Tumor Antigens for Determining Cancer Therapy
20260049112 ยท 2026-02-19
Inventors
- Ugur Sahin (Mainz, DE)
- Claudia Paret (Mainz, DE)
- Kirsten Vormbrock (Mainz, DE)
- Christian Bender (Mainz, DE)
- Petra Simon (Mainz, DE)
- Christoph Hartmann (Frankfurt, DE)
- Stefanie Hubich (Mainz, DE)
- Thomas Bukur (Mainz, DE)
- Thorsten Litzenberger (Olsbrucken (DE), DE)
Cpc classification
G01N33/5758
PHYSICS
A61K2039/507
HUMAN NECESSITIES
C12Q2600/106
CHEMISTRY; METALLURGY
C07K14/4748
CHEMISTRY; METALLURGY
G01N2333/47
PHYSICS
A61P15/00
HUMAN NECESSITIES
A61P35/00
HUMAN NECESSITIES
International classification
Abstract
The present invention relates to the treatment of cancer, in particular breast cancer, particularly triple-negative breast cancer. More particularly, the invention concerns methods and means for cancer treatment involving a specific set of tumor antigens.
Claims
1. A method for treating breast cancer in a patient having breast cancer, the method comprising: (a) determining an expression pattern of a set of tumor antigens in a sample from the patient having breast cancer, wherein the set of tumor antigens comprises CXorf61, PRAME, and CAGE1; (b) diagnosing the patient having breast cancer as needing a cancer therapy regimen based on the determined expression pattern of CXorf61, PRAME, and CAGE1; and (c) treating the patient having breast cancer with an immunotherapeutic that targets those tumor antigens of the set of tumor antigens expressed in the patient.
2. (canceled)
3. The method of claim 1 wherein the expression pattern is determined in a sample obtained from the breast cancer patient.
4. The method of claim 3 wherein the sample comprises cancer cells.
5. The method of claim 1 wherein determining the expression pattern comprises a quantitative and/or qualitative determination of the expression of the tumor antigens.
6. The method of claim 1 wherein determining the expression pattern comprises determining the expression of RNA and/or protein of the tumor antigens.
7.-9. (canceled)
10. The method of claim 1 wherein the immunotherapeutic provides one or more T cell epitopes of each of those tumor antigens of the set of tumor antigens which are expressed in cancer cells of the patient.
11. (canceled)
12. The method of claim 10 wherein the immunotherapeutic is an RNA vaccine.
13. A method for preventing or treating breast cancer in a patient comprising administering to said patient an immunotherapeutic targeting each tumor antigen of a set of tumor antigens, wherein the set of tumor antigens comprises CXorf61, PRAME, and CAGE1.
14. (canceled)
15. The method of claim 13 which comprises inducing an immune response in the patient against each tumor antigen of the set of tumor antigens.
16. The method of claim 15 wherein the immune response comprises a cellular response.
17. The method of claim 16 wherein the immunotherapeutic is a vaccine and the cellular response is induced by administering the vaccine providing one or more T cell epitopes of each tumor antigen of the set of tumor antigens to the patient.
18. The method of claim 17 wherein the one or more T cell epitopes are comprised in the vaccine in one or more peptides or polypeptides wherein said one or more peptides or polypeptides following administration are processed to produce the one or more T cell epitopes.
19. The method of claim 17 wherein the vaccine is an RNA vaccine.
20.-21. (canceled)
22. A set of vaccine products comprising vaccine products for inducing an immune response against each tumor antigen of a set of tumor antigens in a patient, wherein the set of tumor antigens comprises CXorf61, PRAME, and CAGE1.
23. (canceled)
24. The set of vaccine products of claim 22 wherein the immune response comprises a cellular response.
25. The set of vaccine products of claim 22 wherein the vaccine products when administered to a patient provide one or more T cell epitopes of each tumor antigen of the set of tumor antigens.
26. The set of vaccine products of claim 25 which comprises one or more peptides or polypeptides comprising the one or more T cell epitopes.
27. The set of vaccine products of claim 25 wherein the vaccine products are RNA vaccines products encoding one or more peptides or polypeptides comprising the one or more T cell epitopes.
28.-33. (canceled)
Description
FIGURES
[0297]
[0298]
[0299]
[0300] Distribution of transcripts for CXORF61 (
[0301]
[0302]
[0303]
[0304]
[0305]
[0306]
[0307] The known CXorf61 sequence (NM_001017978.3) is indicated. The new predicted sequence is in bold.
[0308]
[0309]
[0310] The indicated normal tissues (n=65) were analysed by qRT-PCR with primers specific for CXorf61 or CXorf61-isol. Relative expression was calculated with the Ct method using HPRT as housekeeping gene.
[0311]
[0312] 29 triple negative breast cancer tissues were analysed by qRT-PCR with primers specific for CXorf61-isol. Relative expression was calculated with the Ct method using HPRT as housekeeping gene.
[0313]
[0314] As reference the CAGE1 structure as described in UCSC was used. The position of the primers used for expression analysis is shown. SEQ ID NO: 45 [NEW EXON 1]: light grey, SEQ ID NO: 46 [NEW EXON 2], dark grey
[0315]
[0316] Expression of CAGE1-Tron1 (black columns) and CAGE1-Tron2 (grey columns) was analysed by qRT-PCR with primers 5527+4783 and primers 4782+5540 respectively in the indicated normal tissues. A positive tumor tissue was used as control. Relative expression was calculated with the Ct method using HPRT as housekeeping gene.
[0317]
[0318] 34 Tissues from Triple negatives breast cancer patients were analysed by qRT-PCR with primers specific for CAGE1-Tron1 (primers 5527+4783, dark columns) and CAGE1-Tron2 (primers 4782+5540, grey columns) respectively. Relative expression was calculated with the Ct method using HPRT as housekeeping gene.
Examples
[0319] The techniques and methods used herein are described herein or carried out in a manner known per se and as described, for example, in Sambrook et al., Molecular Cloning: A Laboratory Manual, 2.sup.nd Edition (1989) Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. All methods including the use of kits and reagents are carried out according to the manufacturers' information unless specifically indicated.
Example 1: Establishing a Set of Tumor Antigens Useful in a Large Fraction of Cancer Patients
[0320] It was assessed whether it is possible to establish a set of tumor antigens which is shared at least partially by a large fraction of tumor patients and on the basis of which a set of vaccine products applicable to a broad spectrum of cancer patients can be provided.
[0321] To this end, RNA was extracted from normal tissues or breast cancer samples using the RNeasy Lipid Tissue Mini Kit (Qiagen). cDNA synthesis was performed using the SuperScript II Reverse Transcriptase Kit (Invitrogen) and oligo-dT. Expression was analysed using the BioMark HD System system (Fluidigm) and the relative expression was calculated using HPRT as house keeping gene.
[0322] In this manner, the relative expression of several genes could be detected. The % of positive samples, using a threshold of relative expression of 30000, changed depending on whether all breast cancer samples, irrespectively of the subtype (n=35), were analysed (
[0323]
Example 2: Analysis of Tumor Specificity of CXORF61, CAGE1 and PRAME
[0324] The tumor specificity of the three transcripts was analysed by qRT-PCR in a large set of normal tissues (n=65). As shown in
Example 3: T Cell Epitopes of CXORF61, CAGE1 and PRAME
[0325] For CXORF61, TCR epitopes were identified by ex-vivo reactivity, analyzed by IFN-ELISPOT assay, of spleen cells from CXORF6 immunized HLA-A*02-transgenic mice against CXORF61-derived peptides. To this end, HLA-A*02 binding peptides derived from CXORF61 were predicted applying the SYFPEITHY algorithm (
[0326] After isolation of TCRs from CD8+ T cells of CXORF61-immunized mice, CD8+ T cells of a HLA-A*02-positive healthy donor were transfected with TCR-/ chain RNAs and tested by IFN-ELISPOT assay for recognition of K562-A2 cells transfected with CXORF61 RNA or pulsed with CXORF61 overlapping 15mer peptides (=CXORF61 pool) or HLA-A*02 binding peptides CXORF61-A2-2/4 (
[0327] For PRAME a large number of T cell epitopes has been reported to elicit antitumoral cytotoxic T cell responses. In a publication b
[0328] HLA-A*0201-presented cytotoxic T lymphocyte (CTL) PRAME epitopes (VLDGLDVLL, SLYSFPEPEA, ALYVDSLFFL, and SLLQHLIGL) are reported. The publication demonstrated the lysis of mammary carcinoma cell lines for these epitopes. Further PRAME epitopes eliciting a immune response by cytotoxic T lymphocytes have been identified by Kessler et al. (2003, Hum Immunol. 64 (2): 245-55) (LPRELFPPL, LPRRLFPPLF, FPPLFMAAF, IPVEVLVDLF, LPTLAKFSPY, CPHCGDRTFY, EPILCPCFM, HLA-B35), Kawahara et al. (2006, Exp Hematol. 34 (11): 1496-504) (GQHLHLETF, HLA-B*62), and Quintarelli et al. (2011, Blood 117 (12): 3353-62) (NLTHVLYPV, HLA-A*02).
[0329] For CAGE1 a publication about serological analysis of cDNA expression libraries (SEREX) showed that cancer patients specifically developed auto-antibodies against this target (Park et al., 2003, Biochim Biophys Acta. 1625 (2): 173-82). Induction of cytolytic T lymphocyte (CTL) reactions has been reported for several cancer/testis antigens.
Example 4: Identification of a CXorf61 Isoform Strictly Expressed in Tumor Tissues
[0330] A new CXorf61 transcript was identified by Next Generation Sequencing, which is expressed in tumor cell lines but not in normal testis. This sequence has a longer 3 UTR and does not change the CXorf61 Open Reading Frame (ORF) (
[0331] To confirm the existence of a longer CXorf61 transcript, the predicted sequence was amplified using primers binding at the 5 of the known sequence and in the new predicted 3 (primers 3873+3875) (
[0332] Relative expression of CXorf61-isol was analyzed by qRT-PCR using the Fluidigm system (primers 2898+3876). While expression of CXorf61 (primers 2898+2899) was detectable very strongly in normal testis and weakly in epididymis and placenta, only irrelevant expression in normal testis was found for CXorf61-isol (
[0333] Relative expression of CXorf61-isol was analyzed by qRT-PCR using the Fluidigm system in triple negative breast cancer patient samples with primers 2898+3876 (
TABLE-US-00001 TABLE1 Sequenceoftheprimersused Primer Sequence(5-3) 3873 CCAAAGTTTCCCAAATCCAGGC 3874 ATCTACTCAAAGTGTCTTTAATGATTTCC 2898 GTGTGCCTTGATTGTCTTCTGG 3875 CTTTCTCTATTGTGCTTCCATTCC 3876 GTATCTGGATTTTTTGTATGTGACTTGGAAT 2899 CCTGGCTATTGAGTGTGGG
Example 5: Identification of CAGE1 Isoforms Strictly Expressed in Tumor Tissues
[0334] By using Next Generation sequencing an alternative start codon in the CAGE1 sequence was identified. The existence of the new exon was confirmed by RT-PCR and sequencing. RT-PCR analysis was performed with primers 5274 and 5527 (for primers sequence see Table 2, for primers position see
TABLE-US-00002 TABLE2 Sequenceoftheprimersusedforexpression analysis Primernumber Sequence(5-3) 5274 GACTCTTCCTGGAGTGGTTGA 5540 GAACCCCGGAAGTGGAGGTT 4783 GGTCATGGACTTCGGATGATT 4782 AGGATTTAATTAGAAAGCCCAGAGA 5527 CTCTACCCCTGTATTTCGCTTG
[0335] The position of the primers used for expression analysis is shown in
TABLE-US-00003 TABLE 3 CAGE1 reference sequences CAGE1 (uc021ylc.1) at chr6: 7326887-7389942 - Homo sapiens cancer antigen 1 (CAGE1), transcript variant 3, mRNA. CAGE1 (uc003mxl.2) at chr6: 7326887-7389942 - Homo sapiens cancer antigen 1 (CAGE1), transcript variant 1, mRNA. CAGE1 (uc003mxk.2) at chr6: 7329330-7389942 - Homo sapiens cancer antigen 1 (CAGE1), transcript variant 2, mRNA. CAGE1 (uc003mxj.3) at chr6: 7326887-7389942 - Homo sapiens cancer antigen 1 (CAGE1), transcript variant 1, mRNA. CAGE1 (uc003mxh.3) at chr6: 7326887-7374364 - Homo sapiens cancer antigen 1 (CAGE1), transcript variant 1, mRNA.
[0336] CAGE1-Tron1 and CAGE1-Tron2 have a restricted expression in normal tissues. Relative expression of CAGE1-Tron1 and CAGE1-Tron2 was analysed in 60 normal tissues, including several brain areas by qRT-PCR using the Fluidigm technology. Expression of CAGE1-Tron1 was detected in placenta and at less extent in testis. No expression of CAGE1-Tron 2 was detected in any normal tissues (
[0337] CAGE1-Tron1 and CAGE1-Tron2 are expressed in Triple negative breast cancer tissues. Relative expression of CAGE1-Tron1 and CAGE1-Tron2 was analyzed by qRT-PCR in 34 triple negative breast cancer patient samples. Using a cut off of 100, 73% of the tumors are positive for CAGE1-Tron1 and 32% for CAGE1-Tron2 (