USE OF ST GAL(+) BACTERIA FOR PRODUCING A FERMENTED MILK PRODUCT WITH A RELATIVELY HIGH STABLE PH

Abstract

A method for producing a fermented milk product (e.g. a yogurt) with a relatively high stable pH value at the end of the fermentation comprising inoculating milk with Streptococcus thermophilus (ST) Gal(+) bacteria.

Claims

1. A method for producing a fermented milk product with a relatively high stable pH value at the end of the fermentation comprising following steps: (a): inoculating at least 100 L milk with: (I): a Streptococcus thermophilus (ST) bacteria composition comprising from 10.sup.4 to 10.sup.14 CFU/g ST bacteria cells, characterized by that the ST bacteria are able to reduce by at least 10% the amounts of excreted galactose in milk as compared to reference ST CHCC4323 (DSM 32826) bacteria (herein termed “ST Gal(+) bacteria”); wherein the comparative test is performed by that the ST bacteria are inoculated in skim cow milk 1% from overnight cultures and incubated for 18 hours at 37° C. and at the end of the fermentation samples are taken to measure galactose content in the fermented milk and thereby measure the reduction of excreted galactose compared to the reference CHCC4323; and (b): fermenting the milk with the bacteria of (a), wherein pH is measured during the fermentation in a way that ensures that one determines the pH values of this step (b) and wherein the fermentation is done under conditions wherein the fermentation ends with a relatively high stable pH value, defined as that the pH at the end of the fermentation is a pH from 4.3 to 4.9 and wherein the pH has not changed more than pH 0.1 during the last 2 hours of the fermentation and wherein the pH from 4.3 to 4.9 is reached before 24 hours of fermentation; and (c): using the fermented milk of (b) with a pH from 4.3 to 4.9 for making further adequate steps to finally end up with the produced fermented milk product.

2. The method of claim 1, wherein the milk of step (a) of claim 1 is cow milk and the fermented milk product of step (c) of claim 1 is yogurt, cheese, kefir or buttermilk.

3. The method of claim 2, wherein fermented milk product of step (c) of claim 1 is yogurt.

4. The method of claim 3, wherein in step (a) of the first aspect the milk is also inoculated with from 10.sup.4 to 10.sup.14 CFU/g Lactobacillus bacteria cells (such as e.g. Lactobacillus delbrueckii subsp. bulgaricus).

5. The method of any of the preceding claims, wherein the ST bacteria of step “(a) (I)” of claim 1 are ST bacteria characterized by that the ST bacteria are able to reduce by at least 25% the amounts of excreted galactose in milk as compared to reference ST CHCC4323 bacteria.

6. The method of any of the preceding claims, wherein the Streptococcus thermophilus (ST) bacteria cell is at least one cell selected from the group consisting of: (a): a Streptococcus thermophilus cell CHCC28380 deposited with registration number DSM 33158; and (b): a Streptococcus thermophilus cell CHCC32045 deposited with registration number DSM 33159.

7. The method of any of the preceding claims, wherein the ST Gal(+) bacteria of step “(a) (I)” of claim 1 are preferably bacteria that have a mutation in the −10 region of the promoter of the galactokinase gene (galK) (SEQ ID NO:8), wherein the mutation results in the replacement of one or both of C and G in the wildtype −10 region (TACGAT, SEQ ID NO:1) with a nucleotide independently selected from the group consisting of A and T.

8. The method of claim 7, wherein the mutation results in a −10 region which has the nucleotide sequence TATGAT (SEQ ID NO:2).

9. The method of any of the preceding claims, wherein: wherein the pH values of step (b) of claim 1 are measured continuously until the end of the fermentation; the fermentation temperature of step (b) of claim 1 is from 25° C. to 48° C.; the fermentation time in step (b) of claim 1 is from 2 to 30 hours; the pH at the end of the fermentation in step (b) of claim 1 is a pH from 4.4 to 4.8; the pH has not changed more than pH 0.05 during the last 2 hours of the fermentation in step (b) of claim 1; and the pH from 4.3 to 4.9 is reached before 10 hours of fermentation in step (b) of claim 1.

10. The method of any of the preceding claims, wherein in step (b) of claim 1 the pH at the end of the fermentation is a pH that is from 0.2 to 0.8 points higher than a corresponding comparative pH at the end of the fermentation obtained by use of the reference ST CHCC4323 (DSM 32826) bacterium performed under comparative identical fermentation conditions.

11. The method of any of the preceding claims, wherein method claim 1 comprises an extra step of: (d): storage of the in step (c) produced fermented milk product for at least 1 week of storage period and wherein the pH of the product at the end of said storage period is a pH from 4.3 to 4.9.

12. The method claim 11, wherein storage temperature is from 2° C. to 10° C. and wherein the fermented milk product is a yogurt or a cheese.

13. A method for screening and isolating a novel Streptococcus thermophilus (ST) bacterium cell comprising the following steps: (i): selecting and isolating from a pool of individual ST bacteria, a new selected pool of ST bacteria that are characterized by that the ST bacteria are able to reduce galactose as required in step (a)(I) of claim 1 (herein termed “ST Gal(+) bacteria”); (ii): selecting and isolating—from the selected pool of ST Gal(+) bacteria of step (i)—a new isolated ST Gal(+) bacterium cell that is capable of giving a relatively high stable pH value at the end of the fermentation as required in step (b) of claim 1.

14. A Streptococcus thermophilus cell CHCC28380 deposited with registration number DSM 33158 or a Streptococcus thermophilus cell CHCC32045 deposited with registration number DSM 33159.

15. A Streptococcus thermophilus cell sharing the functional characteristics of CHCC28380 deposited with registration number DSM 33158 or a Streptococcus thermophilus cell sharing the functional chracteristics of CHCC32045 deposited with registration number DSM 33159.

16. A Streptococcus thermophilus cell according to claim 15, wherein the functional chracteristics means that the ST bacteria are able to reduce by at least 10% the amounts of excreted galactose in milk as compared to reference ST CHCC4323 (DSM 32826) bacteria (herein termed “ST Gal(+) bacteria”).

17. A method to obtain: a mutant strain of Streptococcus thermophilus cell CHCC28380 deposited with registration number DSM 33158; or a mutant strain of Streptococcus thermophilus cell CHCC32045 deposited with registration number DSM 33159 comprising using the deposited strain as starting strain, making mutants of the deposited strain and isolating a novel mutant strain, wherein the mutant strain has retained the property of being ST Gal(+) of the deposited strain.

Description

DRAWINGS

[0077] FIG. 1: Schematic drawing of lac/gal metabolism

[0078] FIG. 2: Figure that shown that herein described ST Gal(+) bacteria had a significantly higher stable pH (around 0.3 to 0.6 points) than corresponding wildtype CHCC27806 ST Gal(−) bacteria at the end of the fermentation as such. The figure shows e.g. that the herein for the first-time deposited novel ST Gal(+) strains (CHCC28380=DSM 33158; CHCC32045=DSM 33159) have a very good stable relatively high pH at the end of the fermentation as such. For further details, see working Example herein.

[0079] FIG. 3: Figure that shown that herein described ST Gal(+) bacteria had a significantly higher stable pH (around 0.2 to 0.5 points) than corresponding wildtype CHCC4426 ST Gal(−) bacteria at the end of the fermentation as such. For further details, see working Example herein.

DETAILED DESCRIPTION OF THE INVENTION

Deposited Strains/Cells

[0080] A sample of the Streptococcus thermophilus cell CHCC4323 has been deposited at DSMZ (Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH, Inhoffenstr. 7B, D-38124 Braunschweig) under the accession number DSM 32826 with a deposit date of 5 Jun. 2018. The deposit has been made under the conditions of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purposes of Patent Procedure.

[0081] The deposited strains below are strains that for the first time have been deposited in relation to the present application—i.e. they are novel strains as such.

[0082] A sample of the novel Streptococcus thermophilus cell CHCC28380 has been deposited at DSMZ (Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH, Inhoffenstr. 7B, D-38124 Braunschweig) under the accession number DSM 33158 with a deposit date of 12 Jun. 2019. The deposit has been made under the conditions of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purposes of Patent Procedure.

[0083] A sample of the novel Streptococcus thermophilus cell CHCC32045 has been deposited at DSMZ (Deutsche Sammlung von Mikroorganismen and Zellkulturen GmbH, Inhoffenstr. 7B, D-38124 Braunschweig) under the accession number DSM 33159 with a deposit date of 12 Jun. 2019. The deposit has been made under the conditions of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purposes of Patent Procedure.

[0084] As discussed in working Examples herein—the herein novel deposited strains have a very good stable relatively high pH at the end of the fermentation as such.

[0085] Accordingly, a separate aspect of the invention relates to a Streptococcus thermophilus cell CHCC28380 deposited with registration number DSM 33158 or a Streptococcus thermophilus cell CHCC32045 deposited with registration number DSM 33159.

[0086] Accordingly a further aspect of the invention relates to a Streptococcus thermophilus cell sharing the functional characteristics of CHCC28380 deposited with registration number DSM 33158 or a Streptococcus thermophilus cell sharing the functional characteristics of CHCC32045 deposited with registration number DSM 33159. In a related aspect hereto, the functional chracteristics means that the ST bacteria are able to reduce by at least 10% the amounts of excreted galactose in milk as compared to reference ST CHCC4323 (DSM 32826) bacteria (herein termed “ST Gal(+) bacteria”).

[0087] A separate aspect of the invention relates to a method to obtain: [0088] a mutant strain of Streptococcus thermophilus cell CHCC28380 deposited with registration number DSM 33158; or [0089] a mutant strain of Streptococcus thermophilus cell CHCC32045 deposited with registration number DSM 33159
comprising using the deposited strain as starting strain, making mutants of the deposited strain and isolating a novel mutant strain, wherein the mutant strain has retained the property of being ST Gal(+) of the deposited strain.

Fermented Milk Product

[0090] The milk of step (a) of the first aspect and thereby the milk of the fermented milk product the first aspect may e.g. be soy milk or animal milk (such as e.g. goat, buffalo, sheep, horse, camel or cow milk. Preferably the milk is cow milk.

[0091] The fermented milk product is preferably a dairy product such as e.g. yogurt, cheese, kefir or buttermilk.

[0092] It may be preferred that the cheese is e.g. fresh cheese product, soft cheese product, cheddar, continental cheese, pasta filata cheese, pizza cheese or mozzarella cheese.

[0093] It may be preferred that the product is a yogurt.

Inoculating the Milk—Step (a) of First Aspect

[0094] As discussed above—in step (a) of the first aspect may the milk be inoculated also with other e.g. lactic acid bacteria (LAB) of interest—for instance L. bulgaricus for making e.g. a yogurt (i.e. fermented milk product is e.g. a yogurt).

[0095] It may be preferred that in step (a) of the first aspect is the milk also inoculated with from 10.sup.4 to 10.sup.14 CFU/g Lactobacillus bacteria cells (such as e.g. Lactobacillus delbrueckii subsp. bulgaricus)—this may be particularly relevant when the fermented milk product is e.g. a yogurt.

[0096] It may be preferred that in step (a) of the first aspect is the milk also inoculated with from 10.sup.4 to 10.sup.14 CFU/g Lactococcus bacteria cells (such as e.g. Lactococcus lactis)—this may be particularly relevant when the fermented milk product is e.g. a cheese.

[0097] It may be preferred that in step (a) of the first aspect is the milk also inoculated with from 10.sup.4 to 10.sup.14 CFU/g Leuconostoc bacteria cells—this may be particularly relevant when the fermented milk product is e.g. a cheese.

[0098] It may be preferred that step (a) of the first aspect relates to inoculating at least 200 L milk or inoculating at least 1000 L milk.

ST Gal(+) Bacteria of Step “(a) (I)” of First Aspect

[0099] In working Example 1 herein is described a method to obtain different ST Gal(+) bacteria complying with the comparative test of step “(a) (I)” of the first aspect.

[0100] As can be seen in Table 1 of Example 1, by use of the in this Example described special method for isolation of galactose hyper-fermenting mutants from S. thermophilus it was possible to obtain ST bacteria able to reduce by around 50% (see e.g. CHCC27912 and CHCC29526) the amounts of excreted galactose in milk as compared to reference ST CHCC4323 bacteria.

[0101] ST bacteria able to reduce by at least 20% the amounts of excreted galactose in milk as compared to reference ST CHCC4323 bacteria may herein be termed ST Gal(++) bacteria.

[0102] Without being limited to theory—the in Example 1 described method for isolation of galactose hyper-fermenting ST Gal(++) mutants from S. thermophilus may be considered special due to the fact that the galactose reduction level is dramatically increased compared to a herein termed Gal(+) strain. As described in Example 1, the galactose reduction level for CHCC14993, a Gal(+) mutant of CHCC4323, is 17%, whereas the galactose reduction level of CHCC14994, a Gal(++) mutant of CHCC4323, is 30%, compared to the wild type CHCC4323. The galactose reduction level of CHCC29526, a Gal(++) mutant from CHCC4459, is even 52% compared to the reference CHCC4323.

[0103] By using method of sub-culturing in M17-gal broth of Example 1 it was therefore possible to isolate galactose hyper-fermenting mutants with a unique galactose reducing ability.

[0104] Preferably, the ST bacteria of step “(a) (I)” of the first aspect are ST bacteria characterized by that the ST bacteria are able to reduce by at least 20% (such as at least 25%, more preferably at least 30% and even more preferably least 40%) the amounts of excreted galactose in milk as compared to reference ST CHCC4323 bacteria.

[0105] Preferably, the Streptococcus thermophilus (ST) bacteria cell is at least one cell selected from the group consisting of:

(a): a Streptococcus thermophilus cell CHCC28380 deposited with registration number DSM 33158; and
(b): a Streptococcus thermophilus cell CHCC32045 deposited with registration number DSM 33159.

[0106] Preferably, in step “(a) (I)” of the first aspect the milk is inoculated with from 10.sup.4 to 10.sup.15 cfu (or from 10.sup.4 to 10.sup.14 cfu) (colony forming units) viable ST bacteria cells per gram milk, including at least 10.sup.5 cfu per gram milk, such as at least 10.sup.6 cfu/g milk, such as at least 10.sup.7 cfu/g milk, such at least 10.sup.8 cfu/g milk, such as at least 10.sup.9 cfu/g milk, such as at least 10.sup.19 cfu/g milk or such as at least 10.sup.11 cfu/g milk.

[0107] The ST bacteria cells may be a mixture of different ST strains (e.g. a mixture of herein discussed CHCC28380 and CHCC32045)—for instance 10.sup.8 cfu/g milk of one ST strain (e.g. CHCC28380)+10.sup.8 cfu/g milk of another ST strain (e.g. CHCC32045), which in sum would imply that the milk is inoculated with 2×10.sup.8 cfu/g milk viable ST bacteria cells.

[0108] Typically, the bacteria (e.g. a starter culture composition) are in a concentrated form including frozen, dried or freeze-dried concentrates.

[0109] As discussed in working Example herein—not all of the tested ST Gal(+) strains actually worked as required herein (i.e. gave herein discussed relatively high stable pH value at the end of the fermentation).

[0110] Accordingly and as discussed in working Example herein—a genome analysis was performed to find a common structural element among preferred positive good working ST Gal(+) strains.

[0111] The results showed that the majority of the good ST Gal(+) strains have a mutation in the −10 region/box of the promoter of the galactokinase gene (galK).

[0112] Such galK mutants are described in e.g. WO2011/026863A1 (Chr. Hansen)—as discussed above, this WO publication does not describe/relate to herein discussed “post-acidification” related problems.

[0113] Below is shown figure on page 10 of WO2011/026863A1 (Chr. Hansen):

TABLE-US-00001 CHCC11379 SEQ ID NO: 5 AAAATA TTCCATGTGAAAGGGGT TTCAGTATAAACAAAAAGAATAAGTGAGATACATC CHCC6008 SEQ ID NO: 6 AAAATA TTCCATGTGAAAGGGGT TTCAGTATAAACAAAAAGAATAAGTGAGATACATC AY7C436B SEQ ID NO: 7 AAAATA TTCCATGTGAAAGGGGT TTCAGTATAAACAAAAAGAATAAGTGAGATACATC Consensus SEQ ID NO: 8 AAAATA TTCCATGTGAAAGGGGT TTCAGTATAAACAAAAAGAATAAGTGAGATACATC        −35                    −10                           RBS
As shown in figure above and discussed in WO2011/026863A1—the wildtype/consensus sequence of the −10 region/box is “TACGAT” and strain termed “CHCC11379” comprises a mutation in −10 region/box.

[0114] The wildtype/consensus promoter sequence of the galactokinase gene (galK) is shown as SEQ ID NO:8 in figure above, which is identical to SEQ ID NO:8 herein.

[0115] In short, the skilled person can routinely determine if a ST Gal(+) strain of interest has a mutation in the −10 region/box of the promoter of the galactokinase gene (galK).

[0116] Accordingly, in a preferred embodiment the ST Gal(+) bacteria of step “(a) (I)” of first aspect are preferably bacteria that have a mutation in the −10 region of the promoter of the galactokinase gene (ga/K) (SEQ ID NO:8), wherein the mutation results in the replacement of one or both of C and G in the wildtype −10 region (TACGAT, SEQ ID NO:1) with a nucleotide independently selected from the group consisting of A and T.

[0117] Preferably, the mutation results in a −10 region which has the nucleotide sequence TATGAT (SEQ ID NO:2—see e.g. very positive results of e.g. CHCC28380 and CHCC32045 discussed below) or TACTAT (SEQ ID NO:4—see e.g. positive results of e.g. CHCC29248 discussed below)—most preferably, the mutation results in a −10 region which has the nucleotide sequence TATGAT (SEQ ID NO:2).

[0118] As discussed in working example herein—the herein novel deposited ST Gal(+) strains (CHCC28380=DSM 33158; CHCC32045=DSM 33159) have a very good stable relatively high pH at the end of the fermentation as such—these deposited strains comprises the mutation “TATGAT” (SEQ ID NO:2)—accordingly it is most preferred herein.

[0119] Without being limited to theory, it is believed that a higher than wildtype expression of the ga/K gene would give the herein discussed positive effect of getting a relatively high stable pH at the end of the fermentation—accordingly, in a preferred embodiment the ST Gal(+) bacteria of step “(a) (I)” of first aspect are preferably bacteria that have a higher than wildtype expression of the galK gene and wherein the ST Gal(+) bacteria have preferably a mutation in the −35, −10 or Ribosome Binding Site (RBS) of SEQ ID NO:8.

Fermenting the Milk with the Bacteria—Step (b) of First Aspect

[0120] Step (b) of first aspect relates to fermenting the milk with the bacteria of (a).

[0121] As discussed above, the fermenting conditions of step (b) may generally be standard suitable ST fermentation conditions in relation to a ST bacterium of interest—such as e.g. around 37° C. as used in working examples herein.

[0122] As discussed above, a reason for this relates to that it is essentially the inherent characteristic of the used ST Gal(+) bacteria as described herein that are responsible for e.g. the pH at the end of the fermentation—i.e. herein not working ST bacteria will e.g. give a final pH at the end of the fermentation of around 4.1 under standard fermentation conditions.

[0123] The skilled person knows how to ferment milk with relevant bacteria to make a fermented milk product (e.g. a cheese) of interest—accordingly, there is in the present context no need to describe this in detail.

[0124] According to the art and depending on e.g. the ST used, the fermentation temperature may e.g. be from 25° C. to 48° C., such as e.g. from 35° C. to 48° C. or such as e.g. from 36° C. to 38° C.

[0125] According to the art, the fermentation time in step (b) of the first aspect may be from 2 to 96 hours, such as from 3 to 72 hours or such as from 4 to 48 hours.

[0126] It may be preferred that the fermentation time in step (b) of the first aspect may be from 2 to 30 hours, such as from 3 to 24 hours.

[0127] Step (b) of the first aspect reads: “the pH at the end of the fermentation”.

[0128] As discussed above, the skilled person knows when one is at the end of the fermentation, which essentially in the present context may be seen as relating to when the pH is not significantly dropping/lowering anymore.

[0129] As known in the art, the fermentation may end/stop when e.g. the fermentation medium does not anymore comprise enough relevant nutrients (e.g. sugars such as e.g. lactose, galactose etc.) for bacteria growth/metabolism or the fermentation may end/stop by changing the temperature (e.g. by rapid cooling) to a temperature significant different from optimal temperature for bacteria growth.

[0130] Alternatively, the fermentation ends naturally be the increasing concentration of lactic acid or other growth inhibiting compounds.

[0131] It may be preferred that the pH at the end of the fermentation is a pH from 4.3 to 4.8, such as e.g. from 4.4 to 4.8 or from 4.4 to 4.7.

[0132] In a preferred embodiment, the pH has not changed more than pH 0.05 during the last 2 hours of the fermentation.

[0133] In a preferred embodiment, the pH from 4.3 to 4.9 is reached before 15 hours (more preferably before 10 hours and even more preferably before 8 hours) of fermentation.

[0134] In relation to large scale herein relevant fermentations of milk—it is known in the art that sometimes may the fermentation of the milk be finalized within around 5 hours.

[0135] As discussed herein, the ST strain CHCC4323 (DSM 32826) may be seen as a ST reference strain that corresponds to a today commercially relevant used ST Gal(−) strains for making e.g. herein relevant dairy products.

[0136] Accordingly, in a preferred embodiment of step (b) of the first aspect the pH at the end of the fermentation is a pH that is from 0.1 to 0.8 points (preferably from 0.2 to 0.8 points, such as e.g. from 0.2 to 0.6 points) higher than a corresponding comparative pH at the end of the fermentation obtained by use of the reference ST CHCC4323 (DSM 32826) bacterium performed under comparative identical fermentation conditions.

[0137] The skilled person of course knows how to make such a comparative experiment—i.e. where fermenting in step (b) is done by use of a ST Gal(+) strain according to the first aspect and then is repeated under identical conditions with the reference ST CHCC4323 (DSM 32826) bacterium and the end pH values are then compared.

Further Adequate Steps to Make Fermented Milk Product of Interest—Step (c) of First Aspect

[0138] Step (c) of first aspect relates to making further adequate steps to finally end up with the produced fermented milk product of interest.

[0139] As discussed above, the skilled person knows how to make a fermented milk product of interest (e.g. cheese or yogurt)—accordingly, there is no need to describe this in detail in the present context.

Storage of Produced Fermented Milk Product—Optional Step (d) of First Aspect

[0140] As discussed above—it is believed that a higher final pH at the end of the fermentation as such would have an impact on post acidification during shelf life, which may be a significant problem with dairy products such as e.g. yogurt (see above).

[0141] Accordingly, herein discussed ST Gal(+) strains with a stable higher pH would result in lower post acidification which is a desired trait of e.g. commercial relevant dairy products.

[0142] Accordingly, in a preferred embodiment of the method of the first aspect—the method also comprises an extra step relating to: [0143] (d): storage of the in step (c) produced fermented milk product for at least 1 day (such as at least 1 week, at least 2 weeks, at least 1 month or at least 2 months) of storage period and wherein the pH of the product at the end of said storage period is a pH from 4.3 to 4.9.

[0144] Preferably, the pH has not changed more than pH 0.3 (preferably not changed more than pH 0.2 or even preferably not changed more than pH 0.1) during the storage period.

[0145] The storage may be at the dairy producer and/or at the retailer/shop selling the fermented milk product (e.g. a yogurt).

[0146] In relation to step (d)—if the storage period of step (d) is e.g. at least one day and the pH of the product has been measured to determine that the product has a pH within the pH from 4.3 to 4.9 range of step (b) (such as e.g. pH 4.4) after one day, then has one performed step (d)—this is also true even though the product may be stored for a longer period (e.g. a year) and the product e.g. after a year has a pH below pH 4.3 (i.e. outside the range of step (d)).

[0147] The skilled person knows how to store a produced fermented milk product of interest—for instance may a yogurt be stored at e.g. from 2° C. to 10° C.—such as e.g. around 5° C.

[0148] The skilled person knows how to measure pH of a stored fermented milk product of interest and can thereby routinely determine if the conditions of step (d) are fulfilled or not.

A Method for Screening and Isolating a Novel ST Bacterium—Second Aspect

[0149] As discussed above, a second aspect of the invention relates to a method for screening and isolating a novel Streptococcus thermophilus (ST) bacterium cell comprising the following steps: [0150] (i): selecting and isolating from a pool of individual ST bacteria, a new selected pool of ST bacteria that are characterized by that the ST bacteria are able to reduce galactose as required in step (a)(I) of the first aspect (herein termed “ST Gal(+) bacteria”); [0151] (ii): selecting and isolating—from the selected pool of ST Gal(+) bacteria of step (i)—a new isolated ST Gal(+) bacterium cell that is capable of giving a relatively high stable pH value at the end of the fermentation as required in step (b) of the first aspect.

[0152] Step (i) of the method of the second aspect reads “selecting and isolating from a pool of individual ST bacteria”.

[0153] As known—it is routine work for the skilled person to make/create such a pool of individual bacteria cells.

[0154] It may e.g. be made from a suitable preferred starting cell, which may be subjected to suitable mutagenesis (e.g. using a chemical mutagen or UV mutagenesis) to make a pool of mutants of said starting cell—i.e. to create a pool of individual bacteria cells.

[0155] As discussed herein, in view of the technical disclosure herein and the common general knowledge—it is routine work for the skilled person to select/identify at herein positive/useful ST strain by the method for screening and isolating of the second aspect.

EXAMPLES

[0156] EXAMPLE 1: ST Gal(+) bacteria—capable of extraordinary reducing the release of galactose also in the presence of high amounts of lactose (as in milk)—i.e. ST Gal(+) bacteria of step “(a) (I)” of the first aspect

Reference Strains

[0157] ST strain CHCC4323: It has what may be termed a galK natural wildtype sequence (herein termed GalK(−)) and may be seen as a ST reference strain that corresponds to a today commercially relevant used ST strain for making e.g. cheese; [0158] ST strain 4323-2 (CHCC14993): It comprises a mutation in the galK (galactokinase) gene (herein termed Gal(+)) and may be seen as a reference strain that corresponds to a strain made according to the description of above discussed WO2011/026863A1 (Chr. Hansen) and WO2011/092300A1 (Chr. Hansen).

Deposited Strains

[0159] CHCC14994: DSM 25838 ST strain—disclosed in WO2013/160413A1 (Chr. Hansen).
CHCC19097: DSM 32594 ST strain
CHCC19100: DSM 32595 ST strain
CHCC27912: DSM 32596 ST strain
CHCC29526: DSM 32597 ST strain
CHCC29530: DSM 32598 ST strain

[0160] Some of the deposited ST Gal(+) strains are discussed in WO2019/042881A1 (Chr. Hansen)—as described above, this WO publication does not describe/relate to herein discussed “post-acidification” related problems.

Isolation of Galactose Hyper-fermenting Mutants from S. thermophilus

[0161] Prior to the mutant isolation the strains were streaked on M17 agar plates with 2% galactose (M17-gal plates). The wild type (wt) strains did not grow significantly on galactose as sole carbohydrate source.

[0162] Overnight cultures were then plated on M17-gal plates and several colonies could be isolated after two days of growth at 37 ° C. Several mutants were purified on M17-gal plates and retested in M17 broth containing 2% galactose as sole carbohydrate. From purified galactose positive mutants second generation galactose hyper-fermenting mutants were isolated by sub-culturing in M17-gal broth with daily 1% reinoculation from the fully outgrown overnight culture; incubation occurred at 37° C. After dilution plating, 100 single colonies were isolated from M17-gal plates and inoculated in microtitre plates with M17-gal broth. The OD was followed by an OD-reader and the clones showing a better increase of OD during 16 hours of incubation at 37 ° C. as the wt strain were further purified and characterized.

[0163] The wt S. thermophilus strains from which galactose-hyperfermenting mutants were isolated are:

CHCC9861

CHCC4459

CHCC4426

CHCC4323

CHCC7018

CHCC3050

[0164] The galactose-hyperfermenting mutants showing an unusually high galactose fermenting ability and reduced galactose excretion into the media are (mutant/wt):

CHCC27912/CHCC9861

CHCC29526/CHCC4459

CHCC29530/CHCC4426

CHCC14994/CHCC4323

CHCC19100/CHCC7018

CHCC19097/CHCC3050

[0165] The example includes also a typical galactose positive strain, isolated as first generation mutant from CHCC4323, named CHCC14993. CHCC14993 showed a typical galactose reduction in milk of 17% (reduction of galactose excretion in milk compared to wt CHCC4323).

Fermentation of Milk

[0166] Mutant strains were inoculated in skim cow milk 1% from overnight cultures and incubated for 24 hours at 37° C. The acidification activity of mutants was similar to the wt strain. At the end of fermentation samples were taken to measure galactose content in the fermented milk and with this the reduction of excreted galactose compared to the galactose negative reference strain CHCC4323.

Results—Analysis of Acidification and Excreted Galactose in the Fermented Milk

[0167] All the tested ST strains had similar acidification profiles—i.e. the deposited ST strains of had not lost their capacity to acidify in milk.

[0168] The amounts of excreted galactose for the different tested strains are shown in Table 1 below:

[0169] Table 1 indicates the amount of galactose in fermented skim cow milk and the reduction of galactose compared to the reference CHCC4323. Whereas the typical gal+ mutant CHCC14993 showed a galactose reduction of less than 20%, the hyperfermenting mutants showed a much higher reduction of up to 52%, meaning that the amount of free galactose is much lower when e.g. pizza cheese is produced with the new mutants, which is leading to reduced browning during baking.

TABLE-US-00002 TABLE 1 Average of two measurements from carbohydrate analysis. Results are shown in mg/g. Strain Galactose Galactose reduction (%) CHCC4323 7.1 0 CHCC14993 5.9 17 CHCC27912 3.4 52 CHCC29526 3.4 52 CHCC29530 4.9 31 CHCC14994 5.0 30 CHCC19100 4.1 42 CHCC19097 5.1 28

Conclusions

[0170] The results demonstrated that the deposited strains are capable of reducing the release of galactose also in the presence of high amounts of lactose (as in milk) to a degree, which is significantly improved as compared to above discussed reference strains.

EXAMPLE 2: ST Gal(+) Bacteria—pH Value at the End of the Fermentation

Strains

[0171] All the ST Gal(+) strains discussed in this Example were ST Gal(+) strains according to requirement (a) of the first aspect (i.e. claim 1) herein, wherein the comparative test is performed according to Example 1 above.

Novel Deposited Strains

[0172] The novel deposited strains below were deposited for the first time in relation to the present invention.

CHCC28380: DSM 33158 ST strain
CHCC32045: DSM 33159 ST strain

Fermentation of Milk

[0173] ST Gal(+) mutant strains and reference/wildtype ST Gal(−) strains were inoculated in skim cow milk 1% from overnight cultures in M17 with 2% lactose and incubated for 24 hours at 37° C.

[0174] The pH was monitored/measured continuously during the fermentation (intab PC logger, EasyView software).

Results

[0175] FIG. 2 herein shown that herein described ST Gal(+) bacteria CHCC28380, CHCC32045 and CHCC32046 had a significantly higher stable pH (around 0.3 to 0.6 points) than corresponding wildtype ST Gal(−) bacterium CHCC27806 at the end of the fermentation as such.

[0176] FIG. 3 herein shown that herein described ST Gal(+) bacteria CHCC29249 and CHCC29529 had a significantly higher stable pH (around 0.2 to 0.5 points) than corresponding wildtype ST Gal(−) bacterium CHCC4426 at the end of the fermentation as such. Also, at the end of fermentation the pH of CHCC4426 continuously decreases whereas the pH of the mutants CHCC29249 and CHCC29529 appeared more stable.

[0177] Herein relevant pH results of other tested strains are shown in table below.

TABLE-US-00003 TABLE 1 Differences in pH between ST Gal(−) wild type strains and galactose positive mutants at the end offermentation. The corresponding gal+ mutants of the wild type strains are indicated below the respective wild type strain. Wild type strain Gal(+) mutant PH after 24 hours CHCC4426 4.20 CHCC29248 4.40 CHCC29249 4.42 CHCC29529 4.44 CHCC4458 4.20 CHCC29231 4.40 CHCC29232 4.40 CHCC29233 4.40 CHCC30964 4.50 CHCC30962 4.70 CHCC4459 4.20 CHCC29250 4.40 CHCC29252 4.44 4459-GAL6 4.20 CHCC3050 4.18 CHCC19098 4.38 CHCC27806 4.15 CHCC28380 4.48 CHCC32045 4.62 CHCC32046 4.80

[0178] As shown in the table above—examples of different ST Gal(+) bacteria had a significantly higher stable pH (around 0.2 to 0.6 points) than corresponding wildtype ST Gal(−) bacteria at the end of the fermentation as such.

[0179] As shown in the table above, some of the tested ST Gal(+) strains did not work as required herein (i.e. did not give herein discussed relatively high stable pH value at the end of the fermentation. As example, ST Gal(+) mutant 4459-GAL6 is included. This strain is a galactose fermenting mutant of CHCC4459. The final pH after 24 hours of incubation is, however, similar to the pH of the wild type strain after 24 hours.

[0180] The mutant with the relatively highest pH at the end of the fermentations were generally so-called galactose hyper-fermenting ST Gal(++) mutant—i.e. (as discussed above) they are able to reduce by at least 20% (such as at least 25%, more preferably at least 30% and even more preferably at least 40%) the amounts of excreted galactose in milk as compared to reference ST CHCC4323 bacteria according to Example 1 above.

[0181] Data is not shown for all tested not working ST Gal(+) strains—but around 20% of the tested ST Gal(+) strains actually worked as required herein (i.e. gave herein discussed relatively high stable pH value at the end of the fermentation).

Conclusions

[0182] The results demonstrated that examples of different ST Gal(+) bacteria had a significantly higher stable pH (around 0.2 to 0.6 points) than corresponding wildtype ST Gal(−) bacteria at the end of the fermentation as such.

[0183] For a number of the tested different ST Gal(+) bacteria—the fermenting of the milk gave a relatively high stable pH value at the end of the fermentation in according with step (b) of the first aspect herein.

[0184] The data also indicated that around 20% of the tested ST Gal(+) strains actually worked as required herein (i.e. gave herein discussed relatively high stable pH value at the end of the fermentation).

[0185] The results also demonstrated that based on the technical teaching herein and the common general knowledge—it is routine screening/selection work for the skilled person to identify novel ST Gal(+) strains with the herein described positive “stable relatively high pH at the end of the fermentation” effect.

[0186] None of the tested ST Gal(−) strains were positive—i.e. none of these gave pH value at the end of the fermentation in accordance with step (b) of the first aspect herein.

EXAMPLE 3: Genome Analysis on Tested ST Gal(+) Strains

[0187] As discussed above—not all of the tested ST Gal(+) strains actually worked as required herein (i.e. gave herein discussed relatively high stable pH value at the end of the fermentation).

[0188] Accordingly, a genome analysis was performed to find a common structural element among preferred positive good working ST Gal(+) mutant strains.

Results

[0189] The table below show the mutations in the −10 region of the promoter of the galactokinase gene (galK) of some the strains discussed in example 2 above—i.e. both some of the positive and negative (not working) strains of Example 2 above.

TABLE-US-00004 TABLE 2 DNA sequences of the −10 region of the promoter of the galactokinase gene (galK) gene for galactose positive mutants compared to the wild type strains. The corresponding gal+ mutants of the wild type strains are indicated below the respective wild type strain. Wild type strain Gal+ mutant −10 galK promoter region CHCC4426 5′-TACGAT-3′ CHCC29248 5′-TACTAT-3′ CHCC29249 5′-TATGAT-3′ CHCC29529 5′-TATGAT-3′ CHCC4458 5′-TACGAT-3′ CHCC29231 5′-TATGAT-3′ CHCC29232 5′-TATGAT-3′ CHCC29233 5′-TATGAT-3′ CHCC30964 5′-TATGAT-3′ CHCC30962 5′-TATGAT-3′ CHCC4459 5′-TACGAT-3′ CHCC29250 5′-TATGAT-3′ CHCC29252 5′-TATGAT-3′ 4459-GAL6 5′-TACAAT-3′ CHCC3050 5′-TACGAT-3′ CHCC19098 5′-TATGAT-3′ CHCC27806 5′-TACGAT-3′ CHCC28380 5′-TATGAT-3′ CHCC32045 5′-TATGAT-3′ CHCC32046 5′-TATGAT-3′

Conclusions

[0190] The results demonstrate that herein relevant good working ST Gal(+) strains are preferably ST Gal(+) bacteria that have a mutation in the −10 region of the promoter of the galactokinase gene (ga/K) (SEQ ID NO:8), wherein the mutation results in the replacement of one or both of C and G in the wildtype −10 region (TACGAT, SEQ ID NO:1) with a nucleotide independently selected from the group consisting of A and T.

[0191] More preferably, the mutation results in a −10 region which has the nucleotide sequence TATGAT (SEQ ID NO:2—see e.g. very positive results of e.g. CHCC28380 and CHCC32045) or TACTAT (SEQ ID NO:4—see e.g. very positive results of e.g. CHCC29248).

[0192] The herein novel deposited ST Gal(+) strains (CHCC28380=DSM 33158; CHCC32045=DSM 33159) have a very good stable relatively high pH at the end of the fermentation as such—these deposited strains comprises the mutation “TATGAT” (SEQ ID NO:2)—accordingly it is most preferred herein.

REFERENCES

[0193] 1. EP2957180B1 (Chr. Hansen A/S, Denmark)
2. YOFLEX® ACIDIFIX® of Chr. Hansen A/S

3. Anbukkarasi et al. (J Food Sci Technol (September 2014) 51(9):2183-2189)

[0194] 4. Anbukkarasi et al. (“Production of low browning Mozzarella cheese: Screening and characterization of wild galactose fermenting Streptococcus thermophilus strains”, International Journal of advanced research, 2013, vol. 1, no. 5, pp. 83-96)
5. Derkx et al. (“The art of strain improvement of industrial lactic acid bacteria without the use of recombinant DNA technology”; Microbial Cell Factories 2014,13 (Suppl 1))
6. WO2011/026863A1 (Chr. Hansen)
7. WO2011/092300A1 (Chr. Hansen)
8. WO2019/042881A1 (Chr. Hansen)