MICROORGANISM SIMULTANEOUSLY PRODUCING 1,3-PROPANEDIOL AND 3-HYDROXYPROPIONIC ACID, AND USE THEREOF

20260043033 ยท 2026-02-12

Assignee

Inventors

Cpc classification

International classification

Abstract

The present specification relates to a microorganism into which a GPD gene, a GPP gene, and dhaB, gdrAB, aldH and/or yqhD genes are introduced, and/or use thereof, the microorganism being capable of simultaneously producing 1,3-PDO and 3-HP.

Claims

1. A microorganism, comprising dhaB, gdrAB, aldH and yqhD.

2. The microorganism according to claim 1, further comprising at least one gene selected from the group consisting of a gene encoding glycerol-3-phosphate dehydrogenase (GPD) (GPD gene) and a gene encoding glycerol-3-phosphate phosphatase (GPP) (GPP gene).

3. (canceled)

4. The microorganism according to claim 2, comprising both the GPD gene and GPP gene.

5. The microorganism according to claim 1, wherein the microorganism further comprises a characteristic of weakened or inactivated activity of at least one gene selected from the group consisting of yqhD, glpK, IdhA, ack-pta, gldA and ptsG.

6. The microorganism according to claim 2, wherein the microorganism further comprises at least one characteristic selected from the group consisting of the following (a) and (b): (a) weakened or inactivated activity of at least one gene selected from the group consisting of yqhD, glpK, ldhA, ack-pta, gldA and ptsG; and (b) enhanced activity of at least one gene selected from the group consisting of galP and glk.

7. The microorganism according to claim 1, simultaneously producing 1,3-propanediol (1,3-PDO) and 3-hydroxypropionic acid (3-HP).

8. The microorganism according to claim 1, wherein the microorganism is an Escherichia sp. microorganism, a Klebsiella sp. microorganism, or a Lactobacillus sp. microorganism.

9. The microorganism according to claim 1, capable of producing 1,3-propanediol (1,3-PDO) and 3-hydroxypropionic acid (3-HP) from glycerol.

10. The microorganism according to claim 2, capable of producing 1,3-propanediol (1,3-PDO) and 3-hydroxypropionic acid (3-HP) from glucose.

11. The microorganism according to claim 1, having 1,3-PDO productivity of at least 0.5 g/L/hr, or 3-HP productivity of at least 0.5 g/L/hr.

12. A recombinant vector, comprising dhaB, gdrAB, aldH and yqhD.

13. The recombinant vector according to claim 12, further comprising at least one gene selected from the group consisting of GPD gene and GPP gene.

14. A composition for producing 1,3-PDO and 3-HP, comprising the microorganism according to claim 1.

15. A method for producing 1,3-PDO and 3-HP, comprising culturing the microorganism according to claim 1.

16. The method for producing 1,3-PDO and 3-HP according to claim 15, wherein the 1,3-PDO productivity of the method for producing 1,3-PDO and 3-HP is at least 0.5 g/L/hr, or the 3-HP productivity of the method for producing 1,3-PDO and 3-HP is at least 0.5 g/L/hr.

17. A fermented composition, which is obtained by fermenting a microorganism having producing activity of 1,3-PDO and 3-HP, and comprises 1,3-PDO at a concentration of at least 10 g/L, and 3-HP at a concentration of at least 10 g/L.

18. The fermented composition according to claim 17, which is prepared by the microorganism comprising dhaB, gdrAB, aldH and yqhD.

19. The fermented composition according to claim 17, which is prepared by the method for producing 1,3-PDO and 3-HP, comprising culturing a microorganism comprising dhaB, gdrAB, aldH and yghD.

20. A composition for producing 1,3-PDO and 3-HP, comprising the recombinant vector according to claim 12.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0095] FIG. 1 is a graph showing the result of confirming production of 1,3-PDO and 3-HP after culturing a microorganism to which dhaB, gdrAB, aldH and/or yqhD genes are introduced.

[0096] FIG. 2 is a graph showing the result of confirming production of 1,3-PDO and 3-HP after culturing a microorganism to which GPD gene, GPP gene, dhaB, gdrAB, aldH and/or yqhD genes are introduced.

MODE FOR INVENTION

[0097] Hereinafter, the present invention will be described in detail by examples. However, the following examples illustrate the present invention only, but the present invention is not limited by the following examples.

Example 1. Plasmid Design for Strain Recombination

Example 1-1. Construction of pCDF-dhaB1,2,3-gdrA,B-aldH-yghD Vectors

[0098] A vector comprising yqhD was constructed to overexpress an yqhD gene. Specifically, the yqhD gene (SEQ ID NO: 1) was prepared by amplifying through PCR using a primer pair consisting of the nucleic acid sequences of SEQ ID NO: 2 and SEQ ID NO: 3, from the genome of an E. coli W3110 strain (yqhD, glpK, ldhA, ack-pta, gldA, and ptsG deletion; galP and glk overexpression; named DKALGP::PK strain; KCCM 40219) (pre-denaturation at 95 C. for 2 minutes, denaturation at 95 C. for 1 minute, annealing at 55 C. for 30 seconds, and elongation at 72 C. for 30 seconds, repeated 30 times, final elongation at 72 C. for 2 minutes, and then maintaining and storing at 4 C., and the final product size: 1.1 kb), and information of the yqhD gene and primers was shown in Tables 1 and 2 below.

TABLE-US-00001 TABLE1 SEQ Gene ID name Sequence(5>3) NO yqhD_ atgaacaactttaatctgcacaccccaacccgcattctgtttggtaaaggcgcaatcgctggttta 1 gene cgcgaacaaattcctcacgatgctcgcgtattgattacctacggcggcggcagcgtgaaaaaaacc ggcgttctcgatcaagttctggatgccctgaaaggcatggacgtgctggaatttggcggtattgag ccaaacccggcttatgaaacgctgatgaacgccgtgaaactggttcgcgaacagaaagtgactttc ctgctggcggttggcggcggttctgtactggacggcaccaaatttatcgccgcagcggctaactat ccggaaaatatcgatccgtggcacattctgcaaacgggcggtaaagagattaaaagcgccatcccg atgggctgtgtgctgacgctgccagcaaccggttcagaatccaacgcaggcgcggtgatctcccgt aaaaccacaggcgacaagcaggcgttccattctgcccatgttcagccggtatttgccgtgctcgat ccggtttatacctacaccctgccgccgcgtcaggtggctaacggcgtagtggacgcctttgtacac accgtggaacagtatgttaccaaaccggttgatgccaaaattcaggaccgtttcgcagaaggcatt ttgctgacgctaatcgaagatggtccgaaagccctgaaagagccagaaaactacgatgtgcgcgcc aacgtcatgtgggcggcgactcaggcgctgaacggtttgattggcgctggcgtaccgcaggactgg gcaacgcatatgctgggccacgaactgactgcgatgcacggtctggatcacgcgcaaacactggct atcgtcctgcctgcactgtggaatgaaaaacgcgataccaagcgcgctaagctgctgcaatatgct gaacgcgtctggaacatcactgaaggttccgatgatgagcgtattgacgcegcgattgccgcaacc cgcaatttctttgagcaattaggcgtgccgacccacctctccgactacggtctggacggcagctcc atcccggctttgctgaaaaaactggaagagcacggcatgacccaactgggcgaaaatcatgacatt acgttggatgtcagccgccgtatatacgaagccgcccgctaa

TABLE-US-00002 TABLE2 Primertype Sequence(5>3) SEQIDNO yqhD_Primer_For tactagcgcagcttaatgaac 2 aactttaatctgcacaccc yqhD_Primer_Rev cagcagcctaggttaattagc 3 gggcggcttcgtatatacgg

[0099] The prepared yqhD gene was cloned to the pCDF-dhaB1,2,3-gdrA,B-aldH plasmid which is for producing 3HP.

[0100] Specifically, the pCDF-dhaB1,2,3-gdrA,B-aldH plasmid was a vector in which the promoter portion of pCDFDuet-1 vector (Novagen 71340) was substituted with J23101 and J23100 promoters, and dhaB (dhaB1, dhaB2, dhaB3) and gdrAB genes (gdrA, gdrB) of Klebsiella pneumoniae (K. pneumoniae genomic DNA; KCTC12385) and aldH gene derived from E. coli K12 MG1655 were cloned. The dhaB (about 2.7 kb; dhaB1, dhaB2, dhaB3) and gdrAB gene (about 2.2 kb; gdrA, gdrB) were amplified using the conditions provided from NEB using the primers of Table 3 below and NEB (New England Biolabs) Q5 DNA polymerase in chromosome of Klebsiella pneumonia. In addition, information of the promoters was shown in Table 4 below.

TABLE-US-00003 TABLE3 SEQ Primertype Sequence(5>3) IDNO dhaB-gdrA_Primer_For GAATTCATGAAAAGATCAAA 4 ACGATTTGCAGTCCT dhaB-gdrA_Primer_Rev AAGCTTGATCTCCCACTGAC 5 CAAAGCTGG gdrB_Primer_For AAGCTTAGAGGGGGCCGTCA 6 TGTCGCTTTCACCGCCAG gdrB_Primer_Rev CTTAAGTCAGTTTCTCTCAC 7 TTAACGGC

TABLE-US-00004 TABLE4 SEQ Promotertype Sequence(5>3) IDNO J23101_Promo tttacagctagctcagtcc 8 taggtattatgctagc J23100_Promo ttgacggctagctcagtcc 9 taggtacagtgctagc

[0101] On the chromosome of Klebsiella pneumonia, dhaB123 and gdrA genes were positioned side by side, so they were amplified together, and gdrB was positioned in the opposite direction to dhaB123 and gdrA, so only gdrB was separately amplified, and then, NEB Q5 DNA polymerase was used, and as the condition, the condition provided by NEB was used. After that, the dhaB123, gdrA genes were cloned using restriction enzymes EcoRI and HindIII, and the gdrB gene was cloned using restriction enzymes HindIII and AfIII, under the J23101 promoter, and the pCDF-dhaB1,2,3-gdrA,B plasmid (hereinafter, pCDF-dhaB-gdrAB vector) was prepared.

[0102] aldH was amplified from E. coli K12 MG1655 chromosome using the J23100 promoter, and then the primers of Table 5 below and NEB Q5 DNA polymerase were used, and the condition provided by NEB was used.

TABLE-US-00005 TABLE5 SEQ Primertype Sequence(5>3) IDNO aldH_Primer_For ggtaccatgaattttcatcatctggc 10 aldH_Primer_Rev catatgtcaggcctccaggcttat 11

[0103] aldH was cloned under the J23100 promoter of the pCDF-dhaB-gdrAB vector using restriction enzymes KpniI and NdeI through T4 DNA ligase reaction, and the pCDF-dhaB1,2,3-gdrA,B-aldH plasmid (hereinafter, pCDF-dhaB-gdrAB-aldH vector) was prepared.

[0104] To the pCDF-dhaB1,2,3-gdrA,B-aldH plasmid prepared as above, the prepared yqhD gene was cloned using PacI restriction enzyme through In-Fusion reaction, and finally, the recombinant vector pCDF-dhaB1,2,3-gdrA,B-aldH-yqhD was prepared (hereinafter, pCDF-dhaB-gdrAB-aldH-yqhD vector). Additionally, the pCDF-dhaB-gdrAB-yqhD vector in which yqhD instead of aldH was cloned to the pCDF-dhaB-gdrAB vector by the same method was prepared.

Example 1-2. Construction of pRSF-pLTTR-GPD-GPP Vector

[0105] For Saccharomyces cerevisiae (BY4741; ATCC 201388)-derived GPD1 and GPP2 genes, PCR (pre-denaturation at 95 C. for 2 minutes; denaturation at 95 C. for 1 minute, annealing at 55 C. for 30 seconds, and elongation at 72 C. for 2 minutes, repeated 28 times; final elongation at 72 C. for 5 minutes; maintaining and storing at 4 C.) was performed using the primer pair of SEQ ID Nos: 12 and 13 or SEQ ID Nos: 14 and 15 of Table 6 below, respectively, and each of them was cloned to the pRSFDuet-1 vector comprising LTTR promoter (Invitrogen), by treatment of BamHI/SacI (using the primer pair of SEQ ID Nos: 12 and 13) and KpnI/XhoI (using the primer pair of SEQ ID Nos: 14 and 15), and a vector comprising pRSF-pLTTR-GPD-GPP (hereinafter, pRSF-pLTTR-GPD-GPP vector) was constructed. The sequence of the used LTTR promoter was described in Table 7 below.

TABLE-US-00006 TABLE6 SEQ Primertype Sequence(5>3) IDNO GPD1_Primer_For catcatcatggatccatagcagtaa 12 gaaaggagcatccatcatgagcgct gcggctg GPD1_Primer_Rev catcatcatgagctctcaatcttca 13 tgaaggtctaattcttcaatcatg GPP2_Primer_For catcatcatggtaccacagttttag 14 taaaggagcatcaaaaatgggactc actacgaaaccg GPP2_Primer_Rev catcatcatctcgagttaccatttc 15 agcagatcgtctttgg

TABLE-US-00007 TABLE7 SEQ Promotertype Sequence(5>3) IDNO LTTR_Promo catcatcatggatccatagcagtaag 16 aaaggagcatccatcatgagcgctgc ggctg

Example 2. Preparation and Culture of Transformed Strain

Example 2-1. Preparation of Strain

[0106] In order to prepare a transformed strain with the vector prepared in Example 1, Escherichia coli W3110 (yqhD, glpK, ldhA, ack-pta, gldA, and ptsG deletion; galP and glk overexpression; named DKALGP::PK strain) strain was prepared. The strain was streak plated on an LB plate (comprising 10 g tryptone, 5 g yeast extract, 10 g NaCl, 15 g agar per 1 L), and cultured at 37 C. overnight. The cultured single colony was inoculated to a 5 mL LB liquid medium (the medium composition was same as the LB plate, but did not comprise agar), and cultured with stirring at 37 C. overnight. The next morning, the culture solution was diluted to 1:100 in 5 mL NL liquid medium and cultured for 3-6 hours until the OD reached 0.5. By cooling on ice for 10-15 minutes and then centrifuging at 4 C. at 4000 rpm for 10 minutes, cells were collected. The cells were resuspended in 1 mL of sterile DI water (Deionized water) cooled with ice and washed, and then centrifuged at 4 C. at 4000 rpm for 10 minutes again to collect the cells. The collected cells were resuspended in 1 mL of DI water and washed again, and centrifuged at 4 C. at 4000 rpm for 10 minutes again to collect the cells. The collected cells were resuspended in 0.08 mL of DI water, and cell aliquots were added to an individual pre-chilled microfuge tube.

Example 2-2. dhaB, gdrAB, aldH and/or yqhD Gene Transformation

[0107] For the collected cells in Example 2-1, the pCDFDuet-1 (pCDF) of Example 1, and the plasmid DNA constructed in Example 1, each of the pCDF-dhaB-gdrAB vector, pCDF-dhaB-gdrAB-yqhD vector and pCDF-dhaB-gdrAB-aldH-yqhD vector were added by pipetting them by 1 L and then 0.08 to 0.09 ml of the mixture was transferred to a pre-treated 0.1 cm electroporation cuvette (pre-chilled electroporation cuvette).

[0108] Electroporation was performed at 1.8 kV, and immediately after the pulse, 1 mL of the LB liquid medium of the room temperature was added to the cells and they were cultured at 37 C. for 1 hour. The culture solution was plated on an LB plate comprising streptomycin and an excessive amount of liquid was made to be dried and absorbed into the plate. The plate was reversed and cultured at 37 C. to prepare a single colony.

Example 2-3. GPD and GPP Gene Additional Transformation

[0109] In addition, for the collected cells in Example 2-1, together with 1 L of the plasmid DNA pRSF-pLTTR-GPD-GPP vector prepared in Example 1 (hereinafter, pRSF-GG vector), the pCDFDuet-1 (pCDF) of Example 1, and the plasmid DNA constructed in Example 1, each of the pCDF-dhaB-gdrAB vector, pCDF-dhaB-gdrAB-aldH vector, pCDF-dhaB-gdrAB-yqhD vector and pCDF-dhaB-gdrAB-aldH-yqhD vector (1 L) were added by pipetting them, and then 0.08 to 0.09 ml of the mixture was transferred to a pre-treated 0.1 cm electroporation cuvette (pre-chilled electroporation cuvette). Electroporation was performed at 1.8 kV, and immediately after the pulse, 1 mL of the LB liquid medium of the room temperature was added to the cells and they were cultured at 37 C. for 1 hour. The culture solution was plated on an LB plate comprising streptomycin and an excessive amount of liquid was made to be dried and absorbed into the plate. The plate was reversed and cultured at 37 C. to prepare a single colony.

Example 3. Confirmation of Produced Amounts of 1,3-Propanediol (1,3-PDO) and 3-Hydroxypropionic Acid (3-HP) of Strain in which dhaB, gdrAB, aldH and/or yqhD Genes are Transformed

Example 3-1. Confirmation of Produced Amounts of 1,3-Propanediol (1,3-PDO) and 3-Hydroxypropionic Acid of Transformed Strain Through Flask Culture

[0110] A modified M9 medium of 100 mL comprising 20 g/L glycerol, 5 g/L glucose and 25 mg/L streptomycin/kanamycin (containing MgSO.sub.4.Math.7H.sub.2O 0.6 g/L, NaCl 1.5 g/L, Na.sub.2HPO.sub.4.Math.7H.sub.2O 12.8 g/L, K.sub.2HPO.sub.4 17.4 g/L, NH.sub.4Cl 2 g/L, yeast extract 0.5 g/L, KH.sub.2PO.sub.4 3 g/L and CaCl.sub.2 0.11 g/L) was prepared in a 250 mL Erlenmeyer flask. Then, pH was maintained at 6.0 using Ca(OH).sub.2.

[0111] 1 mL of the single colony prepared in Example 2-2 was inoculated to the prepared M9 medium flask, and cultured in a 33 C., 250 rpm shaking incubator, and the absorbance of the strain culture solution was measured at OD600 using a UV Spectrometer under the analysis conditions of Table 8 below using HPLC, and the produced amounts of 1,3-PDO and 3-HP of the transformed strain of Example 2-2 were confirmed, and the results were shown in Table 9 below.

TABLE-US-00008 TABLE 8 HPLC Model Agilent Technologies 1200 Series Column Bio-Rad Aminex HPX-87H Ion Exclusion Column300 mm 7.8 mm Detector Refractive Index (RI) / Ultraviolet (UV) Detector Mobile Phase 0.5 mM H.sub.2SO.sub.4 Flow rate 0.4 mL/min Run time 35 min Column temperature 35 C. Detector temperature 35 C. Injection volume 10 l

TABLE-US-00009 TABLE 9 Vector type in transformed strain 1,3-PDO (g/L) 3-HP (g/L) pCDF 0 0 pCDF-dhaB-gdrAB 0 0 pCDF-dhaB-gdrAB-yqhD 1.42 0 pCDF-dhaB-gdrAB-aldH-yqhD 2.40 1.31

[0112] As a result, when only the empty vector (pCDF) or dhaB/gdrAB was expressed, both 1,3-PDO and 3-HP were not produced. However, it was confirmed that when dhaB/gdrAB was expressed with yqhD, 1,3-PDO was produced by 1.42 g/L and when aldH and yqhD were simultaneously expressed, 1,3-PDO and 3HP were simultaneously produced. It was confirmed that the total target produced amount increased, as the 1,3-PDO produced amount increased about 70% compared to single production and 3HP was additionally produced during simultaneous fermentation.

Example 3-2. Confirmation of Produced Amounts of 1,3-Propanediol (1,3-PDO) and 3-Hydroxypropionic Acid (3-HP) of Transformed Strain Through High-Concentration Cell Culture

[0113] The single colony of Example 2-2 was inoculated to an LB liquid medium with the same composition as the LB liquid medium of Example 2-2, and pre-cultured (Seed culture) under the condition of 37 C. for 18 hours.

[0114] Then, for high-concentration cell culture, in a 5 L fermenter, the pre-culture solution (Seed culture) was inoculated to 2 L of a modified MR medium comprising 20 g/L glucose, 25 mg/L streptomycin, and 50 mg/L kanamycin (containing MgSO.sub.4.Math.7H.sub.2O 0.8 g/L, (NH.sub.4).sub.2HPO.sub.4 4 g/L, KH.sub.2PO.sub.4 6.67 g/L and Citrate 0.8 g/L) in a 150 mL flask, and it was cultured under the conditions of 35 C., 500 rpm, pH 6.95 (adjusted using NH.sub.4 (OH)). After exhausting the glucose comprised in the medium, Feeding Solution (comprising glucose 700 g/L, MgSO.sub.4 15 g/L, Trace metal 10 mL/1 L, 10 MR salt 100 mL/1 L, and 25 mg/L streptomycin) was added at a speed of 40 mL/hr and it was cultured for 24 hours.

[0115] After high-concentration cell culture, for 3-HP production, the culture solution was inoculated to 2 L of a new MR medium (containing (NH.sub.4).sub.2HPO.sub.4 4 g/L, KH.sub.2PO.sub.4 6.67 g/L and Citrate 0.8 g/L) at initial O.D. 25 in the medium and 1 M of Vitamin B.sub.12 was added to produce 3-HP. Glucose 200 g/L and glycerol 500 g/L Feeding Solution was added at a speed of 35 mL/hr, and Mg(OH).sub.2 was added to maintain the condition of pH 6.95.

[0116] After that, the produced amounts of 1,3-PDO and 3-HP of the strain in which pCDF-dhaB-gdrAB-aldH-yqhD was transformed were confirmed using HPLC by the substantially same method as Example 3-1 above, and the results were shown in FIG. 1 and Table 10. The yield was calculated by the following Equation 1.

[00001] Yield ( % ) = ( Produced amounts of 1 , 3 - PDO and 3 - HP ) / ( Amount of used glucose and glycerol ) * 100 [ Equation 1 ]

TABLE-US-00010 TABLE 10 Type Measured value 1,3-PDO (g/L) 81 3-HP (g/L) 77 1,3-PDO productivity (g/L/hr) 2.1 3-HP productivity (g/L/hr) 2.0 Yield (%, g/g) 63

[0117] (In Table 10 above, the productivity means the produced amount per hour)

[0118] As a result, the high 1,3-PDO and 3-HP produced amounts and productivity were confirmed, and it was confirmed that the yield was also high.

Example 4. Confirmation of Produced Amounts of 1,3-Propanediol (1,3-PDO) and 3-Hydroxypropionic Acid (3-HP) of Strain Transformed with GPD and GPP Genes

Example 4-1. Confirmation of Produced Amounts of 1,3-Propanediol (1,3-PDO) and 3-Hydroxypropionic Acid (3-HP) of Transformed Strain Through Flask Culture

[0119] A modified M9 medium (containing MgSO.sub.4.Math.7H.sub.2O 0.6 g/L, NaCl 1.5 g/L, Na.sub.2HPO.sub.4.Math.7H.sub.2O 12.8 g/L, K.sub.2HPO.sub.4 17.4 g/L, NH.sub.4Cl 2 g/L, yeast extract 0.5 g/L, KH.sub.2PO.sub.4 3 g/L and CaCl.sub.2) 0.11 g/L) of 100 mL comprising 20 g/L glycerol, 5 g/L glucose and 25 mg/L streptomycin/kanamycin was prepared in a 250 mL Erlenmeyer flask. Then, using Ca(OH).sub.2, pH was maintained at 6.0.

[0120] The single colony prepared in Example 2-3 of 1 mL was inoculated to the prepared M9 medium flask, and cultured in a 33 C., 250 rpm shaking incubator, and the absorbance of the strain culture solution was measured at OD600 using a UV spectrometer under the analysis conditions of Table 11 below, and the produced amounts of 1,3-PDO and 3-HP of the transformed strain of Example 2-3 were confirmed, and the results were shown in Table 12 below.

TABLE-US-00011 TABLE 11 HPLC Model Agilent Technologies 1200 Series Column Bio-Rad Aminex HPX-87H Ion Exclusion Column300 mm 7.8 mm Detector Refractive Index (RI) / Ultraviolet (UV) Detector Mobile Phase 0.5 mM H.sub.2SO.sub.4 Flow rate 0.4 mL/min Run time 35 min Column temperature 35 C. Detector temperature 35 C. Injection volume 10 l

TABLE-US-00012 TABLE 12 Vector type in transformed strain 1,3-PDO (g/L) 3-HP (g/L) pRSF-GG, pCDF 0 0 pRSF-GG, pCDF-dhaB-gdrAB 0 0 pRSF-GG, pCDF-dhaB-gdrAB-aldH 0 3.43 pRSF-GG, pCDF-dhaB-gdrAB-yqhD 1.42 0 pRSF-GG, pCDF-dhaB-gdrAB-aldH-yqhD 5.21 2.76

[0121] As a result, when only the empty vector (pCDF) or dhaB/gdrAB was expressed, both 1,3-PDO and 3HP were not produced. However, it was confirmed that 3HP or 1,3-PDO was produced at 3.43 g/L, 1.42 g/L, respectively, when the dhaB/gdrAB and GPD-GPP were expressed with aldH or yqhD, and 1,3-PDO and 3HP were simultaneously produced, when aldH and yqhD were simultaneously expressed. It was confirmed that the total target produced amount increased, as the 1,3-PDO produced amount increased about 3.7 times compared to single production and 3HP was additionally produced during simultaneous fermentation.

Example 4-2. Confirmation of Produced Amounts of 1,3-Propanediol (1,3-PDO) and 3-Hydroxypropionic Acid (3-HP) of Transformed Strain Through High-Concentration Cell Culture

[0122] The single colony of Example 2-3 was inoculated to an LB liquid medium of the same composition as the LB liquid medium of Example 2-3, and was pre-cultured (seed culture) under the condition of 37 C. for 18 hours.

[0123] Then, for high-concentration cell culture, in a 5 L fermenter, the pre-culture solution was inoculated to 2 L of a modified MR medium comprising 20 g/L glucose, 25 mg/L streptomycin, and 50 mg/L kanamycin (containing MgSO.sub.4.Math.7H.sub.2O 0.8 g/L, (NH.sub.4).sub.2HPO.sub.4 4 g/L, KH.sub.2PO.sub.4 6.67 g/L and Citrate 0.8 g/L) in a 150 mL flask, and it was cultured under the conditions of 35 C., 500 rpm, pH 6.95 (adjusted using NH.sub.4 (OH)). After exhausting the glucose comprised in the medium, Feeding Solution (comprising glucose 700 g/L, MgSO.sub.4 15 g/L, Trace metal 10 mL/1 L, 10 MR salt 100 mL/1 L, 25 mg/L streptomycin, and 50 mg/L kanamycin) was added at a speed of 40 mL/hr and it was cultured for 24 hours.

[0124] After high-concentration cell culture, for 3-HP production, the culture solution was inoculated to 2 L of a new MR medium (containing (NH.sub.4).sub.2HPO.sub.4 4 g/L, KH.sub.2PO.sub.4 6.67 g/L and Citrate 0.8 g/L) at initial O.D. 25 in the medium and 1 M of Vitamin B.sub.12 was added to produce 3-HP. Glucose 600 g/L Feeding Solution was added at a speed of 35 mL/hr, and Mg(OH).sub.2 was added to maintain the condition of pH 6.95.

[0125] After that, the produced amounts of 1,3-PDO and 3-HP were confirmed using HPLC by the substantially same method as Example 4-1 above, and the results were shown in FIG. 2 and Table 13. The yield was calculated by the following Equation 2.

[00002] Yield ( % ) = ( Produced amounts of 1 , 3 - PDO and 3 - HP ) / ( amount of used glucose ) * 100 [ Equation 2 ]

TABLE-US-00013 TABLE 13 Type Measured value 1,3-PDO (g/L) 26 3-HP (g/L) 26 1,3-PDO productivity (g/L/hr) 1.45 3-HP productivity (g/L/hr) 1.45 Yield (%, g/g) 30

[0126] (In Table 13 above, the productivity means the total produced amount per hour)

[0127] As a result, the high 1,3-PDO and 3-HP produced amounts and productivity were confirmed, and it was confirmed that the yield was also high.