COMPOSITIONS AND METHODS FOR THE SELECTIVE DETECTION OF TUMOR-DERIVED VIRAL DNA
20230103645 · 2023-04-06
Inventors
- Gaorav GUPTA (Chapel Hill, NC, US)
- Bhishamjit S. CHERA (Chapel Hill, NC, US)
- Sunil KUMAR (Chapel Hill, NC, US)
Cpc classification
C12Q1/6888
CHEMISTRY; METALLURGY
Y02A50/30
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
International classification
Abstract
The present disclosure provides methods and compositions of modified oligonucleotide primer and probe combinations, structurally modified with locked nucleic acids, quenchers, and dyes, effective to detect tumor-derived Human Papilloma Virus (HPV) and tumor-derived Epstein-Barr virus (EBV) and, especially, to distinguish viral DNA derived from tumors from viral DNA derived from infectious viral particles.
Claims
1. A composition for detecting tumor-derived Human Papilloma Virus type 16 (HPV16), HPV18, HPV31, HPV33, HPV35, or HPV45 in a sample from a subject, comprising at least a triad of modified oligonucleotide primer/probe sets selected from: primer/probe sets numbered 1 to 18 as shown in Table 14 for HPV16, primer/probe sets numbered 1 to 18 as shown in Table 15 for HPV18, primer/probe sets numbered 1 to 17 as shown in Table 16 for HPV31, primer/probe sets numbered 1 to 15 as shown in Table 17 for HPV33, primer/probe sets numbered 1 to 16 as shown in Table 18 for HPV35, or primer/probe sets numbered 1 to 17 as shown in Table 19 for HPV45; wherein a first primer/probe set of the triad is configured to produce a first amplicon signal, wherein a second primer/probe set of the triad is configured to produce a second amplicon signal, wherein a third primer/probe set of the triad is configured to produce a third amplicon signal, and wherein the primer/probe set of the triad with the smallest set number corresponds to the first primer/probe set and the primer/probe set of the triad with the largest set number corresponds to the third primer/probe set.
2. The composition of claim 1 for detecting tumor-derived HPV16 in a sample from a subject, comprising a triad of modified oligonucleotide primer/probe sets selected from primer/probe sets numbered 1 to 18 as shown in Table 14 for HPV16.
3. The composition of claim 1 for detecting tumor-derived HPV18 in a sample from a subject, comprising a triad of modified oligonucleotide primer/probe sets selected from primer/probe sets numbered 1 to 18 as shown in Table 15 for HPV18.
4. The composition of claim 1 for detecting tumor-derived HPV31 in a sample from a subject, comprising a triad of modified oligonucleotide primer/probe sets selected from primer/probe sets numbered 1 to 17 as shown in Table 16 for HPV31.
5. The composition of claim 1 for detecting tumor-derived HPV33 in a sample from a subject, comprising a triad of modified oligonucleotide primer/probe sets selected from primer/probe sets numbered 1 to 15 as shown in Table 17 for HPV33.
6. The composition of claim 1 for detecting tumor-derived HPV35 in a sample from a subject, comprising a triad of modified oligonucleotide primer/probe sets selected from primer/probe sets numbered 1 to 16 as shown in Table 18 for HPV35.
7. The composition of claim 1 for detecting tumor-derived HPV45 in a sample from a subject, comprising a triad of modified oligonucleotide primer/probe sets selected from primer/probe sets numbered 1 to 17 as shown in Table 19 for HPV45.
8. A composition for detecting tumor-derived Epstein-Barr virus (EBV) in a sample from a subject, comprising a triad of modified oligonucleotide primer/probe sets selected from primer/probe sets numbered 1 to 28 as shown in Table 20 for EBV, wherein a first primer/probe set of the triad is configured to produce a first amplicon signal, wherein a second primer/probe set of the triad is configured to produce a second amplicon signal, wherein a third primer/probe set of the triad is configured to produce a third amplicon signal, and wherein the primer/probe set of the triad with the smallest set number corresponds to the first primer/probe set and the primer/probe set of the triad with the largest set number corresponds to the third primer/probe set.
9. The composition of any one of claims 1 to 8, wherein the triad contains three primer/probe sets of which no two primer/probe sets are consecutive.
10. The composition of any one of claims 1 to 8, wherein the triad contains three non-consecutive primer/probe sets.
11. The composition of claim 2, comprising primer/probe sets numbered 3, 5, and 7 as shown in Table 14 for HPV16.
12. The composition of claim 3, comprising primer/probe sets numbered 4, 7, and 10 as shown in Table 15 for HPV18.
13. The composition of claim 4, comprising primer/probe sets numbered 4, 7, and 10 as shown in Table 16 for HPV31.
14. The composition of claim 5, comprising primer/probe sets numbered 4, 7, and 10 as shown in Table 17 for HPV33.
15. The composition of claim 6, comprising primer/probe sets numbered 4, 7, and 10 as shown in Table 18, for HPV35.
16. The composition of claim 7, comprising primer/probe sets numbered 4, 7, and 10 as shown in Table 19, for HPV45.
17. The composition of claim 3, comprising primer/probe sets numbered 4, 5, and 6 as shown in Table 20 for EPV.
18. A method for detecting tumor-derived Human Papilloma Virus type 16 (HPV16), HPV18, HPV31, HPV33, HPV35, or HPV45 in a sample from a subject, the method comprising: providing at least a triad of modified oligonucleotide primer/probe sets of the composition of any one of claims 1 to 17; fractionating a plurality of HPV DNA fragments from the sample into droplets at a concentration wherein only 0 or 1 molecule of the DNA fragments is present in each droplet; amplifying HPV DNA in each droplet with the triad of primer/probe sets to produce amplicon signals; and detecting in each droplet any amplicon signals; wherein detection within a droplet of the second amplicon, but not the first or third amplicon, indicates that the HPV DNA fragment fractionated into the droplet is a tumor-derived HPV DNA fragment.
19-24. (canceled)
25. A method for detecting tumor-derived Epstein-Barr virus (EBV) in a sample from a subject, the method comprising: providing a triad of modified oligonucleotide primer/probe sets of the composition of any one of claims 8, 9, 10, or 17; fractionating a plurality of EBV DNA fragments from the sample into droplets at a concentration wherein only 0 or 1 molecule of the DNA fragments is present in each droplet; amplifying EBV DNA in each droplet with the triad of primer/probe sets to produce amplicon signals; and detecting in each droplet any amplicon signals; wherein detection within a droplet of the second amplicon, but not the first or third amplicon, indicates that the EBV DNA fragment fractionated into the droplet is a tumor-derived EBV DNA fragment.
26-29. (canceled)
Description
DESCRIPTION OF DRAWINGS
[0039]
[0040]
[0041]
[0042]
[0043]
[0044]
[0045]
[0046]
[0047]
DETAILED DESCRIPTION
[0048] Before the present disclosure is described in greater detail, it is to be understood that this disclosure is not limited to particular embodiments described, and as such may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting, since the scope of the present disclosure will be limited only by the appended claims.
[0049] Where a range of values is provided, it is understood that each intervening value, to the tenth of the unit of the lower limit unless the context clearly dictates otherwise, between the upper and lower limit of that range and any other stated or intervening value in that stated range, is encompassed within the disclosure. The upper and lower limits of these smaller ranges may independently be included in the smaller ranges and are also encompassed within the disclosure, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the disclosure.
[0050] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. Although any methods and materials similar or equivalent to those described herein can also be used in the practice or testing of the present disclosure, useful methods and materials are now described.
[0051] All publications and patents cited in this specification are herein incorporated by reference in their entireties, as if each individual publication or patent were specifically and individually indicated to be incorporated by reference, and are incorporated herein by reference to disclose and describe the methods and/or materials in connection with which the publications are cited. The citation of any publication is for its disclosure prior to the filing date and should not be construed as an admission that the present disclosure is not entitled to antedate such publication by virtue of prior disclosure. Further, the dates of publication provided could be different from the actual publication dates that may need to be independently confirmed.
[0052] As will be apparent to those of skill in the art upon reading this disclosure, each of the individual embodiments described and illustrated herein has discrete components and features which can be readily separated from or combined with the features of any of the other several embodiments without departing from the scope or spirit of the present disclosure. Any recited method can be carried out in the order of events recited or in any other order that is logically possible.
[0053] Embodiments of the present disclosure will employ, unless otherwise indicated, techniques of chemistry, biology, and the like, which are within the skill of the art.
[0054] The examples are put forth so as to provide those of ordinary skill in the art with a complete disclosure and description of how to perform the methods and how to make and use the compositions and probes disclosed and claimed herein. Efforts have been made to ensure accuracy with respect to numbers (e.g., amounts, temperature, etc.), but some errors and deviations should be accounted for. Unless indicated otherwise, parts are parts by weight, temperature is in ° C., and pressure is at or near atmospheric. Standard temperature and pressure are defined as 20° C. and 1 atmosphere.
[0055] Before the embodiments of the present disclosure are described in detail, it is to be understood that, unless otherwise indicated, the present disclosure is not limited to particular materials, reagents, reaction materials, manufacturing processes, or the like, as such can vary. It is also to be understood that the terminology used herein is for purposes of describing particular embodiments only, and is not intended to be limiting. It is also possible in the present disclosure that steps can be executed in different sequence where this is logically possible.
[0056] It must be noted that, as used in the specification and the appended claims, the singular forms “a,” “an,” and “the” include plural referents unless the context clearly dictates otherwise.
[0057] As used herein “human papilloma virus” or “HPV” refers to small, non-enveloped, double-stranded DNA viruses that infect the cutaneous and/or mucosal epithelium. As understood by those skilled in the art, over 100 HPV genotypes are known to exist. Sexually transmitted, mucosotropic HPVs are further subcategorized as high risk (e.g. HPV16 and HPV18) or low risk (HPV6 and HPV11).
[0058] As used herein, HPV-associated malignancies include those of the head and neck (larynx, oral cavity, oropharynx, tonsils, and esophagus), respiratory tissue, breast, skin, cervix, vulva, penis and anus. Malignancy and cancer are used interchangeably.
[0059] As used herein, “detecting” or “detection” means testing, screening, or otherwise determining the presence and/or absence of at least one tumor nucleic acid marker for HPV in a sample. Such detecting or detection can be carried out by methods described herein, including those known in the art as applicable to this technology, for example, nucleic acid amplification, hybridization-based detection, microarray, and next generation sequencing.
[0060] Also as used herein, the terms “treat,” “treating” or “treatment” may refer to any type of action that imparts a modulating effect, which, for example, can be a beneficial and/or therapeutic effect, to a subject afflicted with a condition, disorder, disease or illness, including, for example, improvement in the condition of the subject (e.g., in one or more symptoms), delay in the progression of the disorder, disease or illness, delay of the onset of the disease, disorder, or illness, and/or change in clinical parameters of the condition, disorder, disease or illness, etc., as would be well known in the art.
[0061] As used herein, the term “monitoring” refers to assessing the therapeutic efficacy of a treatment for patients with a cancer. As used herein, the term “surveillance” refers to the detection of a virus-associated malignancy in subjects, who may or may not have a clinically diagnosed or symptomatic cancer.
[0062] As used herein, a subject has an “increased likelihood” of some clinical feature or outcome (e.g., recurrence or progression) if the probability of the subject having the feature or outcome exceeds some reference probability or value. The reference probability may be the probability of the feature or outcome across the general relevant subject or patient population. For example, if the probability of recurrence in the general oropharyngeal cancer population is X % and a particular patient has been determined by the methods to have a probability of recurrence of Y %, and if Y>X, then the patient has an “increased likelihood” of recurrence. Alternatively, a threshold or reference value may be determined and a particular patient's probability of recurrence may be compared to that threshold or reference.
[0063] As used herein, “sample” refers to a biological sample containing a tumor nucleic acid marker for HPV. The sample may be tissue, cells, or any fluid taken from the human body, e.g., blood, plasma, urine, saliva, etc. In particular embodiments, the sample is a blood-based sample. Accordingly, the sample may be whole blood or components thereof such as serum or plasma.
[0064] Also disclosed herein are methods for detection, treatment, and surveillance of human papilloma virus-associated malignancies and kits for accomplishing the same.
[0065] Also disclosed herein are methods for quantifying viral nucleic acids in the circulatory system that are specifically derived from tumors, and for distinguishing these tumor-derived viral nucleic acids from other sources of circulating viral nucleic acids.
[0066] Disclosed herein are DNA amplification methods for quantifying DNA fragments of a target DNA in a sample by size. This can be used, for example, to detect tumor-derived viral DNA in blood sample and distinguish it from larger viral DNA from non-tumor sources. In particular, disclosed herein are methods of detecting, monitoring, or treating a human papilloma virus (HPV)-associated malignancy in a subject that involves detecting a presence or absence of at least one circulating tumor-derived HPV DNA in a sample from the subject. Kits for accomplishing the same are also provided.
[0067] The disclosed method can be performed within thousands of micro-droplets (also referred to herein as droplets) generated through, for example, emulsification and/or water-in-oil droplet partitioning, such as is described in Hindson et al., Anal Chem. 2011 Nov. 15; 83(22):8604-8610, Pinheiro et al., Anal Chem. 2012 Jan. 17; 84(2):1003-1011, and Kanagal-Shamanna, Methods Mol Biol. 2016; 1392:33-42, or any other method known to those versed in the art to separate a sample into discrete and/or volumetrically defined partitions for analysis of tumor derived versus non-tumor derived DNA present in the partitions/sample. In the case of micro-droplets, the size of the droplets can be micro-, nano-, pico-, or femto-scale.
[0068] As disclosed herein, the micro-droplets are generated such that they each contain at most a single targeted viral nucleic acid. In embodiments where only two distinct regions of the viral nucleic acid are detected, a micro-droplet containing the targeted viral nucleic acid will be either single-positive, i.e., positive for one of the detection signals, or double-positive, i.e., positive for both of the detection signals. As disclosed herein, the relative numbers of the single-positive and double-positive micro-droplets and double-positive droplets provide quantitative information making it possible to quantitatively determine the relative amounts of tumor-derived and non-tumor derived viral DNA in the sample.
[0069] In embodiments where the PCR is used to detect two physically distinct regions, included is a forward and reverse primer pair corresponding to each detected region. In some embodiments, the detection may be performed using digital PCR, droplet digital PCR, emulsion PCR or micro-droplet PCR according to procedures that would be appreciated by one of skill in the art. As disclosed herein, micro-droplets containing tumor-derived circulating viral nucleic acids have fewer positively detected viral nucleic acid regions relative to micro-droplets containing non-tumor-derived circulating viral nucleic acids. In the simplest case where only 2 different regions in the viral nucleic acid are targeted for detection, the disclosed method identifies micro-droplets containing non-tumor-derived circulating viral DNA as those that are positive for both of the detection signals employed for the different targeted regions (double-positive); by contrast, in this simplest case, micro-droplets containing tumor-derived circulating viral nucleic acid are positive for only one detection signal but not both signals simultaneously.
[0070] To take an illustrative example, if the target nucleic acid regions for detection comprise fragments of ˜70-100 bp, two or more target regions separated by 100 bp would never be present on the same viral DNA molecule if the molecule was derived from circulating tumor DNA. Under this scenario, the simultaneous detection of both target fragments within the same micro-droplet must be due to co-occupancy within the same micro-droplet of two distinct target fragment molecules, each containing one of the regions targeted for detection. Thus, if the analyzed samples contain non tumor-derived viral DNA, there will be a higher frequency of micro-droplets that test positive for two or more target fragments than would be expected based on the frequencies of each target region analyzed individually.
[0071] For example, one quantitative measurement of the proportion of non-tumor-derived viral DNA fragments in the sample is [fraction(droplets double-positive for both detection signals)-fraction(droplets positive only for detection signal 1)*fraction(droplets positive only for detection signal 2)]. It follows that the fraction of tumor-derived viral DNA in the sample is [1-[fraction(droplets double-positive for both detection signals)-fraction(droplets positive only for detection signal 1)*fraction(droplets positive only for detection signal 2)]]. The corresponding quantitative measure of tumor-derived viral DNA would be [#(droplets positive only for detection signal 1)+#(droplets positive only for detection signal 2)]*[proportion of tumor-derived viral DNA fragments]=[#(droplets positive only for detection signal 1)+#(droplets positive only for detection signal 2)] [1-fraction(droplets positive for both detection signals)+fraction(droplets positive only for detection signal 1)*fraction(droplets positive only for detection signal 2)]. These formulae are provided as illustrative examples of how the raw detection signal data can be converted into measurements of tumor-derived and non-tumor-derived viral DNA in the sample, with the understanding there are other formulae that could be utilized for the same purpose.
[0072] The disclosed methods can also be applied in cases where 3 or more regions, each with its own detection signal, are detected in each micro-droplet or other parallelized micro-reaction chamber. In this context, the mathematical formula for quantification of tumor-derived and non-tumor derived viral DNA can be generalized on the basis of the reasoning provided above for 2 amplified regions.
[0073] While the examples above considered detected viral DNA regions of size ˜70-100 bp separated by at least about 50 bp, about 60 bp, about 70 bp, about 80 bp, about 90 bp or about 100 bp, it should be understood that both the size of the detected DNA fragments and their distance may be varied and are not fixed in relation to the disclosed methods.
[0074] Returning to the embodiment in which two different regions are targeted for detection, double-positive micro-droplets may on occasion arise from the co-incidence of two smaller fragments of viral nucleic acid within a single micro-droplet, each fragment containing just a single region targeted for detection, as opposed to the desired measurement of one larger fragment encompassing both of the regions targeted for detection. In some embodiments, this possibility can be ruled out, or the extent to which it is occurring quantified, by comparing the relative frequencies of double-positive and single-positive droplets, and confirming that the frequency of double-positive droplets is approximated by the product of the frequencies of the single-positive droplets, and reduces in prevalence by the square of the dilution factor when re-analyzed at a lower concentration.
[0075] In some embodiments, nucleic acids isolated from blood samples are emulsified into micro-droplets such that the vast majority of micro-droplets contain either one or none of the viral nucleic acids that are being targeted for detection. Experimental methods for determining the correct micro-droplet volume and blood sample dilution factors are provided herein. Subsequent to emulsification, nucleic acid detection methods, which may include PCR-based methods, are employed to detect two or more regions of the targeted viral nucleic acid that are physically separated from one another. In some embodiments, each viral region being targeted detection is associated with a unique detection signal, for example a unique fluorescent color.
[0076] Also disclosed herein are methods of detecting ctHPVDNA in HPV-OPSCC patients. The methods generally involve detecting the presence of tumor-derived viral DNA using a nucleic acid amplification, such as polymerase chain reaction (PCR), in an emulsified context in which least two distinct regions are amplified to distinguish between tumor-derived viral DNA, which is fragmented, and non-tumor-derived intact virions, whose DNA is not fragmented. Also disclosed herein are nucleic acid probes and nucleic acid primers, as well as kits comprising same, for use in a said method.
[0077] Also disclosed herein are methods for identifying the prognosis of individuals with HPV-associated OPSCC that can be successfully treated by de-intensified chemo-radiotherapy (CRT), methods for identifying tumor-specific biomarkers that are predictive of HPV-associated OPSCC relapse or recurrence after treatment, and methods of identifying the prognosis of individuals with HPV-associated OPSCC who are at risk for relapse or recurrence after treatment.
[0078] Subjects suitable to be treated by the disclosed methods include, but are not limited to mammalian subjects. Mammals include, but are not limited to, canines, felines, bovines, caprines, equines, ovines, porcines, rodents (e.g., rats and mice), lagomorphs, primates, humans and the like, and mammals in utero. Any mammalian subject in need of being treated or desiring treatment is suitable. Human subjects of any gender (for example, male, female or transgender) and at any stage of development (i.e., neonate, infant, juvenile, adolescent, adult, elderly) may be treated. Subjects may be of any race or ethnicity, including, but not limited to, Caucasian, African-American, African, Asian, Hispanic, Indian, etc., and combinations thereof. It should be further noted that subject and patient are used interchangeably.
[0079] In particular embodiments, the subject has never been diagnosed with or suffered from a virus-associated malignancy. In other embodiments, the subject may be diagnosed with, afflicted with, suffering from or at risk for a virus-associated malignancy. In some embodiments, the subject has previously undergone treatment for a virus-associated malignancy. In other embodiments, the subject may be in remission from a virus-associated malignancy. In some embodiments, the subject is a smoker. In some embodiments, the subject is a non-smoker.
[0080] Detection of ctHPVDNA
[0081] Methods for determining the level of biomarker nucleic acid, for example, a ctHPVDNA, such as ctHPV16DNA, in a sample may involve the process of nucleic acid amplification, e.g., by PCR, ligase chain reaction (LCR), transcription-based amplification systems, (TAS) self-sustained sequence replication (3SR), nucleic acid sequence-based amplification (NASBA), strand displacement amplification (SDA) and branched DNA (bDNA) amplification, Q-Beta replicase, rolling circle replication, rolling circle amplification, or any other nucleic acid amplification method, followed by detection of the amplified molecules using any technique as would be appreciated by one of skill in the art.
[0082] In some embodiments, the nucleic acid detection method may be carried out in micro-droplets or other micro-reaction chamber so that the detection method can be run in a highly parallelized manner. In some embodiments, micro-droplets or micro-reaction chambers may contain either 0 or 1 copies of the viral DNA region targeted for detection.
[0083] In embodiments involving emulsion PCR, a target nucleic acid or polynucleotide sequence is typically dispersed into micro-droplets. In some embodiments, it is essential that the target nucleic acids be emulsified at a concentration where each micro-droplet (or droplet) contains either one or zero copies of the target molecule. In the case of plasma or serum DNA isolated from patient blood samples, the appropriate dilution level can be recognized by assessing the abundance of a control genomic region and assuring that the frequency of positive micro-droplets remain less than 10% (<10%). The control genomic region detects human (i.e., non-viral) DNA and serves as a quality control for the sample (since many negative samples will not have any positive signal in the assay), and will also be used to establish that the concentration of DNA fragments is appropriate (not to low and not too high).
[0084] Within each micro-droplet, the principles of conventional PCR also apply, where the target molecule is amplified by reaction with at least one oligonucleotide primer or pair of oligonucleotide primers. The primer(s) hybridize to a complementary region of the target nucleic acid and a DNA polymerase extends the primer(s) to amplify the target sequence. Under conditions sufficient to provide polymerase-based nucleic acid amplification products, a nucleic acid fragment of one size dominates the reaction products (the target polynucleotide sequence which is the amplification product). The amplification cycle is repeated to increase the concentration of the single target nucleic acid or polynucleotide sequence within each micro-droplet. The reaction can be performed in any thermocycler commonly used for PCR.
[0085] Methods for setting up a PCR reaction are well known to those skilled in the art. Any known DNA polymerase, nucleoside triphosphate, buffers, additives/reaction enhancers and conditions for amplification (cycles of denaturation, annealing and polymerization) as would be appreciated by one of skill in the art may be used in the PCR reaction.
[0086] In some embodiments, the reaction includes a sequence-specific, hydrolysis probe that is conjugated to both a fluorescent molecule and a fluorescence-quenching molecule to the reaction mixture to enable the detection of successful amplification of the target molecule within each droplet. The chemical composition of specific probes may vary, but follow an established method for detecting synthesis-based nucleic acid amplification by those skilled in the art.
[0087] The preparation of an emulsion of the PCR reaction can be achieved in a variety of ways that are appreciated by those versed in the art. One effective methodology utilizes a fabricated microfluidic chip that mixes the aqueous PCR reaction with a lipid solution at controlled pressure to generate micro-droplets of uniform size. The disclosed method is applicable to any method for achieving a partitioned PCR reaction mixture that allows the simultaneous detection of two or more viral nucleic acid target molecules.
[0088] Following preparation of a PCR reaction mixture that has been appropriately emulsified or partitioned into droplets, the reaction mixture is subjected to primer extension reaction conditions (“conditions sufficient to provide polymerase-based nucleic acid amplification products”), i.e., conditions that permit for polymerase mediated primer extension by addition of nucleotides to the end of the primer molecule using the template strand as a template. Cycles of denaturation, annealing and polymerization may be performed according to any conditions (e.g., number of cycles, temperatures and duration in time) that would be appreciated by one of skill in the art.
[0089] Cycles of denaturation, annealing and polymerization may be performed using an automated device, typically known as a thermal cycler. Thermal cyclers that may be employed are described elsewhere herein as well as in U.S. Pat. Nos. 5,612,473; 5,602,756; 5,538,871; and 5,475,610.
[0090] In other embodiments, non-PCR based applications may be used to detect a target nucleic acid sequence, for example, where such target may be immobilized on a solid support. Methods of immobilizing a nucleic acid sequence on a solid support are known in the art and are described in Ausubel et al. Current Protocols in Molecular Biology, John Wiley and Sons, Inc. and in protocols provided by the manufacturers, e.g. for membranes: Pall Corporation, Schleicher & Schuell, for magnetic beads: Dynal, for culture plates: Costar, Nalgenunc, and for other supports.
[0091] Other nucleic acid amplification procedures will be appreciated by one of skill in the art, such as, but not limited to, LCR, TAS, 3SR, NASBA, SDA, bDNA, and isothermal amplification. The disclosed method is not limited to the use of amplification by PCR, but rather includes the use of any nucleic acid amplification methods or any other procedures which may be useful in amplification of the sequences for the detection and/or quantification of the presence of or expression of one or more of the particular nucleic acid sequences described herein.
[0092] Variations on the exact amounts of the various reagents and on the conditions for the PCR or other suitable amplification procedure (e.g., buffer conditions, cycling times, etc.) that lead to similar amplification or detection/quantification results are known to one of skill in the art and are considered to be equivalents.
[0093] Detection of the presence of target molecules in a sample/micro-droplet is not particularly limited, and may be accomplished by any technique appreciated by one of skill in the art. In some embodiments, detection may include hybridization of the target molecule with a target-specific probe, such as a nucleic acid probe, linked to a fluorescent marker. In other embodiments, the marker may be a non-fluorescent marker. The nature of the marker, fluorescent or non-fluorescent, is not particularly limited and may be any marker or label as would be appreciated by of skill in the art.
[0094] The detection and distinguishing of partitions (droplets) that contain a target molecule from partitions that contain zero target molecules is a critical step in digital PCR. This can be achieved using a variety of established techniques. In some embodiments, micro-droplets are analyzed individually using a microfluidic channel and a fluorescence detector. Alternatively, advanced microscopy techniques may be implemented to count positive and negative droplets. The disclosed method may be embodied with any nucleic acid detection method.
[0095] While some methods disclosed herein have been implementing using digital PCR, the disclosed methods can in principle be utilized with any nucleic acid detection method that is capable of detecting single nucleic acids and distinguishing the size of the detected fragments. For example, such methods may include, hybridization of non-amplified target molecules with a fluorescent or a non-fluorescent probe, and the like. In any such embodiments, the disclosed methods can be applied to distinguish tumor-derived viral nucleic acids in circulation from other non-malignant sources of circulating viral nucleic acid and intact virions. Particular aspects of the disclosed methods are the simultaneous detection in a partitioned reaction of at least two fragments of DNA separated by a defined distance in the viral genome, where the presence of both targets in separate partitions is indicative of tumor viral nucleic acid in a bodily fluid, such as the blood, wherein an increased frequency of co-occupancy of both fragments in the same partition is indicative of non-malignant viral nucleic acids.
[0096] The present invention is more particularly described in the following examples that are intended as illustrative only since numerous modifications and variations therein will be apparent and understood to those skilled in the art. Examples of how the application of this specific and sensitive method for detecting tumor viral nucleic acids in a bodily fluid, such as blood, can be used to predict patient prognosis during cancer treatment, and to identify patients who are at the highest risk of disease recurrence among a cohort of patients who are clinically asymptomatic and thought to be in disease remission are provided below.
[0097] A number of embodiments of the invention have been described. The disclosure is further described in the following examples, which do not limit the scope of the invention described in the claims.
EXAMPLES
Example 1: Digital PCR Assay to Detect HPV Viral DNA in Circulating Cell-Free DNA
[0098] Provided here is an embodiment of the disclosed methods that uses digital emulsion PCR to detect tumor-derived viral HPV DNA in the circulating cell-free DNA isolated from blood. The methodological details described in this example, for example the nucleic acid amplification and detection methods used, are included solely to establish that the invention has been reduced to practice. The methodological details provided in this example related only to this particular embodiment are not to be construed as limiting the invention, as described in the claims and summary sections of this document.
Materials
[0099] Reagents: Cell-Free DNA BCT tubes, RUO (Streck catalog No. #218962); QIAamp™ Circulating Nucleic Acid Kit, Catalog #55114; dPCR Supermax® Bio-Rad catalog no #186-3024; Eppendorf™ 96-Well twin.tec™ PCR Plates; Fisher scientific catalog No. #E951020362; Pipet tips (Bio-Rad catalog No. #186-4121 or #186-4120); Cartridge (Bio-Rad catalog No. #186-4109 or #186-4108); Sealing foil (Bio-Rad catalog No. #181-4040); Optional: VacConnectors® (Qiagen Cat No./ID: 19407).
[0100] This extra connector is useful in case something goes wrong with connectors available in QIAamp Circulating Nucleic Acid Kit, Catalog #55114; Bovine Serum Albumin (BSA); Qubit™ dsDNA HS Assay Kit (Thermo Fisher Scientific Catalog number: #Q32851); Qubit™ Assay Tubes (Thermo Fisher Scientific Catalog number: #Q32856); Falcon® 15 ml Conical Centrifuge Tubes (Corning Catalog No. #352096); Falcon™ 50 ml Conical Centrifuge Tubes (Corning Catalog No. #352098); Disposable sterile 5 ml, 10 ml and 25 ml Serological Pipets (any good brand); Sterile PCR tubes (Any good brand); Sterile filter tips for capacity 2 μl, 10 μl, 200 μl and 1200 μl (any good brand); primers and probes.
[0101] Instruments: Microcentrifuge (suitable for 1.5 ml Eppendorf tubes, e.g. Eppendorf 5424 Microcentrifuge); Centrifuge (Suitable for 15 ml falcon tubes, e.g. Eppendorf Centrifuge 5810 R); Qubit Fluorimeter (Thermo Fisher Scientific Catalog No. #Q33226); Deep 96 well thermocycler (Bio-Rad's C1000 Touch™ Thermal Cycler with 96-Deep Well Reaction Module #1851197); Heating block for drying 1.5 ml Eppendorf tubes (Denville Scientific catalog No. #10540); Water bath (should have sufficient space for incubating twenty-four 50 ml Conical Centrifuge Tubes as 24 samples can be processed at one time); Automated droplet generator (Bio-Rad catalog No. #186-4101); Bio-Rad QX200™ Droplet Reader Catalog No. #1864003; Portable Pipet-Aid® XP Pipette Controller (Drummond Scientific, Catalog No. 4-000-101); Pipette (capacity: 2 μl, 10 μl, 20 μl, 200 μl and 1000 μl; any good brand); 8-channel pipette (any good brand, e.g. Eppendorf Catalog No. #3125000010).
Methods
[0102] Blood Collection: Blood is collected in Cell-Free DNA BCT tubes, RUO (Streck catalog No. #218962).
[0103] Plasma Extraction: Collected blood from step I should ideally be processed on the same day to extract plasma. Same tube can be centrifuged at 2000×g for 10 min at room temperature (RT). Supernatant is transferred to new Falcon™ 15 mL Conical Centrifuge Tubes. Care should be taken to avoid taking middle whitish layer below plasma. Centrifuge the tube again for 10 min at 2000×g at RT. Supernatant is then transferred to a new Falcon™ 15 ml Conical Centrifuge Tubes. The plasma is at −80° C. freezer till further use. NOTE: sometimes 10 min. centrifuge does not lead to clear separation of plasma layer. In such situation, sample should be centrifuged for another 10 min before taking out the plasma. Or, alternatively centrifugation at first step can be done for 15-20 min. Record the sample if plasma looks red. Sometimes extra processing of the sample is required during PCR step because of the hemolysis. Blood should be discarded in 10% bleach or autoclaved or according to any other institution/company approved protocol.
[0104] Plasma cell free DNA (cfDNA) Extraction: The stored plasma samples are thawed at 37° C. in a water bath for about 5 min. A Qiagen kit (QIAamp Circulating Nucleic Acid Kit, Catalog #55114) is used to extract DNA using manufacturer's protocol with the following modifications: Standard vacuum available in laboratory can be used in the protocol; The cfDNA is eluted in 2 steps—first with 100 μl elution buffer and then 75 μl elution buffer if plasma volume is more than 3 ml. Elution can be done in lower volume if the collected plasma volume is less to avoid excessive dilution of the cfDNA; and it was observed that incubation of the column for 3 min. after adding elution buffer (as suggested in the protocol) does not lead to the complete extraction of cfDNA. Generally, a 30 min to 1 h incubation at RT generally follows both elution steps. The cfDNA is quantified on a Qubit fluorimeter. (Note: Generally, 2 μl of the eluate is sufficient to be used for quantification purpose). The eluted cfDNA is stored at −20° C. freezer until further use. Note: The cfDNA recovered at first elution is used for all experiments and calculations. The cfDNA recovered in the second elution step is used only if cfDNA at first elution is exhausted. If a more concentrated cfDNA is required for any purpose like NGS, then the sample can be concentrated using speed vacuum.
[0105] dPCR: The dPCR involve three steps—Droplet generation; PCR; and droplet reading.
[0106] Droplet Generation: Prepare 25 μl reaction for each sample customized as per the following composition (Reagents: dPCR Supermax® Bio-Rad catalog no #186-3024; any nuclease free PCR grade water can be used; other reagents like forward primer, reverse primer and probe are designed by user)
TABLE-US-00001 TABLE 1 Reaction Mixtures 1× Working 1× No template Component stock Final Conc. (sample) control (NTC) Primers 22.5 μM 0.9 μM 1 μl 1 μl Mixture (4) each each Probes 6.25 μM 0.125 μM 0.5 μl 0.5 μl Mixture (2) each each Albumin 10% 0.4% 1 μl 1 μl Betaine 5M 0.4 μM 2 μl 2 μl Trehalose 1.25M 0.16M 3.2 μl 3.2 μl dPCR Supermix 2× 1× 12.5 μl 12.5 μl DNA sample 1×/Diluted N/A 4.3 μl — PCR grade Adjustable N/A — 4.3 μl Water Total 25 μl 25 μl
[0107] The primer and probe sequences for the ctHPVDNA assay described here are as follows:
TABLE-US-00002 TABLE 2 Primers and Probes Variant Primers/Probes HPV16 283_HPV-16_F1 For: Fragment 1 TGACTCTACGCTTCGGTTG (SEQ ID NO: 1) 284_ HPV-16_F1 Rev: GCCCATTAACAGGTCTTCC (SEQ ID NO: 2) 420_HPV-16_F1 Probe_ FAM-ZEN_v2: CGTACAAAGCACACAC GTAGACATTCGTAC (SEQ ID NO: 3) HPV16 424_ HPV16_F2_For: Fragment 2 GGTTTGTAACATCCCAGGC (SEQ ID NO: 4) 425_ HPV16_F2_Rev: GTGTATTTTTTAAGGG GATCTTCTT (SEQ ID NO: 5) 421_HPV16_F2_HEX_LNA: CACCT(+C)(+C)A(+G)CACC (SEQ ID NO: 6) “(+N)” denotes LNA™ base denotes LNA™ base
[0108] The Primers mixture working stock is assembled by combining 22.5 μL each of the four primers (100 μM concentration) into a tube and adding 10 μL nuclease-free water to achieve a final concentration of 22.5 μM for each primer.
[0109] The Probe mixture working stock is assembled by combining 6.25 μL of each probe (100 μM concentration) into a tube and adding 87.5 μL nuclease-free water to achieve a final concentration of 6.25 μL for each probe.
[0110] About 22-23 μl of the above reaction mixture is loaded on a 96 well plate (Eppendorf™ 96-Well twin.tec™ PCR Plates, Fisher scientific catalog No. #E951020362) using Multichannel Pipetors (Note: Instrument uses only 20 μl from each well. An extra volume is added to avoid any pipetting error) Droplets are generated using automated droplet generator (Bio-Rad catalog No. #186-4101) following manufacturer's protocol. Reagents required at this step are pipet tips (Bio-Rad catalog No. #186-4121 or #186-4120) and cartridges (Bio-Rad catalog No #186-4109 or #186-4108). The sample plate is sealed with sealing foil (Bio-Rad catalog No. #181-4040) following manufacturer's protocol. Note: The volume of cfDNA+water should be 4.3 μl. Generally, there is no issue by using 4.3 μl of cfDNA sample in the reaction but sometimes the allele copy number is too high and it results in streaking of the positive droplet across the axis and many dual positive droplets. In such cases, the run should be repeated by using less sample and remaining volume can be adjusted with water. Dilution gives better quantification of allele frequency in such cases. A linear relationship across 5 orders of magnitude has been observed in HPV16 copy number ranging from 5 copies to 50,000 copies per 20 μl reaction. Care should be taken to seal the plate properly. If the plate is not sealed properly then it will lead to sample evaporation during PCR step.
[0111] PCR: The PCR thermocycling was performed using the protocol as described below.
TABLE-US-00003 TABLE 3 PCR conditions Temperature, Ramp Number of Cycling step ° C. Time Rate Cycles Enzyme activation 95 10 sec 2° C./sec 1 Denaturation 94 30 sec 40 Annealing 60 1 min 40 Extension 68 1 min 40 Enzyme 98 10 min 1 deactivation Hold (optional) 4 Infinite 1 Use a heated lid set to 105° C. and set the sample volume to 40 μl
[0112] All wells should be observed visually after PCR and before reading the plate on droplet reader. The copy numbers observed during droplet reading may not be real if there is any well where sample is evaporated because of improper sealing. It is good to leave the plate in the thermocycler for about 15-20 min after PCR is done. It allows the temperature of the plate to come down at more controlled way and it avoids droplet malformation. Sometimes malformation of the droplets because of the static current can be avoided by touching hand with other metallic surface before taking out the plate from thermocycler. It should be made a routine practice for better reproducibility of the results. The PCR plate can be stored overnight after PCR and reading can be done next day morning if time is limited. However, finishing everything in one day is best practice.
[0113] Droplet Reading: The droplet reader (Bio-Rad QX200™ Droplet Reader Catalog No. #1864003) is used to read signal in droplets following the manufacturer's protocol. Note: Discarding Oil waste: The composition of droplet reader oil is proprietary of Bio-Rad. A typical waste profile contains fluorinated oils (95%), water (5%), bleach (<0.5%), proteins, nucleic acids, and fluorescent dye (<0.1%). A proper disposal should be planned accordingly.
[0114] Data Analysis: The copy number calculations should be done following the manufacturer's guidelines. An example of the dPCR ctHPVDNA assay readout is shown in
[0115] Poisson statistics is used to calculate the copies of each fragment in the reaction individually, using the following formula:
#copies=#total droplets*In(#total droplets/#signal negative droplets).
This is calculated first for fragment 1 (FAM positive) and for fragment 2 (HEX positive).
[0116] Extensive control assays have been run to determine the level of experimental noise. Based on these controls, the following criteria were used to determine the number of copies of the target fragment (s) in the assay reaction.
TABLE-US-00004 TABLE 4 Control Criteria HPV16 copies/20 μl reaction Considered as 0 Zero Below 3 False positive and should be considered as zero 3-5 Assay should be repeated to confirm the value Above 5 Considered as positive for HPV16 Any positive value in follow up patient when Assay should be repeated to confirm previous HPV16 values are negative the value
[0117] These copy number values can be used to calculate the frequency of a droplet possessing the target fragment: Pr (frag)=(#positive droplets/#total droplets). The frequency of double-positive droplets that are expected if the sample consists of fragmented, circulating tumor viral DNA is estimated as: Pr (double positive)=Pr (frag1)*Pr (frag2). In contrast, if the Pr (dual positive)>2*Pr (frag1)*Pf (frag2), then the sample was considered to contain non-fragmented viral DNA that is not tumor-derived. If Pr (double positive)>Pr (frag1) or Pr (double positive)>Pr (frag2) it was interpret that the sample is negative for circulating tumor-derived viral nucleic acids. If Pr (frag1) AND Pr (frag2)>2*Pr (double positive), then the sample was considered positive for circulating tumor-derived viral nucleic acids, although there is evidence for coexistent non-tumor derived viral nucleic acids. Raw data for this assay applied to experimental controls and plasma DNA from a cohort of 12 patients with HPV+ oropharyngeal cancer is shown in
[0118] For the HPV16 F1 assay, cutoff of 700 was set on y-axis (FAM channel). Any droplets above 700 are considered as positive droplets for HPV16. For the HPV16 F2 assay, a cutoff of 3000 was set on x-axis (Hex channel). Any droplet above 3000 was considered as positive droplet for HPV16 F2. Occasionally, the patterns of the dPCR readout look unusual. This can be because of a bad sample (unanalyzable cfDNA) or a bad dPCR run. Such sample should be repeated to fix the problem. Data from such samples cannot be used for interpretation. If sample quality is not improved with any available strategies then sample should be categorized as unanalyzable DNA or bad sample. Some strategies to improve the sample quality are as below. The presence of Heparin in the blood sample can interfere with the dPCR reaction. Treating the sample with Bacteroides Heparinase I (New England Biolabs cat no. #P0735S) using manufacturer's protocol improves the quality of sample. Excessive hemolysis sometimes interferes with the dPCR. An improvement has been observed in the assay readout by adding 0.4% bovine serum albumin Some of the representative dot plots from bad samples are provided as separate file with suggested solutions.
[0119] Using an endogenous genomic sequence as a positive control for the dPCR reaction is essential for validating sample quality. dPCR-based detection of a target sequence in the ESR1 gene was utilized as a positive control for sample quality. The assay is described below:
TABLE-US-00005 TABLE 5 Variant Primers and Probes Genomic 132_CtrlESR1_F2: Control ATCTGTACAGCATGAAGTGCAAGA (ESR1 locus) (SEQ ID NO: 7) 133_CtrlESR1_R2: CTAGTGGGCGCATGTAGGC (SEQ ID NO: 8) 094_CtrlESR1_LNA2- TET_probe_WT: T(+C)(+T(+A)T(+G)(+A)(+C)CTG (SEQ ID NO: 9) “(+N)” denotes LNA™ base denotes LNA™ base
TABLE-US-00006 TABLE 6 Setting PCR Reaction Working Final 1× 1× Component stock conc. (sample) (NTC) Forward primer 22.5 μM 0.9 μM 1 μl 1 μl Reverse primer 22.5 μM 0.9 μM 1 μl 1 μl Probe 6.25 μM 0.25 μM 1 μl 1 μl BSA 10% 0.4% 1 μl 1 μl dPCR Supermix 2× 1× 12.5 μl 12.5 μl DNA sample Neat/diluted N/A 8.5 μl — PCR grade Water Adjustable N/A — 8.5 μl Total 25 μl 25 μl
TABLE-US-00007 TABLE 7 PCR Conditions Temp, Ramp Number of Cycling step ° C. Time Rate Cycles Enzyme activation 95 10 sec 2° C./sec 1 Denaturation 94 30 sec 40 Annealing/Extension 60 1 m in 40 Enzyme deactivation 98 10 min 1 Hold (optional) 4 Infinite 1 Use a heated lid set to 105° C. and set the sample volume to 40 μl
[0120] Work Flow for the Analysis of Plasma DNA Samples:
[0121] 1) Test samples using ESR1 genomic control dPCR assay, to evaluate amplifiable DNA and sample concentration.
[0122] 2) Test the samples for the dual fragment HPV16 assay (HPV16ZENv2) 4) If sample is negative for HPV16 then perform the HPV multiplexed assay (HPVmultiplexed_v1)
[0123] 5) Perform the duplex assay to know specific HPV variant
Example 2: Multiplexed dPCR Assay to Detect 5 Distinct HPV Sub-Strains (HPVmultiplexed_v1)
[0124] The disclosed methods were applied to sub-strains of a given virus. While the embodiment here relates to sub-strains of the HPV virus, the method can be readily applied to other viral sub-strains using established techniques known to those versed in the field. Variants included in the described embodiment of the method are HPV16, HPV18, HPV31, HPV33 and HPV35
[0125] HPV16 probe was tagged with FAM-Zen while others with HEX (LNA version).
TABLE-US-00008 TABLE 8 Primers and Probes Variant Primers and Probes HPV16 283_ HPV-16_For: TGACTCTACGCTTCGGTTG (SEQ ID NO: 1) 284_ HPV-16_Rev: GCCCATTAACAGGTCTTCC (SEQ ID NO: 2) 420_HPV-16_Probe_FAM-ZEN_v2: CGTACAAAGCACACACGTAGACATTCGTAC (SEQ ID NO: 3) HPV18 401_HPV18_For: TGAAGCCAGAATTGAGCTAG (SEQ ID NO: 10) 422_ HPV18_Rev_v2: AGGACAGGGTGTTCAGAA (SEQ ID NO: 11) 403_HPV18_LNA_H EX-Probe: CA(+G)A(+C)(+G)AC(+C)TTCG (SEQ ID NO: 12) HPV31 404_HPV31_For: AGCACACAAGTAGATATTCGC (SEQ ID NO: 13) 405_HPV31_Rev: TAGTAGAACAGTTGGGGCA (SEQ ID NO: 14) 406_HPV31_LNA_HEX-Probe: TAA(+C)(+A)G(+C)T(+C)(+T)TG(+C) (SEQ ID NO: 15) HPV33 407_HPV33_For: TAACACCACAGTTCGTTTATGT (SEQ ID NO: 16) 423_ HPV33_Rev_v2: ACAATATTCACTGTGCCCATA (SEQ ID NO: 17) 418_HPV33_LNA_HEX-Probe_v2: TG(+A)C(+C)(+T)A(+C)G(+A)(+A)CC (SEQ ID NO: 18) HPV35 410_HPV35_For: TGAGGCGACACTACGTC (SEQ ID NO: 19) 411_HPV35_Rev: GTGCCCATTAATAAATCTTCCAA (SEQ ID NO: 20) 419_HPV35_LNA_HEX-Probe_v2: AG(+A)G(+C)(+A)CA(+C)(+A)CAT (SEQ ID NO: 21) “(+N)” denotes LNA™ base
[0126] Reaction Mixture
[0127] Primer mixture: Mix equal volume of 10 primers each at 100 μM (each primer diluted 1:10 in the mixture). Probe mixture: Mix 6.25 p of each of five probes in a tube and add 68.75 p water (final concentration will be 6.25 μM each in 100 μl volume)
TABLE-US-00009 TABLE 9 Reaction Mixtures Working Final 1× 1× Component stock Conc. (sample) (NTC) Primers Mixture 10 μM 0.9 μM 2.25 μl 2.25 μl each each Probes Mixture 6.25 μM 0.125 μM 0.5 μl 0.5 μl each each Albumin 10% 0.4% 1 μl 1 μl Betaine 5M 0.4 μM 2 μl 2 μl Trehalose 1.25M 0.16M 3.2 μl 3.2 μl dPCR Supermix 2× 1× 12.5 μl 12.5 μl DNA sample Neat/Diluted N/A 3.55 μl — PCR grade Water Adjustable N/A — 3.55 μl Total 25 μl 25 μl
TABLE-US-00010 TABLE 10 PCR conditions Temperature, Ramp Number of Cycling step ° C. Time Rate Cycles Enzyme activation 95 10 sec 2° C./sec 1 Dentaturation 94 30 sec 40 Annealing 60 1 min 40 Extension 68 1 min 40 Enzyme 98 10 min 1 deactivation Hold (optional) 4 Infinite 1 Use a heated lid set to 105° C. and set the sample volume to 40 μl
[0128] Note: An LNA™-FAM probe was also designed to amplify common region in all known HPV16 variants with same primers (No. 283 & 285). This was not used in the multiplexed assay.
TABLE-US-00011 413_HPV16_LNA_FAM-CommonProbe: (SEQ ID NO: 22) CA(+C)A(+C)(+G)(+T)A(+G)(+A)CAT
Example 3: Duplex dPCR Assay to Detect Specific HPV Variants (HPV_18&33_v1 and HPV_31&35_v1)
[0129] This assay was designed to know the identity of specific HPV variants in patient samples.
TABLE-US-00012 TABLE 11 Primers and Probes Variant Primers Probe Set 1 HPV18 401_HPV18_For: & HPV33 TGAAGCCAGAATTGAGCTAG (SEQ ID NO: 10) 422_ HPV18_Rev_v2: AGGACAGGGTGTTCAGAA (SEQ ID NO: 11) 407_HPV33_For: TAACACCACAGTTCGTTTATGT (SEQ ID NO: 16) 423_ HPV33_Rev_v2: ACAATATTCACTGTGCCCATA (SEQ ID NO: 17) 403_HPV18_LNA_HEX-Probe: CA(+G)A(+C)(+G)AC+CTTCG (SEQ ID NO: 12) 426_HPV33_LNA_FAM-Probe: TG(+A)C(+C)(+T)A(+C)G(+A) (+A)CC (SEQ ID NO: 18) Set 2 HPV31 404_HPV31_For: & HPV35 AGCACACAAGTAGATATTCGC (SEQ ID NO: 13) 405_HPV31_Rev: TAGTAGAACAGTTGGGGCA (SEQ ID NO: 14) 410_HPV35_For: TGAGGCGACACTACGTC (SEQ ID NO: 19) 411_HPV35_Rev: GTGCCCATTAATAAATCTTCCAA (SEQ ID NO: 20) 406_HPV31_LNA_HEX-Probe: TAA(+C)(+A)G(+C)T(+C) (+T)TG(+C) (SEQ ID NO: 15) 427_HPV35_LNA_FAM-Probe: AG(+A)G(+C)(+A(CA(+C)(+A)CAT (SEQ ID NO: 21) “(+N)” denotes LNA™ base
[0130] Reaction Mixture
[0131] Primer mixture: Mix 22.5 μl of each of the four primers and add 10 μl water (22.5 μM each primer in the mixture). Probe mixture: Mix 6.25 μl of both probes in a tube and add 87.5 μl water (final concentration will be 6.25 μM each in 100 μl volume).
TABLE-US-00013 TABLE 12 Reaction Conditions Working Final 1× 1× Component stock Conc. (sample) (NTC) Primers Mixture 22.5 μM 0.9 μM 1 μl 1 μl each each Probes Mixture 6.25 μM 0.125 μM 0.5 μl 0.5 μl each each Albumin 10% 0.4% 1 μl 1 μl Betaine 5M 0.4 μM 2 μl 2 μl Trehalose 1.25M 0.16M 3.2 μl 3.2 μl dPCR Supermix 2× 1× 12.5 μl 12.5 μl DNA sample Neat/Diluted N/A 4.3 μl — PCR grade Water Adjustable N/A — 4.3 μl Total 25 μl 25 μl
TABLE-US-00014 TABLE 13 PCR conditions Temperature, Ramp Number of Cycling step ° C. Time Rate Cycles Enzyme activation 95 10 sec 2° C./sec 1 Dentaturation 94 30 sec 40 Annealing 60 1 m in 40 Extension 68 1 min 40 Enzyme 98 10 min 1 deactivation Hold (optional) 4 Infinite 1 Use a heated lid set to 105° C. and set the sample volume to 40 μl
Example 4: Application to Patient Blood Samples in Prospective Clinical Trials
[0132] Blood samples were analyzed from healthy volunteers, non-virus associated cancer, and HPV+ cancer. Circulating tumor HPV DNA copy numbers, as measured using the assay technology described in Example 1, are shown in
[0133] Blood samples were analyzed from patients enrolled in two prospective phase II clinical trials. The disclosed method for specifically detecting tumor-derived viral HPV DNA in the blood was integrated into the design of both of these clinical trials. The findings from these longitudinal clinical studies illustrate the applicability and utility of the disclosed method both for personalizing patient therapy and for cancer surveillance.
[0134] Summary of patient cohort and clinical trial design. Two prospective phase II clinical trials were completed that evaluated the efficacy of a de-intensified chemo-radiation therapy regimen in low risk OPSCC. In LCCC 1120 (NCT01530997) 45 patients were treated with de-intensified CRT. Eligible patients had HPV-positive and/or p16-positive OPSCC, T0-T3, N0-N2c, M0, and <10 pack years of smoking. Patients received 60 Gy of Intensity Modulated Radiotherapy (IMRT) with concurrent weekly intravenous cisplatin (30 mg/m.sup.2). All patients had biopsy of the primary site and underwent a selective neck dissection to encompass nodal level(s) that were positive pre-treatment, within 4 to 14 weeks after CRT. The primary endpoint of LCCC 1120 was the rate of pCR, which was 86% (37/43) and the 3-year cancer control and overall survival was 100% and 95%, respectively. In addition to excellent cancer control, patient had less toxicity and reported excellent quality of life and lower symptom burden as compared to standard of care CRT (70Gy). In a second-generation phase 2 study (LCCC 1413, NCT02281955) a 12-week post-treatment PET/CT was used to guide the use of biopsy/neck dissection (i.e. post CRT surgical evaluation was not mandatory, but guided by imaging). Of the 113 patients enrolled, 82 patients have had a minimum of 1-year follow-up and the 2-year actuarial cancer control and overall survival in these 82 patients is 90% and 95% respectively (again excellent results). Patients continue to report good recovery of quality of life at 1 year, and thus supports the concept that dose de-escalation can improve the therapeutic ratio. A third generation phase 2 study (LCCC 1612, NCT03077243) is currently being conducted, and has enrolled 53 of an expected 120 patients. Blood samples from 113 patients were prospectively analyzed to detect tumor-derived plasma viral HPV DNA.
[0135] Levels of tumor-derived viral HPV DNA in the blood, as quantified by the disclosed method, correlate significantly with HPV viral DNA in primary tumors. In 63 patients with HPV-OPSCC, serial levels of tumor-derived viral HPV DNA (pre- and weekly during-RT) were prospectively quantified in patient blood samples using the disclosed method (
[0136] The disclosed method was further validated by correlating levels of tumor-derived viral HPV DNA in the blood with analysis of matched primary tumors in a cohort of 20 patients (
[0137] Predict clinical risk in cancer patients. The disclosed method was applied to monitor tumor-derived viral HPV DNA in the blood before and during therapy in 63 patients enrolled in the clinical trial described above. A Favorable Profile was defined as having abundant ctHPV16DNA peak levels of tumor-derived viral HPV DNA in the blood (>200 copies/mL) and rapid clearance kinetics (2% of the peak value by week 4) (
[0138] Early detection of HPV-positive cancer recurrence in healthy patients that are asymptomatic and considered disease-free using existing clinical procedures. The typical surveillance schedule after chemo-radiation therapy is clinical examinations (physical examination and fiber optic nasopharyngolaryngoscopy) every 2 to 6 months for the first 5 years. Most head and neck oncologist also obtain PET/CT every 6 to 12 months. There are currently no available surveillance blood tests for patients with HPV-associated OPSCC. The availability of highly sensitive blood-based surveillance test would aide in early detection of cancer recurrence (prior to clinical or radiographic findings) and improve the value of cancer surveillance in this population by reducing the frequency of office visits and the use of expensive radiological imaging studies. To date 73 patients have been prospectively surveilled with HPV-associated OPSCC (
[0139] There are 4 patients in the study who have detectable HPV DNA in the blood using the disclosed methods, yet have no clinical/radiographic evidence of disease and are being closely followed for recurrence. No cancer recurrences have been detected in patients with undetectable ctHPV16DNA. In summary the negative predictive value and positive predictive value of the plasma ctHPV16DNA assay in detecting cancer recurrence is 100% and 70%, respectively. These observations suggest that plasma ctHPVDNA is exquisitely specific and sensitive for the early detection of HPV-associated cancer. Application of the disclosed method as part of clinical care may improve the effectiveness and reducing the cost of cancer surveillance for patients with HPV-associated oropharyngeal cancer.
Example 5: Plasma Circulating Tumor HPV16DNA as a Biomarker for Treatment of HPV-Associated OPSCC
[0140] The RTOG 0129 study demonstrated that exposures influence clinical risk in oropharyngeal cancer. HPV-positive patients tend to do well, and HPV-negative patients with extensive smoking history do poorly. Most studies, including RTOG 0129, also demonstrate an intermediate prognosis for HPV+ cancers that develop in heavy smokers. This is shown in
[0141] Genetic biomarkers can improve clinical risk stratification. For example, a subset of tumors in HPV+ non-smokers may be exceptionally sensitive to therapy, whereas, there may be smokers with HPV+ cancers that have more HPV-like biology, and others that may have more tobacco-like biology. Biomarkers may be able to identify these subgroups better than clinical parameters alone.
[0142] Plasma ctHPVDNA is detected in a majority of HPV-OPSCC patients. As such, ctHPV DNA can be a biomarker of tumor burden, and as importantly, response kinetics. Plasma circulating tumor HPV DNA can also inform decisions regarding who is appropriate for de-escalated therapy of HPV-associated OPSSC.
[0143] A digital PCR assay has been developed for HPV16 DNA that is: highly specific, in that the assay does not cross-detect HPV-18, -31, -33, or 35, and has very low background signal; linear over 5 orders of magnitude in copy number (5-50,000 copies); precise and has exceptional reproducibility; and ultra-sensitive and can detect as few as 6 copies of HPV16 with ˜80% sensitivity. This is shown in
[0144] A study population including 64 patients with biopsy-proven HPV-positive OPSCC that overexpressed p16 (IHC) and/or were HPV ISH positive. All patients received definitive chemo-radiation (no induction chemo). 54 patients (84%) enrolled in a prospective CRT de-intensification trial (60Gy IMRT+weekly Cisplatin 30 mg/m.sup.2). Of these, 46 patients were clinically favorable (<T4 and s ≤10 pack-years tobacco), and 18 were clinically unfavorable (T4 or >10 pack-years tobacco). No patients had N3 or M1 disease. Research bloods were collected pre-treatment, weekly during CRT, and at post-treatment clinic visits (˜450 blood samples analyzed).
[0145] Plasma ctHPV16DNA levels were measured during chemo-radiotherapy. Plasma ctHPV16DNA is responsive to CRT and in most cases is “cleared” after treatment. Its potential as a biomarker of treatment efficacy, and correlation of peak-ctHPV16DNA levels with smoking status, disease burden, and tumor HPV copy number was evaluated. This regimen is shown in
[0146] Plasma ctHPV16 DNA was detected in 77% of the patients, and
[0147] However, plasma ctHPV16 levels did not exhibit significant correlation with disease burden, as shown in
[0148] Attention was next turned to the HPV16 negative patients, and digital PCR assays were developed for the 4 most common alternative HPV strains. This analysis is shown in
[0149] Variable clearance kinetics among patients who were high expressers of HPV16 was also observed. As shown in
[0150] Putting this all together, plasma circulating tumor HPV16 based risk groups were defined. This is depicted in
[0151] As shown in
[0152] In summary, plasma ctHPV16 DNA reveals genetic heterogeneity among HPV-associated OPSCC patients 4/18 (22%) patients with >10 pack-years tobacco or T4 disease and p16+ OPSCC were negative for HPV-16/18/31/33/35. Approximately 30% of HPV-associated OPSCC have a favorable ctHPV16 Profile (i.e., ≥200 copies/mL and rapid clearance kinetics) unfavorable ctHPV16 profiles (i.e., low/undetectable or delayed clearance) are strongly associated with regional disease failure in heavy smokers. Assessment of ctHPV16 profiles can help guide treatment intensity in non-smokers and smokers being treated for HPV-associated OPSCC.
Example 6: Application to Cancer Surveillance in a Longitudinal Clinical Study of Patients that do not Exhibit any Clinical Evidence of Cancer Following Therapy
[0153] A prospective study was conducted of 73 patients who previously were diagnosed with an HPV+ malignancy but were deemed to have “no evidence of disease” after curative intent therapy. The HPV blood test was applied to these patients during a routine follow-up. None of the patients who tested negative in the HPV blood test developed a new HPV+ cancer or recurrence of the prior HPV+ cancer. In contrast, 9 out of 13 patients who tested positive in the HPV blood test were diagnosed with an HPV+ cancer.
[0154]
[0155] A summary of the clinical results is shown in
Example 7: Modified Oligonucleotide Compositions and Methods for Detection of Tumor-Derived HPV16
[0156] Provided in Table 14 below are primers and probes for detection of tumor-derived HPV16, where the “+” signifies a locked nucleic acid. Tumor derived HPV16 DNA can be detected and distinguished from non-tumor sources using any three primer/probe sets from Table 14 within a single multiplex digital PCR reaction, where the central probe has a detection color distinct from both of the other (boundary) probes. The two boundary probes may or may not have the same color. The DNA of the primer/probe sets is modified to include quenchers, dye moieties and locked nucleic acids. In this example, droplets that are positive for the central probe's detection label and negative for the boundary/distal probes detection label contain tumor derived viral DNA.
[0157]
[0158] As another example, modified primer probe sets 4, 7, and 10 from Table 14 could be used for the multiplexed digital PCR reaction to detect tumor-derived HPV16 DNA, where detection probe 7 is conjugated to FAM and detection probes 4 and 10 are conjugated to HEX. Alternatively, detection 7 could be conjugated to FAM, probe 4 conjugated to HEX, and probe 10 conjugated to a different detection moiety.
[0159] In some embodiments, the primer/probe sets may be selected so that no two sets are consecutive in Table 14. For illustration, examples of triads in this embodiment with no consecutive primer probe sets include {1, 3, 5}, {1, 3, 8}, {4, 6, 9}, . . . {14, 16, 18}. Examples of triads with a consecutive primer probe set include {1, 2, 5} and {10, 12, 13}.
[0160] For the purposes of this application, digital PCR refers to any method that will be understood to those versed in the art where PCR reactions are partitioned into many sub-reactions for analysis. The partition could be droplets or microwells or any other partition used for digital PCR.
[0161] It is to be understood that HEX and FAM are used solely for clarity and illustrative purposes in all the examples.
TABLE-US-00015 TABLE 14 Primers and Probes for HPV16 Amplicon (size) Set (Assay) Detail Named as Sequence T.sub.M.sup.1 1 1A Forward 1A_Primer1 5′TGC ACC AAA AGA GA+A CT3′ 60.4 (70 bp) primer (SEQ ID NO: 23) Reverse 1A_Primer2 5′GTG CAT AAC TGT GGT +AAC 60.5 primer T3′ (SEQ ID NO: 24) TaqMan® 1A_Probe 5′/Dye/CT+G +TG+G GTC +CT+G 68.2 probe A/Quencher/3′ (SEQ ID NO: 25) 2 2A Forward 2A_Primer1 5′AGA GOT GCA AAC AAC TAT ACA3′ 62 (78 bp) primer (SEQ ID NO: 26) (E6) Reverse 2A_Primer2 5′TAT ACC TCA CGT CGC AGT3′ 62.2 primer (SEQ ID NO: 27) TaqMan® 2A_Probe 5′/Dye/AGA ATG TGT /Quencher- 67.5 probe 2/GTA CTG CAA GCA ACA GTT/Quencher-1/3′ (SEQ ID NO: 28) 3 3A Forward 3A_Primer1 5′ CGT GAG GTA TAT GAC TTT GCT 62.4 (75 bp) primer T3′ (SEQ ID NO: 29) Reverse 3A_Primer2 5′ TCA CAT ACA GCA TAT GGA TTC 62.1 primer C 3′ (SEQ ID NO: 30) TaqMan® 3A_Probe 5′/Dye/CG+G +GAT +TTA +T+G+C 69.4 probe A/Quencher/3′ (SEQ ID NO: 31) 4 4A Forward 4A_Primer1 5′GTT TTA TTC TAA AAT TAG TGA 60.2 (75 bp) primer +G+TA T3′ (SEQ ID NO: 32) Reverse 4A_Primer2 5′TTG TAT TGC TGT TCT A+AT GTT3′ 59.9 primer (SEQ ID NO: 33) TaqMan® 4A_Probe 5′/Dye/AGT T+T+G +TA+T 67.1 probe +G+GA/Quencher/3′ (SEQ ID NO: 34) 5 5A Forward 5A_Primer1 5′ CAA ACC GTT GTG TGA TTT GT 3′ 61.9 (75 bp) primer (SEQ ID NO: 35) Reverse 5A_Primer2 5′ GAT GTC TTT GCT TTT CTT CAG 62 primer G 3′ (SEQ ID NO: 36) TaqMan® 5A_Probe 5′/Dye/AAG C+C+A +CTG 68.1 probe +T+GT/Quencher/3′ (SEQ ID NO: 37) 6 6A Forward 6A_Primer1 5′TCT GGA CAA AAA GCA A+AG3′ 60.6 (75 bp) primer (SEQ ID NO: 38) Reverse 6A_Primer2 5′GA+T GAT CTG CAA CAA GAC3′ 60.3 primer (SEQ ID NO: 39) TaqMan® 6A_Probe 5′/Dye/TCC AC+C G+A+C CCC 68 probe T/Quencher/3′ (SEQ ID NO: 40) 7 7A Forward 7A_Primer1 5′ TGC ATG AAT ATA TGT TAG ATT 61.9 (76 bp) primer TGC A 3′ (SEQ ID NO: 41) Reverse 7A_Primer2 5′ TCC TCT GAG CTG TCA TTT AAT 61.9 primer T 3′ (SEQ ID NO: 42) TaqMan® 7A_Probe 5′/Dye/A+C+A A+C+T +GAT CT+C 68.2 probe T/Quencher/3′ (SEQ ID NO: 43) 8 8A Forward 8A_Primer1 5′TGA +AAT AGA TGG TCC AGC3′ 60 (74bp) primer (SEQ ID NO: 44) Reverse 8A_Primer2 5′TGC AAC AAA AGG TTA CA+A TA3′ 60 primer (SEQ ID NO: 45) TaqMan® 8A_Probe 5′/Dye/CAG +A+GC C+C+A T+T+A 68.1 probe C/Quencher/3′ (SEQ ID NO: 46) 9 9A Forward 9A_Primer1 5′TGA CTC TAC GOT TOG GTT G3′ 63.6 (73 bp) primer (SEQ ID NO: 47) (E7) Reverse 9A_Primer2 5′GCC CAT TAA CAG GTC TTC C3′ 62.3 primer (SEQ ID NO: 48) TaqMan® 9A_Probe_ 5′/Dye/TACAAAGCA/Quencher-2/CAC 68 probe v1 ACG TAG ACA TTC GTA CTT/Quencher-1/3′ (SEQ ID NO: 49) 9A_Probe_ 5′/Dye/CGT ACA AAG/Quencher- 68.3 v2 2/CAC ACA CGT AGA CAT TCG TAC/Quencher-1/3′ (SEQ ID NO: 50) 9A_Probe_ 5′/Dye/CA+CA+C+G+TA+G+ACAT/Qu 67.7 v3 encher/3′ (SEQ ID NO: 51) 10 1B Forward 1 B_Primer1 5′ACT GCA ATG T+TT CAG G+A3′ 60.2 (79 bp) primer (SEQ ID NO: 52) Reverse 1 B_Primer2 5′CAT +GTA +TAG +TTG TTT +GC3′ 60.1 primer (SEQ ID NO: 53) TaqMan® 1 B_Probe 5′/Dye/CGA CCC AGA/Quencher- 68.3 probe 2/AAG TTA CCA CAG TTA TGC A/Quencher-1/3′ (SEQ ID NO: 54) 11 2B Forward 2B_Primer1 5′TTA GAA TGT GTG TAC TGC +AA3′ 60.2 (75 bp) primer (SEQ ID NO: 55) Reverse 2B_Primer2 5′CAT AAA TCC +CGA AAA GCA3′ 60.2 primer (SEQ ID NO: 56) TaqMan® 2B_probe 5′/Dye/GCA ACA GTT/Quencher- 68.3 probe 2/ACT GCG ACG TGA GGT AT/Quencher-1/3′ (SEQ ID NO: 57) 12 3B Forward 3B_Primer1 5′CAT A+GT ATA T+AG AG+A TGG 60.1 (75 bp) primer GA3′ (SEQ ID NO: 58) Reverse 3B_Primer2 5′TC+T ATA C+TC A+CT AAT TT+T 60.3 primer AG3′ (SEQ ID NO: 59) TaqMan® 3B_Probe 5′/Dye/A+T+C A+C+A TA+C 66.6 probe +AGC/Quencher/3′ (SEQ ID NO: 60) 13 4B Forward 4B_Primer1 5′CAT TAT TGT TAT A+G+T T+T+G 59.9 (73 bp) primer TA3′ (SEQ ID NO: 61) Reverse 4B_Primer2 5′TAA TTA ACA AAT CAC A+CA 59.9 primer ACG3′ (SEQ ID NO: 62) TaqMan® 4B_Probe 5′/Dye/TA+T +G+G+A A+CA A+CA 67.6 probe T/Quencher/3′ (SEQ ID NO: 63) 14 5B Forward 5B_Primer1 5′TG+T ATT AA+C T+GT C+AA AAG3′ 60.2 (70 bp) primer (SEQ ID NO: 64) Reverse 5B_Primer2 5′GGA +ATC TTT GCT TTT +TGT3′ 60.1 primer (SEQ ID NO: 65) TaqMan® 5B_Probe 5′/Dye/TG+T +GT+C +CT+G AAG 68 probe A/Quencher/3′ (SEQ ID NO: 66) 15 6B Forward 6B_Primer1 5′ATA ATA TAA GGG GTC G+GT G3′ 60.1 (80 bp) primer (SEQ ID NO: 67) Reverse 6B_Primer2 5′AGC TGG GTT TCT CTA CG3′ 60.4 primer (SEQ ID NO: 68) TaqMan® 6B_Probe_ 5′/Dye/CGG TCG ATG / Quencher- 68.4 probe v1 2/TAT GTC TTG TTG CAG ATC ATC/Quencher-1/3′ (SEQ ID NO: 69) 6B_Probe_ 5′/Dye/CCG GTC GAT / Quencher- 68.3 v2 2/GTA TGT CTT GTT GCA GAT/Quencher-1/3′ (SEQ ID NO: 70) 16 7B Forward 7B_Primer1 5′TGC ATG GAG ATA CAC CT3′ 59.7 (72 bp) primer (SEQ ID NO: 71) Reverse 7B_Primer2 5′ACA GTA G+AG ATC AGT TGT3′ 59.9 primer (SEQ ID NO: 72) TaqMan® 7B_Probe 5′/Dye/CC+A G+A+G A+C+A 68.4 probe A+CT/Quencher/3′ (SEQ ID NO: 73) 17 8B Forward 8B_Primer1 5′TAT GAG CAA TTA A+A+T G+AC 60 (92 bp) primer A3′ (SEQ ID NO: 74) Reverse 8B_Primer2 5′ATT GT+A ATG GGC TCT GTC3′ 59.9 primer (SEQ ID NO: 75) TaqMan® 8B_Probe 5′/Dye/ATT T+C+A TC+C +T+C+C 68.1 probe T/Quencher/3′ (SEQ ID NO: 76) 18 9B Forward 9B_Primer1 5′TAC +AAA GCA CAC ACG TAG3′ 60 (92 bp) primer (SEQ ID NO: 77) Reverse 9B_Primer2 5′TT+A TGG TTT CTG AGA ACA 60.4 primer GAT3′ (SEQ ID NO: 78) TaqMan® 9B_Probe 5′/Dye/TGG AAG ACC /Quencher- 68.1 probe 2/TGT TAA TGG GCA CAC T/Quencher-1/3′ (SEQ ID NO: 79) .sup.1“Dye” stands for a fluorescent reporter dye. Any reporter dyes such as FAM™, HEX™, VIC®, Cy5™, and Cy5.5™ that is compatible with the detection channels for the instrument can be used. A quencher compatible with the respective dye was used at 3′ end of the probe (Quencher-1). A second quencher (Quencher-2) such as ZEN was sometimes placed internally between 9.sup.th and 10.sup.th nucleotide base from the reporter dye to enhance the overall dye quenching. Note that quenchers are linked to both the preceding and following nucleic acid. .sup.2 These estimates of melting temperature(TM) were calculated using IDT′S oligo analyzer tools with following settings: (a) For primers: Target type = DNA, Oligo concentration = 0.9 pM, Nat concentration = 50 mM, Mg.sup.++ concentration = 3 mM, and dNTPs concentration = 0.8 mM. (b) for Probe: Target type = DNA, Oligo concentration = 0.25 pM, Nat concentration = 50 mM, Mg.sup.++ concentration = 3 mM, and dNTPs concentration = 0.8 mM. .sup.3+ before a nucleic acid = Locked nucleic acid.
Example 8: Modified Oligonucleotide Compositions and Methods for Detection of Tumor-Derived HPV18
[0162] Provided in Table 15 below are primers and probes for detection of tumor-derived HPV18, where the “+” signifies a locked nucleic acid. Tumor derived HPV18 DNA can be detected and distinguished from non-tumor sources using any three primer/probe sets from Table 15 within a single multiplex digital PCR reaction, where the central probe has a detection color distinct from both of the other (boundary) probes. The two boundary probes may or may not have the same color. The DNA of the primer/probe sets is modified to include quenchers, dye moieties, and locked nucleic acids. In this example, droplets that are positive for the central probe's detection label and negative for the boundary/distal probes detection label contain tumor derived viral DNA.
[0163] For example, modified primer probe sets 4, 7, and 10 from Table 15 could be used for the multiplexed digital PCR reaction to detect tumor-derived HPV18 DNA, where detection probe 7 is conjugated to FAM and detection probes 4 and 10 are conjugated to HEX. Alternatively, detection 7 could be conjugated to FAM, probe 4 conjugated to HEX, and probe 10 conjugated to a different detection moiety.
[0164] In some embodiments, the primer/probe sets may be selected so that no two sets are consecutive in Table 15. For illustration, examples of triads in this embodiment with no consecutive primer probe sets include {1, 3, 5}, {1, 3, 8}, {4, 6, 9}, . . . {14, 16, 18}. Examples of triads with a consecutive primer probe set include {1, 2, 5} and {10, 12, 13}.
[0165] For the purposes of this application, digital PCR refers to any method that will be understood to those versed in the art where PCR reactions are partitioned into many sub-reactions for analysis. The partition could be droplets or microwells or any other partition used for digital PCR.
[0166] It is to be understood that HEX and FAM are used solely for clarity and illustrative purposes in all the examples.
TABLE-US-00016 TABLE 15 Primers and probes for HPV18 Amplicon (size) Set (Assay) Detail Named as Sequence T.sub.M.sup.1 1 1C Forward primer 1C_Primer1 5′CGC TTT GAG GAT CCA AC3′ 60 (70 bp) (E6) (SEQ ID NO: 80) Reverse primer 1 C_Primer2 5′GCA GTG AAG TGT TCA GTT3′ 60 (SEQ ID NO: 81) TaqMan® 1 C_Probe 5′/Dye/ACC CTA CAA/Quencher-2/GCT ACC TGA 67.6 probe TCT GTG C/Quencher-1/3′ (SEQ ID NO: 82) 2 2C Forward primer 2C_Primer1 5′AAG ACA +TAG AAA TAA CCT +GT3′ 60.2 (76 bp) (E6) (SEQ ID NO: 83) Reverse primer 2C_Primer2 5′TTA A+A+T +G+CA AAT TCA AAT3′ 60.3 (SEQ ID NO: 84) TaqMan® 2C_Probe 5′/Dye/TGC AAG ACA /Quencher-2/GTA TTG GAA 67.7 probe CTT ACA GAG GT/Quencher-1/3′ (SEQ ID NO: 85) 3 3C Forward primer 3C_Primer1 5′TTA T+TT GTG GTG TAT A+GA GA3′ 59.8 (80 bp) (E6) (SEQ ID NO: 86) Reverse primer 3C_Primer2 5′AAT T+CT +CTA ATT +CTA GAA TAA3′ 59.8 (SEQ ID NO: 87) TaqMan probe 3C_Probe 5′/Dye/CA+T G+C+G +G+TA +TAC T/Quencher/3′ 68.2 (SEQ ID NO: 88) 4 4C Forward primer 4C_Primer1 5′AAG AC+A TTA +TTC AGA C+TC T3′ 60.2 (72 bp) (E6) (SEQ ID NO: 89) Reverse primer 4C_Primer2 5′AAT AAA TTG +TAT AAC +C+CA3′ 60.4 (SEQ ID NO: 90) TaqMan® 4C_Probe 5′/Dye/TG+G +AGA +C+A+C +ATT/Quencher/3′ 67.6 probe (SEQ ID NO: 91) 5 5C Forward primer 5C_Primer1 5′AGAAACCGTTGAATCCAG3′ 59.5 (71 bp) (E6) (SEQ ID NO: 92) Reverse primer 5C_Primer2 5′ATT TCA CAA CAT AGC TGG G3′ 60.1 (SEQ ID NO: 93) TaqMan® 5C_Probe 5′/Dye/AG+A CA+C +C+TT AA+T +GA/Quencher/3′ 68.1 probe (SEQ ID NO: 94) 6 6C Forward primer 6C_Primer1 5′CCA GTG CCA TTC GTG C3′ 60.8 (80 bp) (E6) (SEQ ID NO: 95) Reverse primer 6C_Primer2 5′TTA TA+C TTG +TGT TTC TCT G3′ 60.1 (SEQ ID NO: 96) TaqMan® 6C_Probe 5′/Dye/CAC GAC AGG /Quencher-2/AAC GAC 68.3 probe TCC AAC GAC/Quencher-1/3′ (SEQ ID NO: 97) 7 7C Forward primer 7C_Primer1 5′ATG GAC CTA AGG CAA CA3′ 60.3 (72 bp) (E7) (SEQ ID NO: 98) Reverse primer 7C_Primer2 5′TG+A CAT AGA AGG TCA ACC3′ 60.2 (SEQ ID NO: 99) TaqMan® 7C_Probe 5′/Dye/TT+T A+G+A +G+CC +CC/Quencher/3′ 68.2 probe (SEQ ID NO: 100) 8 8C Forward primer 8C_Primer1 5′CGA GCA A+TT AAG CGA CTC3′ 60.2 (75 bp) (E7) (SEQ ID NO: 101) Reverse primer 8C_Primer2 5′CGG GCT GGT AAA TGT TGA3′ 60 (SEQ ID NO: 102) TaqMan® 8C_Probe 5′/Dye/T+C+G +TTT T+CT T+C+C T/Quencher/3′ 68.1 probe (SEQ ID NO: 103) 9 9C Forward primer 9C_Primer1 5′ACA ACG TCA CAC AAT GTT3′ 60.1 (75 bp) (E7) (SEQ ID NO: 104) Reverse primer 9C_Primer2 5′TCT GCT GAG CTT TCT ACT3′ 60 (SEQ ID NO: 105) TaqMan® 9C_Probe 5′/Dye/TGT ATG TGT /Quencher-2/TGT AAG TGT 66.9 probe GAA GCC AGA AT/Quencher-1/3′ (SEQ ID NO: 106) 10 10C Forward primer 10C_Primer1 5′ACC TTC GAG CAT TCC A3′ 60.2 (74 bp) (E7) (SEQ ID NO: 107) Reverse primer 10C_Primer2 5′TTACTGCTGGGATGCA3′ 60.2 (SEQ ID NO: 108) TaqMan® 10C_Probe 5′/Dye/CTG AA+C +AC+C C+T+G T/Quencher/3′ 68.2 probe (SEQ ID NO: 109) 11 1D Forward primer 1 D_Primer1 5′CCC TAC AAG CTA CCT GAT3′ 60 (83 bp) (E6) (SEQ ID NO: 110) Reverse primer 1 D_Primer2 5′CAA TAT A+CA +CAG +GT+T ATT T3′ 60.1 (SEQ ID NO: 111) TaqMan® 1 D_Probe 5′/Dye/CA+C +G+GA A+C+T GAA C/Quencher/3′ 68.1 probe (SEQ ID NO: 112) 12 2D Forward primer 2D_Primer1 5′TAT TT+G +AAT TT+G +CAT +TTA3′ 59.9 (92 bp) (E6) (SEQ ID NO: 113) Reverse primer 2D_Primer2 5′AAT +CTA TA+C +ATT TAT +GGC3′ 59.9 (SEQ ID NO: 114) TaqMan® 2D_Probe 5′/Dye/AG+A C+AG +TA+T AC+C 67.9 probe +GC/Quencher/3′ (SEQ ID NO: 115) 13 3D Forward primer 3D_Primer1 5′CTA G+AA TTA +G+A+G AAT T+AA GA3′ 60.1 (74 bp) (E6) (SEQ ID NO: 116) Reverse primer 3D_Primer2 5′AGT GTT AGT TAG TTT +TTC CAA T3′ 60.1 (SEQ ID NO: 117) TaqMan® 3D_Probe 5′/Dye/TC+A +G+A+C T+CT G+TG T/Quencher/3′ 68.4 probe (SEQ ID NO: 118) 14 4D Forward primer 4D_Primer1 5′ATT A+AT AAG GTG CC+T GC3′ 60.2 (75 bp) (E6) (SEQ ID NO: 119) Reverse primer 4D_Primer2 5′TCG III I I c AIT A+AG GTG T3′ 60 (SEQ ID NO: 120) TaqMan® 4D_Probe 5′/Dye/TGA AT+C +C+AG C+A+G A/Quencher/3′ 67.8 probe (SEQ ID NO: 121) 15 5D Forward primer 5D_Primer1 5′ATT TCA CAA CAT AGC TGG G3′ 60.1 (98 bp) (E6) (SEQ ID NO: 122) Reverse primer 5D_Primer2 5′GTT TCT CTG CGT CGT TG3′ 60.4 (SEQ ID NO: 123) TaqMan® 5D_Probe 5′/Dye/AG+T G+C+C +A+TT C+GT G/Quencher/3′ 68.3 probe (SEQ ID NO: 124) 16 6D Forward primer 6D_Primer1 5′ATT +GTA TTG CAT TTA GAG CC3′ 59.8 (90 bp) (E7) (SEQ ID NO: 125) Reverse primer 6D_Primer2 5′TTC ATC GTT TTC TTC +CTC3′ 59.9 (SEQ ID NO: 126) TaqMan® 6D_Probe 5′/Dye/CTA T+G+T +CA+C +G+AG C/Quencher/3′ 68.2 probe (SEQ ID NO: 127) 17 7D Forward primer 7D_Primer1 5′ATA GAT G+GA GTT A+AT CAT CA3′ 59.7 (82 bp) (E7) (SEQ ID NO: 128) Reverse primer 7D_Primer2 5′AC+T TAC AAC ACA +TAC ACA3′ 60 (SEQ ID NO: 129) TaqMan® 7D_Probe 5′/Dye/CCG AAC CAC /Quencher-2/AAC GTC ACA 67.8 probe CAA TGT T/Quencher-1/3′ (SEQ ID NO: 130) 18 8D Forward primer 8D_Primer1 5′TGA AGO CAG AAT TGA GOT AG3′ 61.9 (83 bp) (SEQ ID NO: 131) (E7) Reverse primer 8D_Primer2 5′AGG ACA GGG TGT TCA GAA3′ 62.6 (SEQ ID NO: 132) TaqMan® 8D_Probe 5′/Dye/CA+GA+C+GAC+CTTCG/Quencher/3′ 65.9 probe (SEQ ID NO: 133) .sup.1“Dye” stands for a fluorescent reporter dye. Any reporter dyes such as FAM™, HEX™, VIC®, Cy5™, and Cy5.5™ that is compatible with the detection channels for the instrument can be used. A quencher compatible with the respective dye was used at 3′ end of the probe (Quencher-1). A second quencher (Quencher-2) such as ZEN was sometimes placed internally between 9.sup.th and 10.sup.th nucleotide base from the reporter dye to enhance the overall dye quenching. .sup.2 These estimates of melting temperature(TM) were calculated using IDT′S oligo analyzer tools with following settings: (a) For primers: Target type = DNA, Oligo concentration = 0.9 pM, Nat concentration = 50 mM, Mg.sup.++ concentration = 3 mM, and dNTPs concentration = 0.8 mM. (b) for Probe: Target type = DNA, Oligo concentration = 0.25 pM, Nat concentration = 50 mM, Mg.sup.++ concentration = 3 mM, and dNTPs concentration = 0.8 mM. .sup.3+ = Locked nucleic acid
Example 9: Modified Oligonucleotide Compositions and Methods for Detection of Tumor-Derived HPV31
[0167] Provided in Table 16 below are primers and probes for detection of tumor-derived HPV31, where the “+” signifies a locked nucleic acid. Tumor derived HPV31 DNA can be detected and distinguished from non-tumor sources using any three primer/probe sets from Table 16 within a single multiplex digital PCR reaction, where the central probe has a detection color distinct from both of the other (boundary) probes. The two boundary probes may or may not have the same color. The DNA of the primer/probe sets is modified to include quenchers, dye moieties and locked nucleic acids. In this example, droplets that are positive for the central probe's detection label and negative for the boundary/distal probes detection label contain tumor derived viral DNA.
[0168] For example, modified primer probe sets 4, 7, and 10 from Table 16 could be used for the multiplexed digital PCR reaction to detect tumor-derived HPV31 DNA, where detection probe 7 is conjugated to FAM and detection probes 4 and 10 are conjugated to HEX. Alternatively, detection 7 could be conjugated to FAM, probe 4 conjugated to HEX, and probe 10 conjugated to a different detection moiety.
[0169] In some embodiments, the primer/probe sets may be selected so that no two sets are consecutive in Table 16. For illustration, examples of triads in this embodiment with no consecutive primer probe sets include {1, 3, 5}, {1, 3, 8}, {4, 6, 9}, . . . {13, 15, 17}. Examples of triads with a consecutive primer probe set include {1, 2, 5} and {10, 12, 13}.
[0170] For the purposes of this application, digital PR refers to any method that will be understood to those versed in the art where PCR reactions are partitioned into many sub-reactions for analysis. The partition could be droplets or microwells or any other partition used for digital PCR.
[0171] It is to be understood that HEX and FAM are used solely for clarity and illustrative purposes in all the examples.
TABLE-US-00017 TABLE 16 Primers and probes for HPV31 Amplicon (size) Set (Assay) Detail Named as Sequence T.sub.M.sup.1 1 1E Forward primer 1 E_Primer1 5′ATG TTC AAA AA+T CCT GCA3′ 60 (75 bp) (E6) (SEQ ID NO: 134) Reverse primer 1E_Primer2 5′TTC ATC GTA GGG TAT +TTC 03′ 60.2 (SEQ ID NO: 135) TaqMan® probe 1 E_Probe 5′/Dye/AAC +T+AA G+C+T C+G+G C/Quencher/3′ 68.3 (SEQ ID NO: 136) 2 2E Forward primer 2E_Primer1 5′CT+A AGA TTG A+AT TGT GT+C T3′ 59.9 (75 bp) (E6) (SEQ ID NO: 137) Reverse primer 2E_Primer2 5′TAA ATC +TGT AAA TGC AA+A ATC TA 3′ 59.9 (SEQ ID NO: 138) TaqMan® probe 2E_Probe 5′/Dye/AC+A GA+A A+CA +G+AG 68.1 +GT/Quencher/3′ (SEQ ID NO: 139) 3 3E Forward primer 3E_Primer1 5′ACA ATA +GTA TAT AGG GAC GAC3′ 59.9 (75 bp) (E6) (SEQ ID NO: 140) Reverse primer 3E_Primer2 5′TTC ACT +TAC TTT TGA +ATA +AAA T3′ 59.8 (SEQ ID NO: 141) TaqMan® probe 3E_Probe 5′/Dye/AC+G +G+AG TG+T +GTA C/Quencher/3′ 68.1 (SEQ ID NO: 142) 4 4E Forward primer 4E_Primer1 5′TTT A+GA TG+G TAT AGA TAT AGT GT3′ 60 (81 bp) (E6) (SEQ ID NO: 143) Reverse primer 4E_Primer2 5′CC+T AAT TAA +C+AA ATC ACA TA3′ 60 (SEQ ID NO: 144) TaqMan® probe 4E_Probe 5′/Dye/A+T+G +G+AA +C+AA CAT T/Quencher/3′ 67.7 (SEQ ID NO: 145) 5 5E Forward primer 5E_Primer1 5′TGT AT+A ACG TGT +CAA AGA C 60 (74 bp) (E6) (SEQ ID NO: 146) Reverse primer 5E_Primer2 5′TTG TGG AAT C+GT T+TC TTT3′ 59.9 (SEQ ID NO: 147) TaqMan® probe 5E_Probe 5′/Dye/TGT +G+TC +C+AG A+A+G A/Quencher/3′ 68.4 (SEQ ID NO: 148) 6 6E Forward primer 6E_Primer1 CAT AGG AGG AAG GTG GAC 60.5 (70 bp) (E6) (SEQ ID NO: 149) Reverse primer 6E_Primer2 5′TTA CAC TT+G GGT +TTC AG3′ 60.2 (SEQ ID NO: 150) TaqMan® probe 6E_Probe 5′/Dye/CGT TGC ATA /Quencher-2/GCA TGT 67.4 TGG AGA AGA CC/Quencher-1/3′ (SEQ ID NO: 151) 7 7E Forward primer 7E_Primer1 5′CAA GA+C TAT GTG TTA +GAT T3′ 59.9 (75 bp) (E7) (SEQ ID NO: 152) Reverse primer 7E_Primer2 5′TCA TCT GAG CTG TC+G G+GT AAT T3′ 60.1 (SEQ ID NO: 153) TaqMan® probe 7E_Probe 5′/Dye/AAC TGA +C+C+T C+C+A C/Quencher/3′ 68.3 (SEQ ID NO: 154) 8 8E Forward primer 8E_Primer1 5′AGG ATG TCA TA+G ACA GTC3′ 59.8 (89 bp) (E7) (SEQ ID NO: 155) Reverse primer 8E_Primer2 5′TG+T AGA CTT ACA CTG ACA A3′ 60.3 (SEQ ID NO: 156) TaqMan® probe 8E_Probe 5′/Dye/CTG +G+AC A+AG +C+AG A/Quencher/3′ 68 (SEQ ID NO: 157) 9 9E Forward primer 9E_Primer1 5′AGC ACA CAA GTA GAT ATT CGC3′ 62.4 (79 bp) (E7) (SEQ ID NO: 158) Reverse primer 9E_Primer2 5′TAG TAG AAC AGT TGG GGC A3′ 62.6 (SEQ ID NO: 159) TaqMan® probe 9E_Probe 5′/Dye/TAA+C+AG+CT+C+TTG+C/Quencher/3′ 65.3 (SEQ ID NO: 160) 10 1F Forward primer 1F_Primer1 5′AAA TTG CAT G+AA CTA +AGC3′ 60.2 (82 bp) (E6) (SEQ ID NO: 161) Reverse primer 1 F_Primer2 5′TT+A ACT GAC CTT TGC AGT3′ 59.8 (SEQ ID NO: 162) TaqMan® probe 1F_Probe 5′/Dye/CGG CAT TGG /Quencher-2/AAA TAC 68.1 CCT ACG ATG AAC TAA/Quencher-1/3′ (SEQ ID NO: 163) 11 2F Forward primer 2F_Primer1 5′CAG AA+A CAG AGG TAT TA+G AT3′ 60.1 (90 bp) (E6) (SEQ ID NO: 164) Reverse primer 2F_Primer2 5′TTA +AAC ATT TTG TAC A+CA CT3′ 59.8 (SEQ ID NO: 165) TaqMan® probe 2F_Probe 5′/Dye/AC+G +A+CA +C+AC CAC A/Quencher/3′ 68.1 (SEQ ID NO: 166) 12 3F Forward primer 3F_Primer1 5′ATT T+TA TTC AA+A AGT A+AG TGA3′ 59.8 (81 bp) (E6) (SEQ ID NO: 167) Reverse primer 3F_Primer2 5′CCT +TTG TTT GTC +AAT T+TT TC3′ 60.1 (SEQ ID NO: 168) TaqMan® probe 3F_Probe 5′/Dye/TAG +T+G+T GTA +T+G+G A/Quencher/3′ 68.7 (SEQ ID NO: 169) 13 4F Forward primer 4F_Primer1 5′TAT ATG TGA TTT GTT A+AT TA+G GT3′ 60 (75 bp) (E6) (SEQ ID NO: 170) Reverse primer 4F_Primer2 5′TCC AA+A TGT C+TT TGT TTT TC3′ 60.1 (SEQ ID NO: 171) TaqMan® probe 4F_Probe 5′/Dye/CC+G TT+G T+G+T +C+CA G/Quencher/3′ 68.1 (SEQ ID NO: 172) 14 5F Forward primer 5F_Primer1 5′TAA AAA G+AA ACG ATT +CCA C3′ 60.1 (80 bp) (E6) (SEQ ID NO: 173) Reverse primer 5F_Primer2 5′TT+T CAG TAC GAG GTC TTC3′ (SEQ ID NO: 174) TaqMan® probe 5F_Probe 5′/Dye/AAG GTG GAC /Quencher-2/AGG ACG 66.5 TTG CA/Quencher-1/3′ (SEQ ID NO: 175) 15 6F Forward primer 6F_Primer1 5′TGG AGA AAC ACC TAC GT3′ 59.8 (74 bp) (E7) (SEQ ID NO: 176) Reverse primer 6F_Primer2 5′TAA TTG CTC AT+A ACA GTG GA3′ 60 (SEQ ID NO: 177) TaqMan® probe 6F_Probe 5′/Dye/AA+C +C+T+G AGG CAA C/Quencher/3′ 68.3 (SEQ ID NO: 178) 16 7F Forward primer 7F_Primer1 5′AGA TGA GGA GGA TGT C+AT3′ 60.3 (74 bp) (E7) (SEQ ID NO: 179) Reverse primer 7F_Primer2 5′AG+G TAA +CGA TAT T+GT AAT T3′ 59.8 (SEQ ID NO: 180) TaqMan® probe 7F_Probe 5′/Dye/CA+A +G+C+A G+AA C+CG/Quencher/3′ 67.9 (SEQ ID NO: 181) 17 8F Forward primer 8F_Primer1 5′TGT CAG T+GT AAG TC+T ACA3′ 60.2 (90 bp) (E7) (SEQ ID NO: 182) Reverse primer 8F_Primer2 5′TCC AAA TGA GCC C+AT TAA3′ 59.9 (SEQ ID NO: 183) TaqMan® probe 8F_Probe 5′/Dye/TGT +A+C+A +GA+G CA+C A/Quencher/3′ 68.2 (SEQ ID NO: 184) .sup.1“Dye” stands for a fluorescent reporter dye. Any reporter dyes such as FAM™, HEX™, VIC®, Cy5™, and Cy5.5™ that is compatible with the detection channels for the instrument can be used. A quencher compatible with the respective dye was used at 3′ end of the probe (Quencher-1). A second quencher (Quencher-2) such as ZEN was sometimes placed internally between 9.sup.th and 10.sup.th nucleotide base from the reporter dye to enhance the overall dye quenching. .sup.2 These estimates of melting temperature(TM) were calculated using IDT′S oligo analyzer tools with following settings: (a) For primers: Target type = DNA, Oligo concentration+.9 pM, Nat concentration = 50 mM, Mg.sup.++ concentration = 3 mM, and dNTPs concentration+.8 mM. (b) for Probe: Target type = DNA, Oligo concentration = 0.25 pM, Nat concentration = 50 mM, Mg.sup.++ concentration = 3 mM, and dNTPs concentration = 0.8 mM. .sup.3+ = Locked nucleic acid
Example 10: Modified Oligonucleotide Compositions and Methods for Detection of Tumor-Derived HPV33
[0172] Provided in Table 17 below are primers and probes for detection of tumor-derived HPV33, where the “+” signifies a locked nucleic acid. Tumor derived HPV33 DNA can be detected and distinguished from non-tumor sources using any three primer/probe sets from Table 17 within a single multiplex digital PCR reaction, where the central probe has a detection color distinct from both of the other (boundary) probes. The two boundary probes may or may not have the same color. The DNA of the primer/probe sets is modified to include quenchers, dye moieties and locked nucleic acids. In this example, droplets that are positive for the central probe's detection label and negative for the boundary/distal probes detection label contain tumor derived viral DNA.
[0173] For example, modified primer probe sets 4, 7, and 10 from Table 17 could be used for the multiplexed digital PCR reaction to detect tumor-derived HPV33 DNA, where detection probe 7 is conjugated to FAM and detection probes 4 and 10 are conjugated to HEX. Alternatively, detection 7 could be conjugated to FAM, probe 4 conjugated to HEX, and probe 10 conjugated to a different detection moiety.
[0174] In some embodiments, the primer/probe sets may be selected so that no two sets are consecutive in Table 17. For illustration, examples of triads in this embodiment with no consecutive primer probe sets include {1, 3, 5}, {1, 3, 8}, {4, 6, 9}, . . . {11, 13, 15}. Examples of triads with a consecutive primer probe set include {1, 2, 5} and {10, 12, 13}.
[0175] For the purposes of this application, digital PCR refers to any method that will be understood to those versed in the art where PCR reactions are partitioned into many sub-reactions for analysis. The partition could be droplets or microwells or any other partition used for digital PCR.
[0176] It is to be understood that HEX and FAM are used solely for clarity and illustrative purposes in all the examples.
TABLE-US-00018 TABLE 17 Primers and probes for HPV33 Amplicon (size) Set (Assay) Detail Named as Sequence T.sub.M.sup.1 1 1G (75 bp) Forward primer 1G_Primer1 5′TTC AAG ACA CTG AGG +AAA3′ 59.9 (E6 assay) (SEQ ID NO: 185) Reverse primer 1 G_Primer2 5′AAT GTT GT+G TAT AGT T+GT CTC3′ 60.2 (SEQ ID NO: 186) TaqMan® probe 1G_Probe 5′/Dye/AAC ATT GCA /Quencher-2/TGA TTT 67.6 GTG CCA AGC ATT/Quencher-1/3′ (SEQ ID NO: 187) 2 2G (77 bp) Forward primer 2G_Primer1 5′AAT GCA AAA AAC CTT +TGC3′ 60.1 (E6 assay) (SEQ ID NO: 188) Reverse primer 2G_Primer2 5′TCC C+TC TCT +ATA TAC A+AC T3′ 60.2 (SEQ ID NO: 189) TaqMan® probe 2G_Probe 5′/Dye/CG+A TC+T +G+AG G+T+A 67.1 T/Quencher/3′ (SEQ ID NO: 190) 3 3G (83 bp) Forward primer 3G_Primer1 5′AAT +CCA TTT G+GA ATA TG+T A3′ 59.8 (E6 assay) (SEQ ID NO: 191) Reverse primer 3G_Primer2 5′CCA +TAT A+CA +GAA T+AA TTA TAA 60 TG3′ (SEQ ID NO: 192) TaqMan® probe 3G_Probe 5′/Dye/CT+G +T+GT TTG +C+GG 68.2 T/Quencher/3′ (SEQ ID NO: 193) 4 4G (75 bp) Forward primer 4G_Primer1 5′TGA +A+AT ATT AAT TA+G +GTG T3′ 60 (E6 assay) (SEQ ID NO: 194) Reverse primer 4G_Primer2 5′TTT AAA TCC ACA TGT +CGT T3′ 59.9 (SEQ ID NO: 195) TaqMan® probe 4G_Probe 5′/Dye/TG+T GTC +C+T+C +AA+G 68 A/Quencher/3′ (SEQ ID NO: 196) 5 5G (82 bp) Forward primer 5G_Primer1 5′CAA A+CG +ATT T+CA TAA TA+T T3′ 59.9 (E6 assay) (SEQ ID NO: 197) Reverse primer 5G_Primer2 5′CAG TGC AGT TTC TCT ACG3′ 59.6 (SEQ ID NO: 198) TaqMan® probe 5G_Probe 5′/Dye/ACA +CG+C CGC +ACA 68.1 G/Quencher/3′ (SEQ ID NO: 199) 6 6G (75 bp) Forward primer 6G_Primer1 5′ACA CAA GCC AAC GTT AAA3′ 60.1 (E6 assay) (SEQ ID NO: 200) Reverse primer 6G_Primer2 5′AAT TGC TCA TA+G CA+G TAT A3′ 59.9 (SEQ ID NO: 201) TaqMan® probe 6G_Probe 5′/Dye/ATC +C+T+G AA+C +CAA 67.8 C/Quencher/3′ (SEQ ID NO: 202) 7 7G (83 bp) Forward primer 7G_Primer1 5′AAG TGA CAG CTC AGA TGA3′ 60.3 (E7 assay) (SEQ ID NO: 203) Reverse primer 7G_Primer2 5′TTA CA+A TGT AGT AA+T CAG CT3′ 60.1 (SEQ ID NO: 204) TaqMan® probe 7G_Probe 5′/Dye/CG+G T+C+C AA+G OCT 67.8 T/Quencher/3′ (SEQ ID NO: 205) 8 8G (87 bp) Forward primer 8G_Primer1 5′TAACACCACAGTTCGTTTATGT3′ 62.4 (E7 assay) (SEQ ID NO: 206) Reverse primer 8G_Primer2 5′ACAATATTCACTGTGCCCATA3′ 61.9 (SEQ ID NO: 207) TaqMan® probe 8G_Probe_v 5′/Dye/TG +AC+C +TA+CG 66.4 1 +A+ACC/Quencher/3′ (SEQ ID NO: 208) 8G_Probe_v 5′/Dye/CAG +TA+C +AG+C A+A+G 68.3 2 T/Quencher/3′ (SEQ ID NO: 209) 9 1H (81 bp) Forward primer 1 H_Primer1 5′CAA GCA TTG GAG AC+A ACT A3′ 60.3 (E6 assay) (SEQ ID NO: 210) Reverse primer 1 H_Primer2 5′TAT ACC TCA GAT CG+T TGC3′ 60 (SEQ ID NO: 211) TaqMan® probe 1 H_Probe 5′/Dye/TC+C A+C+G CAC +TG+T 68.6 A/Quencher/3′ (SEQ ID NO: 212) 10 2H (75 bp) Forward primer 2H_Primer1 5′TGA TT+T TGC ATT TGC AGA3′ 60.1 (E6 assay) (SEQ ID NO: 213) Reverse primer 2H_Primer2 5′CAA A+CA CA+G TTT A+CA TAT3′ 60 (SEQ ID NO: 214) TaqMan® probe 2H_Probe 5′/Dye/TT+C +C+CT +C+T+C TAT 68 A/Quencher/3′ (SEQ ID NO: 215) 11 3H (79 bp) Forward primer 3H_Primer1 5′GTT +C+TT AT+C TAA AAT TA+G TG3′ 59.7 (E6 assay) (SEQ ID NO: 216) Reverse primer 3H_Primer2 5′TTT AAC TG+T TTG TTC +TAA TGT3′ 60 (SEQ ID NO: 217) TaqMan® probe 3H_Probe_v 5′/Dye/TT+C +C+AT ATA +C+A+G 65 1 A/Quencher/3′ (SEQ ID NO: 218) 3H_Probe_v 5′/Dye/T+CT G+TA TA+T +G+G+A 65 2 A/Quencher/3′ (SEQ ID NO: 219) 12 4H (80 bp) Forward primer 4H_Primer1 5′AGG TGT ATT ATA T+GT CAA A+GA3′ 59.9 (E6 assay) (SEQ ID NO: 220) Reverse primer 4H_Primer2 5′ATA TTA TGA AAT +C+G+T TTG TT3′ 60.2 (SEQ ID NO: 221) TaqMan® probe 4H_Probe_v 5′/Dye/TT+G T+GT +C+C+T CA+A 67.9 1 G/Quencher/3′ (SEQ ID NO: 222) 4H_Probe_v 5′/Dye/CG+A +CAT GT+G +G+AT 67 2 T/Quencher/3′ (SEQ ID NO: 223) 13 5H(74 bp) Forward primer 5H_Primer1 5′AG+G +AAT ATG T+TT TA+G ATT3′ 60.1 (E6 assay) (SEQ ID NO: 224) Reverse primer 5H_Primer2 5′ATC TGA GCT GTC ACT +TAA3′ 60.2 (SEQ ID NO: 225) TaqMan® probe 5H_probe 5′/Dye/TG+A +C+C+T A+TA +CTG 68.1 C/Quencher/3′ (SEQ ID NO: 226) 14 6H (77 bp) Forward primer 6H_Primer1 5′GAG GAT GAA GGC TTG GA3′ 60.6 (E7 assay) (SEQ ID NO: 227) Reverse primer 6H_Primer2 5′TGA CA+A CAG GTT A+CA AT3′ 60.3 (SEQ ID NO: 228) TaqMan® probe 6H_probe 5′/Dye/CCA GAT GGA /Quencher-2/CAA 67.7 GCA CAA CCA GC/Quencher-1/3′ (SEQ ID NO: 229) 15 7H (77 bp) Forward primer 7H_Primer1 5′TGT CA+A CAG TAC AGC AA3′ 60 (E7 assay) (SEQ ID NO: 230) Reverse primer 7H_Primer2 5′AGG TAG GGC ACA CAA TAT3′ 60.2 (SEQ ID NO: 231) TaqMan® probe 7H_Probe 5′/Dye/AC+C +ATA +C+A+G +CAA 68.1 C/Quencher/3′ (SEQ ID NO: 232) .sup.1“Dye” stands for a fluorescent reporter dye. Any reporter dyes such as FAM™, HEX™, VIC®, Cy5™, and Cy5.5™ that is compatible with the detection channels for the instrument can be used. A quencher compatible with the respective dye was used at 3′ end of the probe (Quencher-1). A second quencher (Quencher-2) such as ZEN was sometimes placed internally between 9.sup.th and 10.sup.th nucleotide base from the reporter dye to enhance the overall dye quenching. .sup.2 These estimates of melting temperature(TM) were calculated using IDT′S oligo analyzer tools with following settings: (a) For primers: Target type = DNA, Oligo concentration = 0.9 pM, Nat concentration = 50 mM, Mg.sup.++ concentration = 3 mM, and dNTPs concentration = 0.8 mM. (b) for Probe: Target type = DNA, Oligo concentration = 0.25 pM, Nat concentration = 50 mM, Mg.sup.++ concentration = 3 mM, and dNTPs concentration = 0.8 mM. .sup.3+ = Locked nucleic acid
Example 11: Modified Oligonucleotide Compositions and Methods for Detection of Tumor-Derived HPV35
[0177] Provided in Table 18 below are primers and probes for detection of tumor-derived HPV35, where the “+” signifies a locked nucleic acid. Tumor derived HPV35 DNA can be detected and distinguished from non-tumor sources using any three primer/probe sets from Table 18 within a single multiplex digital PCR reaction, where the central probe has a detection color distinct from both of the other (boundary) probes. The two boundary probes may or may not have the same color. The DNA of the primer/probe sets is modified to include quenchers, dye moieties and locked nucleic acids. In this example, droplets that are positive for the central probe's detection label and negative for the boundary/distal probes detection label contain tumor derived viral DNA.
[0178] For example, modified primer probe sets 4, 7, and 10 from Table 18 could be used for the multiplexed digital PCR reaction to detect tumor-derived HPV35 DNA, where detection probe 7 is conjugated to FAM and detection probes 4 and 10 are conjugated to HEX. Alternatively, detection 7 could be conjugated to FAM, probe 4 conjugated to HEX, and probe 10 conjugated to a different detection moiety.
[0179] In some embodiments, the primer/probe sets may be selected so that no two sets are consecutive in Table 18. For illustration, examples of triads in this embodiment with no consecutive primer probe sets include {1, 3, 5}, {1, 3, 8}, {4, 6, 9}, . . . {12, 14, 16}. Examples of triads with a consecutive primer probe set include {1, 2, 5} and {10, 12, 13}.
[0180] For the purposes of this application, digital PCR refers to any method that will be understood to those versed in the art where PCR reactions are partitioned into many sub-reactions for analysis. The partition could be droplets or microwells or any other partition used for digital PCR.
[0181] It is to be understood that HEX and FAM are used solely for clarity and illustrative purposes in all the examples.
TABLE-US-00019 TABLE 18 Primers and probes for HPV35 Amplicon (size) Set (Assay) Detail Named as Sequence T.sub.M.sup.1 1 1I (78 bp) Forward primer 1I_Primer1 5′CTG A+AC G+AC CTT ACA AA3′ 59.9 (E6 assay) (SEQ ID NO: 233) Reverse primer 1I_Primer2 5′ATA CAC AAT T+CA AA+C +AAA3′ 60.3 (SEQ ID NO: 234) TaqMan® probe 1I_Probe 5′/Dye/TGA TTT GTG /Quencher-2/CAA CGA 67.5 GGT AGA AGA AAG C/Quencher-1/3′ (SEQ ID NO: 235) 1I_probe_v 5′/Dye/CG+A G+G+T +A+GA A+GA 67.4 2 A/Quencher/3′ (SEQ ID NO: 236) 2 2I (72 bp) Forward primer 2I_Primer1 5′CAA A+CA AGA A+TT AC+A GC3′ 60 (E6 assay) (SEQ ID NO: 237) Reverse primer 2I_Primer2 5′CCT +T+CT +CTA TAT A+CT ATA3′ 59.9 (SEQ ID NO: 238) TaqMan® probe 2l_probe 5′/Dye/AG+T +C+A+T ATA +C+CT 67.5 CAC/Quencher/3′ (SEQ ID NO: 239) 3 3I (80 bp) Forward primer 3I_Primer1 5′ATT +C+AA AAA TAA +G+TG AAT3′ 59.7 (E6 assay) (SEQ ID NO: 240) Reverse primer 3I_Primer2 5′TAA CTG TTT GTT +GCA TTG T3′ 59.8 (SEQ ID NO: 241) TaqMan® probe 3I_Probe 5′/Dye/TA+G +T+GT GTA +T+G+G 68.1 A/Quencher/3′ (SEQ ID NO: 242) 4 4I (75 bp) Forward primer 4I_Primer1 5′TGT CAT T+TA +T+TA ATT +AGG T3′ 60 (E6 assay) (SEQ ID NO: 243) Reverse primer 4I_Primer2 5′TTC TTC TAA +ATG T+CT TTG C3′ 60 (SEQ ID NO: 244) TaqMan® probe 4I_Probe 5′/Dye/TG+T +CAA AAA +C+C+G 68.4 C/Quencher/3′ (SEQ ID NO: 245) 5 5I (74 bp) Forward primer 5I_Primer1 5′CGA TTC CAT AAC +ATC GGT3′ 60 (E6 assay) (SEQ ID NO: 246) Reverse primer 5I_Primer2 5′TCG GTT TCT CTA CGT GT3′ 59.7 (SEQ ID NO: 247) TaqMan® probe 5I_Probe 5′/Dye/CG+G +T+G+T AT+G +TCC 68.1 T/Quencher/3′ (SEQ ID NO: 248) 6 6I (75 bp) Forward primer 6I_Primer1 5′CAT GGA +GA+A ATA ACT A+CA3′ 60 (E7 assay) (SEQ ID NO: 249) Reverse primer 6I_Primer2 5′CTC ATA ACA +GTA +TA+G GTC3′ 60.2 (SEQ ID NO: 250) TaqMan® probe 6I_Probe 5′/Dye/TG+C AA+G A+C+T A+T+G 67.5 T/Quencher/3′ (SEQ ID NO: 251) 7 7I (79 bp) Forward primer 7I_Primer1 5′AAT T+GT GTG ACA GCT CA3′ 60.1 (E7 assay) (SEQ ID NO: 252) Reverse primer 7I_Primer2 5′TAA TTG GAG GTG TCT GGT3′ 60 (SEQ ID NO: 253) TaqMan® probe 7I_Probe 5′/Dye/TT+G +C+TT +GTC +C+AG 68.1 C/Quencher/3′ (SEQ ID NO: 254) 8 8I (92 bp) Forward primer 8I_Primer1 5′TA+A TAT TGT AAC GT+C CTG T3′ 60 (E7 assay) (SEQ ID NO: 255) Reverse primer 8I_Primer2 5′AT+A A+AT CTT C+CA ATT +TAC G3′ 59.9 (SEQ ID NO: 256) TaqMan® probe 8I_Probe 5′/Dye/CA+C +TA+C +G+TC TG+T 67.4 G/Quencher/3′ (SEQ ID NO: 257) 9 U (72 bp) Forward primer 1J_Primer1 5′TGC ATG ATT TGT +GCA AC3′ 60.1 (E6 assay) (SEQ ID NO: 258) Reverse primer 1J_Primer2 5′CTT G+TT TGC AGT A+TA CAC3′ 60.1 (SEQ ID NO: 259) TaqMan® probe 1J_Probe 5′/Dye/AAA G+C+A T+C+C +AT+G 68.1 A/Quencher/3′ (SEQ ID NO: 260) 10 2J (95 bp) Forward primer 2J_Primer1 5′CAG CGG AGT GAG GTA TAT3′ 60 (E6 assay) (SEQ ID NO: 261) Reverse primer 2J_Primer2 5′AAT T+TT A+AA +CAT TT+C +ATG3′ 60 (SEQ ID NO: 262) TaqMan® probe 2J_Probe 5′/Dye/AG+A G+AA G+GC C+A+G 68 C/Quencher/3′ (SEQ ID NO: 263) 11 3J (76 bp) Forward primer 3J_Primer1 5′AAT +ATA +GAT G+GT ATA +G+AT ATA3′ 60 (E6 assay) (SEQ ID NO: 264) Reverse primer 3J_Primer2 5′AAT A+AA T+GA +CAT AAC T+GT TT3′ 60.1 (SEQ ID NO: 265) TaqMan® probe 3J_Probe 5′/Dye/TT+C +T+C+C A+TA +CAC 67.8 A/Quencher/3′ (SEQ ID NO: 266) 12 4J (75 bp) Forward primer 4J_Primer1 5′AA+T TA+G GT+G TAT TAC A+TG3′ 59.8 (E6 assay) (SEQ ID NO: 267) Reverse primer 4J_Primer2 5′AAT +CGT TTT +TTT T+CT TCT3′ 60 (SEQ ID NO: 268) TaqMan® probe 4J_Probe 5′/Dye/C+C+A +G+TT +GAA AA+G 67.3 CA/Quencher/3′ (SEQ ID NO: 269) 13 5J (74 bp) Forward primer 5J_Primer1 5′CC+A TAA CAT CGG TGG AC3′ 60.1 (E6 assay) (SEQ ID NO: 270) Reverse primer 5J_Primer2 5′AC+A CCT CGG TTT CTC TA3′ 60.1 (SEQ ID NO: 271) TaqMan® probe 5J_Probe 5′/Dye/TGT +ATG +T+C+C +TG+T 67.9 T/Quencher/3′ (SEQ ID NO: 272) 14 6J (77 bp) Forward primer 6J_Primer1 5′TTT AGA TTT GGA +ACC CGA3′ 60 (E7 assay) (SEQ ID NO: 273) Reverse primer 6J_Primer2 5′TAT CTT CCT CCT +CCT CT3′ 60.2 (SEQ ID NO: 274) TaqMan® probe 6J_Probe 5′/Dye/AC+T +G+A+C +CTA TA+C 68.3 T/Quencher/3′ (SEQ ID NO: 275) 15 7J (73 bp) Forward primer 7J_Primer1 5′CTA TTG ACG GTC CAG CT3′ 60.5 (E7 assay) (SEQ ID NO: 276) Reverse primer 7J_Primer2 5′CAT TTA C+AA C+AG GAC GTT3′ 60 (SEQ ID NO: 277) TaqMan® probe 7J_Probe 5′/Dye/CCA +G+A+C +A+CC 68.7 +TCC/Quencher/3′ (SEQ ID NO: 278) 16 8J (75 bp) Forward primer 8J_Primer1 5′TGA GGC GAC ACT ACG TC3′ 62.9 (E7 Assay) (SEQ ID NO: 279) Reverse primer 8J_Primer2 5′GTG CCC ATT AAT AAA TCT TCC AA3′ 61.7 (SEQ ID NO: 280) TaqMan® probe 8J_Probe 5′/Dye/AG+AG+C+ACA+C+ACAT/Quencher/3′ 67.5 (SEQ ID NO: 281) Reverse primer 1I_Primer1 5′CTG A+AC G+AC CTT ACA AA3′ 59.9 (SEQ ID NO: 282) TaqMan® probe 1I_Primer2 5′ATA CAC AAT T+CA AA+C +AAA3′ 60.3 (SEQ ID NO: 283) .sup.1“Dye” stands for a fluorescent reporter dye. Any reporter dyes such as FAM™, HEX™, VIC®, Cy5™, and Cy5.5™ that is compatible with the detection channels for the instrument can be used. A quencher compatible with the respective dye was used at 3′ end of the probe (Quencher-1). A second quencher (Quencher-2) such as ZEN was sometimes placed internally between 9.sup.th and 10.sup.th nucleotide base from the reporter dye to enhance the overall dye quenching. .sup.2 These estimates of melting temperature(TM) were calculated using IDT′S oligo analyzer tools with following settings: (a) For primers: Target type = DNA, Oligo concentration = 0.9 pM, Nat concentration = 50 mM, Mg.sup.++ concentration = 3 mM, and dNTPs concentration = 0.8 mM. (b) for Probe: Target type = DNA, Oligo concentration = 0.25 pM, Nat concentration = 50 mM, Mg.sup.++ concentration = 3 mM, and dNTPs concentration = 0.8 mM. .sup.3+ = Locked nucleic acid
Example 12: Modified Oligonucleotide Compositions and Methods for Detection of Tumor-Derived HPV45
[0182] Provided in Table 19 below are primers and probes for detection of tumor-derived HPV45, where the “+” signifies a locked nucleic acid. Tumor derived HPV45 DNA can be detected and distinguished from non-tumor sources using any three primer/probe sets from Table 19 within a single multiplex digital PCR reaction, where the central probe has a detection color distinct from both of the other (boundary) probes. The two boundary probes may or may not have the same color. The DNA of the primer/probe sets is modified to include quenchers, dye moieties and locked nucleic acids. In this example, droplets that are positive for the central probe's detection label and negative for the boundary/distal probes detection label contain tumor derived viral DNA.
[0183] For example, modified primer probe sets 4, 7, and 10 from Table 19 could be used for the multiplexed digital PCR reaction to detect tumor-derived HPV45 DNA, where detection probe 7 is conjugated to FAM and detection probes 4 and 10 are conjugated to HEX. Alternatively, detection 7 could be conjugated to FAM, probe 4 conjugated to HEX, and probe 10 conjugated to a different detection moiety.
[0184] In some embodiments, the primer/probe sets may be selected so that no two sets are consecutive in Table 19. For illustration, examples of triads in this embodiment with no consecutive primer probe sets include {1, 3, 5}, {1, 3, 8}, {4, 6, 9}, . . . {13, 15, 17}. Examples of triads with a consecutive primer probe set include {1, 2, 5} and {10, 12, 13}.
[0185] For the purposes of this application, digital PCR refers to any method that will be understood to those versed in the art where PCR reactions are partitioned into many sub-reactions for analysis. The partition could be droplets or microwells or any other partition used for digital PCR.
[0186] It is to be understood that HEX and FAM are used solely for clarity and illustrative purposes in all the examples.
TABLE-US-00020 TABLE 19 Primers and probes for HPV45 Amplicon Tm.sup.1 (size) Set (Assay) Detail Named as Sequence 1 1K (74 bp) Forward primer 1K_Primer1 5′CGC TTT GAC GAT CCA AA3′ 60 (E6 assay) (SEQ ID NO: 284) Reverse primer 1 K_Primer2 5′TCT +TGT A+GT GAT G+TA TTC3′ 60.0 (SEQ ID NO: 285) TaqMan® probe 1 K_Probe 5′/Dye/AG+C +TA+C +C+AG +ATT/Quencher/3′ 68.4 (SEQ ID NO: 286) 2 2K (85 bp) Forward primer 2K_Primer1 5′CGT ATC TA+T TGC CTG TGT A3′ 60.4 (E6 assay) (SEQ ID NO: 287) Reverse primer 2K_Primer2 5′CAC TAT A+C+A +TAA AT+C TTT AA3′ 60 (SEQ ID NO: 288) TaqMan® probe 2K_Probe 5′/Dye/AGC AAC ATT /Quencher-2/GGA ACG 68.4 CAC AGA GGT ATA TC/Quencher-1/3′ (SEQ ID NO: 289) 3 3K (74bp) Forward primer 3K_Primer1 5′ATA GAG A+CT +GTA T+AG CA3′ 60 (E6 assay) (SEQ ID NO: 290) Reverse primer 3K_Primer2 5′ATA T+CT TAA TT+C +T+CT AAT TC3′ 60.1 (SEQ ID NO: 291) TaqMan® probe 3K_Probe 5′/Dye/TA+C +ATT TA+T +G+G+C 66.2 AT/Quencher/3′ (SEQ ID NO: 292) 4 4K (75 bp) Forward primer 4K_Primer1 5′TAT T+CA AAC +T+CT GTA +TAT3′ 60 (E6 assay) (SEQ ID NO: 293) Reverse primer 4K_Primer2 5′CAC +C+TT ATT AA+C +AAA TTA T3′ 59.9 (SEQ ID NO: 294) TaqMan® probe 4K_Probe 5′/Dye/TC+C +AGT G+T+C T+CT C/Quencher/3′ 68.1 (SEQ ID NO: 295) 5 5K (70 bp) Forward primer 5K_Primer1 5′CCA GA+A ACC +ATT GAA CC3′ 60 (E6 assay) (SEQ ID NO: 296) Reverse primer 5K_Primer2 5′AGC TAT GCT GTG AA+A TCT3′ 60.1 (SEQ ID NO: 297) TaqMan® probe 5K_Probe 5′/Dye/CG+T +AG+A +C+AC +CTT/Quencher/3′ 67.4 (SEQ ID NO: 298) 6 6K (70 bp) Forward primer 6K_Primer1 5′CGA GGG CAG TGT A+AT AC3′ 60.3 (E6 assay) (SEQ ID NO: 299) Reverse primer 6K_Primer2 5′CTT GTG T+TT CCC TAC GT3′ 60.4 (SEQ ID NO: 300) TaqMan® probe 6K_Probe_ 5′/Dye/CC+T +GG+T +CAC +A+AC 67.5 v1 A/Quencher/3′ (SEQ ID NO: 301) 6K_Probe_ 5′/Dye/TGA CCA GGC /Quencher-2/ACG 68.6 v2 GCA AGA AAG A/Quencher-1/3′ (SEQ ID NO: 302) 7 7K (73 bp) Forward primer 7K_Primer 5′AAC ACT GCA AGA AAT +TGT A3′ 60.1 (E7 assay) 1 (SEQ ID NO: 303) Reverse primer 7K_Primer2 5′CTC GTA ACA CA+A CAG GT3′ 60.2 (SEQ ID NO: 304) TaqMan® probe 7K_Probe 5′/Dye/TGG AA+C +CT+C A+G+A 68.3 A/Quencher/3′ (SEQ ID NO: 305) 8 8K (71 bp) Forward primer 8K_Primer1 5′CAA TTA AGC G+AG TCA GAG3′ 60 (E7 assay) (SEQ ID NO: 306) Reverse primer 8K_Primer2 5′GTC GGG CTG GTA GTT GT3′ 58.8 (SEQ ID NO: 307) TaqMan® probe 8K_Probe 5′/Dye/CG+A +T+G+A AGC +AG+A 68 T/Quencher/3′ (SEQ ID NO: 308) 9 9K (85 bp) Forward primer 9K_Primer1 5′AAT TTT GT+G +TGT ATG +TTG3′ 59.8 (E7 assay) (SEQ ID NO: 309) Reverse primer 9K_Primer2 5′CTG +CTG TAG T+GT TCT AA3′ 59.7 (SEQ ID NO: 310) TaqMan® probe 9K_Probe 5′/Dye/AC+G +G+CA +G+AA +TTG 68 A/Quencher/3′ (SEQ ID NO: 311) 10 1L (75 bp) Forward primer 1L_Primer1 5′CCT ACA AGO +TAC CAG ATT3′ 60.1 (E6 assay) (SEQ ID NO: 312) Reverse primer 1 L_Primer2 5′TGC AAT ATA CAC AGG C+AA3′ 59.8 (SEQ ID NO: 313) TaqMan® probe 1 L_Probe 5′/Dye/CA+C TA+C +AA+G +A+CG 67.8 T/Quencher/3′ (SEQ ID NO: 314) 11 2L (75 bp) Forward primer 2L_Primer1 5′AAC ATT GGA ACG CAC AG3′ 60.3 (E6 assay) (SEQ ID NO: 315) Reverse primer 2L_Primer2 5′TAT GCT ATA CAG TCT C+TA TAC AC3′ 60.3 (SEQ ID NO: 316) TaqMan® probe 2L_Probe 5′/Dye/AG+G +T+AT A+T+C AAT TTG 67.8 +CTT/Quencher/3′ (SEQ ID NO: 317) 12 3L (70 bp) Forward primer 3L_Primer1 5′CAT +GCC ATA +AAT GTA TAG +AC3′ 60.1 (E6 assay) (SEQ ID NO: 318) Reverse primer 3L_Primer2 5′CC+A TA+T ACA GA+G TTT GAA T3′ 59.7 (SEQ ID NO: 319) TaqMan® probe 3L_Probe 5′/Dye/T+C+C +A+GA ATT A+G+A GA 68.3 (SEQ ID NO: 320) 13 4L (84 bp) Forward primer 4L_Primer1 5′AAT AAC T+AA TA+C AG+A GTT GT3′ 60.1 (E6 assay) (SEQ ID NO: 321) Reverse primer 4L_Primer2 5′TGT CTA CGT TTT T+CT GC3′ 59.9 (SEQ ID NO: 322) TaqMan® probe 4L_Probe_v 5′/Dye/AA+C +C+AT T+G+A +ACC 67.9 1 C/Quencher/3′ (SEQ ID NO: 323) 4L_Probe_v 5′/Dye/TTG TTA ATA /Quencher-2/AGG 67.7 2 TGC CTG CGG TGC/Quencher-1/3′ (SEQ ID NO: 324) 14 5L (91 bp) Forward primer 5L_Primer1 5′TTA AGG A+CA AAC +GAA GAT3′ 60 (E6 assay) (SEQ ID NO: 325) Reverse primer 5L_Primer2 5′AAG TCT TTC TTG CCG TG3′ 59.6 (SEQ ID NO: 326) TaqMan® probe 5L_Probe_v 5′/Dye/TGG ACA GTA /Quencher-2/CCG 68.4 1 AGG GCA GTG TAA TA/Quencher-1/3′ (SEQ ID NO: 327) 5L_Probe_v 5′/Dye/TAG CTG GAC /Quencher-2/AGT 68.7 2 ACC GAG GGC A/Quencher-1/3′ (SEQ ID NO: 328) 15 6L (75 bp) Forward primer 6L_Primer 1 5′TCA GA+A TGA ATT +AGA TOO TG3′ 60.1 (E7 assay) (SEQ ID NO: 329) Reverse primer 6L_Primer2 5′TGC TTC ATC GTT TTC CTC3′ 59.8 (SEQ ID NO: 330) TaqMan® probe 6L_Probe 5′/Dye/TGA +C+C+T +GTT GT+G T/Quencher/3′ 67.9 (SEQ ID NO: 331) 16 7L (75 bp) Forward primer 7L_Primer1 5′TAG TCA TGC ACA ACT +ACC3′ 59.7 (E7 assay) (SEQ ID NO: 332) Reverse primer 7L_Primer2 5′TCA CAC TTA CAA CAT A+CA C3′ 59.8 (SEQ ID NO: 333) TaqMan® probe 7L_Probe 5′/Dye/CCG A+CG +A+GC CGA/Quencher/3′ 67.5 (SEQ ID NO: 334) 17 8L (90 bp) Forward primer 8L_Primer1 5′CGG CAG AAT TGA GCT TAG A3′ 62.4 (E7 assay) _v1 (SEQ ID NO: 335) 8L_Primer1 5′CGG CAG AAT TGA GCT TAC3′ 60.4 _v2 (SEQ ID NO: 336) Reverse primer 8L_Primer2 5′GGA CAC ACA AAG GAC AAG G3′ 62.7 _v1 (SEQ ID NO: 337) 8L_Primer2 5′GGA CAC ACA AAG GAC AAG3′ 60.2 _v2 (SEQ ID NO: 338) TaqMan® probe 8L_Probe_v 5′/Dye/TCG GCA GA+G G+A+C 65.7 1 C/Quencher/3′ (SEQ ID NO: 339) 8L_Probe_v 5′/Dye/TCG GC+A GA+G G+A+C 68.3 2 C/Quencher/3′ (SEQ ID NO: 340) .sup.1“Dye” stands for a fluorescent reporter dye. Any reporter dyes such as FAM™, HEX™, VIC®, Cy5™, and Cy5.5™ that is compatible with the detection channels for the instrument can be used. A quencher compatible with the respective dye was used at 3′ end of the probe (Quencher-1). A second quencher (Quencher-2) such as ZEN was sometimes placed internally between 9.sup.th and 10.sup.th nucleotide base from the reporter dye to enhance the overall dye quenching. .sup.2 These estimates of melting temperature(TM) were calculated using IDT′S oligo analyzer tools with following settings: (a) For primers: Target type = DNA, Oligo concentration = 0.9 pM, Nat concentration = 50 mM, Mg.sup.++ concentration = 3 mM, and dNTPs concentration = 0.8 mM. (b) for Probe: Target type = DNA, Oligo concentration = 0.25 pM, Nat concentration = 50 mM, Mg.sup.++ concentration = 3 mM, and dNTPs concentration = 0.8 mM. .sup.3+ = Locked nucleic acid
Example 13: Modified Oligonucleotide Compositions and Methods for Detection of Tumor-Derived EBV
[0187] Provided in Table 20 below are primers and probes for detection of tumor-derived EBV, where the “+” signifies a locked nucleic acid. Tumor derived EBV DNA can be detected and distinguished from non-tumor sources using any three consecutive primer/probe sets from Table 20 within a single multiplex digital PCR reaction, where the central probe has a detection color distinct from both of the other (boundary) probes. The two boundary probes may or may not have the same color. In this example, droplets that are positive for the central probe's detection label and negative for the boundary/distal probes detection label contain tumor derived viral DNA.
[0188] For example, modified primer probe sets 4, 5, and 6 from Table 20 could be used for the multiplexed digital PCR reaction to detect tumor-derived EBV DNA, where detection probe 5 is conjugated to FAM and detection probes 4 and 6 are conjugated to HEX. Alternatively, detection 5 could be conjugated to FAM, probe 4 conjugated to HEX, and probe 6 conjugated to a different detection moiety.
[0189] For illustration, examples of three consecutive primer probe sets include {1, 2, 3}, {2, 3, 4}, {3, 4, 5}, . . . {15, 16, 17}.
[0190] For the purposes of this application, digital PCR refers to any method that will be understood to those versed in the art where PCR reactions are partitioned into many sub-reactions for analysis. The partition could be droplets or microwells or any other partition used for digital PCR.
[0191] It is to be understood that HEX and FAM are used solely for clarity and illustrative purposes in all the examples.
TABLE-US-00021 TABLE 20 Primers and probes for Epstein-Barr virus (EBV) Amplicon (size) Set (Assay) Detail Named as Sequence T.sub.M.sup.1 1 1M (70 bp) Forward primer 1M_Primer1 5′GGG AGA COG AAG TGA A3′ 59.9 (SEQ ID NO: 341) Reverse primer 1M_Primer2 5′TCC ACT TAC CTC TGG C3′ 59.7 (SEQ ID NO: 342) TaqMan® probe 1M_Probe 5′/Dye/CT+G GA+C C+A+A +CCC G/Quencher/3′ 68 (SEQ ID NO: 343) 2 2M (80 bp) Forward primer 2M_Primer1 5′CTC GGA CAG CTC CTA AG3′ 60.3 (SEQ ID NO: 344) Reverse primer 2M_Primer2 5′ACC CTT CT+A CGG ACT C3′ 60.2 (SEQ ID NO: 345) TaqMan® probe 2M_Probe 5′/Dye/CG+C CCA GT+C +CT+A C/Quencher/3′ 68.5 (SEQ ID NO: 346) 3 3M (87 bp) Forward primer 3M_Primer1 5′TCT CTT AGA GAG +TGG CT3′ 60.8 (SEQ ID NO: 347) Reverse primer 3M_Primer2 5′TTC TTC +TAT G+TA GAC +AGA3′ 60.4 (SEQ ID NO: 348) TaqMan® probe 3M_Probe 5′/Dye/CG+C +ATT A+G+A +G+AC 68.5 C/Quencher/3′ (SEQ ID NO: 349) 4 4M (78 bp) Forward primer 4M_Primer1 5′TGC CTA C+AT +TCT +ATC TTG3′ 59.9 (SEQ ID NO: 350) Reverse primer 4M_Primer2 5′ACG GGT TTC CAA GAC TA3′ 59.8 (SEQ ID NO: 351) TaqMan® probe 4M_Probe 5′/Dye/TA+T +G+TT TG+T +CC+C 69.1 C/Quencher/3′ (SEQ ID NO: 352) 5 5M (75 bp) Forward primer 5M_Primer1 5′CAC TCT CAG TA+A TTC CCT C3′ 60.2 (SEQ ID NO: 353) Reverse primer 5M_Primer2 5′CAA AGA +TT+G TTA GTG G+AA T3′ 60 (SEQ ID NO: 354) TaqMan® probe 5M_Probe 5′/Dye/TCC +CTA +CC+A +GG+A A/Quencher/3′ 68.6 (SEQ ID NO: 355) 6 6M (76 bp) Forward primer 6M_Primer1 5′CCG CTA GGA TAT GAC GT3′ 59.9 (SEQ ID NO: 356) Reverse primer 6M_Primer2 5′TTA CAA TAT +AAT TA+G +C+CA3′ 59.9 (SEQ ID NO: 357) TaqMan® probe 5M_Probe 5′/Dye/ACC TCT AGC /Quencher-2/ATC TGC 68.2 TAT GCG AAT GC/Quencher-1/3′ (SEQ ID NO: 358) 7 17M (81 Forward primer 7M_Primer1 5′GCT TAC CCC TCC ACA A3′ 60.4 (SEQ ID NO: 359) bp) Reverse primer 7M_Primer2 5′GGC ACC GTT AGT GTT G3′ 59.7 (SEQ ID NO: 360) TaqMan® probe 7M_Probe 5′/Dye/TAC CCC TCC /Quencher-2/TAC CCC 68.5 TCT GCC/Quencher-1/3′ (SEQ ID NO: 361) 8 8M (91 bp) Forward primer 8M_Primer1 5′TAC CGA ACT TCA ACC CA3′ 60.1 (SEQ ID NO: 362) Reverse primer 8M_Primer2 5′TTG +ATG AGT AAG AGG GTG3′ 59.9 (SEQ ID NO: 363) TaqMan® probe 8M_Probe_ 5′/Dye/CC+A TCA C+CA +C+C+A 68.9 v1 C/Quencher/3′ (SEQ ID NO: 364) 8M_Probe_ 5′/Dye/TG+C +C+AG A+CC AAT 68.4 v2 C/Quencher/3′ (SEQ ID NO: 365) 9 9M (75 bp) Forward primer 9M_Primer1 5′AGC ACC CCA +AAT GAT C3′ 60.2 (SEQ ID NO: 366) Reverse primer 9M_Primer2 5′TAA TGG +CAT AGG TGG AA3′ 59.8 (SEQ ID NO: 367) TaqMan® probe 9M_Probe 5′/Dye/TCC AGA ACC /Quencher-2/ACG GTC 68.1 CCC G/Quencher-1/3′ (SEQ ID NO: 368) 10 10M (87 bp) Forward primer 10M_Primer 5′ATC AAC GAC CAA CAA +TTA C3′ 60 1 (SEQ ID NO: 369) Reverse primer 10M_Primer 5′TTG AGT CTT AGA GGG T+TG3′ 60.1 2 (SEQ ID NO: 370) TaqMan® probe 10M_Probe 5′/Dye/CC+C +GAG +GG+T AG+A T/Quencher/3′ 68.8 (SEQ ID NO: 371) 11 11M (76 bp) Forward primer 11M_Primer 5′TTG GAG ACC AGA GCC3′ 59.6 1 (SEQ ID NO: 372) Reverse primer 11M_Primer 5′TTG TCC CTG ATG AAG +AC3′ 60.1 2 (SEQ ID NO: 373) TaqMan® probe 11M_Probe 5′/Dye/GC+C +T+GA A+C+T AA+G 67.8 T/Quencher/3′ (SEQ ID NO: 374) 12 12M (86 bp) Forward primer 12M_Primer 5′ACT CAC CAA CTC CTG G3′ 60 1 (SEQ ID NO: 375) Reverse primer 12M_Primer 5′TTC ATG TAT TG+G TGA AAC G3′ 60.1 2 (SEQ ID NO: 376) TaqMan® probe 12M_Probe 5′/Dye/CAA TGC CGC /Quencher-2/CCC CGT 68 TTG TAG/Quencher-1/3′ (SEQ ID NO: 377) 13 13M (78 bp) Forward primer 13M_Primer 5′CGG AGT CCC ATA +ATA GC3′ 59.9 1 (SEQ ID NO: 378) Reverse primer 13M_Primer 5′GTC TGC GGG GTC TAT AG3′ 60.1 2 (SEQ ID NO: 379) TaqMan® probe 13M_Probe 5′/Dye/CA+G +AG+G +C+TC CCA T/Quencher/3′ 68.7 (SEQ ID NO: 380) 14 14M (84 Forward primer 14M_Primer 5′AAA GTT GG+G ATT A+CA TTT3′ 59.9 bp) 1 (SEQ ID NO: 381) Reverse primer 14M_Primer 5′GGC GAG GTC TTT T+AC TG3′ 60.4 2 (SEQ ID NO: 382) TaqMan® probe 14M_Probe 5′/Dye/TGA GAC AAC /Quencher-2/AGA ATC 68 TCC TAG CTC AGA TGA/Quencher-1/3′ (SEQ ID NO: 383) 15 15M (86 Forward primer 15M_Primer 5′TAGGCCCACTTAACACTAC3′ 60.6 bp) 1 (SEQ ID NO: 384) Reverse primer 15M_Primer 5′GGAGGCCCTTAGACTTAC3′ 60.5 2 (SEQ ID NO: 385) TaqMan® probe 15M_Probe 5′/Dye/CGCCTCTCCATTCATCATGTAACCCAC/ 68.4 Quencher/3′ (SEQ ID NO: 386) 16 16M (85 Forward primer 16M_Primer 5′ATCCCTAGGATAATACCACAC3′ 60.5 bp) 1 (SEQ ID NO: 387) Reverse primer 16M_Primer 5′CACGTAAAGCCACAAGC3′ 60.8 2 (SEQ ID NO: 388) TaqMan® probe 16M_Probe 5′/Dye/AGCAGTGTAGTCCTGTCAATCTCCTGA/ 68.3 Quencher/3′ (SEQ ID NO: 389) 17 1N (93 bp) Forward primer 1 N_Primer1 5′CTC CTA AGA AGG +CAC C3′ 60.4 (SEQ ID NO: 390) Reverse primer 1 N_Primer2 5′CTC CTC TTC TTG CTG GA3′ 60.1 (SEQ ID NO: 391) TaqMan® probe 1 N_Probe 5′/Dye/CA+A +G+AA C+C+C AG+A 68.9 C/Quencher/3′ (SEQ ID NO: 392) 18 2N (81 bp) Forward primer 2N_Primer1 5′ATT +AGA GAC C+AC TTT +GAG3′ 60.1 (SEQ ID NO: 393) Reverse primer 2N_Primer2 5′TTA GTC +TTC ATC CTC T+TC T3′ 60.3 (SEQ ID NO: 394) TaqMan® probe 2N_Probe 5′/Dye/CG+C C+AA T+C+T +G+TC 68.7 T/Quencher/3′ (SEQ ID NO: 395) 19 3N (83 bp) Forward primer 3N_Primer1 5′TCT AAT TGT TGA CAC +GGA T3′ 60.3 (SEQ ID NO: 396) Reverse primer 3N_Primer2 5′TGT CT+G ACA GTT GTT CC3′ 60.4 (SEQ ID NO: 397) TaqMan® probe 3N_Probe 5′/Dye/CTT GGA AAC /Quencher-2/CCG TCA 68.1 CTC TCA GTA ATT CC/Quencher-1/3′ (SEQ ID NO: 398) 20 4N (84 bp) Forward primer 4N_Primer1 5′TCA CCT CTT GAT AGG GAT C3′ 59.8 (SEQ ID NO: 399) Reverse primer 4N_Primer2 5′ATT AGC CAT CCA AAG C+AT3′ 60.3 (SEQ ID NO: 400) TaqMan® probe 4N_Probe 5′/Dye/CGG GCA TGG /Quencher-2/ACC TCT 67.7 AGC ATC T/Quencher-1/3′ (SEQ ID NO: 401) 21 5N (89 bp) Forward primer 5N_Primer1 5′ATA TTG +TAA GA+C A+A+T CAC3′ 60.3 (SEQ ID NO: 402) Reverse primer 5N_Primer2 5′ATG TGG CTG GAC CAA3′ 60.1 (SEQ ID NO: 403) TaqMan® probe 5N_Probe 5′/Dye/CC+T G+AG +GGG C+TG T/Quencher/3′ 68.4 (SEQ ID NO: 404) 22 6N (84 bp) Forward primer 6N_Primer1 5′CTC TAC GCC CGA CAG3′ 60.2 (SEQ ID NO: 405) Reverse primer 6N_Primer2 5′TTG GTG GCA TC+A TGA G3′ 59.7 (SEQ ID NO: 406) TaqMan® probe 6N_Probe 5′/Dye/TGT CAC CTC /Quencher-2/TGT CAC 67.7 AAC CGA GG/Quencher-1/3′ (SEQ ID NO: 407) 23 7N (98 bp) Forward primer 7N_Primer1 5′ACC CAC ACC ACT ACT C3′ 59.6 (SEQ ID NO: 408) Reverse primer 7N_Primer2 5′TCT GGC ACA TGC AAG +A3′ 60.4 (SEQ ID NO: 409) TaqMan® probe 7N_Probe 5′/Dye/TAC CGA ACT /Quencher-2/TCA ACC 68.2 CAC ACC ATC AC/Quencher-1/3′ (SEQ ID NO: 410) 24 8N (86 bp) Forward primer 8N_Primer1 5′AAT CAA TGC ACC CTC +TTA3′ 59.9 (SEQ ID NO: 411) Reverse primer 8N_Primer2 5′AAT G+TT ATA AAA TAC AG+T +CG3′ 60.2 (SEQ ID NO: 412) TaqMan® probe 8N_Probe 5′/Dye/TGA TCC AGA /Quencher-2/TAG TCC 68.4 AGA ACC ACG GT/Quencher-1/3′ (SEQ ID NO: 413) 25 9N (85 bp) Forward primer 9N_Primer1 5′ATT ACC CCC CTC ACA AT3′ 59.8 (SEQ ID NO: 414) Reverse primer 9N_Primer2 5′TAG ATG AT+G TAA TTG TT+G GT3′ 59.9 (SEQ ID NO: 415) TaqMan® probe 9N_Probe 5′/Dye/CAC CAC CAG /Quencher-2/CAG CAC 68.1 CAG C/Quencher-1/3′ (SEQ ID NO: 416) 26 10N (82 Forward primer 10N_Primer 5′ACA AGC AAC GCA AGC3′ 60.5 bp) 1 (SEQ ID NO: 417) Reverse primer 10N_Primer 5′AGG ACT GGA C+TT AGT TCA3′ 60.7 2 (SEQ ID NO: 418) TaqMan® probe 10N_Probe 5′/Dye/ACC TTG GAG /Quencher-2/ACC AGA 68 GCC AAA CA/Quencher-1/3′ (SEQ ID NO: 419) 27 11N (75 Forward primer 11N_Primer 5′CGT +TTG TAG AAA T+TC ACA C3′ 60.2 bp) 1 (SEQ ID NO: 420) Reverse primer 11N_Primer 5′TCT GGG CTA TT+A TGG GA3′ 60.1 2 (SEQ ID NO: 421) TaqMan® probe 11 N_Probe 5′/Dye/TCA +C+C+A ATA +C+AT 68 +GA/Quencher/3′ (SEQ ID NO: 422) 28 12N (77 Forward primer 12N_Primer 5′CCA TTC TCT TCC CCG AT3′ 60.3 bp) 1 (SEQ ID NO: 423) Reverse primer 12N_Primer 5′AAA TGT AA+T CCC AA+C TTT3′ 60.3 2 (SEQ ID NO: 424) TaqMan® probe 12N_Probe 5′/Dye/CC+G +C+A+G ACT +TA+G 67.7 A/Quencher/3′ (SEQ ID NO: 425) .sup.1“Dye” stands for a fluorescent reporter dye. Any reporter dyes such as FAM™, HEX™, VIC®, Cy5™, and Cy5.5™ that is compatible with the detection channels for the instrument can be used. A quencher compatible with the respective dye was used at 3′ end of the probe (Quencher-1). A second quencher (Quencher-2) such as ZEN was sometimes placed internally between 9.sup.th and 10.sup.th nucleotide base from the reporter dye to enhance the overall dye quenching. 2 These estimates of melting temperature(TM) were calculated using IDT′S oligo analyzer tools with following settings: (a) For primers: Target type = DNA, Oligo concentration = 0.9 pM, Nat concentration = 50 mM, Mg.sup.++ concentration = 3 mM, and dNTPs concentration = 0.8 mM. (b) for Probe: Target type = DNA, Oligo concentration = 0.25 pM, Nat concentration = 50 mM, Mg.sup.++ concentration = 3 mM, and dNTPs concentration = 0.8 mM. .sup.3+ = Locked nucleic acid
Other Embodiments
[0192] It is to be understood that while the invention has been described in conjunction with the detailed description thereof, the foregoing description is intended to illustrate and not limit the scope of the invention, which is defined by the scope of the appended claims. Other aspects, advantages, and modifications are within the scope of the following claims.