RECOMBINANT ANTI-HUMAN PD-1 ANTIBODY AND APPLICATION THEREOF
20230104769 · 2023-04-06
Inventors
- Jinchao Zhang (Beijing, CN)
- Rongjuan WANG (Beijing, CN)
- Shasha JIAO (Beijing, CN)
- Shuang WANG (Beijing, CN)
Cpc classification
A61K45/06
HUMAN NECESSITIES
A61K39/00
HUMAN NECESSITIES
C07K2317/33
CHEMISTRY; METALLURGY
C07K2317/24
CHEMISTRY; METALLURGY
C07K2317/76
CHEMISTRY; METALLURGY
C07K2317/34
CHEMISTRY; METALLURGY
A61K47/6849
HUMAN NECESSITIES
C07K2317/92
CHEMISTRY; METALLURGY
International classification
C07K16/28
CHEMISTRY; METALLURGY
A61K47/68
HUMAN NECESSITIES
Abstract
The present invention provides an antibody binding to programmed cell death protein 1 (PD-1) or a fragment thereof and a use of the antibody or a fragment thereof in preventing or treating a tumor or cancer. The antibody or a fragment thereof of the present invention can effectively block the interactions of PD-1/PD-L1 and PD-1/PD-L2 and has a unique antigen binding epitope and unique properties in terms of efficacy and safety.
Claims
1. An antibody capable of binding to programmed cell death protein 1 (PD-1) or a fragment thereof, the antibody or fragment thereof comprising a light chain variable region and/or a heavy chain variable region, wherein the light chain variable region comprises light chain CDR1 (LCDR1), CDR2 (LCDR2), CDR3 (LCDR3) and/or the heavy chain variable region comprises heavy chain CDR1 (HCDR1), CDR2 (HCDR2) and CDR3 (HCDR3) as set forth in following sequences respectively: TABLE-US-00016 LCDR1 LCDR2 LCDR3 X1ASQDVX2TX3VA X1ASTRX2X3 QQX1X2X3X4PX5 (SEQ ID NO: 1) (SEQ ID NO: 2) (SEQ ID NO: 3) X1 = K or R; X1 = A, G or W; X1 = A, F or Y; X2 = E or S; X2 = A, H or Q; X2 = D, N or S; X3 = A, V or Y X3 = S or T X3 = R, N or S; X4 = F or Y; X5 = G, W or Y HCDR1 HCDR2 HCDR3 X1X2X3MS TIX1X2X3X4X5 PX1X2SGVAX3 (SEQ ID NO: 4) X6TX7YPDSVKG (SEQ ID NO: 6) X1 = D or S; (SEQ ID NO: 5) X1 = D, E or Y; X2 = A, N or Y; X1 = K, S or W; X2 = A or S; X3 = D, S or Y X2 = G, S or Y; X3 = T or Y X3 = D, G or S; X4 = G or S; X5 = G or S; X6 = T or Y; X7 = A, T or Y
2. The antibody or fragment thereof according to claim 1, wherein the light chain variable region and/or the heavy chain variable region comprises LCDR1, LCDR2, LCDR3 and/or HCDR1, HCDR2, HCDR3 as set forth in following sequences respectively: TABLE-US-00017 LCDR1 LCDR2 LCDR3 X1ASQDVX2TX3VA X1ASTRX2X3 QQX1X2X3X4PX5 (SEQ ID NO: 1) (SEQ ID NO: 2) (SEQ ID NO: 3) X1 = K or R; X1 = W; X1 = Y; X2 = E; X2 = H; X2 = D, N or S; X3 = A, V or Y X3 = S or T X3 = R or S; X4 = F or Y; X5 = W HCDR1 HCDR2 HCDR3 X1X2X3MS TIX1X2X3X4X5X6 PX1X2SGVAX3 (SEQ ID NO: 4) TX7YPDSVKG (SEQ ID NO: 6) X1 = D or S; (SEQ ID NO: 5) X1 = D or Y; X2 = A or Y; X1 = S; X2 = S; X3 = D or S X2 = G or S; X3 = Y X3 = D, G or S; X4 = G or S; X5 = S; X6 = Y; X7 = A or Y
3. The antibody or fragment thereof according to claim 1, wherein the light chain variable region and/or the heavy chain variable region comprises LCDR1, LCDR2, LCDR3 and/or HCDR1, HCDR2, HCDR3 as set forth in following sequences respectively: LCDR1 selected from the group consisting of SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10 and SEQ ID NO:11; LCDR2 selected from the group consisting of SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16 and SEQ ID NO:17; LCDR3 selected from the group consisting of SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, SEQ ID NO:24, SEQ ID NO:25, SEQ ID NO:26 and SEQ ID NO:27; and/or HCDR1 selected from the group consisting of SEQ ID NO:28, SEQ ID NO:29, SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32 and SEQ ID NO:33; HCDR2 selected from the group consisting of SEQ ID NO:34, SEQ ID NO:35, SEQ ID NO:36, SEQ ID NO:37, SEQ ID NO:38, SEQ ID NO:39, SEQ ID NO:40, SEQ ID NO:41, SEQ ID NO:42, SEQ ID NO:43, SEQ ID NO:44, SEQ ID NO:45 and SEQ ID NO:46; HCDR3 selected from the group consisting of SEQ ID NO:47, SEQ ID NO:48, SEQ ID NO:49, SEQ ID NO:50, and SEQ ID NO:51.
4. The antibody or fragment thereof according to claim 1, wherein the light chain variable region comprises LCDR1, LCDR2, LCDR3 selected from the group consisting of sequence combinations as follows: TABLE-US-00018 Combination LCDR1 LCDR2 LCDR3 1 SEQ ID NO: 7 SEQ ID NO: 12 SEQ ID NO: 18 2 SEQ ID NO: 8 SEQ ID NO: 12 SEQ ID NO: 18 3 SEQ ID NO: 9 SEQ ID NO: 12 SEQ ID NO: 18 4 SEQ ID NO: 10 SEQ ID NO: 12 SEQ ID NO: 18 5 SEQ ID NO: 11 SEQ ID NO: 12 SEQ ID NO: 18 6 SEQ ID NO: 7 SEQ ID NO: 13 SEQ ID NO: 18 7 SEQ ID NO: 7 SEQ ID NO: 14 SEQ ID NO: 18 8 SEQ ID NO: 7 SEQ ID NO: 15 SEQ ID NO: 18 9 SEQ ID NO: 7 SEQ ID NO: 16 SEQ ID NO: 18 10 SEQ ID NO: 7 SEQ ID NO: 17 SEQ ID NO: 18 11 SEQ ID NO: 7 SEQ ID NO: 12 SEQ ID NO: 19 12 SEQ ID NO: 7 SEQ ID NO: 12 SEQ ID NO: 20 13 SEQ ID NO: 7 SEQ ID NO: 12 SEQ ID NO: 21 14 SEQ ID NO: 7 SEQ ID NO: 12 SEQ ID NO: 22 15 SEQ ID NO: 7 SEQ ID NO: 12 SEQ ID NO: 23 16 SEQ ID NO: 7 SEQ ID NO: 12 SEQ ID NO: 24 17 SEQ ID NO: 7 SEQ ID NO: 12 SEQ ID NO: 25 18 SEQ ID NO: 7 SEQ ID NO: 12 SEQ ID NO: 26 19 SEQ ID NO: 7 SEQ ID NO: 12 SEQ ID NO: 27 20 SEQ ID NO: 8 SEQ ID NO: 17 SEQ ID NO: 18 21 SEQ ID NO: 8 SEQ ID NO: 12 SEQ ID NO: 22 22 SEQ ID NO: 8 SEQ ID NO: 12 SEQ ID NO: 25 23 SEQ ID NO: 7 SEQ ID NO: 17 SEQ ID NO: 22 24 SEQ ID NO: 8 SEQ ID NO: 17 SEQ ID NO: 22, and/or the heavy chain variable region comprises HCDR1, HCDR2, HCDR3 selected from the group consisting of sequence combinations as follows: TABLE-US-00019 Combination HCDR1 HCDR2 HCDR3 1 SEQ ID NO: 28 SEQ ID NO: 34 SEQ ID NO: 47 2 SEQ ID NO: 29 SEQ ID NO: 34 SEQ ID NO: 47 3 SEQ ID NO: 30 SEQ ID NO: 34 SEQ ID NO: 47 4 SEQ ID NO: 31 SEQ ID NO: 34 SEQ ID NO: 47 5 SEQ ID NO: 32 SEQ ID NO: 34 SEQ ID NO: 47 6 SEQ ID NO: 33 SEQ ID NO: 34 SEQ ID NO: 47 7 SEQ ID NO: 28 SEQ ID NO: 35 SEQ ID NO: 47 8 SEQ ID NO: 28 SEQ ID NO: 36 SEQ ID NO: 47 9 SEQ ID NO: 28 SEQ ID NO: 37 SEQ ID NO: 47 10 SEQ ID NO: 28 SEQ ID NO: 38 SEQ ID NO: 47 11 SEQ ID NO: 28 SEQ ID NO: 39 SEQ ID NO: 47 12 SEQ ID NO: 28 SEQ ID NO: 40 SEQ ID NO: 47 13 SEQ ID NO: 28 SEQ ID NO: 41 SEQ ID NO: 47 14 SEQ ID NO: 28 SEQ ID NO: 42 SEQ ID NO: 47 15 SEQ ID NO: 28 SEQ ID NO: 43 SEQ ID NO: 47 16 SEQ ID NO: 28 SEQ ID NO: 44 SEQ ID NO: 47 17 SEQ ID NO: 28 SEQ ID NO: 45 SEQ ID NO: 47 18 SEQ ID NO: 28 SEQ ID NO: 34 SEQ ID NO: 48 19 SEQ ID NO: 28 SEQ ID NO: 34 SEQ ID NO: 49 20 SEQ ID NO: 28 SEQ ID NO: 34 SEQ ID NO: 50 21 SEQ ID NO: 28 SEQ ID NO: 34 SEQ ID NO: 51 22 SEQ ID NO: 32 SEQ ID NO: 40 SEQ ID NO: 47 23 SEQ ID NO: 32 SEQ ID NO: 44 SEQ ID NO: 47 24 SEQ ID NO: 28 SEQ ID NO: 46 SEQ ID NO: 47 25 SEQ ID NO: 32 SEQ ID NO: 40 SEQ ID NO: 47 26 SEQ ID NO: 28 SEQ ID NO: 46 SEQ ID NO: 47; preferably, the light chain variable region and the heavy chain variable region comprise LCDR1, LCDR2, LCDR3 and HCDR1, HCDR2, HCDR3 selected from the group consisting of sequence combinations as follows: TABLE-US-00020 Combination LCDR1 LCDR2 LCDR3 HCDR1 HCDR2 HCDR3 1 SEQ ID NO: 7 SEQ ID NO: 12 SEQ ID NO: 18 SEQ ID NO: 28 SEQ ID NO: 34 SEQ ID NO: 47 2 SEQ ID NO: 8 SEQ ID NO: 12 SEQ ID NO: 18 SEQ ID NO: 28 SEQ ID NO: 34 SEQ ID NO: 47 3 SEQ ID NO: 9 SEQ ID NO: 12 SEQ ID NO: 18 SEQ ID NO: 28 SEQ ID NO: 34 SEQ ID NO: 47 4 SEQ ID NO: 10 SEQ ID NO: 12 SEQ ID NO: 18 SEQ ID NO: 28 SEQ ID NO: 34 SEQ ID NO: 47 5 SEQ ID NO: 11 SEQ ID NO: 12 SEQ ID NO: 18 SEQ ID NO: 28 SEQ ID NO: 34 SEQ ID NO: 47 6 SEQ ID NO: 7 SEQ ID NO: 13 SEQ ID NO: 18 SEQ ID NO: 28 SEQ ID NO: 34 SEQ ID NO: 47 7 SEQ ID NO: 7 SEQ ID NO: 14 SEQ ID NO: 18 SEQ ID NO: 28 SEQ ID NO: 34 SEQ ID NO: 47 8 SEQ ID NO: 7 SEQ ID NO: 15 SEQ ID NO: 18 SEQ ID NO: 28 SEQ ID NO: 34 SEQ ID NO: 47 9 SEQ ID NO: 7 SEQ ID NO: 16 SEQ ID NO: 18 SEQ ID NO: 28 SEQ ID NO: 34 SEQ ID NO: 47 10 SEQ ID NO: 7 SEQ ID NO: 17 SEQ ID NO: 18 SEQ ID NO: 28 SEQ ID NO: 34 SEQ ID NO: 47 11 SEQ ID NO: 7 SEQ ID NO: 12 SEQ ID NO: 19 SEQ ID NO: 28 SEQ ID NO: 34 SEQ ID NO: 47 12 SEQ ID NO: 7 SEQ ID NO: 12 SEQ ID NO: 20 SEQ ID NO: 28 SEQ ID NO: 34 SEQ ID NO: 47 13 SEQ ID NO: 7 SEQ ID NO: 12 SEQ ID NO: 21 SEQ ID NO: 28 SEQ ID NO: 34 SEQ ID NO: 47 14 SEQ ID NO: 7 SEQ ID NO: 12 SEQ ID NO: 22 SEQ ID NO: 28 SEQ ID NO: 34 SEQ ID NO: 47 15 SEQ ID NO: 7 SEQ ID NO: 12 SEQ ID NO: 23 SEQ ID NO: 28 SEQ ID NO: 34 SEQ ID NO: 47 16 SEQ ID NO: 7 SEQ ID NO: 12 SEQ ID NO: 24 SEQ ID NO: 28 SEQ ID NO: 34 SEQ ID NO: 47 17 SEQ ID NO: 7 SEQ ID NO: 12 SEQ ID NO: 25 SEQ ID NO: 28 SEQ ID NO: 34 SEQ ID NO: 47 18 SEQ ID NO: 7 SEQ ID NO: 12 SEQ ID NO: 26 SEQ ID NO: 28 SEQ ID NO: 34 SEQ ID NO: 47 19 SEQ ID NO: 7 SEQ ID NO: 12 SEQ ID NO: 27 SEQ ID NO: 28 SEQ ID NO: 34 SEQ ID NO: 47 20 SEQ ID NO: 8 SEQ ID NO: 17 SEQ ID NO: 18 SEQ ID NO: 28 SEQ ID NO: 34 SEQ ID NO: 47 21 SEQ ID NO: 8 SEQ ID NO: 12 SEQ ID NO: 22 SEQ ID NO: 28 SEQ ID NO: 34 SEQ ID NO: 47 22 SEQ ID NO: 8 SEQ ID NO: 12 SEQ ID NO: 25 SEQ ID NO: 28 SEQ ID NO: 34 SEQ ID NO: 47 23 SEQ ID NO: 7 SEQ ID NO: 17 SEQ ID NO: 22 SEQ ID NO: 28 SEQ ID NO: 34 SEQ ID NO: 47 24 SEQ ID NO: 8 SEQ ID NO: 17 SEQ ID NO: 22 SEQ ID NO: 28 SEQ ID NO: 34 SEQ ID NO: 47 25 SEQ ID NO: 7 SEQ ID NO: 12 SEQ ID NO: 18 SEQ ID NO: 29 SEQ ID NO: 34 SEQ ID NO: 47 26 SEQ ID NO: 7 SEQ ID NO: 12 SEQ ID NO: 18 SEQ ID NO: 30 SEQ ID NO: 34 SEQ ID NO: 47 27 SEQ ID NO: 7 SEQ ID NO: 12 SEQ ID NO: 18 SEQ ID NO: 31 SEQ ID NO: 34 SEQ ID NO: 47 28 SEQ ID NO: 7 SEQ ID NO: 12 SEQ ID NO: 18 SEQ ID NO: 32 SEQ ID NO: 34 SEQ ID NO: 47 29 SEQ ID NO: 7 SEQ ID NO: 12 SEQ ID NO: 18 SEQ ID NO: 33 SEQ ID NO: 34 SEQ ID NO: 47 30 SEQ ID NO: 7 SEQ ID NO: 12 SEQ ID NO: 18 SEQ ID NO: 28 SEQ ID NO: 35 SEQ ID NO: 47 31 SEQ ID NO: 7 SEQ ID NO: 12 SEQ ID NO: 18 SEQ ID NO: 28 SEQ ID NO: 36 SEQ ID NO: 47 32 SEQ ID NO: 7 SEQ ID NO: 12 SEQ ID NO: 18 SEQ ID NO: 28 SEQ ID NO: 37 SEQ ID NO: 47 33 SEQ ID NO: 7 SEQ ID NO: 12 SEQ ID NO: 18 SEQ ID NO: 28 SEQ ID NO: 38 SEQ ID NO: 47 34 SEQ ID NO: 7 SEQ ID NO: 12 SEQ ID NO: 18 SEQ ID NO: 28 SEQ ID NO: 39 SEQ ID NO: 47 35 SEQ ID NO: 7 SEQ ID NO: 12 SEQ ID NO: 18 SEQ ID NO: 28 SEQ ID NO: 40 SEQ ID NO: 47 36 SEQ ID NO: 7 SEQ ID NO: 12 SEQ ID NO: 18 SEQ ID NO: 28 SEQ ID NO: 41 SEQ ID NO: 47 37 SEQ ID NO: 7 SEQ ID NO: 12 SEQ ID NO: 18 SEQ ID NO: 28 SEQ ID NO: 42 SEQ ID NO: 47 38 SEQ ID NO: 7 SEQ ID NO: 12 SEQ ID NO: 18 SEQ ID NO: 28 SEQ ID NO: 43 SEQ ID NO: 47 39 SEQ ID NO: 7 SEQ ID NO: 12 SEQ ID NO: 18 SEQ ID NO: 28 SEQ ID NO: 44 SEQ ID NO: 47 40 SEQ ID NO: 7 SEQ ID NO: 12 SEQ ID NO: 18 SEQ ID NO: 28 SEQ ID NO: 45 SEQ ID NO: 47 41 SEQ ID NO: 7 SEQ ID NO: 12 SEQ ID NO: 18 SEQ ID NO: 28 SEQ ID NO: 34 SEQ ID NO: 48 42 SEQ ID NO: 7 SEQ ID NO: 12 SEQ ID NO: 18 SEQ ID NO: 28 SEQ ID NO: 34 SEQ ID NO: 49 43 SEQ ID NO: 7 SEQ ID NO: 12 SEQ ID NO: 18 SEQ ID NO: 28 SEQ ID NO: 34 SEQ ID NO: 50 44 SEQ ID NO: 7 SEQ ID NO: 12 SEQ ID NO: 18 SEQ ID NO: 28 SEQ ID NO: 34 SEQ ID NO: 51 45 SEQ ID NO: 7 SEQ ID NO: 12 SEQ ID NO: 18 SEQ ID NO: 32 SEQ ID NO: 40 SEQ ID NO: 47 46 SEQ ID NO: 7 SEQ ID NO: 12 SEQ ID NO: 18 SEQ ID NO: 32 SEQ ID NO: 44 SEQ ID NO: 47 47 SEQ ID NO: 7 SEQ ID NO: 12 SEQ ID NO: 18 SEQ ID NO: 28 SEQ ID NO: 46 SEQ ID NO: 47 48 SEQ ID NO: 8 SEQ ID NO: 17 SEQ ID NO: 22 SEQ ID NO: 32 SEQ ID NO: 40 SEQ ID NO: 47 49 SEQ ID NO: 8 SEQ ID NO: 17 SEQ ID NO: 22 SEQ ID NO: 28 SEQ ID NO: 46 SEQ ID NO: 47
5. The antibody or fragment thereof according to claim 1, wherein the antibody or fragment thereof has one or more activities selected from the group consisting of: (1) blocking the binding of PD-1 to its ligand PD-L1 or PD-L2; (2) binding to primate PD-1 specifically, and showing no cross-reactivity with non-primate PD-1; (3) showing no binding to members of CD28 family other than PD-1; (4) inducing the production of IL-2 and/or IFN-γ in CD4+ T cells; and (5) having no ADCC-effector function; preferably, the antibody or fragment thereof binds to the carbohydrate chain at N58 of human PD-1; preferably, the heavy chain variable region of the antibody or fragment thereof comprises an amino acid sequence as set forth in SEQ ID NO:47; preferably, the light chain variable region comprises an amino acid sequence as set forth in SEQ ID NO:52 or SEQ ID NO:60, or an amino acid sequence having at least 75% sequence identity to the amino acid sequence as set forth in SEQ ID NO:52 or SEQ ID NO:60; and/or the heavy chain variable region comprises an amino acid sequence as set forth in SEQ ID NO:54 or SEQ ID NO:62, or an amino acid sequence having at least 75% sequence identity to the amino acid sequence as set forth in SEQ ID NO:54 or SEQ ID NO:62; preferably, the “at least 75% sequence identity” refers to any percent identity greater than or equal to 75%, for example at least 80%, preferably at least 85%, more preferably at least 90%, further more preferably at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or even 99% identity.
6. The antibody or fragment thereof according to claim 1, wherein the light chain variable region comprises an amino acid sequence as set forth in SEQ ID NO:60 or a variant thereof; and with reference to the numbering and composition of amino acid residues of the sequence as set forth in SEQ ID NO: 60, the variant has one or more, preferably 1-3 amino acid substitution(s) in comparison with SEQ ID NO:60 selected from the group consisting of: K24R, E30S, V32A, V32Y, W50A, W50G, H55A, H55Q, T56S, Y91A, Y91F, S92D, S92N, R93N, R93 S, Y94F, W96G and W96Y; preferably, the variant has one or more, preferably 1-3 amino acid substitution(s) in comparison with SEQ ID NO:60 selected from the group consisting of: K24R, V32A, V32Y, T56S, S92D, S92N, R93 S and Y94F.
7. The antibody or fragment thereof according to claim 1, wherein the heavy chain variable region comprises an amino acid sequence as set forth in SEQ ID NO:62 or a variant thereof; and with reference to the numbering and composition of amino acid residues of the sequence as set forth in SEQ ID NO: 62, the variant has one or more, preferably 1-3 amino acid substitution(s) in comparison with SEQ ID NO:62 selected from the group consisting of: S31D, Y32A, Y32N, D33S, D33Y, S52K, S52W, G53S, G53Y, G54D, G54S, G55S, S56G, Y57T, Y59A, Y59T, D100E, D100Y, S101A and Y106T; preferably, the variant has one or more, preferably 1-3 amino acid substitution(s) in comparison with SEQ ID NO:62 selected from the group consisting of: S31D, Y32A, D33S, G53S, G54S, G55S, Y59A and D100Y.
8. The antibody or fragment thereof according to claim 1, wherein the antibody can be any of a monoclonal antibody, a single chain antibody, a bifunctional antibody, a single domain antibody, a nanobody, a fully or partially humanized antibody or chimeric antibody, or the like; preferably, the antibody is an IgA, IgD, IgE, IgG, or IgM antibody, more preferably is an IgG1 or IgG4 antibody; preferably, the fragment is any fragment of the antibody that is capable of specifically binding to PD-1 or any portion thereof; more preferably, the fragment is a fragment scFv, BsFv, dsFv, (dsFv).sub.2, Fab, Fab′, F(ab′).sub.2 or Fv of the antibody; more preferably, the heavy chain constant region of the antibody is of IgG1 or IgG4 subtype, and the light chain constant region is of κ type; further preferably, the light chain constant region of the antibody comprises an amino acid sequence as set forth in SEQ ID NO:56 or SEQ ID NO:64, or an amino acid sequence having at least 75% sequence identity to the amino acid sequence as set forth in SEQ ID NO:56 or SEQ ID NO:64; and/or the heavy chain constant region comprises an amino acid sequence as set forth in SEQ ID NO:58 or SEQ ID NO:66, or an amino acid sequence having at least 75% sequence identity to the amino acid sequence as set forth in SEQ ID NO:58 or SEQ ID NO:66; preferably, the “at least 75% sequence identity” refers to any percent identity greater than or equal to 75%, for example at least 80%, preferably at least 85%, more preferably at least 90%, further more preferably at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or even 99% identity.
9. A conjugate or fusion protein comprising the antibody or fragment thereof according to claim 1.
10. A nucleic acid molecule comprising a nucleotide sequence encoding the heavy chain CDRs, the light CDRs, the heavy chain variable region, the light chain variable region, the heavy chain or the light chain in the antibody or fragment thereof according to claim 1; preferably, the nucleic acid molecule comprises a nucleotide sequence as set forth in SEQ ID NO:53, SEQ ID NO:55, SEQ ID NO:57, SEQ ID NO:59, SEQ ID NO:61, SEQ ID NO:63, SEQ ID NO:65 or SEQ ID NO:67.
11. A vector comprising the nucleic acid molecule according to claim 10.
12. A host cell comprising the nucleic acid molecule according to claim 10 and/or a vector comprising the nucleic acid molecule, or transformed or transfected with the nucleic acid molecule and/or the vector.
13. A pharmaceutical composition comprising the antibody or fragment thereof according to claim 1, a conjugate or fusion protein comprising the antibody or fragment thereof, a nucleic acid molecule comprising a nucleotide sequence encoding the heavy chain CDRs, the light CDRs, the heavy chain variable region, the light chain variable region, the heavy chain or the light chain in the antibody or fragment thereof, a vector comprising the nucleic acid molecule and/or a host cell comprising the nucleic acid molecule and/or a vector comprising the nucleic acid molecule, or transformed or transfected with the nucleic acid molecule and/or the vector, and optionally a pharmaceutically acceptable excipient.
14. Use of the antibody or fragment thereof according to claim 1, a conjugate or fusion protein comprising the antibody or fragment thereof, a nucleic acid molecule comprising a nucleotide sequence encoding the heavy chain CDRs, the light CDRs, the heavy chain variable region, the light chain variable region, the heavy chain or the light chain in the antibody or fragment thereof, a vector comprising the nucleic acid molecule, a host cell comprising the nucleic acid molecule and/or the vector, or transformed or transfected with the nucleic acid molecule and/or the vector and/or a pharmaceutical composition comprising the antibody or fragment thereof, the nucleic acid molecule comprising the nucleotide sequence, the vector and/or the host cell, and optionally a pharmaceutically acceptable excipient for manufacturing a medicament for the prevention or treatment of a tumor or cancer.
15. A pharmaceutical combination comprising: (1) the antibody or fragment thereof according to claim 1, a conjugate or fusion protein comprising the antibody or fragment thereof, a nucleic acid molecule comprising a nucleotide sequence encoding the heavy chain CDRs, the light CDRs, the heavy chain variable region, the light chain variable region, the heavy chain or the light chain in the antibody or fragment thereof, a vector comprising the nucleic acid molecule, a host cell comprising the nucleic acid molecule and/or the vector, or transformed or transfected with the nucleic acid molecule and/or the vector and/or a pharmaceutical composition comprising the antibody or fragment thereof, the nucleic acid molecule comprising the nucleotide sequence, the vector and/or the host cell, and optionally a pharmaceutically acceptable excipient; (2) other immunopotentiator or immunopotentiating means, such as a small molecule chemical drug, a targeted agent, a recombinant protein drug such as an antibody, a vaccine, a ADC, an oncolytic viruse, a drug for gene and nucleic acid therapy, and a radiotherapy.
16. A kit comprising the antibody or fragment thereof according to claim 1, a conjugate or fusion protein comprising the antibody or fragment thereof, a nucleic acid molecule comprising a nucleotide sequence encoding the heavy chain CDRs, the light CDRs, the heavy chain variable region, the light chain variable region, the heavy chain or the light chain in the antibody or fragment thereof, a vector comprising the nucleic acid molecule, a host cell comprising the nucleic acid molecule and/or the vector, or transformed or transfected with the nucleic acid molecule and/or the vector and/or a pharmaceutical composition comprising the antibody or fragment thereof, the nucleic acid molecule comprising the nucleotide sequence, the vector and/or the host cell, and optionally a pharmaceutically acceptable excipient.
17. A method of preventing or treating a tumors or cancer, including administrating the antibody or fragment according to claim 1, a conjugate or fusion protein comprising the antibody or fragment thereof, a nucleic acid molecule comprising a nucleotide sequence encoding the heavy chain CDRs, the light CDRs, the heavy chain variable region, the light chain variable region, the heavy chain or the light chain in the antibody or fragment thereof, a vector comprising the nucleic acid molecule, a host cell comprising the nucleic acid molecule and/or the vector, or transformed or transfected with the nucleic acid molecule and/or the vector and/or a pharmaceutical composition comprising the antibody or fragment thereof, the nucleic acid molecule comprising the nucleotide sequence, the vector and/or the host cell, and optionally a pharmaceutically acceptable excipient, and optionally other drug or means to a subject in need thereof.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0060] Embodiments of the present invention are described in detail hereinafter in combination with the accompanying drawings, in which:
[0061]
[0062]
[0063]
[0064]
[0065]
[0066]
[0067]
[0068]
[0069]
[0070]
[0071]
[0072]
[0073]
[0074]
[0075]
[0076]
[0077]
DETAILED DESCRIPTION OF PREFERRED EMBODIMENTS
[0078] The present invention will be further described in detail in combination with the particular embodiments hereinafter. It will be appreciated by those skilled in the art that the embodiments provided are only used to illustrate the present invention, rather than limiting the scope of the present invention in any way.
[0079] Experimental methods in the following Examples are all conventional methods, unless particularly stated. Raw materials and reagents used in the following Examples are all products that commercially available, unless particularly stated.
EXAMPLE 1
Screening and Identification of Hybridoma Cell Strains Producing Anti-Human PD-1 Antibodies and Analysis of Antibody Sequences
[0080] Immunization: two immunization methods employing Freund's adjuvant and water-soluble adjuvant respectively were used for the immunization of mice. In the immunization method employing the Freund's adjuvant, the mice were immunized by intraperitoneal injection of the Freund's adjuvant twice on day 0 and day 14, and in the immunization method employing the water-soluble adjuvant, Balb/c mice aged 8-10 weeks were immunized by intramuscular injection of the water-soluble adjuvant twice on day 0 and day 21. The antigen used for immunization is: recombinant human PD-1/mFc protein (NCBI accession No.: NP_005009.2, 21aa-167aa, Lot: 2016.3.16), which was recombinantly expressed in HEK293 cells and provided by Beijing Kohnoor Science R. Technology Co., Ltd. Dose for the first immunization was 50 μg, and dose for the second immunization was 25 μg. Sera of the mice taken before the immunization were served as negative controls for testing. Blood samples were taken from the tail veins of the mice on day 28 after primary immunization with Freund's adjuvant and on day 35 after primary immunization with water-soluble adjuvant, and then serum titers were measured by ELISA using a 96-well plate coated with recombinant human PD-1 protein. Mice whose serum titer met the requirements for fusion were boosted by intraperitoneal injection of 500 μl of 25 μg antigen diluted with D-PBS. Spleen cells from mice with high serum titers were collected on day 38 after the primary immunization for further cell fusion.
[0081] Cell fusion and preparation of the hybridoma: on day 38 after the primary immunization, blood was collected by enucleating the eyeball of the mouse whose serum titer met the requirements for fusion, then the serum isolated was used as positive control serum for antibody detection. Further, the spleen of the mouse was taken aseptically, a B lymphocyte suspension was prepared and mixed with FO myeloma cells in a ratio of 5:1 and the two kinds of cells were allowed to fuse under the action of PEG4000. The fused cells were resuspended in HAT medium and aliquoted into a 96-well plate containing macrophages. The plate was placed in an incubator at 37° C. and 5% CO.sub.2 for 2 weeks, then the HAT medium therein was replaced with HT medium and the cells were cultured for another two weeks before replacing the HT medium with R1640 complete medium.
[0082] Screening for positive hybtidomas: after 10-14 days of fusion, a plate was coated with recombinant human PD-1/His protein (NCBI accession No.: NP_005009.2, 21aa-167aa, Lot: 2016.2.22) (10 μg/ml, pH 9.6, 0.1 M NaHCO.sub.3) overnight at 4° C., The plate was blocked with 4% skim milk powder-PBS for 2 hours at 37° C., and was washed three times with PBST (0.05% Tween 20-PBS). Afterwards, the supernatants of the cultured hybridioma clones were added into the plate and incubated for 1 hour at 37° C. Following controls were set: (1) positive control: serum of the mouse separated after immunization (diluted with PBS at a dilution of 1:1000); (2) negative control: serum of the mouse separated before immunization (diluted with PBS at a dilution of 1:1000); (3) blank control: PBS. Again the plate was washed three times with PBST (0.05% Tween 20-PBS), and HRP-Goat anti-mouse IgG (Fcγ) with a dilution of 1:20000 was added and incubated for 1 hour at 37° C. Once again, the plate was washed five times with PBST (0.05% Tween 20-PBS), and chromogenic reagent OPD was added for developing color for 10-15 min in dark, then the reaction was terminated by adding 2 M H.sub.2SO.sub.4. Absorbances at 490 nm (A490) were read with a microplate reader. Clones in wells, which had A490 2.1 times greater than that of the negative control well, were regarded as positive ones. In order to determine the reliability of the positive clones, another screening was performed every other day after changing the medium used in the previous screening, and a total of three rounds of screening were performed. After detection and identification, multiple positive cell strains secreting antibodies were obtained and designated as Clones: 6, 317, 500, 763, 795, and 904 (
[0083] A plate was coated with recombinant human PD-1/His protein (NCBI accession No.: NP_005009.2, 21aa-167aa, Lot: 2016.2.22), cynomolgus monkey PD-1 (Cat: 90311-C08H, Sino Biological Inc.), rat PD-1 (Cat: 80448-R08H, Sino Biological Inc.) and mouse PD-1 (Cat: 50124-M08H, Sino Biological Inc.) in a concentration of 1 μg/mL overnight at 4° C., washed three times with PBS subsequently, and 5% BSA-PBS was added for blocking for 60 min at 37° C. The plate was washed three times with PBST afterwards, and supernatants of the hybridiomas diluted 100 times were added and incubated for 60 min at 37° C. Again, the plate was washed four times with PBST, HRP-Goat anti-mouse IgG (Fcγ) (Cat: 115-035-071, Jackson Immuno Research) with a dilution of 1:5000 was added for a 30 min incubation at 37° C. Once again, the plate was washed four times with PBST, and TMB substrate was added for developing color through incubating for 10 min at 37° C., then the reaction was terminated by adding 2 M HCl. With 630 nm as reference wavelength, the absorbance at 450 nm (A450 nm-630 nm) of each well in the plate was read and recorded. Five supernatants of hybridoma cells (corresponding to Clone 317, 500, 763, 795, and 904) were used for detection of cross-reactivity with recombinant PD-1 of different species. Results obtained from ELISA showed that all antibodies in the five supernatants could specifically bind to the recombinant human PD-1 and cynomolgus monkey PD-1, but had no binding to the recombinant rat PD-1 and mouse PD-1, indicating that the antibodies have no cross-reactivity (
[0084] Hybridoma cells of Clone 317 secreting anti-human PD-1 antibody were expanded, and the subtype of the antibody was detected using Mouse Monoclonal Antibody IgG Subclass Test Card (Cat: A12403) and Mouse Monoclonal Antibody Light/Heavy Chain Test Card (Cat: A12401) following the protocols for the reagents. The subtype was identified as follows: the antibody was IgG1 for the heavy chain, and was Kappa for the light chain (
[0085] Total RNA was extracted from the hybridoma cells of Clone 317 using TRIzol (Cat: 15596026, Invitrogen) following the steps described in the instructions. The total RNA of the hybridoma cells was reversely transcribed into cDNA using M-MuLV reverse transcriptase (CAT: M0253S, NEB). The sequences of light chain variable region IgVL (κ) and heavy chain variable region VH of the antibody were amplified using degenerate primers (see Tables 1 and 2) and Phusion kit (Cat: E0553L, NEB). The PCR products were purified with gel extraction kit (Cat: AP-GX-250, Axygen) and the purified PCR products were ligated to T vector following the instructions of the T vector cloning Kit (Cat: ZC205, ZOMANBIO) and then the vector was transformed into competent cells of E. coli for amplification. The plasmid was then extracted for DNA sequencing to obtain the variable region sequences of the monoclonal antibody. The sequencing results show that the light chain variable region of the antibody 317 has a nucleotide sequence as set forth in SEQ ID NO:53, and the amino acid sequence of the light chain variable region of the antibody 317 deduced from the DNA sequence is shown in SEQ ID NO:52; and the heavy chain variable region of the antibody 317 has a nucleotide sequence as set forth in SEQ NO:55, and the amino acid sequence of the heavy chain variable region of the antibody 317 deduced from the DNA sequence is shown in SEQ ID NO:54.
TABLE-US-00006 TABLE 1 Primers f or the PCR of light chain Upstream MKV1 ATGAAGTTGCCTGTTAGGCTGTTGGTGCTG primer (SEQ ID NO: 68) MKV2 ATGGAGWCAGACACACTCCTGYTATGGGTG (SEQ ID NO: 69) MKV3 ATGAGTGTGCTCACTCAGGTCCTGGSGTTG (SEQ ID NO: 70) MKV4 ATGAGGRCCCCTGCTCAGWTTYTTGGMWTC TTG (SEQ ID NO: 71) MKV5 ATGGATTTWCAGGTGCAGATTWTCAGCTTC (SEQ ID NO: 72) MKV6 ATGAGGTKCYYTGYTSAGYTYCTGRGG (SEQ ID NO: 73) MKV7 ATGGGCWTCAAGATGGAGTCACAKWYYCW GG (SEQ ID NO: 74) MKV8 ATGTGGGGAYCTKTTTYCMMITTTTCAAT TG (SEQ ID NO: 75) MKV9 ATGGTRTCCWCASCTCAGTTCCTTG (SEQ ID NO: 76) MKV10 ATGTATATATGTTTGTTGTCTATTTCT (SEQ ID NO: 77) MKVII ATGGAAGCCCCAGCTCAGCTTCTCTTCC (SEQ ID NO: 78) Downstream MCK TCATCAACACTCATTCCTgTTgAAgCTCT primer TgA (SEQ ID NO: 79)
TABLE-US-00007 TABLE 2 Primers for the PCR of heavy chain Upstream MHVI ATGAAATGCAGCTGGGGCATSTTCTTC primer (SEQ ID NO: 80) MHV2 ATGGGATGGAGCTRTATCATSYTCTT (SEQ ID NO: 81) MHV3 ATGAAGWTGTGGTTAAACTGGGTTTTT (SEQ ID NO: 82) MHV4 ATGRACTTTGGGYTCAGCTTGRTTT (SEQ ID NO: 83) MHV5 ATOGACTCCAGGCTCAATTTAGTTTTC CTT (SEQ ID NO: 84) MHV6 ATGGCTTGTCYTRGSGCTRCTCTTCTG C (SEQ ID NO: 85) MHV7 ATGGRATGGAGCKGGRTCTTTMTCTT (SEQ ID NO: 86) MHV8 ATGAGAGTGCTGATTCTTTTGTG (SEQ ID NO: 87) MHV9 ATGGMTTGGGTGTGGAMCTTGCTATTC CTG (SEQ ID NO: 88) MHV10 ATGGGCAGACTTACATTCTCATTCCTG (SEQ ID NO: 89) MHVII ATGGATTTTGGGCTGATTTTTTTTATTG (SEQ ID NO: 90) MHV12 ATGATGGTGTTAAGTCTTCTGTACCTG (SEQ ID NO: 91) Downstream MIgG1CH1 CTAACAATCCCTEEgCACAATTTTCTTg primer TCCACC (SEQ ID NO: 92)
EXAMPLE 2
Preparation of Anti-Human PD-1 Chimeric Antibody
[0086] The light chain variable region gene and heavy chain variable region gene of the monoclonal antibody obtained through cloning, with cleavage sites of restriction enzymes introduced by PCR using the following primers (Table 3), were respectively cloned into the upstream of gene encoding human-kappa light chain constant region and the upstream of gene encoding the human IgG4 heavy chain constant region carried in eukaryotic expression vectors. The obtained human-mouse chimeric light chain expression plasmid (pKN019-317L) and human-mouse chimeric heavy chain expression plasmid (pKN034-317H) were then transformed into E. coli for amplification. A large number of plasmids carrying the human-mouse chimeric light chain and heavy chain were isolated, mixed with 293fectin and co-transfected into HEK293 cells. The cultured supernatant was collected 5-6 days after the transfection and purified with ProA affinity chromatography column, and chimeric antibody 317 was obtained. The affinity of the antibody was determined by the anti-human antibody capture assay with Fortebio (BLITZ pro1.1.0.28). For the determination, anti-Human IgG Fc Capture (AHC) biosensors were soaked in PBS for 10 min. 4 μl diluted antibody samples (chimeric antibody 317, Nivolumab; 20 μg/mL) were loaded onto two AHC biosensors respectively which were then equilibrated in PBS for 30 s. Subsequently, the AHC biosensors were reacted with the diluted recombinant human PD-1-His protein (NCBI accession No.: NP_005009.2, 21aa-167aa, Lot: 2016.2.22) of different concentrations (1 μM, 0.6 μM and 0 nM) for binding for 45 s, and was then transferred into PBS for dissociating for 120 s. When the experiment was finished, data from which response values of blank controls had been deducted was fitted using a 1:1 Langmuir binding model by software, and then kinetic constants for antigen-antibody binding were calculated.
[0087]
TABLE-US-00008 TABLE 3 primers for cloning the light chain and the heavy chain variable regions of the antibody 317 Primers Upstream hM-hl5 CTCAAGCTTAATTGCCGCC for primer ACCATG cloning (SEQ ID NO: 93) the SP-317L-F CCTGGAGCCATCGGAG light ACATTGTGATGACC chain (SEQ ID NO: 94) variable Downstream SP-317L-R GGTCATCACAAT region primer GTCTCCGATGGC TCCAGG (SEQ ID NO: 95) 317L-R GCTGGCGCCGCATC AGCCCGTTTGATTTC (SEQ ID NO: 96) Primers Upstream hM-hl5 CTCAAGCTTAATTG for primer CCGCCACCATG cloning (SEQ ID NO: 97) the SP-317H-F GAAGGGCGTGCAGT heavy GCGAAGTGAAG chain CTGGTG variable (SEQ ID NO: 98) region Downstream SP-317H-R CACCAGCTTCACTTCG primer CACTGCACGCCCTTC (SEQ ID NO: 99) 317H-R GCGCTAGCTGCAGAG ACAGTGACCA GAG (SEQ ID NO: 100)
TABLE-US-00009 TABLE 4 Detection results of the affinity of the chimeric antibody to the recombinant human PD-1 extracellular domain protein KD (M) kon (1/Ms) kd (1/s) 317 2.64E−09 2.15E+05 5.66E−04 Nivolumab 2.018E−09 3E+05 6.05E−04
EXAMPLE 3
Humanization of the Anti-Human PD-1 Monoclonal Antibody and Construction of a Stable Cell Strain
[0088] Firstly, a comprehensive analysis was conducted on the heavy chain sequence of the mouse antibody for determining the antigen complementary determinant regions (CDRs) in the antibody that bind with the antigen and the framework regions supporting the conserved three-dimensional conformation of the antibody. The closest human antibody matches were sought in human antibody germline library (http://www2.mrc-lmb.cam.ac.uk/vbase/alignments2.php#VHEX) according to results of homologous comparison. VH3 (3-21) was finally selected as the basic template, and CDR grafting was performed with considering the frequency of amino acid at specific position of FR region (A49) in the rearranged antibody in combination with blast results of complete sequence. Furthermore, S98 in the FR3 of the mouse antibody was not replaced since it was close to the CDR3 region. Meanwhile, JH4 (wgqgtlvtvss) was selected as the sequence for J region according to the sequence of CDR3 (Pdssgvay). As a result, a high humanization of the frame region in H1 was achieved. In addition, the closest human antibody matches were sought in human antibody germline library (http://www2.mrc-lmb.cam.ac.uk/vbase/alignments2.php#VHEX) according to results of homologous comparison. VK II (A19) was finally selected as the basic template , and CDR grafting was performed with considering the frequency of amino acid at specific position of FR region (R45) in the rearranged antibody in combination with blast results of complete sequence. Meanwhile, JK1 (fgqgtkveik) was selected as the sequence for JK region according to the sequence of CDR3 (Qqysrypw). Thus, the fully humanization of light chain frame region was achieved.
[0089] Fully humanized design was made on the sequence of murine origin antibody 317 and the obtained humanized sequence was fully synthesized, and the antibody obtained by the humanization of the antibody 317 was named h317. Further, expression vectors expressing the light chain and the heavy chain of the h317 were constructed by cloning the humanized h317-VH1 into upstream of gene encoding heavy chain constant region of human IgG4 carried in the eukaryotic expression vector pKN034 through enzyme digestion, and cloning the humanized h317-VL2 into upstream of gene encoding Cκ of human light chain carried in the eukaryotic expression vector pKN019 through enzyme digestion. Subsequently, through enzyme digestion, the obtained heavy chain of h317 (h317-H) and light chain of h317 (h317-L) were cloned into the eukaryotic expression vector pKN002. The recombinant vectors were then linearized with Pvu I, and genes of h317 were integrated into the DNA of CHO cells using Nucleofector 2B (300452, Lonza). The CHO cells were screened by MSX (Cat: M5379-500MG, Sigma) and subcloned before finally obtaining a stable cell strain highly expressing h317. The nucleotide sequence of the light chain variable region of h317 is as set forth in SEQ ID NO:61, and the amino acid sequence thereof is as set forth in SEQ ID NO:60 the nucleotide sequence of the heavy chain variable region of h317 is as set forth in SEQ ID NO:63, and the amino acid sequence thereof is as set forth in SEQ ID NO:62.
EXAMPLE 4
Kinetic Research on Binding of h317 to Human PD-1 Protein
[0090] Biotinylation of h317 and Nivolumab: 200 μL of 5 mg/ml EZ-LinkNHS-LC-LC-Biotin (Cat: 21343, Thermo) was placed at RT for 5 min and then mixed with 1 ml of 1 mg/mL h317 (Lot: DP201805002, Jiangsu T-mab BioPhaima) or Nivolumab (Lot: AAW4553, BMS). The obtained mixture was placed at RT for 30 min, and then was concentrated by ultrafiltration to 0.5 mL. After determined at 280 nm for the protein content therein, the protein concentrate was aliquoted, and stored at −80° C., with frozen and thawed not more than once.
[0091] Determination of the binding kinetics: the affinity of the antibody was determined with Octet QKe system from Fortebio using an assay of capturing biotin-labeled antibody with streptavidin. Specifically, the biotin-labeled antibodies (h317-biotin, and Nivolumab-biotin) were diluted to 5 μg/mL with PBS, and passed through the surface of streptavidin pre-coated biosensors (Cat: 1612101, PALL) for 120 s. The recombinant human PD-1 protein (NCBI accession No.: NP_005009.2, 21aa-167aa) as the mobile phase was diluted in PBS serially to get two-fold serial dilutions, covering a concentration range of 100 nM-12.5 nM. Both the binding and dissociating were conducted for 300 s. When the experiment was finished, data from which response values of blank controls had been deducted was fitted using a 1:1 Langmuir binding model by software, and then kinetic constants for antigen-antibody binding were calculated.
[0092]
TABLE-US-00010 TABLE 5 Detection results of the affinity of the h317 to the recombinant human PD-1 extracellular domain protein KD (M) kon (1/Ms) kd (1/s) h317 6.16E−09 1.54E+05 9.50E−04 Nivolumab 8.06E−09 2.09E+05 1.69E−03
EXAMPLE 5
Detection of Inhibitory Effect of h317 on Binding of PD-1 to its Ligands PD-L1 and PD-L2 in ELISA
[0093] Detection of inhibitory effect of h317 on binding of PD-1 to PD-L1 in ELISA: a plate was coated with human PD-1-hFc (NCBI accession No.: NP_005009.2, 21aa-167aa, Lot: 20180329) having a dilution concentration of 0.5 μg/mL overnight at 4° C., and was then blocked with 5% BSA in a constant temperature incubator at 37° C. for 60 min. h317 (Lot: DP201805002, Jiangsu T-mab BioPharma) or Nivolumab (Lot: AAW4553, BMS) (1.5-fold serial dilutions with an initial concentration of 3 μg/mL) was subsequently added for reacting in the constant temperature incubator at 37° C. for 120 min. 1 μg/mL PD-L1-mFc (NCBI accession No.: NP_054862.1, 19aa-238aa, Lot: 20180412) was added to the plate for incubating with the antibodies in the constant temperature incubator at 37° C. for 60 min. Afterwards, HRP-anti-mouse Fc (Cat: 115-035-071, Jackson Immuno Research) which was diluted at a dilution of 1:5000 was added to the plate for reacting for 45 min. Later, TMB substrate (Cat: ME142, Beijing Taitianhe Biotech Co., Ltd.) was added to develop color for 15 min, which was followed by the addition of 2 M HCl to terminate the reaction and then the plate was detected by a microplate reader. With 630 nm as reference wavelength, the absorbance at 450 nm (A450 nm-630 nm) of each well in the plate was read and recorded.
[0094] Detection of inhibitory effect of h317 on binding of PD-1 to PD-L2 in ELISA: a plate was coated with PD-1-hFc (NCBI accession No.: NP_005009.2, 21aa-167aa, Lot: 20180329) having a dilution concentration of 0.5 μg/mL overnight at 4° C., and was then blocked with 5% BSA in a constant temperature incubator at 37° C. for 60 min. h317 (Lot: :DP201805002, Jiangsu T-nab BioPharma) or Nivolumab (Lot: AAW4553, BMS) (1.5-fold serial dilutions with an initial concentration of 3 μg/mL) was subsequently added for reacting in the constant temperature incubator at 37° C. for 120 min. 2 μg/mL PD-L2-hFc-Biotin (NCBI accession No.: NP_079515.2, 20aa-220aa, Lot: 2016.12.05) was added to the plate for incubating with the antibodies in the constant temperature incubator at 37° C. for 60 min. Afterwards, HRP-streptavidin (Cat: 52438, Sigma) which was diluted at a dilution of 1:2000 was added to the plate for reacting for 30 min. Later, TMB substrate was added to develop color for 15 min, which was followed by the addition of 2 M HCl to terminate the reaction and then the plate was detected by a microplate reader. With 630 nm as reference wavelength, the absorbance at 450 nm (A450 nm-630 nm) of each well in the plate was read and recorded.
[0095] The results showed that h317 could block the binding between the recombinant human PD-1 and its ligands PD-L1 and PD-L2 effectively. The competitive inhibitory effects of h317 and Nivolumab on the binding of PD-1 to its ligand PD-L1 were determined by ELISA, and the obtained half maximal inhibitory concentrations (IC50) were 1.4 nM and 1.3 nM respectively (
EXAMPLE 6
Research on Species-Specificity of Binding of h317 to PD-1 by ELISA
[0096] ELISA plates were coated with recombinant human PD-1 (NCBI accession No.: NP_005009.2, 21aa-167aa, Lot: 20180423), cynomolgus monkey PD-1 (Cat: 90311-C08H, Sino Biological Inc.), rat PD-1 (Cat: 80448-R08H, Sino Biological Inc.) and mouse PD-1 (Cat: 50124-M08H, Sino Biological Inc.) proteins in a concentration of 1 μg/mL respectively overnight at 4° C. The plates were washed three times with PBS subsequently, and 5% BSA-PBS was added for blocking for 60 min at 37° C. Then the plates were washed three times with PBST, and biotinylated h317 (the same as that used in Example 4) with different dilutions (11 concentrations were obtained by diluting serially in a 3-fold gradient dilution with an initial concentration of 1 μg/mL) was added and incubated for 60 min at 37° C. Again, the plates were washed four times with PBST, then HRP-streptavidin (Cat: 019-035-098, Jackson immuno Research) with a dilution of 1:100 was added for a 30 min incubation at 37° C. Once again, the plates were washed four times with PBST, and TMB substrate was added for developing color through incubating for 10 min at 37° C., then the reaction was terminated by adding 2 M HCl. With 630 nm as reference wavelength, the absorbance at a wavelength of 450 nm (A450 nm-630 nm) of each well in the plates was read and recorded.
[0097] The results showed that h317 could specifically bind to recombinant human PD-1 and cynomolgus monkey PD-1 in a half maximal effective concentration (EC50) of 0.004703 nM and 0.01823 nM respectively, while had no binding affinity to rat PD-1 and mouse PD-1, indicating that h317 has no cross-reactivity (
EXAMPLE 7
Research on Specificity of Binding of h317 to Members of the CD28 Family
[0098] ELISA plates were coated with recombinant human PD-1 (NCBI accession No.: NP_005009.2, 21aa-167aa, Lot: 20180423), CD28 (Cat: 11524-HCCH, Sino Biological Inc.), CTLA4 (Cat: 11159-H08H, Sino Biological Inc.) and ICOS (NCBI accession No.: NP_036224.1, 1aa-199aa) proteins in a concentration of 1 μg/mL respectively overnight at 4° C. The plates were washed three times with PBS subsequently, and 5% BSA-PBS was added for blocking for 60 min at 37° C. Then the plates were washed three times with PBST, and biotinylated h317 (the same as that used in Example 4) with different dilutions (11 concentrations were obtained by diluting in a 3-fold gradient dilution with an initial concentration of 1μg/mL) was added and incubated for 60 min at 37° C. Again, the plates were washed four times with PBST, then HRP-streptavidin (Cat: 019-035-098, Jackson Immuno Research) with a dilution of 1:100 was added for a 30 min incubation at 37° C. Once again, the plates were washed four times with PBST, and TMB substrate was added for developing color through incubating for 10 min at 37° C., then the reaction was terminated by adding 2 M HCl. With 630 nm as reference wavelength, the absorbance at a wavelength of 450 nm (A450 nm-630 nm) of each well in the plates was read and recorded.
[0099] The results showed that h317 could specifically bind to recombinant human PD-1, while had no binding affinity to other members of the CD28 family, indicating that h317 has no cross-reactivity (
EXAMPLE 8
Research on Activity of h317 in Stimulating Human T Cells (PBMCs) In Vitro
[0100] A. Isolation of CD14+ Monocytes and Differentiation of Dendritic Cells
[0101] PBMCs were extracted using Ficoll-Paque PLUS (Cat: 17-1440-03, Lot: 10246684, GE Healthcare) following the manufacturer's instructions and then CD14+ monocytes were positively selected with CD14 MicroBeads (Cat: 130-050-201, Lot: 5170814438, Miltenyi) following the manufacturer's instructions. The obtained cells were resuspended to 5×10.sup.5 cells/ml with ImmunoCult™ DC Differentiation Medium (Cat: 10988, Lot: 17G83035, STEMCELL), and then 5 ml suspension was taken and inoculated into a T-25 flask, and cultured in an incubator at 37° C., 5% CO.sub.2 for 3 days. The culture was centrifuged and new medium was added for a 2 day culture in the incubator at 37° C., 5% CO.sub.2. Then 50 μl ImmunoCult™ Dendritic Cell Maturation Supplement (Cat: 10989, Lot: 17B77271, STEMCELL) was added, mixed and the cells were cultured in the incubator at 37° C., 5% CO.sub.2 for 2 days. Cells obtained were used for the following MLR assay.
[0102] B. Extraction and Isolation of CD4+ T Cells
[0103] PBMCs were extracted using Ficoll-Paque PLUS (Cat: 17-1440-03, Lot: 10246684, GE Healthcare) following the manufacturer's instructions, and then CD4+ T cells were isolated from the PBMCs using CD4+ T cells isolation kit (Cat: 130-096-533, Lot: 5171016623, Miltenyi) according to the instructions in the kit. Cells obtained were used for the following MLR assay.
[0104] C. MLR Assay
[0105] Solutions of the antibodies (h317 (Lot: DP201805002, Jiangsu T-mab BioPharma)), Nivolumab (Lot: AAW4553, BMS), and Human NC-IgG4 control (Lot: AB170090) to be tested at 8 μg/mL were prepared respectively with a Complete Medium, and then were diluted serially in a 10-fold gradient dilution and a total of 6 concentrations were prepared. Later, 50 μl of each of the solutions containing the antibodies was added to corresponding wells of a 96-well plate according to the setup for the plate used in the experiment. Subsequently, 100 μL suspension of CD4+ T cells with an adjusted concentration of 1×10.sup.6 cells/mL was added to the corresponding wells (1×10.sup.5 cells/well). DCs were digested with 2 mM EDTA, centrifuged at 1500 rpm for 5 min, and 50 μL suspension of the DCs with an adjusted concentration of 2×10.sup.5 cells/mL was added to the corresponding wells (1×10.sup.4 cells/well). Then, the total volume of the mixture in one well was 200 μL, and the ratio of CD4+ T cells to DCs was 10:1. Then the 96-well plate was placed in an incubator for culturing for 5 days at 37° C. Cell supernatants obtained thereby were collected and concentrations of IFN-γ and IL-2 therein were detected using IFN-γ ELISA kit (Cat: 430106, Lot: 8247782, Biolegend) and IL-2 ELISA kit (Cat: DY202, Lot: P155804, R&D).
[0106] The detection results showed that h317 could stimulate human mixed lymphocytes and promote the cells to secret killer cytokines IL-2 (
EXAMPLE 9
Research on the ADCC Activity of h317 on 293T/hPD-1 Cells
[0107] PBMCs were extracted using Ficoll-Paque PLUS (Cat: 17-1440-03, Lot: 10246684, GE Healthcare) following the manufacturer's instructions, and then resuspended in a medium for ADCC assay (phenol-red-free RPMI 1640 medium (Cat: 11835-030, Lot: 1860152, Gibco) containing 2% FBS (Cat: SH30084.03, Lot: GAE0138, Hyclone)). PBMCs obtained were counted, and NK cells, which were subsequently used in the analysis of ADCC, were isolated according to the instructions of the NK Cell Isolation Kit (Cat: 130-092-657, Lot: 5170911524, Miltenyi). 293T cells expressing human PD-1 at the exponential phase were taken, and according to CytoTox 96® Non-Radioactive Cytotoxicity Assay (Cat: G1781, Lot: 0000265175, Promega), the 293T cells were then diluted with the medium for ADCC to obtain a cell suspension containing the target cells in a concentration of 50×10.sup.4 cells/mL. For each well in a 96-well round bottom plate, 40 μL of the cell suspension and 10 μL of solutions of antibodies to be tested (each concentration of the antibodies to be tested was assayed in triplicate) were added and then incubated at room temperature for 30 min. Final concentrations of the antibodies to be tested (h317 (Lot: DP201805002, Jiangsu T-mab BioPharma), h317-hIgG1 (Lot: 20180528), and Human NC-IgG4 (Lot: 20180521)) were 10000 ng/mL, 1000 ng/mL, 100 ng/mL, 10 ng/mL, 1 ng/mL, 0.1 ng/mL and 0.01 ng/mL. Further, two E:T ratios of 10:1 and 5:1 were set by adding 50 μL of NK cell suspensions in different concentrations to each well. Later, the 96-well plate was centrifuged at 250 g for 4 min to allow a sufficient contact between the effector cells and the target cells before incubating the cells for 4 h at 37° C., 5% CO.sub.2/95% air. 10 μL lysis buffer (10 μl per 100 μl) was added to the max lysis control well 45 min, before the plate was centrifuged at 250 g for 5 min and supernatants were transferred. Supernatants of 50 μl from the wells were transferred to a clean 96-well plate, and to each well 50 μl reaction substrate was added, mixed for 30 s and the plate was incubated at room temperature for 30 min. Following, 50 μL termination solution was added to the plate and mixed for 30 s. Absorbances (OD490 nm) were read.
[0108] The average value of the control wells containing the culture medium was subtracted from that of the test wells, that of the control wells containing target cells, and that of the wells containing NK cells and target cells. % cytotoxiticy was calculated using values obtained according to the following formula.
[0109] Experimental results showed that the killing effect of NK cells in human PBMCs (peripheral blood mononuclear cells) on target cells was not initiated by the binding of h317 to hPD-1 on 293T cells (
EXAMPLE 10
Evaluation of Anti-Tumor Efficacy of h317 in PD-1 Transgenic Mouse Xenograft Tumor Model
[0110] A total of 65 HuGEMMPD-1 mice (aged 6-8 weeks, Shanghai Model organisms) were selected and inoculated subcutaneously with MC38-hPD-L1 tumor cells (1×10.sup.6 cells/mouse, 1×10.sup.6 cells resuspended in 100 μL PBS) on the right side. When the average tumor volume of the tumor-bearing mice reached about 60-100 mm.sup.3, each mouse was weighted, and the tumor volume was measured with a vernier caliper. The mice were randomly divided into 6 groups using StudyDirector™ (version 3.1.399.19, supplied by Studylog System, Inc., S. San Francisco, Calif., USA) before administration. The administration was started at day 0 (D0), and Table 6 showed the information about number of animals in each group as well as the routes, doses and protocols of the administration in detail. The administration, measurement of the tumor volume, weighting and the like were all performed in a biosafety cabinet or clean bench. During the experiment, experimental data was collected with the software StudyDirector™ (version 3.1.399.19, supplied by Studylog System, Inc.), including measuring the long and short diameters of tumors as well as weighting the mice, and initial data was directly imported into the software after obtained by measuring using a balance and a vernier caliper. The experiment was terminated when the mean volume of the tumors in the control group exceeded 2000 mm.sup.3 or one week after the last administration. The tumors were collected, weighted and taken pictures. FACS assay was performed using tumors sampled on the day the experiment ended, from 4 mice of each group (the mice had numbers corresponding to those of the mice whose blood was sampled below), and markers were: CD3, CD4, CD8, and CD45, Live/Dead. Another FACS assay was performed using whole blood sampled on the day the experiment ended, from 4 mice of each group (the mice had numbers corresponding to those of the mice whose tumors were sampled), and markers were: CD3, CD4, CD8, and CD45.
TABLE-US-00011 TABLE 6 Design for the pharmacodynamics experiment Adminis- Adminis- Number Drug Dose tration tration Group of mice administrated (mg/kg) route cycle 1 8 hIgG control 10 i.p. BIW × 3 weeks 2 8 h317-H 10 i.p. BIW × 3 weeks 3 8 h317-M 2 i.p. BIW × 3 weeks 4 8 h317-L 0.5 i.p. BIW × 3 weeks 5 8 Nivolumab-L 2 i.p. BIW × 3 weeks 6 6-8 Nivolumab-H 10 i.p. BIW × 3 weeks (TBD) Note: volume for administration was 10 μL/g; hIgG control (Lot: 20180521), h317 (Lot: DP201805002, Jiangsu T-mab BioPharma), Nivolumab (Lot: AAW4553, BMS).
[0111] HuGEMMPD-1 mouse model, which is a kind of genetically engineered mouse, is established by insetting the coding region of human PD-1 protein into the ATG position in the mouse PD-1 under the genetic background of C57BL/6J, such that the mouse expresses human PD-1 instead of mouse PD-1. MC38 is a murine intestinal cancer cell line induced in C57BL/6 mouse. MC38 cell line expressing human PD-L1, named as MC38-hPD-L1 cell line, is obtained by knocking out the murine PD-L1 of the MC38 and knocking in the human PD-L1 using genetic engineering. With the PD-1 transgenic mouse xenograft tumor model, the inhibitory effects of h317 and control antibody Nivolumab on tumor growth were evaluated and compared. The results (see
TABLE-US-00012 TABLE 7 Tumor volume and statistical analysis thereof of subcutaneous xenograft tumors in PD-1 transgenic mice of each group D0 D11 tumor tumor T/C volume volume (RTV) TGI P Number Treatment (mm.sup.3) .sup.a (mm.sup.3) .sup.a % (%) Value.sup.b 1 hIgG control, 10 mg/kg 68.21 ± 9.16 2600.18 ± 178.98 — — — BIW*4 times, i.p. 2 h317-H, 10 mg/kg, 67.90 ± 8.74 76.84 ± 33.94 2.96 97.04 <0.001 BIW*4 times, i.p. 3 h317-M, 2 mg/kg, 68.09 ± 8.40 354.89 ± 157.70 11.25 88.75 <0.001 BIW*4 times, i.p. 4 h317-L, 0.5 mg/kg, 67.51 ± 7.62 2581.85 ± 230.58 101.60 −1.60 1.000 BIW*4 times, i.p. 5 Nivolumab-L, 2 mg/kg, 67.17 ± 8.05 594.63 ± 212.98 23.72 76.28 <0.001 BIW*4 times, i.p. 6 Nivolumab-H,10 mg/kg, 67.75 ± 7.83 84.82 ± 66.02 2.31 97.69 <0.001 BIW*4 times, i.p. Note: .sup.a the data was shown as “mean ± standard error”; n = 8 .sup.bP value was obtained by using one way ANOVA of tumor volume, and F value analyzed by Dunnett’s T3 was significantly different (P < 0.05).
EXAMPLE 11
Binding to PD-1 Receptor and Internalization of h317
[0112] Construction of 293 cell line transiently expressing human PD-1: 10 ml of HEK293 cell suspension was inoculated into a shaking flask at a density of 6*10.sup.5 cells/mL, and at 37° C., 5% CO.sub.2, shaken and cultured in a shaking incubator at 130 rpm for 24 h. An expression plasmid encoding full-length human PD-1 (NP_005009.2, 21aa-288aa) and 293fectin (Cat:12347019, Gibco) in a ratio of 1:1.2 were respectively let stand in 0.5 mL Opti-MEM (Cat: 11058021, Gibco) for 5 min, then mixed and let stand for 15 min at room temperature before added to the HEK293 cells. After a 48 h shaking culture at 130 rpm in a shaking incubator at 37° C., 5% CO.sub.2, the obtained 293/hPD-1 cells were used for detection via FACS.
[0113] Endocytosis of the h317 mediated by PD-1: h317 (Lot: DP201805002, Jiangsu T-mab BioPharma) and Nivolumab (Lot: AAW4553, BMS) were labeled with Mix-n-Stain™ CF™ 488A (Cat: MX488AS100, Sigma); and the labeled antibodies (h317-CF488A and Nivolumab-CF488A) were diluted to 10 μg/mL with 5% BSA. The 293/hPD-1 cells were washed one time with PBS, and then the diluted h317-CF488A and Nivolumab-CF488A were added thereto respectively. Each mixture was divided into two groups, one was placed in an electro-heating standing-temperature cultivator at 37° C. and the other was placed in a refrigerator at 4° C. as a negative control. The cells were washed three times with PBS after 1 h incubation, and placed back for incubation at 37° C. or 4° C. The cells were observed and taken pictures with a fluorescence microscope after incubation for 3 hand incubation for 6 h.
[0114] Endocytosis of the h317 mediated by PD-1 was observed with a fluorescence microscope and the results (
EXAMPLE 12
Study on Epitopes Recognized by 317
[0115] Preparation of PD-1-h317-Fab complex: Molecular weight of the recombinant human PD-1 extracellular domain protein (NCBI accession No.: NP_005009.2, 21.aa-167aa, Lot: 20170626) is 16.4 Kd, and molecular weight of h317-Fab (Lot: 20170626) is about 46.5 Kd. A mixture was obtained by mixing the PD1 and h317-Fab in 20 mM Tris 150 mM NaCl at a molar ratio of 1:1.5, and was then placed on ice for 30 min to form a complex. The complex was concentrated by ultrafiltration to a concentration of 12 mg/ml for crystallization analysis.
[0116] Crystallization of PD-1-h317-Fab complex and diffraction data collection and structure analysis of the obtained crystals: this experiment was accomplished by the sitting drop method using Automated Crystallization Screening System. 0.2 μl protein sample was added to each well of the crystallization plate equipped in the system, and when the addition was completed, the crystallization plate was sealed and placed in a constant temperature chamber for culture. The temperature for crystal growth was 16° C. or 4° C., and the protein concentration added was 8 mg/ml or 12 mg/ml. Kits used for the screening included: Crystalscreen (1-98), Index (1-96), PEGRX (1-96), SaltRx (1-96), Nartrix (1-96), and PEG/ion (1-96) supplied by HAMPTON; Protein Complex Suite (1-96) supplied by QIAGEN; WIZARD I/II (1-96), and WIZARD III/IV (1-96) supplied by Emerald Biosystems. Crystal growth was observed for 15 days and the growth conditions under which better crystals formed in a preliminary screening were optimized. Before the diffraction experiment, crystals obtained under the optimized conditions were immersed in a crystallization solution supplemented with 10% ethylene glycol for a few seconds, then immersed in liquid nitrogen for a quick freezing. The diffraction experiment was performed at BL17U in Shanghai Synchrotron Radiation Facility (SSRF) using a X-ray wavelength of 0.9792 Å and a crystal diffraction temperature of 100 K. Diffraction data was collected using Q315r detector supplied by ADSC, and was then processed using HKL2000 software. The crystals were determined belonging to P2 space group, and diffracted to a resolution of 2.90 Å. Crystal structure was analyzed through molecular replacement method using PHASER software, and the models used for the molecular replacement were PD-1 single protein structure (PDB ID 3RRQ) and PD-1 Fab (PDB ID 5WT9) structure. Subsequently, COOT software was used to rebuild the model, and Refmac5 and Phenix softwares were used for structure refinement.
[0117] Binding between deglycosylated recombinant human PD-1 protein and h317: Four glycosylation sites N49, N58, N116, and N74, which can be observed in the structure of human PD-1 antigen (NP_005009.2), were mutated to alanine (A) by site-directed mutation. The mutants obtained were inserted into an expression vector carrying EGFP to construct five plasmids expressing full-length human PD-1 (WT, N49A, N58A., N116A, N74A). Later, the plasmids were mixed with 293fectin and co-transfected into HEK293 cells. 2 days after the transfection, the cells were collected to a 96-well plate, centrifuged at 1500 rpm for 2 minutes, and the supernatants in the wells were discarded. The cells were resuspended by adding 200 μl PBS and the suspensions obtained were then centrifuged at 1500 rpm for 2 minutes, then supernatants were discarded, 200 μl of each primary antibody (h317 (Lot: 2017.05.24) or Nivolumab (Lot: 2017.04.26)) diluted with 5% BSA was added to the cells to incubate for 1 h at room temperature. The working concentration of the primary antibodies was 2 μg/ml, and cells without primary antibodies added were used as negative controls. The mixtures obtained were centrifuged at 1500 rpm for 2 minutes, and supernatants were discarded. The cells in each well were resuspended by adding 200 μl PBS and the suspensions obtained were then centrifuged at 1500 rpm for 2 minutes, then supernatants were discarded. Later, the obtained cells were incubated with 200 μl goat anti-human IgG(Fc)-Cy5 (Cat: 12136, Lot: 017M4800V, Sigma) diluted with 5% BSA added into each well for 1 h at room temperature, then centrifuged at 1500 rpm for 2 minutes, and supernatants were discarded. The cells were resuspended by adding 200 μl PBS and the suspensions obtained were then centrifuged at 1500 rpm for 2 minutes, then supernatants were discarded. The cells again were resuspended by adding 200 μl PBS thereto and detected by flow cytometry (B49007AD, SNAW31211).
[0118] The overall structure analysis of the PD-1-h317-Fab complex showed that the PD-1 antigen (extracellular region 1-167aa) existed as a monomer, and formed a complex with the h317-Fab fragment of the anti-PD-1 antibody in a ratio of 1:1 (
TABLE-US-00013 TABLE 8 amino acids involved in the interactions between PD-1 and Fab317 PD-1 Heavy chain Light chain Region Residue Region Residue Region Residue Interaction BC loop T59 CDR2 Y57 Hydrogen bond S60 CDR2 Y57 Van der Waals interaction E61 CDR1 D33 Hydrogen bond (via water) CDR2 S52 Hydrogen bond CDR2 G53 Hydrogen bond (via water) CDR2 G54 Hydrogen bond CDR2 G55 Hydrogen bond CDR2 S56 Hydrogen bond S62 CDR1 D33 Hydrogen bond V64 CDR3 S101 Van der Waals interaction C'D loop F82 CDR1 S31 Van der Waals interaction P83 CDR1 S31 Van der Waals interaction CDR1 Y32 Van der Waals interaction E84 CDR1 Y32 Hydrogen bond R86 N-ter V2 Hydrophobic interaction CDR1 F27 Van der Waals interaction CDR1 Y32 Van der Waals interaction CDR3 S98 Hydrogen bond CDR3 D100 Salt bridge CDR3 YI06 Hydrophobic interaction S87 CDR3 Y106 Van der Waals interaction CDR2 H55 Van der Waals interaction CDR2 T56 Van der Waals interaction Q88 CDR2 T56 Van der Waals interaction FG loop I126 CDR3 S101 Van der Waals interaction CDR2 W50 Hydrophobic interaction L128 CDR1 D33 Van der Waals interaction CDR3 D100 Van der Waals interaction CDR3 S101 Van der Waals interaction CDR3 Y91 Hydrophobic interaction CDR3 Y94 Van der Waals interaction CDR3 W96 Van der Waals interaction A129 CDR2 Y59 Hydrophobic interaction CDR3 Y94 Hydrophobic interaction P130 CDR2 Y59 Hydrophobic interaction CDR3 R93 Van der Waals interaction CDR3 Y94 Hydrophobic interaction K131 CDR1 E30 Salt bridge CDR3 S92 Van der Waals interaction CDR3 R93 Hydrogen bond A132 CDR1 E30 Van der Waals interaction CDR1 V32 Hydrophobic interaction CDR3 Y91 Van der Waals interaction CDR3 S92 Hydrogen bond I134 CDR2 W50 Hydrophobic interaction
[0119] In addition, glycosylation at sites N49, N58, and N116 could be observed in the structure of PD-1 antigen, while the glycosylation at site N74 was not clear. Further, the involvement of the carbohydrate chain at N58 in the binding to h317-Fab could also be observed (
EXAMPLE 13
Site-Directed Mutation in Light Chain CDRs and Heavy Chain CDRs of h317
[0120] 1. Mutants of light chain CDRs and heavy chain CDRs were constructed according to the structure analysis of the PD-1-h317Fab complex. Expression vectors were constructed using site-directed mutation method. See Ronghao Wang, Runchuan Chen, and Runzhong Liu, Journal of Xiamen University (Natural Science) 2008, Vol 47, sup 2, 282-285, for details.
[0121] Methods for expression and purification of the variant antibodies were the same as above.
[0122] 2. Comparison of Relative Affinity of the Variant Antibodies
[0123] The comparison of affinity between the variant antibodies and the parent antibody was performed using Octet QKe system supplied by Fortebio. The method used was similar to that used in Example 4, except that the affinity was measured via only single antigen concentration binding for all variant antibodies to assess their relative affinities. Firstly, the antibodies to be tested at the same target value were coated, and the relative affinities were determined using 100 nM recombinant human PD-1 protein (NCBI accession No.: NP_005009.2, 21aa-167aa) as the mobile phase.
[0124] The detection results of the affinities of the variant antibodies showed that the affinities of the variant antibodies having various mutations changed significantly. Table 9 shows the mutations and Table 10 shows certain affinity changes.
TABLE-US-00014 TABLE 9 Amino acid sequences of CDRs 317 variant antibodies LCDR1 LCDR2 LCDR3 X1ASQDVX2TX3VA X1ASTRX2X3 QQX1X2X3X4PX5 X1 = K or R X1 = A or G or W X1 = A or F or Y X2 = E or S X2 = A or H or Q X2 = D or N or S X3 = A or V or Y X3 = S or T X3 R or N or S X4 F or Y X5 = G or W or Y HCDR1 HCDR2 HCDR3 X1X2X3MS TIX1X2X3X4X5 PX1X2SGVAX3 X1 = D or S X6TX7YPDSVKG X1 = D or E or Y X2 = A or N or Y X1 = K or S or W X2 = A or S X3 = D or S or Y X2 = G or S or Y X3 = T or Y X3 = D or G or S X4 = G or S X5 = G or S X7 = A or T or Y
TABLE-US-00015 TABLE 10 MUT KD(M) LCDR1: KASQDVETVVA K24R 1.02E−09 E30S 1.42E−08 V32A 6.21E−09 V32Y 9.81E−09 LCDR2: WASTRHT W50A 1.23E−08 W50G 6.14E−08 H55A 1.72E−07 H55Q 1 42E−08 T56S 3.02E−09 LCDR3: QQYSRYPW Y91A 5.12E−08 Y91F 4.76E−08 S92D 7.52E−09 S92N 3.49E−09 R93N 3.64E−08 R93S 7.94E−09 Y94F 6.81E−09 W96G 1.53E−08 W96Y 4.12E−07 Combined mutation of LCDR 24R(CDR1) 3.23E−09 56(2) 24R(CDR1) 4.17E−09 92N(CDR3) 24R(CDR1) 5.32E−09 94F(CDR3) 56S(CDR2) 3.98E−09 92N(CDR3) 24R(CDR1) 2.91E−09 56S(CDR2) 92N(CDR3) HCDR1: SYDMS S31D 5.12E−09 Y32A 6.83E−09 Y32N 1.81E−08 D33S 2.89E−09 D33Y 2.36E−07 HCDR2: TISGGGSYTYYPDSVKG S52K 2.72E−08 S52W 3.94E−08 G53S 5.53E−09 G53Y 1.03E−08 G54D 2.93E−08 G54S 1.32E−09 G55S 9.09E−09 S56G 1.48E−07 Y57T 6.12E−08 Y59A 3.29E−09 Y59T 1.89E−08 HCDR3: PDSSGVAY D100E 7.44E−08 D100Y 8.23E−09 S101A 1.63E−08 YI06T 2.94E−07 Combined mutation of HCDR 33S(CDR1) 3.12E−09 54S(CDR2) 33S(CDRH 3.96E−09 59A(CDR2) 54S(CDR2) 2.68E−09 59A(CDR2) Combined mutation of LCDR + HCDR L- 3.38E−09 24R(CDR1) 56S(CDR2) 92N(CDR3); H- 33S(CDR1) 54S(CDR2) L- 2.88E−09 24R(CDR1) 56S(CDR2) 92N(CDR3); H- 54S(CDR2) 59A(CDR2)
[0125] Data in the Table showed that the affinity was affected greatly, for example lowered by more than 10 times, if the amino acids at certain positions were mutated. While, the affinity of the antibody was improved if the amino acids at certain positions were mutated, for example, the affinity was improved to a certain extent by mutating K at position 24 of the light chain to R, T at position 56 of the light chain to S, S at position 92 of the light chain to N, D at position 33 of the heavy chain to S, G at position 54 of the heavy chain to S, and/or Y at position 59 of the heavy chain to A. Furthermore, the affinity remained unchanged or was further improved by combining some of the mutations at the above positions. Meanwhile, it was also found that HCDR3 was essential for the binding of the antibody and most variant antibodies having mutations in HCDR3 exhibited reduced affinities.
[0126] The above description for the embodiments of the present invention is not intended to limit the present invention, and those skilled in the art can make various changes and variations according to the present invention, which are within the protection scope of the claims of the present invention without departing from the spirit of the same.