 56 and Seq ID NO: 59 to recover the HomAB PCR fragment of the homology regions of the amyE gene. The plasmid pCC001 was cut with Bsal following ligation of the amyE protospacer oligonucleotide duplex (SeqID NO: 50/Seq ID NO: 51) with T4-DNA ligase (NEB) as described for pCC003. The resulting plasmid and the PCR-fragment of the homology regions HomAB of the amyE gene were cut with Sfil following ligation with T4-DNA ligase (NEB). The reaction mixture was transformed into E. coli XL1-Blue competent cells (Stratagene). The correct plasmid containing the amyE protospacer and the HomAB of amyE in reverse orientation compared to pCC005 was recovered and named pCC006.
[0256] Plasmid pCC007
[0257] The plasmid pCC002 was cut with Bsal following ligation of the amyE protospacer oligonucleotide duplex (SeqID NO: 50/Seq ID NO: 51) with T4-DNA ligase (NEB) as described for pCC003. The resulting plasmid and the PCR-fragment of the homology regions HomAB of the amyE gene as described for construction of pCC004 were cut with Sfil following ligation with T4-DNA ligase (NEB). The reaction mixture was transformed into E. coli XL1-Blue competent cells (Stratagene). The correct plasmid containing the the HomAB of the amyE gene and the amyE protospacer was recovered and named pCC007.
[0258] Plasmid pCC008
[0259] The plasmid pCC002 was cut with Bsal following ligation of the amyE protospacer oligonucleotide duplex (SeqID NO: 50/Seq ID NO: 51) with T4-DNA ligase (NEB) as described for pCC003. The resulting plasmid and the PCR-fragment of the homology regions HomAB of the amyE amplified with oligonucleotides Seq ID NO: 56 and Seq ID NO: 59 as described for pCC006 were cut with Sfil following ligation with T4-DNA ligase (NEB). The reaction mixture was transformed into E. coli XL1-Blue competent cells (Stratagene). The correct plasmid containing the the HomAB of amyE in reverse orientation compared to pCC007 and the amyE protospacer was recovered and named pCC008.
[0260] Gene Deletion Using Fusion-CRISPR.
[0261] Electrocompetent B. subtilis ATCC6051 cells were transformed with 1 μg each of plasmids pJ0E8999, pCC004, pCC005, pCC006, pCC007, pCC008 as essentially described by Xue et al (Xue, G.-P., 1999, Journal of Microbiological Methods 34, 183-191) with the following modification: Upon transformation of DNA, cells were recovered in 1 ml LBSPG buffer and incubated for 3h at 33° C. (Vehmaanpera J., 1989, FEMS Microbio. Lett., 61: 165-170) following plating on LB-Lennox plates supplemented with 20 μg/ml kanamycin and 0.2% D-Mannose for Cas9 induction. Hates were incubated for 20-22h at 33° C. Up to 10 clones from each plasmid transformation were picked and transferred onto a fresh preheated LB-Lennox-plate following incubation at 50° C. for 18h. From each large grown colony, cells were picked and 3 strokes on fresh LB-Lennox plates performed to yield single colonies after 7-8h incubation at 45° C. Single colonies were transferred onto LB-Lennox plates and LB-Lennox plates supplemented with 20 μg/ml kanamycin, following incubation for 16-18 hours at 30° C. Kanamycin-sensitive clones, indicative of plasmid loss, were plated on LB-Lennox plates supplemented with 1% soluble starch following incubation for 20 hours at 30° C. Inactivation of the amylase amyE gene was visualized by covering the plates with iodine containing LugoIs solution and analyzed for the presence or absence of a light halo, the latter indicating a successful inactivation.
[0262] Table 2 summarizes the amount of total clones after plasmid curing, amount of clones with inactivated amylase, the percentage of clones with inactivated amylase relative to total clones and the relative knockout efficiency with the indicated plasmids relative to pCC004 (
TABLE-US-00008 TABLE 2 Subclones Subclones Subclones Amy. neg. Relative to Construct total Amy. neg. [%] pCC004 pJOE8999 90 0 0 0 pCC004 177 42 24 100 pCC005 197 113 57 242 pCC006 192 79 41 173 pCC007 117 95 81 342 pCC008 146 116 79 335