11-(4-CHLOROPHENYL)-4-(2,3-DIHYDRO-1H-INDOLE-1-CARBONYL)-3,11-DIMETHYL-5,10,DIOXATRICYCLO[7.4.0.0,2,6,]TRIDECA-1,3,6,8-TETRAEN-13-ONE AND DERIVATIVES AS DESTABILIZER OF CRY1 FOR THE TREATMENT OF CIRCADIAN RHYTHM ASSOCIATED DISEASES AND DISORDERS

20230104487 · 2023-04-06

Assignee

Inventors

Cpc classification

International classification

Abstract

A 11-(4-chlorophenyl)-4-(2,3-dihydro-1H-indole-1-carbonyl)-3,11-dimethyl-5,10,dioxatricyclo[7.4.0.0,2,6,]trideca-1,3,6,8-tetraen-13-one compound and related derivatives, as well as the use thereof in a preparation of a medicament for treatment and/or prevention of diseases or disorders associated with a circadian rhythm. The compound is a CRY1-binding small molecule and also a destabilizer of CRY1, and is therefore useful, as pharmaceutical agent, especially in the treatment and/or prevention of disorders associated with the circadian rhythm, including CRY1-mediated diseases such as cancer.

Claims

1. A method of use of a compound having the following formula or a pharmaceutically acceptable salt the compound for a preparation of a medicament for a treatment and/or a prevention of a disease or a disorder associated with a circadian rhythm, ##STR00003## wherein the method comprises: dissolving the compound in 2.5% dimethyl sulfoxide (DMSO) and 15% Cremophor EL, and diluting a resulting mixture with a 82.5% isotonic sodium chloride solution on each study day to obtain the medicament.

2. The method according to claim 1, wherein the use for the preparation of the medicament useful in the treatment and/or the prevention of the disease or the disorder is related to cryptochrome 1 (CRY1).

3. The method according to claim 2, wherein the disease or the disorder is a cancer.

4. The method according to claim 1, wherein the disease or the disorder is a sleep disorder, and the sleep disorder is a delayed sleep phase syndrome.

5. The method according to claim 1, wherein the disease or the disorder is related with a circadian amplitude reduction.

6. A pharmaceutical composition, comprising a pharmaceutical carrier, and a therapeutically effective amount of the compound according to claim 1 or a pharmaceutically acceptable salt of the compound.

7. A method for identifying a compound destabilizing CRY1, comprising contacting a compound with a CRY1 protein under conditions allowing for an interaction, and determining whether the compound leads to a reduction in a CRY1 level by using a system, wherein the system uses a signal and/or a marker generated by the interaction between the CRY1 and the compound to detect a presence or absence or change of the signal and/or the marker.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0022] The present invention is illustrated in the accompanying figures wherein;

[0023] FIGS. 1A-1C are an illustration of FORMULA I changes period of U2-OS cells dose dependently. FIG. 1A shows a structure of FORMULA I. FIG. 1B is a representative figure for the effect of FORMULA I on the bioluminescence rhythm of U2-OS cells stably expressing Bmal1-dLuc. FORMULA I lengthened the circadian rhythm dose dependently (Data represent the mean±SEM, n=4 with duplicates ***: p<0.001 **: p<0.005, *: p<0.05 versus DMSO control by student t-test). FIG. 1C shows an effect of FORMULA I on the Cry1.sup.−/−/Cry2.sup.−/− mouse embryonic fibroblasts transiently transfected with mPer2-dLuc reporter.

[0024] FIGS. 2A-2P are an illustration of FORMULA I decreases the half-life of CRY1. FIGS. 2A-2B show FORMULA I increased the degradation rate of CRY1-LUC dose dependently. HEK 293T cells were transfected with Cry1-Luc plasmid. 24 h after transfection cells were treated with different doses of FORMULA I or solvent (DMSO final 0.5%) as control. 24 h after molecule treatment cells were treated with cycloheximide (20 μg/ml final) and bioluminescence was recorded. Normalized half-life is shown with ±SEM (n=4 with triplicates). *p<0.05 **p<0.01 FIGS. 2C-2D show FORMULA I did not affect the degradation rate of CRY2-LUC (n=4 with triplicates). FIGS. 2E-2F show FORMULA I decreased the steady-state level of CRY1 in U2-OS cells. CRY1 level relative control treated with solvent (DMSO) was shown ±SEM (n=3). FIG. 2G shows a binding pose of FORMULA I on the equilibrated CRY1 (4K0R) structure predicted by AutodockVina with −13.4 kcal/mol binding energy. Protein structure is shown in surface. FBXL3 binding residues (4I6J) are colored as red, PER2 binding residues (4CT0) are colored as orange. FORMULA I interacting residues are shown in sticks (carbons are white, nitrogens are blue, oxygens are red, however, carbons in FORMULA I are shown in gray). FIGS. 2H-2I show FORMULA I did not affect the half-life of mutant CRY1R293AW399L-LUC degradation (Data shown with ±SEM n=3 with triplicates). FIGS. 2J-2L show HEK293T cells transfected with Cry1-His-Myc, Cry2-His-Myc, or Cry1-T5-His-Myc plasmids then lysates were subjected to pull-down assay. Lysates treated with solvent (DMSO), 50 μM bFORMULA I, and 50 μM bFORMULA I with 100 μM FORMULA I (competitor). While FORMULA I binds to PHR of CRY1 (FIGS. 2J-2L) it does not bind to CRY2 (FIGS. 2J-2K) (n=3). FIG. 2M shows a binding mode of FORMULA I on equilibrated CRY2 (4I6G) predicted by AutodockVina with binding energy −9.4 kcal/mol. W310 occupies the binding region of FORMULA I. Coloring is done as explained in FIG. 2G with modifications. Carbon atoms of CRY2 are shown in cyan. FIG. 2N shows a dihedral angle between C—Cα-Cβ-Cδ atoms of W399 and W292 in CRY1; FIG. 2O shows W417 and W310 in CRY2 throughout the simulations. Dihedral angle around −1500 of W292 in CRY1, W310 in CRY2 represents the parallel position; angle >00 represents the perpendicular position of these residues to R293 and R311 in CRY1 and CRY2, respectively. Similarly, dihedral angle around 900 of W399 in CRY1, W417 in CRY2 represents the parallel position; angle around 400 represents the perpendicular position of these residues. FIG. 2P shows a superimpose image of equilibrated CRY1 and CRY2 structures. FORMULA I binding residues (W399, W292, R293) in CRY1 and corresponding residues in CRY2 (W417, W310, R311) are shown in sticks. Coloring is done as explained in FIG. 2M.

[0025] FIGS. 3A-3G are an illustration of FORMULA I decreased CRY1 level in synchronized U2-OS cells. Confluent U2-OS cells were synchronized by 2 h treatment with dexamethasone (0.1p M) and medium replaced with fresh medium containing FORMULA I or solvent (DMSO final 0.5%). Cells were harvested at indicated time points. FIGS. 3A-3B show lysed cells were analyzed via protein immunoblot technique. FORMULA I decreased the protein level of CRY1 and increased the level of CRY2 between 80th-92nd h. CRY levels in DMSO control divided by that of in FORMULA I treated samples were reported (mean±SEM, n=4). FIGS. 3C-3G show cells were subjected to reverse-transcription-quantitative polymerase chain reaction (RT-qPCR). FORMULA I treatment changed the peak time of Dbp, Cry1 and Cry2, in addition, increased the level of Dbp and Per2. Expression level of genes was normalized according to the expression level of that gene at 72ndh. (Data represent the mean±SEM, n=3 with duplicates ***: p<0.001 **: p<0.005, *: p<0.05 versus DMSO control by two-way ANOVA).

[0026] FIGS. 4A-4H are an illustration of toxicity and pharmacokinetics of FORMULA I in mice. FIG. 4A shows body temperatures in C57BL/6J mice treated with single intraperitoneal doses of 5 mg/kg, 50 mg/kg, 300 mg/kg FORMULA I or vehicle during 15-day observation period. Body temperatures (° C.) were expressed as mean±SEM. “↓” indicates the treatment days of FORMULA I. ***p<0.001, control vs 300 mg/kg FORMULA I; #p<0.05, ##p<0.01 control vs 5 mg/kg FORMULA I (Two-way ANOVA with Bonferroni post hoc test). FIG. 4B shows body weight changes (%) in C57BL/6J mice treated with single intraperitoneal doses of 5 mg/kg, 50 mg/kg, 300 mg/kg FORMULA I or vehicle during 15-day observation period. Body weight changes (%) were expressed as mean±SEM. “↓” indicates the treatment days of FORMULA I. *p<0.05,**p<0.01, ***p<0.001, control vs 300 mg/kg FORMULA I; #p<0.05, ##p<0.01, ###p<0.001 5 mg/kg vs 300 mg/kg FORMULA I; jp<0.05, jjp<0.01 control vs 50 mg/kg; kp<0.05, 5 mg/kg vs 50 mg/kg FORMULA I (Two-way ANOVA with Bonferroni post hoc test). FIG. 4C shows body temperatures in C57BL/6J mice treated with intraperitoneal doses of 40 mg/kg, 80 mg/kg, 150 mg/kg FORMULA I or vehicle for 5 days. Body temperatures (° C.) were expressed as mean±SEM. “↓” indicates the treatment days of FORMULA I. *p<0.05,**p<0.01, ***p<0.001, control vs 150 mg/kg FORMULA I; #p<0.05, ##p<0.01, ###p<0.001 control vs 80 mg/kg FORMULA I (Two-way ANOVA with Bonferroni post hoc test). FIG. 4D shows body weight changes (%) in C57BL/6J mice treated with intraperitoneal doses of 40 mg/kg, 80 mg/kg, 150 mg/kg FORMULA I or vehicle for 5 days. Body weight changes (%) were expressed as mean±SEM. “↓” indicates the treatment days of FORMULA I. **p<0.01 control vs 150 mg/kg FORMULA I (Two-way ANOVA with Bonferroni post hoc test). FIG. 4E shows body temperatures in C57BL/6J mice treated with intraperitoneal dose 60 mg/kg FORMULA I or vehicle for 14 days. Body temperatures (° C.) were expressed as mean±SEM. “↓” indicates the treatment days of FORMULA I. *p<0.05, **p<0.01, ***p<0.001, control vs 60 mg/kg FORMULA I (Two-way ANOVA with Bonferroni post hoc test). FIG. 4F shows body weight changes (%) in C57BL/6J mice treated with intraperitoneal dose of 60 mg/kg FORMULA I or vehicle for 14 days. Body weight changes (%) were expressed as mean±SEM. “↓” indicates the treatment days of FORMULA I. *p<0.05, ***p<0.001, control vs 60 mg/kg FORMULA I (Two-way ANOVA with Bonferroni post hoc test). FIG. 4G shows a mean plasma concentration-time curve of FORMULA I administered at 100 mg/kg intraperitoneally to C57BL/6J mice. Data were expressed as mean±SEM (n=4 per time point). FIG. 4H shows FORMULA I levels in brain tissue at 2nd (n=2) and 4th (n=2) hours following FORMULA I administration at a dose of 100 mg/kg intraperitoneally to C57BL/6J mice. Data were expressed as mean±SEM.

[0027] FIGS. 5A-5G are an illustration of FORMULA I decreased the nuclear CRY1 in mice liver. FORMULA I (25 mg/kg or 50 mg/kg) or vehicle intraperitoneally administered to C57BL/6J mice. 6 h after the treated mice were sacrificed (n=3). While FORMULA I slightly decreased the CRY1 levels in whole cell lysate (WCL) and cytosolic fraction, decreased the nuclear CRY1 level significantly. FIGS. 5A-5B show an effect of FORMULA I in WCL. FIG. 5C-5D show an effect of FORMULA I in cytosolic fraction. FIGS. 5E-5F show an effect of FORMULA I in nuclear fraction of muce liver. FIG. 5G shows liver samples subjected to RT-PCR. FORMULA I treatment increased the mRNA level of Per2. (Data represent the mean±SEM, n=3 (with duplicates in RT-PCR) *: p<0.05 versus control by student t-test).

[0028] FIGS. 6A-6B are an illustration of FORMULA I enhanced the effect of oxalipilatin in p53 null MSF cells. Ras pT24 transformed p53 null MSF fibroblast cells were treated with 0, 10 or 20 μM oxaliplatin and incubated for 24 h. Then either DMSO or FORMULA I was added and incubated for 16 h. Cells were lysed and analyzed via protein immunoblot technique. At each cases FORMULA I increases the cleaved PARP protein level. Bar graph was drawn normalizing to 10 μM dosage of oxaliplatin (Data represent the mean±SEM, n=4 **: p<0.005, * p<0.05 versus DMSO control by two-way ANOVA).

[0029] FIGS. 7A-7D are an illustration of FORMULA I shortened the period of locomotor activity in mice. C57BL/6J mice were synchronized 10 days under 12 h:12 h light-dark cycles. After 10 days mice were treated with intraperitoneal dose of 60 mg/kg FORMULA I or vehicle for 14 days and kept under constant darkness (n=12). Locomotor activity of mice were recorded for additional 10-days without any injection. During these days locomotor activity of mice were recorded by ClockLab (Actimetrics) software program. FIG. 7A Representative locomotor activity of mice injected with vehicle (n=5) or FIG. 7B FORMULA I (n=7). FIG. 7C Period and FIG. 7D amplitude of mice under different conditions and injected with vehicle or FORMULA I. Period and amplitude values were calculated by using ClockLab Analysis (Actimetrics) program. Statistical significance was evaluated using one-way analysis of variance (ANOVA), followed by a Tukey's multiple comparisons test using Prism software (GraphPad Software)

DETAILED DESCRIPTION OF THE EMBODIMENTS

[0030] In the present invention, it is aimed to discover a novel CRY1-binding small compound using a structure-based approach. As a result, the interaction of a CRY1-binding compound with CRY1 has been predicted in silico and then demonstrated experimentally.

[0031] The CRY1-binding compound was identified that destabilizes CRY1 protein and enhances the degradation of CRY1 both in vivo and in vitro.

[0032] Furthermore, it was discovered that, as a result of this interaction, the subsequent degradation of CRY1 by proteasome is regulated by the CRY1-binding compound resulting in suppression of the CRY1 function thereof. A decrease in nuclear CRY1 level leads to the participation of the negative arm of the TTFL and, in turn, and dampen the amplitude of the circadian rhythm with increase in period length.

[0033] The present invention relates to a CRY1-binding compound (Formula I).

[0034] Unless specified otherwise, the term “Formula I” or “compound” or “FORMULA I” refers to compounds of Formula I, prodrugs thereof, salts of the compound and/or prodrug, hydrates or solvates of the compound, stereoisomers, tautomers, isotopically labeled compounds, and polymorphs.

[0035] It is an object of this invention to provide a CRY1-binding compound having the chemical name 11-(4-chlorophenyl)-4-(2,3-dihydro-1H-indole-1-carbonyl)-3,11-dimethyl-5,10,dioxatricyclo[7.4.0.0,2,6,]trideca-1,3,6,8-tetraen-13-one (IUPAC) as destabilizer of CRY1 and so mediator of CRY1 degradation by proteasome.

[0036] In accordance with the purpose(s) of the invention, as embodied and broadly described herein, the present invention relates to a CRY1-binding compound, capable of destabilizing CRY1 by binding to FAD-binding pocket of CRY1. In this regard, the invention relates to a compound having the following Formula I.

##STR00002##

or a pharmaceutically acceptable salt thereof.

[0037] In a further aspect, the present invention relates to a compound (Formula I) that binds to a CRY1 protein and negatively modulate CRY1 activity.

[0038] The present invention relates to a novel CRY1-binding small molecule that affects the degradation of CRY1 protein in the nucleus through the destabilization of the CRY1 and thus dampen the circadian rhythm. FAD plays a time and location-dependent role to regulate CRY stability by competing with FBXL3, which is supported by the fact that FBXL3 is predominantly localized in the nucleus (Godinho et al., 2007; Hirano et al., 2013; Yoo et al., 2013). When Formula I is present, it binds to CRY1 via FAD binding packet which is critical for the FBXL3 interaction and enhance the degradation of CRY1 by proteasome. Upon binding of Formula I to CRY1, the amount of the CRY1 in the nucleus abolished. Thus, Formula I dampen the amplitude of the circadian rhythm. Formula I exhibits period-lengthening activities by binding to the FAD-biding pocket of CRY1 in competition with FBXL3.

[0039] In one embodiment of the invention, the disclosed compound exhibits selectivity and high affinity for the CRY1 protein. Thus, the interaction is potent.

[0040] Cryptochromes (CRY1, CRY2) proteins have the characteristics of an N-terminal photolyase homology (PHR) domain. The PHR domain can bind to the flavin adenine dinucleotide (FAD) cofactor and a light-harvesting chromophore. The structure of CRY1 is characterized by an a/P domain and a helical domain (Lin and Todo, 2005).

[0041] In certain aspects, the compound binds the PHR region of CRY1 which is a critical domain for the rhythmicity of the cells (Khan et al., 2012). Docking pose and mutational analysis show that the compound binds to W399 in FAD binding pocket and R293 which connects FAD binding pocket to the secondary pocket. In another embodiment, binding residues of the compound are R293, W292 and W399 in CRY1. Different conformational preferences allowed the compound to specifically bind to CRY1 but not CRY2 due to the steric hindrance governed by W417 and W310. Yet, results confirm the specific binding of the compound to CRY1.

[0042] The compound directly targets the clock protein, CRY1 and lengthens the period of the circadian rhythm in human cell lines. Although period shortening molecules were previously disclosed as CRY destabilizers, GO044, GO200, and GO211 shortened the period while enhancing the CRY stability (Oshima et al., 2015).

[0043] Moreover, it is found that the compound affects the amplitude of circadian rhythm with increasing period length by decreasing the amount of CRY1 in the nucleus without affecting the protein levels in negative arm PER2, BMAL1 or CLOCK. According to the invention, the compound dampens circadian rhythm amplitude. Further in vivo studies showed that the compound has half-life of 6 h in blood and destabilized CRY1 in a mammal. The compound also reduces half-life of CRY1 and overall CRY1 amount. According to the invention, the compound decreases CRY1 level at certain time points and increases circadian clock output genes, e.g. Per2 and Dbp as expected when repressor capacity is attenuated.

[0044] As used herein, the term “destabilize”, “destabilization” or “destabilizing” refers to accelerated degradation or reduced half-life of CRY1 in the nucleus. This, in turn, causes the reduction in suppression or repressor activity of CRY1.

[0045] The term “a therapeutically effective amount” of a compound of the present invention refers to a non-toxic and sufficient amount of the compound of the present invention that will elicit the biological or medical response of a subject, for example, reduction or inhibition of the protein activity or protein: protein interaction, or ameliorate symptoms, alleviate conditions, slow or delay disease progression, or prevent a disease or disorder, etc.

[0046] All of the various embodiments of the present invention as disclosed herein relate to methods of treating and/or preventing various diseases and disorders as described herein. As stated herein the compound used in the method of this invention is capable of destabilizing CRY1 protein. It is known that cryptochromes also affect human health, including cancer, sleep disorders, and many physiological disorders.

[0047] The invention further provides methods for the treatment or prevention of circadian rhythm related disorders and diseases. Non-limiting examples of circadian rhythm disorders include aging, sleep disorders, altered metabolism (metabolic syndromes), obesity, diabetes, mood disorders, cancer and cardiovascular diseases. Mood disorders including major depressive disorder, bipolar I disorder; sleep disorders including circadian rhythm sleep disorders such as shift work sleep disorder, jet lag syndrome, advanced sleep phase syndrome, non-24-hour sleep-wake syndrome, irregular sleep-wake rhythm and delayed sleep phase syndrome.

[0048] In a preferred embodiment of the invention, the circadian rhythm related disease is cancer.

[0049] In another embodiment the compound enhances apoptosis in mammalian cancer cells such as p53.sup.−/− MEF cells. The toxicity and pharmacokinetic parameters from mice studies suggested that the compound can be used to improve the effectiveness of cancer treatment related with p53 mutations and other type of diseases related with CRY1.

[0050] Importantly, knockdown of the Crys in p53.sup.−/− mice or cell-lines improved sensitivity to cancer chemotherapy by activating tumor suppressor genes (Lee et al., 2013; Ozturk et al., 2009). In addition, overexpression of Per2 genes in human pancreatic cancer cells prevented cell proliferation, initiated apoptosis and behaved synergistically with cisplatin (Oda et al., 2009) thereby suppressed the tumor growth.

[0051] According to the invention, it is found that the compound as CRY1 destabilizer is also Per2 enhancer. In another embodiment of the invention, the compound is used as novel anti-cancer therapeutic agent. Since the compound decreases CRY1 level and enhances the level of Per2 both in cell-line and in vivo, the compound is a useful remedy for cancer by promoting apoptosis.

[0052] Moreover, the invention relates to a pharmaceutical composition comprising such compounds, uses and methods of use for such compounds in the treatment and/or prevention of disorders associated with the circadian rhythm. In other embodiment of the present invention, a pharmaceutical composition comprising the compound is useful in the treatment and/or prevention of circadian rhythm related diseases and disorders due the destabilization of CRY1.

[0053] The present invention relates to pharmaceutical compositions comprising a pharmaceutical carrier and a therapeutically effective amount of a compound of Formula I, or a pharmaceutically acceptable salt thereof.

[0054] The present invention also relates to pharmaceutical compositions to treat and/or prevent a CRY1-mediated disorders and/or diseases, such as cancer related to the circadian rhythm.

[0055] In one aspect, the disclosure relates to a method for the manufacture of a medicament for destabilizing CRY1 in a mammal comprising combining a therapeutically effective amount of a disclosed compound with a pharmaceutically acceptable carrier or diluent.

[0056] The present invention provides a method for identifying a compound for destabilizing CRY1. The method can be established using systems for pharmaceutical screening that are well known in the art.

[0057] In one aspect, the present invention provides a method for identifying a compound that destabilize CRY1, wherein the method comprises contacting a compound with CRY1 protein under conditions allowing for the interaction, and determining whether the compound leads to reduction in CRY1 level by using a system that uses a signal and/or a marker generated by the interaction between the compound and CRY1 to detect presence or absence or change of the signal and/or the marker. The term “signal” as used herein refers to a substance that can be detected directly by itself based on the physical properties or chemical properties thereof. The term “marker” refers to a substance that can be detected indirectly when the physical properties or biological properties thereof are used as an indicator.

[0058] These examples are intended to representative of specific embodiments of the invention, and are not intended as limiting the scope of the invention.

SPECIFIC EMBODIMENTS

[0059] In these embodiments, a structure-based design was applied to find small molecules that specifically bind to the CRY1 protein. After identifying candidate molecules by virtual screening, experimental studies lead to discover a compound (Formula I) that specifically binds to CRY. The compound, named hereafter FORMULA I, enhanced the degradation rate of CRY1 and modulated the period of U2-OS Bmal1-dLuc cells. It destabilizes CRY1 protein by binding to the FAD-binding packet of CRY1 in the nucleus both in vivo and in vitro. Further studies indicated that Formula I dampens the amplitude of the circadian rhythm at the cellular level by promoting the negative arm of the transcriptional/translational feedback loop with increasing the period length. In addition, pharmacological studies with mice indicated that FORMULA I had no toxic effect with half-life of ˜6 h in blood. In addition, subcellular fractionation studies from mice liver indicated that FORMULA I selectively decrease CRY1 level in the nucleus. Furthermore, FORMULA I mediated CRY1 reduction enhanced cisplatin-induced apoptosis in Ras transformed p53-null fibroblast cells. Effect of FORMULA I on the oxalipilation-induced apoptosis makes it a very promising agent to treat p53 mutant dependent forms of cancer and other CCRY1 related diseases.

EXAMPLES

Example 1 in Silico Search for Compounds that Interact with CRY1

[0060] Molecular Dynamics

[0061] The mouse CRY1 (mCRY1) structure (PDB ID: 4K0R) was used to identify small molecules targeting its photolyase (PHR) domain. Before docking studies, molecular simulation was performed on CRY1 to obtain a structure similar to that found under physiological conditions. Firstly, the structure of CRY1 was solvated in a rectangular box and neutralized with counter ions. Subsequently, the system was minimized, heated up to physiological temperature (310° K) and simulated for 10 ns. CHARMM-PARAM22 force field was used for the molecular dynamics (MD) simulations. RMSD of backbone atoms showed convergence after initial increase upon minimization. The last frame of the simulation was utilized as the receptor for the docking analysis.

[0062] Docking Setup

[0063] More than 8 million small molecules with non-identified functions were used as ligands for the docking. Molecules were filtered according to the following criteria to eliminate non-relevant molecules: molecules should have less than 7H-bond donor, less than 12H-bond acceptor, less than 600 Da molecular weight, log P<7, less than 8 rotatable bonds, at least 3 aromatic rings, and at least 4 rings. Openbabel, Autodock4.2, Autodock Tools4 (Morris et al., 2009) and Autodock (Trott and Olson, 2010) program packages which are free for academic purposes, were utilized to prepare ligands (small molecules) for the docking. Commercially available small molecule libraries with non-identified function were used as ligands. AutoDock Vina (Trott and Olson, 2010) was used to screen approximately 2 million commercially available small molecules filtered by “Lipinski's Rule of Five” (Lipinski et al., 2001). Target pocket for FAD and FBXL3 binding site was determined based on the CRY-FBXL3 crystal structure (Xing et al., 2013) Autodock Tools4 or PyMol (http://pymol.sourceforge.net/) software were used to visualize the docking results and protein structure, respectively.

[0064] A final number of 200 compounds with affinities ranging from −9 to −13.5 kcal/mol were then tested experimentally.

Example 3 Cell Cytotoxicity Test

[0065] Human osteosarcoma U2-OS cell lines were used for the cytotoxicity assay. Cells were seeded in triplicate to clear 96-well plates with 4000 cells/well then grown for 48 h. Cells were treated with molecules at desired concentrations (final DMSO concentration 0.5%) in DMEM. Cells were incubated with molecules for 48 h. Cell viability was measured by adding tetrazolium dye 3-[4,5-dimethylthiazol-2-yl]-2,5 diphenyl tetrazolium bromide (MTT) which is converted to insoluble purple color formazan as a result of the mitochondrial activity. To measure the purple color after incubating cells with MTT reagent medium was replaced with DMSO:EtOH (50:50) mixture for 4 hours and absorbance of wells were measured at 570 nm by the spectrophotometer. Cells treated with 5% final DMSO concentration (known as toxic to cells) as negative controls.

Example 4 Real-Time Monitoring of Circadian Rhythm

[0066] This assay was performed with two different equipment: Synergy H1 (BioTek) with 96-well plate and LumiCycle luminometer (Actimetrics) with 35 mm plates. Initial screening of molecules to determine their effect on the circadian period was performed in 96-well plate via Synergy H1. Clear 35-mm plates are used in LumiCycle luminometer which provides high resolution data describing the circadian oscillation. For 96-plate tests, 50000 U2-OS Bmal1-dLuc cells were seeded on an opaque 96-well plate and cultured overnight. Next day cells were reset by adding dexamethasone (DXM) (0.1p M final) for 2 h. Then medium is changed to bioluminescence recording media which contains the following in 1 L: DMEM powder (sigma D-2902, 10×1 L), 0.35 gr sodium bi-carbonate (tissue culture grade, sigma S5761), 3.5 gr D (+) glucose powder (tissue culture grade, sigma G7021), 10 mL 1M HEPES buffer (Gibco 15140-122), 2.5 mL Pen/Strep (100 ug/ml), 50 mL 5% FBS and up to 1 L sterile milliQ water. Luciferin is added freshly with 0.1 mM final concentration. Molecules were added to the bioluminescence recording media at desired concentration (0.5% final DMSO concentration). Plates were sealed with optically clear film to prevent evaporation and gas exchange thereby to maintain homeostasis of the cells.

[0067] Luminescence values were recorded at 32° C. for each 30 minutes with 15 seconds integration time via Synergy H1 luminometer for a week. For LumiCycle, 400×10.sup.3 U2-OS Bmal1-dLuc or NIH3T3 mPer2-dLuc cells were seeded to 35 mm plates and then procedure given above was followed with a change in the last step. Plates were sealed with vacuum grease and placed to LumiCycle. Each plate was recorded continuously every 10 minutes for 70 seconds at 37° C. via photomultiplier tubes. Period and amplitude data were obtained from LumiCycle Analysis software. To detect the effect of FORMULA I in the absence of CRYs, Cry1.sup.−/−/Cry2.sup.−/− mouse embryonic fibroblasts (CRYDKO MEFs) transiently transfected with pGL3-Per2-Luc (luciferase reporter) were used. 3×10.sup.5 CRYDKO cells were seeded in 35 mm clear plates. Next day, cells were transfected with 4000 ng pGL3-Per2-Luc via Fugene6 transfection reagent according to the manufacturer's instruction. In short, 3:1 ratio of Fugene6 in μl against transfected DNA amount in μg was kept in transfections. 72 h after transfection cells were synchronized with DXM for two hours. Then, medium was changed with lumicycle medium having DMSO or molecule, sealed with vacuum grease, and placed to LumiCycle.

Example 5 CRY-LUC Cloning

[0068] To insert Cry1-Luc, Cry2-Luc constructs and only Luc into pcDNA4A-myc-his plasmid, coding sequence of mouse Cry1 and firefly Luciferase in pG5luc plasmid (Addgene) was amplified with primers having EcoRV-NotI and NotI-XhoI flanking sites for Crys and Luc, respectively. Product size was verified by visualizing in agarose gel and product was isolated from the gel by using NucleoSpin PCR and Gel purification kit (Macherey Nagel). pcDNA4A plasmid having Luc was double digested with NotI and XhoI and used as insert; Cry1 pcDNA4A-myc-his and Cry2 pcDNA4A-myc-his plasmids were double digested with NotI and XhoI FastDigest enzymes (Thermo Scientific) and used as host plasmids. Hosts were treated with FASTAP (Thermo Scientific) to prevent self-annealing. After gel isolation and cleaning inserts with Gel purification kit (Macherey Nagel) and destination vectors were ligated by using T4 DNA ligase (Thermo Scientific).

Example 6 Site Directed Mutagenesis

[0069] Quick-change method was used for the site-directed mutagenesis. The primers were designed to have around 30 base pairs with the designated base changed in the middle of the primer. All the primer sequences for site-directed mutagenesis can be found. The PCR reaction mixtures contained 0.3 mM dNTP, 5 μl of 10× Phusion GC Buffer (Thermo Scientific), 3% DMSO, 1 μM of each primer, 50 ng of the template plasmid (mCry1 in pcDNA4A) and 1 unit of Phusion DNA polymerase in a 50 μl of final volume. The reaction conditions were set to 98° C. for 30 seconds, 55° C. for 30 seconds and 68° C. for 5 minutes, 18 cycles. PCR products were visualized in 1% agarose gel. The samples with correct sized bands were digested with 1 unit of DpnI FastDigest enzyme (Thermo Scientific) for 1 hour at 37° C. and then 5 μl of sample was transformed to E. coli DH5α cells. Colonies were picked to culture and then plasmids were isolated via miniprep (Macherey Nagel). Sanger sequencing (Macrogen) was utilized to confirm the mutations.

Example 7 CRY-LUC Degradation Assay

[0070] 40 ng of Cry1-Luc, Cry2-Luc, mutant Cry1-Luc plasmids or 5 ng Luc plasmid were reverse transfected to 4×10.sup.4 HEK293T cells on opaque 96-well plate with flat bottom via PEI transfection reagent. 24 h after transfection, cells were treated with molecules or solvent (DMSO). 24 h of post molecule treatment cells were treated with luciferin (0.4 mM final) and HEPES (10 mM final and pH=7.2). After 2 h, cycloheximide (20 μg/ml final) was added to wells to stop protein synthesis. Plate was sealed with optically clear film and placed to Synergy H1. Luminescence readings were recorded every 10 min at 32° C. for 24 h. Half-life of protein was calculated via one-phase exponential decay fitting function in GraphPad Prism5 software. For each molecule or control at least three replicates were done in each experiment.

Example 8 Protein Immunoblot

[0071] Cells were lysed in RIPA buffer (50 mM Tris, 150 mM NaCl, 1% Triton-X, 0.1% SDS) with fresh Protease inhibitor cocktail (PIC). After centrifugation at 13000 rpm for 15 minutes at 4° C., supernatant was used to determine the protein amount using Pierce Protein Assay (Thermo Scientific) according to the manufacturer's instruction. Mice liver samples were homogenized and lysed with Dounce homogenizer and RIPA buffer. After homogenization samples were incubated 10 minutes on ice. After centrifugation 13000 rpm 15 minutes at 4° C. supernatant was used for the whole cell lysate. Subcellular fractionation of liver samples: Liver samples were homogenized with cytosolic lysis buffer (10 mM HEPES pH 7.9, 10 mM KCl, 0.1 mM EDTA, 0.05% NP40, proteasome inhibitor) by pipetting 40 times with a cut tip. Then samples were incubated 10 minutes on ice and centrifuged for 3 minutes at 3000 rpm at 4° C. Supernatant was saved in a new tube, and pellet was processed for the nuclear fraction. Supernatant was centrifuged at 13000 rpm for 3 minutes at 4° C. where new supernatant saved as the cytosolic fraction. Pellet was wash with cytosolic buffer and centrifuged 3 minutes at 3000 rpm at 4° C. and pellet was dissolved in nuclear lysis buffer (20 mM HEPES pH 7.9, 0.4M NaCl, 1 mM EDTA, 10% Glycerol, proteasome inhibitor), sonicated (60% power, 2 times 10 seconds×3 cycles), and centrifuged 13000 rpm for 5 minutes at 4° C. Supernatant is the nuclear fraction. After determining the protein amount, all lysates described above were supplemented with 4× Laemmli buffer (277.8 mM Tris HCl pH: 6.8, 4.4% LDS, 44.4% (w/v) glycerol, 0.02% Bromophenol blue, (freshly added) 5% volume of beta Mercaptoethanol) and boiled at 950 C for 10 minutes. Lysates mixed with Laemmli buffer were resolved in SDS-PAGE and transferred to PVDF membrane (Millipore). Membrane was blocked with 5% milk solution in 0.15% TBS-Tween for 1 hour and then incubated overnight with the following primary antibodies where they necessary: CRY1 (Bethyl Catalog No. A302-614A), CRY2 (Bethyl Catalog No. A302-615A), PER2 (Bethyl Catalog No. A303-109A), BMAL1 (Santa Cruz, sc-365645), anti-Myc ( ), anti-His (Santa Cruz SC-8036) BetaActin (Cell Signaling, 8H10D10), AlphaTubulin (Sigma, T9026), HistoneH3 (Abcam, ab1791). After washing membranes with 3 times for 5 minutes with 0.15% TBS-Tween, membranes were incubated 1 hour with appropriate HRP conjugated secondary mouse (Santa Cruz SC-358920) or rabbit (Cell Signaling, 7074) antibodies. ECL buffer system (Advansta WesternBright) was used to visualize HRP chemi-luminescence via BioRad ChemiDoc Touch visualizer.

Example 9 RNA Isolation and Real Time (RT) Quantitative PCR (qPCR)

[0072] QIAGEN RNeasy Mini Kit was used to isolate the mRNA. Protocol provided by the manufacturer was followed. On-column DNase treatment was performed with the DNase enzyme provided with the kit. Dounce homogenizer was used for the homogenization of the liver samples and followed protocol provided by the manufacturer to isolate RNA. Quantity of RNA was determined by Nanodrop 2000 (Thermo Scientific). Quality of RNA was verified by running in ˜0.5% agarose gel prepared with DEPC water and visualizing under UV light. ˜400 ng of each RNA sample were subjected to first strand cDNA synthesis with MMLV-reverse transcriptase (Thermo) as the following: RNAs were mixed with 2 μl Oligo(dT)23, 1 μl 10 mMdNTP mix, and nuclease-free H.sub.2O to a final volume of 10 μl (mix1). Mix1 was incubated at 65° C. for 5 minutes to denature the possible secondary structures of RNA and primers which may prevent long cDNA synthesis then mixture was incubated at 4° C. for 5 minutes. Mixture2 (mix2) containing 2 μl 10× reverse transcription buffer, 0.2 μl Ribolock RNase inhibitor, 1 μl Revert Aid Reverse Transciptase and 6.8 μl nuclease-free H.sub.2O was added to mix1. Mixture of mix1 and mix2 (totally 20 μl) was incubated at 42° C. for 1 hour and then at 65° C. for 20 minutes to inactive the enzymatic activity. Volume of each sample was completed to 100 μl with nuclease-free H.sub.2O. For quantitative real time PCR (qRT-PCR) analysis cDNAs were further diluted 5-fold (1:5). mRNA expression levels were calculated by qRT-PCR with the SYBR Green. Gapdh gene was used as an internal control. A sample qRT-PCR reaction is the following: 8 μl SYBR Green, 3 μl cDNA (from 5-fold diluted solution), 1 μl forward and reverse primer mix (0.5 μM final), 8 μl nuclease-free H.sub.2O. All reactions were performed in biological triplicates (each triplicate with two technical replicates), and the results were expressed relative to the transcript level of Gapdh in each sample using the 2.sup.−ΔΔCT method. qRT-PCR was run with the following cycling protocol: 95° C. 10 seconds denaturation, 57 to 62° C. for 20 seconds annealing (the degree is determined by primer type) and 72° C. for 30 seconds of elongation, 35 cycles. List of primers used for the qRT-PCR can be found in Table 1 indicated as RT_GeneName.

TABLE-US-00001 TABLE 1 Primers for the site-directed mutagenesis. Luc-pcDNA-NotI-F GCACAGTGGCGGCCGCTCATGGAAGACGCCAAAAAC (SEQ ID NO: 1) Luc-pcDNA-XhoI-R TCTAGACTCGAGCACGGCGATCTTTCC (SEQ ID NO: 2) mCRY1-pcDNA- TTCTGCAGATATCCAATGGGGGTGAACGCCGTG (SEQ ID NO: 3) EcoRV-F mCRY1-pcDNA- AGACTCGAGCGGCCGCCAGTTACTGCTCTGCCGCTG (SEQ ID NotI-R NO: 4) mCRY2-pcDNA- TTCTGCAGATATCCAATGGCGGCGGCTGCTGTG (SEQ ID NO: 5) EcoRV-F mCRY2-pcDNA- GAGCGGCCGCCACTGTGCGGAGTCCTTGCTTGCTGG (SEQ ID NotI-R NO: 6) mCRY1_W399L_F GCTGGAAGTTGGATGTTGCTGTCCTGCAGTTCC (SEQ ID NO: 7) mCRY1_W399L_R CGACCTTCAACCTACAACGACAGGACGTCAAGG (SEQ ID NO: 8) mCRY1_R293A_F CTTTATGGGCAACTCCTGTGGGCTGAATTTTTTTATACAGCAG (SEQ ID NO: 9) mCRY1_R293A_R CTGCTGTATAAAAAAATTCAGCCCACAGGAGTTGCCCATAAAG (SEQ ID NO: 10) RT_hBMAL1_F GCCCATTGAACATCACGAGTAC (SEQ ID NO: 11) RT_hBMAL1_R CCTGAGCCTGGCCTGATAGTAG (SEQ ID NO: 12) RT_hCRY1_F ACAGGTGGCGATTTTTGCTTC (SEQ ID NO: 13) RT_hCRY1_R TCCAAAGGGCTCAGAATCATACT (SEQ ID NO: 14) RT_hCRY2_F CTACCGGGGACTCTGTCTACT (SEQ ID NO: 15) RT_hCRY2_R ACTGGGTAGTGGTCTTGGGC (SEQ ID NO: 16) RT_hDBP_F GAGGAACTTAAGCCCCAGCC (SEQ ID NO: 17) RT_hDBP_R CTCGTTGTTCTTGTACCGCC (SEQ ID NO: 18) RT_hPER2_F GCGTGTTCCACAGTTTCACC (SEQ ID NO: 19) RT_hPER2_R GGCTTTTCCGGACACTGACA (SEQ ID NO: 20) RT_hGAPDH_F TGCACCACCAACTGCTTAGC (SEQ ID NO: 21) RT_hGAPDH_R ACAGTCTTCTGGGTGGCAGTG (SEQ ID NO: 22) RT_mGapdh_F AACTTTGGCATTGTGGAAGG (SEQ ID NO: 23) RT_mGapdh_R ACACATTGGGGGTAGGAACA (SEQ ID NO: 24) RT_mPer2_F GAGCGCCACCAAGTGACGG (SEQ ID NO: 25) RT_mPer2_R GGTGGGACTTGGGGAGAAGT (SEQ ID NO: 26) The red color indicates the mutated codon.

Example 10 CRY Repression Assay

[0073] 4×10.sup.4 HEK 293T cells were reverse transfected with a mixture of 50 ng pSport6-Bmal1, 125 ng pSport6-CLOCK, 50 ng pGL3-mPer1::luc, 2.5 ng or higher doses of pcDNA4A-Cry1 (WT or mutant) and empty Sport6 (to equalize the transfected amount of DNA totally 300 ng) in a 96-well opaque plate via PEI transfection reagent. As a control same plasmid mixture without Cry1 was transfected to determine the activity of CLOCK/BMAL1 dependent transactivation in absence of the repressor. In each independent experiment transfections were done in triplicates for each condition. The plates were incubated for 24 h at 37° C., 5% CO2. Firefly luciferase and renilla luciferase expression was determined using the Dual-Glo Luciferase Assay System (Promega) using manufacturer's protocol.

Example 11 Pull-down Assay with Biotinylated Molecule

[0074] 10 μg of Cry1-pcDNA4, Cry2-pcDNA4 or Cry1-T5-pcDNA4 plasmids expressing His and Myc at the C-terminal of CRYs were transfected to HEK293T cell. After 48 h of transfection cells were harvested and lysed in lysis buffer (50 mM Tris pH 7.4, 2 mM EDTA, 1 mM MgCl2, 0.2% NP-40 (v/v), 0.1% sodium deoxycholate (w/v), 1 mM sodium orthovanadate, 1 mM sodium fluoride, and protease inhibitor cocktail (Thermo Scientific)). Lysates were incubated for 10 minutes on ice then mixed gently and incubated for another 10 minutes on ice. Then lysate was centrifuged for 10 minutes at 7000 g at 4° C. 5% of the supernatant was kept for input analysis. Remaining supernatant was divided to three and mixed with 2×binding buffer (100 mM Tris-HCl pH 7.4, 300 mM NaCl, 0.2% NP-40 (v/v), 2 mM sodium orthovanadate, 2 mM sodium fluoride, and protease inhibitor) with 1:1 ratio, incubated with rotation having either of these: a) DMSO, b) biotinylated molecule, c) biotinylated molecule and the competitor for 2 h. During this period NeutrAvidin Agarose resin (Thermo Scientific) was equilibrated with lysis buffer by mixing for 5 minutes via rotation at 4° C. three times. After each mix period, resins were centrifuged at 2500 g at 4° C. for 2 minutes and supernatant was discarded. After 2 h of mixing, lysates were incubated with equilibrated resins for 2 h to isolate the proteins interacting with the molecule. After 2 h, resins were centrifuged (2500 g, 2 minutes, 4° C.) supernatants were discarded and washed with 1×binding buffer six times. Finally, proteins bound to resin were isolated by adding 50p 4×Laemmli buffer and boiling at 95° C. for 10 minutes. Pulled-down samples were analyzed via western blot.

Example 12 In Vivo Mice Studies

[0075] Animals and their Synchronization

[0076] Male and female C57BL/6J mice, 8-12 weeks of age, weighing 18-24 g were used in the in vivo studies with FORMULA I. Mice were obtained from Kog University Animal Research Facility (KUTTAM) and experiments were conducted in accordance with the guidelines approved for animal experimental procedures by the Koc University Animal Research Local Ethics Committee (No: 2015/13).

[0077] Mice were housed in polystyrene cages up to four animals in the room equipped with temperature control (21±2° C.) and humidity (55±5%). Mice were housed under 12 h of light (L) in alternation with 12 h of darkness (D) (LD 12:12) prior to any intervention and the same lighting regimen continued to the end of the experiment. Water and food were provided ad libitum throughout the experiments. FORMULA I or vehicle were administered intraperitoneally to mice at the same time every day (three hours after light onset).

[0078] Preparation of FORMULA I Formulation

[0079] FORMULA I was dissolved in 2.5% DMSO and 15% Cremophor EL and then diluted with 82.5% isotonic sodium chloride solution (Vehicle=DMSO:Cremophor EL:0.9% NaCl; 2.5:15:82.5, v/v/v) on each study day to prepare freshly, prior to intraperitoneal injection. Solvents were reagent grade, and all other commercially available reagents were used as received unless otherwise stated.

[0080] Determination of the Dose Range

[0081] The dose levels to be used in the single dose toxicity study were selected according to the OECD Guidelines (Guidelines for the testing of chemicals, 2002). Male (n=2-3) and female (n=2-3) C57BL/6J mice were used at each dose level. Mice were treated with 5, 50, 300 or 1000 mg/kg single doses of FORMULA I intraperitoneally, one dose being used per group. Control mice (n=3 for both sexes) were only treated with vehicle (DMSO:Cremophor EL:0.9% NaCl; 2.5:15:82.5, v/v, i.p.). Careful observations of mice including body weight changes, body temperature, behavioral and clinical abnormality, and mortality were performed during 14 days, and gross necropsy of all animals was carried out at the end of the experiment. Body weight was measured every day as an index of general toxicity. FORMULA I-induced body weight change was expressed relative to body weight on the initial treatment day. The body temperatures of the mice were recorded by rectal homeothermic monitor (Harvard Apparatus, US) for 5 days following FORMULA I injection. Temperature measurements were performed at the same time each day. Food intake and water consumption were also monitored for 14 days. After the observation period, mice were exposed to isoflurane anesthesia and blood was collected by cardiac puncture. Mice were immediately sacrificed by cervical dislocation after blood collection. Hematological parameters were analyzed in blood samples.

[0082] Repeated Dose Toxicity Study: Determination of the Maximum Tolerated Dose of FORMULA I Upon 5-Day Administration

[0083] The single dose toxicity data were used to assist the selection of the doses in this repeated dose toxicity study. C57BL/6J mice (n=6 per group) were treated with 40, 80 or 150 mg/kg doses of FORMULA I intraperitoneally for 5 days. Control mice (n=4) were only treated with vehicle (DMSO:Cremophor EL:0.9% NaCl; 2.5:15:82.5, v/v, i.p.). Throughout the study, animals were monitored for mortality, clinical signs, body weight changes, body temperature, food and water consumptions, behaviour assessment and gross findings at the terminal necropsy. Body weights and body temperatures of mice were measured every day as an index of toxicity. Within 48 h after the last dose of FORMULA I administration, blood was collected from mice by cardiac puncture under isoflurane anesthesia. Hematological and biochemical analyzes were performed in blood. Liver, spleen, kidneys and lungs were removed and fixed in 10% formalin solution for histological examinations.

[0084] Repeated Dose Toxicity Study: Determining the Subacute Toxicity of 60 mg/kg FORMULA I Upon 14-Day Administration

[0085] According to the results of the 5-day maximum tolerated dose determination study, FORMULA I dose was determined as 60 mg/kg for the next 14-day subacute toxicity study. In this study, C57BL/6J mice (n=10) were treated with 60 mg/kg dose of FORMULA I intraperitoneally for 14 days. Control mice (n=5) were only treated with vehicle. Following this, aforementioned procedure (5-day maximum tolerated dose determination study) has been conducted in the same way.

[0086] Pharmacokinetic Studies

[0087] C57BL/6J female mice (n=4 per each time point) were treated with 100 mg/kg single dose of FORMULA I intraperitoneally. Blood samples were collected 0, 0.5, 1, 2, 4, 8, 12 and 24 h after administration of FORMULA I by cardiac puncture under isoflurane anesthesia. Plasma was obtained by centrifugation from heparinized tubes and stored at −80° C. until analysis. Brain tissues were quickly removed and stored at −80° C. for further processing. For assessment of the brain exposure of FORMULA I, levels in this tissue were only determined at 2nd (n=2) and 4th (n=2) hours according to maximum concentrations of the molecule in plasma.

[0088] Determination of FORMULA I Levels in Plasma and Brain

[0089] Liquid chromatography coupled to tandem mass spectrometry (LC-MS/MS) was used to obtain high mass accuracy data of the analytes in plasma samples for the determination of FORMULA I and Internal standard (IS) Loratadine. The instrument was operated in full scan mode and ion source parameters were optimised for the analytes. The optimized conditions of the electrospray ionization (ESI) source were as follows: gas temperature, 300° C.; gas flow, 10 L/min; nebulizer pressure, 25 psi; capillary voltage, 5500 V. ESI in the positive ion mode provides the best results for FORMULA I. For MS-MS detection, the protonated molecules were selected as precursor ions and the most abundant fragment ions obtained at collision energy of 22-20 eV were monitored as the product ions for FORMULA I and IS. MS-MS analysis was performed in the selected reaction monitoring (SRM) positive ionization mode, using mass transitions for FORMULA I m/z 472.1.fwdarw.353.4 [collision energy (CE)=22 eV] and Fragmentor 234 V, for IS; m/z 383.2.fwdarw.337.2 (CE=20 eV) and fragmentor 140 V. For the separation of the analytes, a conventional reversed-phase LC separation on C18-bonded silica was used, with Methanol: % 0.1 Formic acid (90:10, v/v) mobile phase. FORMULA I was extracted from plasma samples by using liquid-liquid extraction with Methanol. 10 μL of sample was injected into the LC-MS/MS system.

[0090] Pharmacokinetic Analysis

[0091] Peak plasma concentration (Cmax) and time to reach peak plasma concentration (tmax) values were directly obtained from the FORMULA I plasma concentration-time curve. The area under the plasma concentration-time curve from 0 to 48 h (AUC0-48 h) was calculated by the trapezoidal method. AUC0-∞ was obtained by addition of the extrapolated part after the last sampling time using standard techniques. Other pharmacokinetic parameters of FORMULA I were calculated by the non-compartmental method. Elimination rate constant (kel) was calculated from the terminal points of FORMULA I plasma concentration-time plot and the slope of this line was equal to kel. Terminal elimination half-life (t½) was calculated by ln-linear approximation of terminal points of the data. t½ and kel were interconverted with the following formula: t.sub.1/2=ln 2/k.sub.el

[0092] Circadian Behavioral Analysis

[0093] Mice were housed in individual cages within a temperature- and humidity-controlled, light-tight enclosure. Each cage contained a running wheel. Food and water were allowed ad libitum. Animals were entrained to a 12:12 h L:D cycle for ≥2 weeks before being released into constant darkness. Then, vehicle (n=5) and FORMULA I (n=6) administered to animals for 5 days and then animals were kept under constant conditions for more than 2 weeks. Locomotor activity monitoring, actogram creation, and period calculations were performed using ClockLab Data Collection (Actimetrics). Statistical analysis of period change was done through application of both a t test and an alternative, nonparametric Mann-Whitney test using the t.test( ) and wilcox.test( ) functions in R. Both tests resulted in a significantly (p<0.05) greater period among mutant as compared to wild-type mice.

Example 13 Statistical Analysis

[0094] All data were expressed as means±standard error of the means (SEM) for each studied variable. Statistical analyses were performed using GraphPad Prism for Windows (GraphPad Software, California, USA). The statistical significance of differences between groups was validated with either of these: Student's t-test and one- or two-way analysis of variance (ANOVA), following Tukey or Bonferroni post hoc tests, respectively. Type of significant test used in each experiment and their p-values were indicated in the figure legends.

[0095] Results

[0096] Identification of the Molecules Effect the Half-Life of the CRY

[0097] Initially, toxicity of selected molecules was assessed by MTT using immortalized human osteosarcoma (U2-OS) cells at concentrations of 20 μM, 10 μM and, 2.5 μM. Molecules with relative cell viability less than 90% at 2.5 μM were eliminated. Next, the effects of the nontoxic molecules on circadian rhythm were assed using U2-OS cells stably expressing Bmal1-luc construct. Analysis of the results indicated 14 molecules affect the circadian rhythm either by increasing or decreasing the period by 1 hour or more. In order to find molecules that either enhance or decrease half-life CRY, we used CRY1::LUC degradation assay where CRY1 was fused with Luciferase (LUC) at the C-terminal. In this assay the effect of the 14 molecules were measured according to the CRYL::LUC decay rate. After transfection of HEK293T cells with CRY1-LUC plasmids, cells were treated with these non-toxic molecules. Then cells were treated with cycloheximide (CHX) to inhibit the protein synthesis and bioluminescence was recorded for 18 h. Of these 14 molecules, 6 of them significantly decreased the half-life of CRY1-LUC. We focused on the molecules that destabilized CRY1 and tested their dose-dependent effect on the circadian rhythm of U2-OS Bmal1-dLuc cells. Among these 6 molecules, FORMULA I showed the best dose responsive effect. Thus FORMULA I was selected for further characterization.

[0098] Characterization of FORMULA I

[0099] Before we begin the characterization of the FORMULA I on circadian clock we first assed it effect on half-life on LUC and its toxicity on U2-OS cells in detail. FORMULA I had no effect on the stability of LUC and any toxic effect in dose dependent manner. We then determined the effect of FORMULA I on circadian rhythm using U2-OS Bmal1-dLuc cells and NIH 3T3 Per2-dLuc cells in a dose dependent manner. FORMULA I significantly lengthened the period and dampened the rhythm a dose-dependent manner with the EC50 value of ˜6.5 μM in U2-OS (FIG. 1B). FORMULA I treated NIH 3T3 cells exhibited similar phenotype in dose dependent manner. To eliminate the possibility that FORMULA I might affect the other proteins and, in turn, circadian rhythmicity we tested the effect of FORMULA I in Cry1.sup.−/−Cry2.sup.−/− mouse embryonic fibroblast cells (DKO-MEF) transfected with mPer2-luc plasmid. Results indicated that FORMULA I had no effect on was through CRY (FIG. 1C). We next determined the effect of the FORMULA I on the half-of both CRY1 an CRY2 by measuring the decay rate of CRY1-LUC and CRY2-LUC. To this end HEK 293T cells were transfected with Cry-Luc plasmids. Cells were, then, treated with cycloheximide to inhibit protein translation in the presences of the various amount of FORMULA I. Notably, FORMULA I reduces the half-life of CRY1 in dose dependent manner while there was no effect on the half-life of CRY2 (FIGS. 2A-2D). Next, unsynchronized U2-OS cells were treated with FORMULA I and the level of both CRY1 and CRY2 level were measured by Western blot. Consistent with our CRY-LUC assay, the level of CRY1 reduced while the CRY2 levels were comparable between FORMULA I treated cells and DMSO-treated cells (FIGS. 2E-2F) FORMULA I binds to CRY1 through R293 and W399 amino acid residues identified by Autodock Vina (FIG. 2G). Docking FORMULA I to CRY1 showed that indoline groups of FORMULA I and Trp399 interact through a strong pi-pi interaction. In addition, benzene group at the other side of the FORMULA I interacts with Arg293 through a pi-cation interaction (FIG. 2G). The replacement of these residues in CRY1 eliminates the binding of FORMULA I to CRY1. To test this, R293 and W399 of CRY1 were replaced with Ala and Leu by site directed mutagenesis, respectively. Before measuring the effect of FORMULA I on this CRY1 mutant, we confirmed CRY-1R293AW399L mutant retained its repressor activity with Per1-Luc assay using BMAL1/CLOCK in the presences of the mutant and wild type CRY1. We then measured half-life CRY1R293AW399L::LUC. FORMULA I had no effect on the half-life of CRY1-R293A-W399L compared to control (FIGS. 2H-2I). This approved that FORMULA I binds the computationally predicted region.

[0100] All these results showed FORMULA I binds to the FAD binding pocket in the PHR domain and specifically destabilizes CRY1.

[0101] Physical Interaction between FORMULA I and CRY1

[0102] To show the physical binding of the FORMULA I to CRY1, biotinylated-FORMULA I (bFORMULA I) was commercially synthesized by Enamine (Ukraine). To test whether bFORMULA I binds CRY1 plasmids have His-Myc tagged Cry1 and His-Myc tagged Cry2 were transfect to HEK293T cells. After preparation of the cell lysate, bFORMULA I was used to pull-down CRY1-HIS-MYC and CRY2-HIS-MYC in the presence and absence of the competitor (FORMULA I). Results indicated that FORMULA I physically binds to CRY1 but not to CRY2 (FIGS. 2J-2K). Binding of bFORMULA I to CRY1 disappeared in the presence of the free FORMULA I. To confirm the binding of the molecule to PHR domain of the CRY1 we performed a pull down assay between bFORMULA I and CRY1-T5 (the lack of 100 amino acids from C-terminal end). Result showed FORMULA I bound to the PHR domain (FIG. 2L). Furthermore, the activity of biotinylated FORMULA I was confirmed on circadian rhythm and half-life of CRY1 to make sure that biotinylation did not alter the function and binding of the molecule. Pull down assays along with mutagenesis studies suggested that FORMULA I physically binds to CRY1 through the FAD binding pocket.

[0103] To understand why CRY2 was unable to bind FORMULA I we performed computational studies on FAD binding region of the CRY2. We ran a 10 ns simulation of mouse CRY2 (mCRY2) (PDB ID: 4I6G) and used it for docking FORMULA I. FORMULA I could not interact with the residues W417 and R311 in CRY2, which are homologous to W399 and R293 of CRY1 (FIG. 2M). Thus, Autodock Vina predicted the binding energy of FORMULA I to CRY2 as −9.5 kcal/mol while it predicted that of CRY1 as −13.3 kcal/mol. To further understand the difference in the binding residues of FORMULA I between CRY1 and CRY2, we analyzed the equilibrated CRY1 and CRY2 structures utilized in docking simulations. Although residues in PHR of CRY1 and CRY2 are 77% identical, 88% similar, two of the critical residues (W399 in CRY1, W417 in CRY2; W292 in CRY1, W310 in CRY2) locate themselves differently in equilibrated CRY1 and CRY2 structures. To understand the conformational changes atoms were measured throughout the simulations. Dihedral angle around 500 for W399 CRY1 (W417 in CRY2) corresponds to conformation where tryptophan residue is parallel to R293 in CRY1 (R311 in CRY2) where values around 1000 corresponds to parallel position. Dihedral value around −1500 for W292 in CRY1 (W310 in CRY2) corresponds to parallel position of this residue with respect to R293 in CRY1 (R311 in CRY2), however >00 corresponds to perpendicular position (FIG. 2N). While side chains of W399 and W292 were mostly located parallel to R293 in CRY1 and left enough space FORMULA I to bind, W417 and W310 in CRY2 acquired a position perpendicular to R311 where they occupied most of the FORMULA I binding space in CRY2. Although W399 mainly maintained its position parallel to R293 in CRY1 (76% of the entire simulation), W310 kept its position perpendicular to R311 in CRY2 and filled the binding space of FORMULA I through the entire simulation. Superimposing the equilibrated structures of CRY1 and CRY2 showed clearly how these critical amino acid residues were located differently (FIG. 2P). As a result, parallel position of W399 and W292 allowed binding of FORMULA I to CRY1. However, perpendicular position of W417 and W310 to R311 precluded FORMULA I binding to CRY2. Similar results were verified from 50 ns independent simulations for both CRY1 and CRY2.

[0104] These results showed that the internal dynamics of CRY1 and CRY2 are different even at the very conserved region which can modulate their interactions with proteins or ligands, and thus their cellular roles.

[0105] Time-Dependent Effect of FORMULA I on the U2-OS Cells

[0106] To evaluate the effect of FORMULA I on the endogenous protein and mRNA level of clock genes, synchronized U2-OS cells were treated with 10 μM FORMULA I. Cells were harvested between 72-92 hours of post-synchronization at 4 h time intervals. FORMULA I decreased the level of CRY1, especially between 80-92 h (FIGS. 3A-3B). On the other hand, we observed increased CRY2 levels which is most likely to compensates for the reduction of CRY1. Analysis of mRNA level of Cry1 and Cry2 showed that FORMULA I changed the peak time without significantly changing their overall abundance (FIGS. 3C-3G).

[0107] Increase in clock output genes of the Dbp and Per2 mRNA levels also confirmed the decrease in the total repressor capacity of the cells treated with FORMULA I. Decreased mRNA and protein levels of BMAL1 indicates that FORMULA I did not affect BMAL1 post-translationally. All these results suggest that FORMULA I is a promising molecule to regulate circadian clock machinery through CRY1. To investigate pharmacological properties and activity of FORMULA I in vivo, it has been subjected to in mice studies.

[0108] Single, Repeated and Subactute FORMULA I Toxicity Studies in Mice

[0109] To evaluate the toxicity of the FORMULA I in vivo we first performed single dose toxicity study (SDT). FORMULA I was intraperitoneally (i.p.) administered to C57BL/6J mice at the doses of 5, 50, 300 and 1000 mg/kg. General toxicity was evaluated on the basis of mortality, body weight changes, body temperature, clinical signs, food and water consumptions, behavior assessment and gross findings at terminal necropsy. Animals treated with 1000 mg/kg of the FORMULA I exhibited the following clinical symptoms: dyspnea, hyporeflexia, reduced locomotor activity, piloerection, hunched posture and corneal opacity. This dose was considered lethal and animals were scarified for the ethical reasons. No mortality and clinical signs were observed in other doses (5, 50, 300 mg/kg). Compared to control mice (treated with vehicle where their body temperatures were 36.0-37.0° C.) mild hypothermia (33.5-35.1° C.) was observed in mice within 6 h after administrating the FORMULA I and body temperatures gradually increased in the next hours at the dose of 300 mg/kg (FIG. 4A). The body temperature of the animals were comparable to control groups at the dose of 5 mg/kg while the body temperatures of the animals were higher in animals treated with 50 mg/kg (FIG. 4A). We then measured weight loss on these animals for 15 days. The administration (FIG. 4B). There were no significant weight losses in animals treated with 5 mg/kg of the FORMULA I. All these result suggested that STD of 5 and 50 mg/kg were well-tolerated by mice.

[0110] We next determined the 5-day maximum tolerated dose (MTD) using 40, 80 or 150 mg/kg of FORMULA I with repeated injections for 5 days. A single death (1/6; 16.6%) among all tested doses was observed in the group of 150 mg/kg on the 3th day of injection. There were no observed clinical signs for the animals treated with 40 and 80 mg/kg of the FORMULA I. The following clinical signs were observed in animals treated with 150 mg/kg of the FORMULA I hyporeflexia, which were more prominent in the first three days of treatment and lightened on 4th and 5th day. The body temperature of the animals treated with 40 mg/kg of FORMULA I was comparable to the control animals. On the other hand mild hypothermia (33.4-35.8° C.) was measured in mice on the first day at doses of 80 and 150 mg/kg. Body temperatures increased gradually in the following days (FIG. 4C). The body weight losses were similar for all doses with exception at 3rd and 4th injections at the dose of 150 mg/kg where the highest mean body weight loss (6.3%) was observed on the 3rd day of injection (FIG. 4D). All these results suggested that doses of 5 and 80 mg/kg were well-tolerated by mice. We therefore decided to carry out subacute toxicity test to further evaluate the effect of the FORMULA I on animals using dose of 60 mg/kg for 14-days of repeated injections.

[0111] When FORMULA I was administered to animals once a day for 14 days no mortality and clinical signs were observed for the 60 mg/kg dose. Mild hypothermia (33.7-35.4° C.) was recorded in mice during injections (FIG. 4E). The highest mean body weight loss (3.7%) occurred on the first day following administration and body weights increased through the next 13 days of injections (FIG. 4F).

[0112] Determination of Pharmacokinetic Profile of FORMULA I

[0113] Mean plasma concentration-time curve of FORMULA I administered at 100 mg/kg single dose (i.p.) to female C57BL/6J mice were presented in FIG. 4G, and pharmacokinetic parameters of FORMULA I were given in Table 2.

TABLE-US-00002 TABLE 2 Plasma pharmacokinetic parameters of FORMULA I (100 mg/kg, single dose, i.p.) Parameters Values C.sub.max (ng/ml) 1150.52 ± 506.26    t.sub.max (h) 2-4 AUC.sub.0-24 (ng .Math. h/ml) 4921 ± 3069.09 AUC.sub.0-∞ (ng .Math. h/ml) 5194 ± 3134.00 k.sub.el (1/h) 0.127 ± 0.01    t.sub.1/2 (h) 5.5 ± 0.33.sup. 

[0114] FORMULA I plasma level was first detected at 0.5 h, reached maximum level at 2-4 h and was still quantifiable at 24 h using HPLC and Mass spectrophotometry. For the assessment of the brain exposure of FORMULA I, levels in this tissue were only determined at 2nd (n=2) and 4th (n=2) hours according to maximum concentrations of the molecule in plasma. FORMULA I molecule was detected in the brain tissue (FIG. 4H). All these results suggested that FORMULA I molecule has half-life in vivo and crosses the blood-brain barrier.

[0115] In Vivo Effect of FORMULA I

[0116] All in vitro studies suggested that FORMULA I binds and reduces half-life of CRY1. To assess its in vivo effect, FORMULA I was intraperitoneally (i.p.) administered into mouse at 25 mg/kg and 50 mg/kg doses. Mice were sacrificed 6 h after the injection and all organs were kept for downstream analysis. We could observe a slight decrease in CRY1 levels in the whole cell lysate of mouse liver cells (FIGS. 5A-5B).

[0117] Since CRYs are stabilized and degraded differently in cytosolic and nuclear compartments, we further analyzed the level of CRY1 in the cytosolic and nuclear fraction of the mouse liver. We fractionated the same liver samples and separately isolated cytosolic and nuclear proteins. Proteins, known to be specifically localized in nucleus (Histone-H3) and cytoplasm (Tubulin), were used as controls to evaluate the purity of the fractions. CRY1 abundance in nucleus was significantly low compared to controls in dose dependent manner (FIGS. 5C-5D). On the other hand, cytosolic levels of CRY1 in FORMULA I treated mice liver were not statistically significant compared to controls (FIGS. 5E-5F). To further explore the influence of FORMULA I on circadian transcriptional function in vivo, we used qPCR to measure the transcriptional level of Per2. The Per2 gene level significantly increased in mice treated with FORMULA I (FIG. 5G). All these suggested that FORMULA I is effective on CRY1 levels in mouse liver cells.

[0118] Effect of FORMULA I on Apoptosis in p53 Mouse Embryonic Fibroblast Cells

[0119] In previous studies it was reported that cytochrome mutation sensitizes the Ras transformed p53-null cells, but not cells with wild-type p53, to apoptosis induced by UV or UV mimetic agents e.g oxaliplatin. Using fibroblasts isolated from the skin of Cry1.sup.−/−Cry2.sup.−/−p53.sup.−/− and p53.sup.−/− mice, it has been shown that Cry deletion on the p53-null background sensitized the cells to bulky-DNA adduct-induced apoptosis (Lee and Sancar, 2011). With the expectation that FORMULA I would destabilize CRY1 and increase the effectiveness of UV mimetic chemotherapeutic agents, we performed apoptosis assay with Ras transformed p53-null MEF cell lines. In this assay, cells were treated by increasing dose of oxaliplatin for 16 h followed by FORMULA I treatment for 24 h and probed for apoptosis by measuring PARP cleavage. As chemotherapeutic agent, oxaliplatin was preferred since mutation of Cry sensitizes p53-null cells to apoptosis (Lee et al., 2013). We found that FORMULA I treatment sensitized Ras transformed p53-null MEF cell line to oxaliplatin-induced apoptosis measuring indicators of apoptosis cleaved PARP in dose dependent manner (FIGS. 6A-6B).

[0120] Effect of FORMULA I on Apoptosis in p53 Mouse Embryonic Fibroblast Cells

[0121] To investigate the effect of the Formula I on the behavior of mice, animals are treat with Formula I under constant dark conditions. As can be seen in FIGS. 7A-7D, animals treated with Formula I had approximately 14 min shorter period length compared with animals treated with vehicle. We next determined the amplitude of the animals. Formula 1 had statistically significant impact on the amplitude compared with control animals (FIG. 7D).

REFERENCES

[0122] Chen, Z., Yoo, S. H., Park, Y. S., Kim, K. H., Wei, S., Buhr, E., Ye, Z. Y., Pan, H. L., and Takahashi, J. S. (2012). Identification of diverse modulators of central and peripheral circadian clocks by high-throughput chemical screening. P Natl Acad Sci USA 109, 101-106. [0123] Chun, S. K., Jang, J., Chung, S., Yun, H., Kim, N. J., Jung, J. W., Son, G. H., Suh, Y. G., and Kim, K. (2014). Identification and validation of cryptochrome inhibitors that modulate the molecular circadian clock. ACS Chem Biol 9, 703-710. [0124] Czarna, A., Berndt, A., Singh, H. R., Grudziecki, A., Ladurner, A. G., Timinszky, G., Kramer, A., and Wolf, E. (2013). Structures of Drosophila Cryptochrome and Mouse Cryptochromel Provide Insight into Circadian Function. Cell 153, 1394-1405. [0125] Hirano, A., Yumimoto, K., Tsunematsu, R., Matsumoto, M., Oyama, M., Kozuka-Hata, H., Nakagawa, T., Lanjakornsiripan, D., Nakayama, Keiichi I., and Fukada, Y. (2013). FBXL21 Regulates Oscillation of the Circadian Clock through Ubiquitination and Stabilization of Cryptochromes. Cell 152, 1106-1118. [0126] Hirota, T., Lee, J. W., St John, P. C., Sawa, M., Iwaisako, K., Noguchi, T., Pongsawakul, P. Y., Sonntag, T., Welsh, D. K., Brenner, D. A., et al. (2012). Identification of Small Molecule Activators of Cryptochrome. Science 337, 1094-1097. [0127] Hirota, T., Lewis, W., Liu, A., Lee, J., Schultz, P., and Kay, S. (2008). A chemical biology approach reveals period shortening of the mammalian circadian clock by specific inhibition of GSK-3beta. Proc Natl Acad Sci USA 105, 20746-20751. [0128] Khan, S. K., Xu, H., Ukai-Tadenuma, M., Burton, B., Wang, Y., Ueda, H. R., and Liu, A. C. (2012). Identification of a Novel Cryptochrome Differentiating Domain Required for Feedback Repression in Circadian Clock Function. Journal of Biological Chemistry 287, 25917-25926. [0129] Lampson, M. A., and Kapoor, T. M. (2006). Targeting protein stability with a small molecule. Cell 126, 827-829. [0130] Lee, J. H., Gaddameedhi, S., Ozturk, N., Ye, R., and Sancar, A. (2013). DNA Damage-Specific Control of Cell Death by Cryptochrome in p53-Mutant Ras-Transformed Cells. Cancer Research 73, 785. [0131] Lee, J. H., and Sancar, A. (2011). Circadian clock disruption improves the efficacy of chemotherapy through p73-mediated apoptosis. Proceedings of the National Academy of Sciences 108, 10668. [0132] Lin, C., and Todo, T. (2005). The cryptochromes. Genome Biol 6, 220. [0133] Lipinski, C. A., Lombardo, F., Dominy, B. W., and Feeney, P. J. (2001). Experimental and computational approaches to estimate solubility and permeability in drug discovery and development settings. Adv Drug Deliv Rev 46, 3-26. [0134] Morris, G. M., Huey, R., Lindstrom, W., Sanner, M. F., Belew, R. K., Goodsell, D. S., and Olson, A. J. (2009). AutoDock4 and AutoDockTools4: Automated docking with selective receptor flexibility. J Comput Chem 30, 2785-2791. [0135] Oda, A., Katayose, Y. U., Yabuuchi, S., Yamamoto, K., Mizuma, M., Shirasou, S., Onogawa, T., Ohtsuka, H., Yoshida, H., Hayashi, H., et al. (2009). Clock Gene Mouse Period2 Overexpression Inhibits Growth of Human Pancreatic Cancer Cells and Has Synergistic Effect with Cisplatin. Anticancer Research 29, 1201-1209. [0136] Oshima, T., Yamanaka, I., Kumar, A., Yamaguchi, J., Nishiwaki-Ohkawa, T., Muto, K., Kawamura, R., Hirota, T., Yagita, K., Irle, S., et al. (2015). C—H activation generates period-shortening molecules that target cryptochrome in the mammalian circadian clock. Angew Chem Int Ed Engl 54, 7193-7197. [0137] Ozturk, N., Lee, J. H., Gaddameedhi, S., and Sancar, A. (2009). Loss of cryptochrome reduces cancer risk in <em>p53</em> mutant mice. Proceedings of the National Academy of Sciences 106, 2841. [0138] Schmalen, I., Reischl, S., Wallach, T., Klemz, R., Grudziecki, A., Prabu, J. R., Benda, C., Kramer, A., and Wolf, E. (2014). Interaction of Circadian Clock Proteins CRY1 and PER2 Is Modulated by Zinc Binding and Disulfide Bond Formation. Cell 157, 1203-1215. [0139] Solt, L. A., Wang, Y. J., Banerjee, S., Hughes, T., Kojetin, D. J., Lundasen, T., Shin, Y., Liu, J., Cameron, M. D., Noel, R., et al. (2012). Regulation of circadian behaviour and metabolism by synthetic REV-ERB agonists. Nature 485, 62-68. [0140] Trott, O., and Olson, A. J. (2010). AutoDock Vina: improving the speed and accuracy of docking with a new scoring function, efficient optimization, and multithreading. J Comput Chem 31, 455-461. [0141] Xing, W. M., Busino, L., Hinds, T. R., Marionni, S. T., Saifee, N. H., Bush, M. F., Pagano, M., and Zheng, N. (2013). SCFFBXL3 ubiquitin ligase targets cryptochromes at their cofactor pocket. Nature 496, 64-+. [0142] Yoo, S. H., Mohawk, J. A., Siepka, S. M., Shan, Y., Huh, S. K., Hong, H. K., Kornblum, I., Kumar, V., Koike, N., Xu, M., et al. (2013). Competing E3 ubiquitin ligases govern circadian periodicity by degradation of CRY in nucleus and cytoplasm. Cell 152, 1091-1105.