NUCLEIC ACID DETECTION METHOD BY REAL-TIME PCR

20220316000 · 2022-10-06

Assignee

Inventors

Cpc classification

International classification

Abstract

An object of the invention is to provide an optical detection method and a quantification method of a product obtained by amplifying a target nucleic acid contained in a paper piece of a blood spot in a filter paper obtained by blotting blood on a filter paper and then drying the blood using nucleic acid amplification reaction by real-time PCR and to further provide a kit used for the methods. The invention provides a method and a kit which can optically detect and quantify a target nucleic acid from a dried blood spot in a filter paper by real-time PCR without any complicated pretreatment, by adjusting the size of the punched piece of the dried blood spot in a filter paper or the whole blood amount contained in the punched piece, the amount of the PCR reaction reagent, or performing the PCR reaction in a PCR reaction tube closed with a cap.

Claims

1. A method for detecting a target nucleic acid contained in a dried blood spot in a filter paper by real-time PCR, including the steps of (A) to (D) below: (A) a step of adding the dried blood spot in a filter paper to a PCR reaction tube, wherein the filter paper is a circular punched piece with a diameter of 1.2 mm to 2.0 mm or a punched piece containing whole blood in an amount of 0.95 v/v % to 6.6 v/v % based on the total amount of the reaction solution; (B) a step of adding 20 to 50 μL of a PCR reagent to the PCR reaction tube; (C) a step of performing PCR reaction in the tube which contains the PCR reagent and the dried blood spot in a filter paper and which is sealed with a cap; and (D) a step of sequentially and optically detecting the target nucleic acid amplified by the PCR reaction.

2. The method for detecting a target nucleic acid according to claim 1, wherein the step of (B) is conducted after the step of (A).

3. The method for detecting a target nucleic acid according to claim 1, wherein the PCR reaction tube is a 96-well plate for PCR reaction or a tube in an eight-tube strip.

4. The method for detecting a target nucleic acid according to claim 1, wherein the PCR reagent contains at least a primer, a polymerase, dNTPs and an intercalator or a fluorescently labeled probe.

5. The method for detecting a target nucleic acid according to claim 4, wherein the amplified target nucleic acid is detected through detection of fluorescence emitted by irradiation of the intercalator with an excitation light.

6. The method for detecting a target nucleic acid according to claim 4, wherein the fluorescently labeled probe has a fluorescent substance and a quencher and includes a partial sequence complementary to a template of the nucleic acid amplification reaction, and the amplified target nucleic acid is detected through detection of fluorescence emitted by irradiation of the fluorescent substance with an excitation light.

7. The method for detecting a target nucleic acid according to claim 1, wherein the target nucleic acid is one or more gene fragments and/or genes selected from the group consisting of TRECs, KRECs and SMN1.

8. A method for quantifying a target nucleic acid by the method for detecting a target nucleic acid by real-time PCR according to claim 1, wherein the target nucleic acid is quantified using a standard below; (1) a standard which contains an artificial nucleic acid including the sequence of the target nucleic acid and which is not contained in the dried blood spot in a filter paper, wherein the standard is dissolved directly in a reaction container and used.

9. A quantification kit used for a method for quantifying a target nucleic acid by the method for detecting a target nucleic acid by real-time PCR according to claim 1, including at least the following; (1) a standard which contains an artificial nucleic acid including the sequence of the target nucleic acid and which is not contained in the dried blood spot in a filter paper, wherein the standard is dissolved directly in a reaction container and used.

Description

DESCRIPTION OF EMBODIMENTS

(PCR Reaction Tube)

[0029] The tube used in the invention is a tube for PCR reaction and has a structure into which a punched piece of the blood spot in a filter paper can be smoothly inserted and which can be sealed with a cap. In a suitable shape, the opening at the upper part of the tube is a circle (for example, an inside diameter of around 2.5 mm to 10 mm), and the bottom is narrower than the opening at the upper part. An inverted cone shape or the like is preferable.

[0030] The volume of the tube may be a volume to which the PCR reaction reagent can be added and which can sufficiently hold the reaction solution even with the temperature changes during the PCR reaction, and the tube preferably has a volume of 0.1 mL to 0.3 mL, further preferably a volume of 0.15 mL to 0.25 mL, most preferably a volume of 0.2 mL.

[0031] The PCR reaction tube used in the invention is preferably a 96-well plate for PCR reaction in which 96 plates are connected or one in an eight-tube strip in which eight tubes are connected, and as commercial products, those sold with a name 96-well PCR plate, PCR eight-tube strip or the like can be used. Commercial products include LightCycler 480 Multiwell Plate 96 (Roche, Inc.), 96-Well PCR Plate, Flat Top, Low Profile, Natural, Polypropylene, UltraFlux (Scientific Specialties, Inc.), Eppendorf PCR plate 96, skirtless, 150 μL, colorless (Eppendorf), PCR plate 96-well simplate 0.1 ml natural (BM Equipment Co., Ltd.), LightCycler (registered trademark) 8-Tube Strips (Roche, Inc.) and the like.

[0032] The material of such a reaction tube desirably causes little contamination of the reaction solution and is stiff so that the shape does not change even with the changes in the internal pressure due to the temperature changes during the PCR reaction, and the tube is made of polypropylene, for example.

(Cap)

[0033] The cap used in the invention has a structure which can fit and seal the opening of the PCR reaction tube. Like the PCR reaction tube, the material is desirably a material which does not deform with the changes in the internal pressure due to the PCR reaction and is desirably a highly optically transparent material, and the cap may be made of polypropylene. Specific examples thereof include LightCycler (registered trademark) 8-Tube Strips (Roche, Inc.), optical flat 8-cap strips (Bio-Rad Laboratories, Inc.), MicroAmp™ Optical 8-Cap Strips (Thermo Fisher Scientific), Strips of 8 Flat Optical Caps (NIPPON Genetics Co, Ltd), cap strips, 8-strips, flat (Eppendorf) and the like.

[0034] In the invention, when the PCR reaction is performed in the PCR reaction tube which is sealed with the cap, generation of bubbles due to the thermal cycles can be prevented. As a result, vibration of the punched piece in the reaction solution and lifting of the punched piece are prevented. Therefore, excessive elution of interfering substances contained in the punched piece into the reaction solution is thought to be prevented. Moreover, because lifting of the punched piece due to generation of bubbles can be prevented, the optical detection by real-time PCR can be conducted with excellent reproducibility without blocking of the light path by the punched piece.

(Blood Sample/Dried Blood Spot in a Filter Paper)

[0035] The blood sample used in the invention is blood (whole blood) in a filter paper that is obtained by blotting blood (whole blood) on the filter paper and then drying the blood and is sometimes simply called a dried blood spot in a filter paper. The dried blood spot in a filter paper is taken out using a punching device as a paper piece having the shape of the punching hole (punched piece). The size of the punched piece is desirably 1.2 to 2.0 mm in diameter, further desirably 1.5 mm to 1.8 mm, because the amount of the contained blood should be in an appropriated range. The whole blood amount contained in the punched piece based on the total amount of the PCR reaction solution is desirably 0.95 v/v % to 6.6 v/v %, further desirably 1.4 v/v % to 5.2 v/v %. The whole blood amount contained in the punched piece based on the total amount of the PCR reaction solution is desirably 0.95 v/v % to 6.6 v/v %, further desirably 1.4 v/v % to 5.2 v/v %. Here, the whole blood amount is indicated as the proportion which is obtained by adding a circular punched piece with a diameter of 1.2 to 2.0 mm or a punched piece having a diameter of 1.5 mm to 1.8 mm to 20 to 50 μL of a PCR reaction solution and dissolving the blood and which is calculated based on the actual value (when 30 μL of whole blood was added to a filter paper before cutting out a punched piece and dried, the diameter of the created circular blood portion was of 9.5 mm).

[0036] Examples of the dried blood spot in a filter paper used in the invention include a blood spot in a filter paper collected from the heel of a newborn during newborn mass screening or the like, a blood spot in a filter paper collected during simultaneous optional screening and the like, but the dried blood spot in a filter paper is not limited to the examples.

(PCR Reagent)

[0037] The PCR reagent used in the invention contains at least a set of primers, a polymerase, dNTPs (deoxynucleoside triphosphates), an intercalator or a fluorescently labeled probe. The reagent also typically contains a buffer. The buffer is not particularly limited as long as the buffer has the function of inhibiting the activities of substances which inhibit the DNA amplification reaction, such as positively charged substances (certain kinds of protein and the like) and negatively charged substances (certain kinds of saccharide, dyes and the like), in the body fluid of a living thing. Examples of commercial buffers include Ampdirect, Ampdirect plus (both manufactured by Shimadzu Corporation) and the like.

[0038] The amount of the PCR reagent used in the invention added to a reaction tube is 20 to 50 μL.

(Real-Time PCR)

[0039] The real-time PCR method generally means a method for sequentially monitoring the process of generation of an amplification product in PCR. In the invention, detection by real-time PCR means detection of an amplified target nucleic acid (also simply referred to as an amplification product below) by optical means after the PCR reaction. Here, the amplification product may be detected, for example, at the time of completion of the PCR reaction or after the completion or may be detected simultaneously during the PCR reaction step. In the case of simultaneous detection, the amplification product can be detected, for example, sequentially. The sequential detection (monitoring) may be, for example, continuous or noncontinuous (intermittent) detection.

[0040] The temperature changes of the steps in the PCR reaction may be automatically controlled using, for example, a thermal cycler or the like. In the PCR reaction in the invention, because the PCR reaction is started after sealing the tube with the cap, generation of bubbles due to the temperature changes can be prevented, and vibration can be prevented without lifting the punched piece. As a result, excessive elution of interfering substances from the punched piece can be prevented, and optical detection and quantification of the target nucleic acid contained in the punched piece have been enabled without conducting any complicated pretreatment. Moreover, during real-time PCR, which is continuous monitoring of PCR reaction, the punched piece cannot be forcibly placed at the bottom by centrifugation or the like in the middle of the reaction, and thus lifting of the punched piece is fatal for the optical detection. Because lifting of the punched piece can be prevented by the invention, continuous optical detection by real-time PCR without blocking of the light path by the punched piece has been enabled.

[0041] The amplification product generated by the PCR reaction can be detected, for example, by detecting the fluorescence intensity generated from the amplification product. The fluorescence detection is not particularly restricted but is the conventionally known intercalator method, the TaqMan (registered trademark) probe method, the hybridization method, the cycling probe method or the like.

[0042] The fluorescence intensity can be detected, for example, with a fluorometer. Moreover, in general, an apparatus which has both a PCR reaction unit (for example, a thermal cycler) and an optical unit (for example, a fluorometer) is used. Specific examples include commercial SmartCycler (product name, manufactured by Takara Bio Inc.), LightCycler (product name, manufactured by Roche Diagnostics), ABI PRISM7000 (product name, manufactured by Applied Biosystems) and the like.

(Quantification Method of Target Nucleic Acid)

[0043] The method for quantifying a target nucleic acid of the invention is a method of generating an amplification product complementary to the target nucleic acid in the dried blood spot in a filter paper, detecting the amplification product by optical means and quantifying the amplification product. By counting the PCR cycle number at which the amount of the amplification product has reached a certain amount, the target nucleic acid contained in the dried blood spot in a filter paper can be quantified in the method. Moreover, as in the Examples described below, the quantification can be conducted by calculating the copy number of 1 μL of whole blood in the dried blood spot in a filter paper from a calibration curve of the Cq values calculated from the standards.

[0044] The invention relates to a method for detecting a target nucleic acid in a dried blood spot in a filter paper by real-time PCR, including the steps of (A) to (D) below.

[0045] (A) A step of adding the dried blood spot in a filter paper to a PCR reaction tube, wherein the filter paper is a circular punched piece with a diameter of 1.2 mm to 2.0 mm or a punched piece containing whole blood in an amount of 0.95 v/v % to 6.6 v/v % based on the total amount of the reaction solution.

[0046] (B) A step of adding 20 to 50 μL of a PCR reagent to the PCR reaction tube.

[0047] (C) A step of performing PCR reaction in the tube which contains the PCR reagent and the filter paper and which is sealed with a cap.

[0048] (D) A step of sequentially and optically detecting the target nucleic acid amplified by the PCR reaction.

[0049] Here, either one of the (A) step and the (B) step may be conducted first, or the steps may be conducted simultaneously. However, the step of (B) is desirably conducted after the step of (A). By conducting (A) first, the filter paper can be more certainly placed at the bottom of the tube with the reagent solution even when the filter paper adheres to the tube wall or the like. To ensure that the punched piece is placed at the bottom of the tube before starting the PCR reaction, centrifugation or the like is also desirable.

[0050] In this manner, the invention is characterized by subjecting the blood spot in a filter paper directly to real-time PCR without pretreatment such as separation and purification from the dried blood spot in a filter paper. A sample which has not been subjected to such pretreatment generally contains substances which inhibit the DNA amplification reaction. The substances which inhibit the DNA amplification reaction are hemoglobin contained in the blood, precipitates of blood components generated by thermal denaturation during the PCR reaction and the like.

[0051] Thus, when the PCR reaction is performed without any pretreatment, it is expected that the PCR reaction is affected by the interfering substances. However, according to the invention, as described above, by adjusting the size of the punched piece or the whole blood amount contained in the punched piece and the amount of the PCR reaction reagent in the certain ranges, placing the punched piece at the bottom of the tube and performing the PCR reaction after sealing the tube with the cap, generation of bubbles due to the temperature changes can be prevented, and vibration can be prevented without lifting the paper piece. As a result, the excessive elution of interfering substances from the punched piece can be prevented, and optical detection and quantification of the target nucleic acid contained in the punched piece directly by real-time PCR have been enabled without conducting any complicated pretreatment.

(Target Nucleic Acid)

[0052] The nucleic acid as the target to be detected by real-time PCR in the invention is not particularly restricted, and in addition to whole blood-derived DNA and RNA, a foreign nucleic acid introduced to the whole blood by a virus or the like and the like are all included.

[0053] In particular, the target nucleic acid of the invention is preferably, for example, a nucleic acid derived from the whole blood of a newborn and is a nucleic acid contained in a gene fragment of TRECs (T-cell receptor excision circles) or KRECs (kappa-deleting recombination excision circles) or a gene such as SMN1 (Survival Motor Neuron 1) and SMN2 (Survival Motor Neuron 2).

(Standard/Kit)

[0054] The standard (also called a calibrator) of the invention refers to a standard substance used for a method for quantifying a target nucleic acid by the method for detecting a target nucleic acid. The standard of the invention is characterized by containing an artificial nucleic acid including the sequence of the target nucleic acid and by not being contained in the dried blood spot in a filter paper.

[0055] Regarding the form of the standard, in a possible method, the standard may be added to the dried blood spot in a filter paper and used for quantification to offset the influence of the dried blood spot in a filter paper, but the accuracy and the reproducibility may be deteriorated due to the variation in the degree of influence due to the variation in the components extracted from the dried blood spot in a filter paper or in the elution of the standard from the dried blood spot in a filter paper and the like.

[0056] In this regard, the standard of the invention of the present application is intentionally provided in a form of not being contained in the dried blood spot in a filter paper and is a standard present in the form of, for example, solution state, a freeze-dried product or the like. The standard of the invention is in such a form and thus can be dissolved directly in the reaction solution and used, which achieves accurate quantification.

[0057] The invention can also provide a quantification kit for a target nucleic acid including such a standard.

EXAMPLES

[0058] The invention is explained in detail below by Examples, but the invention is not limited to the following Examples.

[0059] The Examples are examples in which punched pieces were taken out from dried blood spots in filter papers and subjected directly to PCR reaction and in which the amplification products were optically detected by real-time PCR.

[Example 1] TREC/KREC Gene Quantification Systems

(a) Test Materials

[0060] (a-1) TREC, KREC and RNase P Amplification Primers

[0061] As primers for amplification of TRECs, KRECs and an internal standard gene (RNase P), the following primers were synthesized by Sigma-Aldrich Co. LLC and used.

TABLE-US-00001 TREC forward primer (SEQ ID NO: 1) 5′-CCCTTTCAACCATGCTGACA-3′ TREC reverse primer (SEQ ID NO: 2) 5′-GTGCCAGCTGCAGGGTTTAG-3′ KREC forward primer (SEQ ID NO: 3) 5′-CAGCTCAGCGCCCATTACG-3′ KREC reverse primer (SEQ ID NO: 4) 5′-TGGGACTCCAGGAGCCAG-3′ RNase P forward primer (SEQ ID NO: 5) 5′-GCGGAGGGAAGCTCATCA-3′ RNase P reverse primer (SEQ ID NO: 6) 5′-GTCTGACCTCGCGCGGA-3′
(a-2) TREC, KREC and RNase P Detection Probes

[0062] As probes for observing the PCR amplification of TRECs, KRECs and RNase P, the following detection probes which were fluorescently labeled were synthesized and produced by Primetech Corporation and used.

TABLE-US-00002 TREC detection probe 5′-(Quasar670)-CCTCTGGTTTTTGTAAAGGTGCCCACT-(BHQ3)- 3′ (the nucleotide sequence part is SEQ ID NO: 7) KREC detection probe 5′-(ROX)-TCTGCACGGGCAGCAGGTTGG-(BHQ2)-3′ (the nucleotide sequence part is SEQ ID NO: 8) RNase P detection probe 5′-(FAM)-CCACGAGCTGAGTGCGTCCTG-(BHQ1)-3′ (the nucleotide sequence part is SEQ ID NO: 9)
(a-3) Plasmids

[0063] For quantifying the PCR amplification products, plasmids having the partial sequences of TREC, KREC and RNase P genes shown below incorporated in a vector were synthesized by Eurofins Scientific SE and used as standards for calibration curves.

TABLE-US-00003 Partial TREC Sequence (SEQ ID NO: 10) GACTGAATTCGGCTCTGTCTAGTGTGATAACATTTTGTTATCTTATTCAT TGTCTTCATCCCTGAAATACACTCTGCTCTCTCCTATCTCTGCTCTGAAA GGCAGAAAGAGGGCAGCCCTCTCCAAGGCAAAATGGGGCTCCTGTGGGGA ACAGAGGGGTGCCTCTGTCAACAAAGGTGATGCCACATCCCTTTCAACCA TGCTGACACCTCTGGTTTTTGTAAAGGTGCCCACTCCTGTGCACGGTGAT GCATAGGCACCTGCACCCCGTGCCTAAACCCTGCAGCTGGCACGGGCCCT GTCTGCTCTTCATTCACCGTTCTCACGAGTTGCAATAAGTTCAGCCCTCC ATGTCACACTGTGTTTTCCATCCTGGGGAGTGTTTCACAGCTATCCCAAG CCCCACGCTGACGAATCACGGCCGAAAACACACTCTGATGCCAGCACAGA CCACGGAGCAAATGTCAGACAAGATCAGCCTCGGAAAAGTGAGGAATTCA GTC Partial KREC Sequence (SEQ ID NO: 11) GCTTTAAATTATTTACAATCCCCTAATGGAAATTTTCACTAATGAGATAT CATAATGAATGTGAATTTTATTTCTGAAATCTCTAATAAATCAGTCTTCT CCCTGGTTTTCCCAGCTCAGCGCCCATTACGTTTCTGTTCTCTTTCCCTT AGTGGCATTATTTGTATCACTGTGCATCAGCACAGTGTGCGCTGCCAACC TGCTGCCCGTGCAGAAACTCTAGGGTAAGAGCTGGCTCCTGGAGTCCCAC CCAGGCTGCGTGTCCCTCACAGTCTGCTCTGTGTCTATGTGTGTGTGTTG GGGGGATATTATTGGACAATTCAAGGGAGGCTCAGTGAGGAGGAAGGAAA ATTTCATGTAATTCTTTCTGGTTTGTCTTTCTCAACCCCCTCCTCCTGCC TACTCCTTAACTGAGAGAGTG Partial RNase P Sequence (SEQ ID NO: 12) ATAGGGCGGAGGGAAGCTCATCAGTGGGGCCACGAGCTGAGTGCGTCCTG TCACTCCACTCCCATGTCCCTTGGGAAGGTCTGAGACTAGGGCCAGAGGC GGCCCTAACAGGGCTCTCCCTGAGCTTCGGGGAGGTGAGTTCCCAGAGAA CGGGGCTCCGCGCGAGGTCAGACTGGGCAGGAGATGCCGTGGACCCCGCC CTTCGGGGAGGGGCCCGGCGGATGCCTCCTTTGCCGGAGCTTGGAACAGA CTCACGGCCAGCGAAGTGAGTTCAATGGCTGAGGTGAGGTACCCCGCAGG GGACCTCATAACCCAATTCAGACTACTCTCCTCCGCCCATT

(b) PCR Reagent

[0064] The composition of the PCR reagent is shown below. [0065] PCR buffer (Ampdirect Plus; Shimadzu Corporation) [0066] 0.25 μM (final concentration) TREC forward primer [0067] 0.25 μM (final concentration) TREC reverse primer [0068] 0.125 μM (final concentration) KREC forward primer [0069] 0.125 μM (final concentration) KREC reverse primer [0070] 0.125 μM (final concentration) RNase P forward primer [0071] 0.125 μM (final concentration) RNase P reverse primer [0072] 0.135 μM (final concentration) TREC detection probe [0073] 0.135 μM (final concentration) KREC detection probe [0074] 0.135 μM (final concentration) RNase P detection probe [0075] 0.03 U/μL BIOTAQ HSDNA polymerase

(c) PCR Reagents Containing Standards For Calibration Curves

[0076] PCR reagents containing the standards below (dilution series; STD1 to 4) were prepared by adding the plasmids to the PCR reagent. The values in the brackets are the copy numbers of the genes per one PCR reaction. The reagents were used in the solution state without adding to a dried blood spot in a filter paper.

[0077] STD1 (TRECs 10,000 copy/reaction, KRECs 10,000 copy/reaction, RNase P 100,000 copy/reaction)

[0078] STD2 (TRECs 1,000 copy/reaction, KRECs 1,000 copy/reaction, RNase P 10,000 copy/reaction)

[0079] STD3 (TRECs 100 copy/reaction, KRECs 100 copy/reaction, RNase P 1,000 copy/reaction)

[0080] STD4 (TRECs 10 copy/reaction, KRECs 10 copy/reaction, RNase P 100 copy/reaction)

(d) Control Dried Blood Spot in a Filter Papers

[0081] After adding the TREC plasmid and the KREC plasmid to swine whole blood each at 12.5 copy/μL and further adding genomic DNA extracted from cell line K562 (derived from chronic myelogenous leukemia cells; provided from National Institutes of Biomedical Innovation, Health and Nutrition, Cell Bank) at 13.5 ng/μL, 40 μL thereof was blotted on a filter paper for blood collection (Advantec) and directly dried.

(e) Conditions For PCR Reaction

[0082] (i) 95° C.: 15 minutes [0083] (ii) 95° C.: 15 seconds, 63° C.: 80 seconds (45 cycles) [0084] (iii) 37° C.: 5 minutes

(f) Real-Time PCR Measurement

[0085] (f-1) Measurement Method

[0086] The measurement was made by the following procedures.

[0087] (i) From the control dried blood spots in filter papers, circular punched pieces with diameters of 1.2 mm, 1.5 mm, 1.8 mm, 2.0 mm and 3.0 mm were taken out using a puncher.

[0088] (ii) To PCR reaction tubes (manufactured by Roche, Inc.: LightCycler (registered trademark) 8-Tube Strips, made of polypropylene), the punched pieces were introduced.

[0089] (iii) After adding 20 μL, 30 μL, 40 μL or 50 μL of the PCR reagents to the tubes, the tubes were sealed with caps (included as a set with the tubes).

[0090] (iv) The PCR reagents containing the standards for calibration curves according to the addition amounts were also dispensed to tubes.

[0091] (v) Using a thermal cycler (LightCycler96; Roche, Inc.), triplex real-time PCR measurement for TRECs, KRECs and RNase P was conducted.

[0092] (vi) The combinations were measured each four times. The copy numbers per 1 μL whole blood in the punched pieces were calculated from the calibration curves of the Cq values calculated from the standards, and the average values of the copy numbers of the four measurements were calculated. The values obtained by dividing the average values by the set values were regarded as the recovery rates.

(f-2) Measurement Results

[0093] The results are shown in Tables 1 to 3. Regarding the difference in the size of the punched piece, the reproducibility of the amplification and the recovery rates were excellent in the case of diameters of 1.5 mm to 2.0 mm. With the diameter of 1.2 mm, amplification was not caused in some cases, but the recovery rates were excellent. On the other hand, in the case of the diameter of 3.0 mm, measurement could not be made in some cases because an amplification curve could not be drawn (the parts with hyphen (-) or shown in bold in the tables). It is believed that the causes were that the punched piece had a large size and thus did not reach the bottom of the tube and that the paper piece thus blocked the light path, which prevented the light from reaching the reaction solution and affected the fluorescence detection.

TABLE-US-00004 TABLE 1 TREC Measurement Results Amount of PCR Size of TREC Average Reaction Punched (copy/μL (copy/μL Recovery Solution Piece W.B.) N = 1 N = 2 N = 3 N = 4 W.B.) Rate % 20 μL 1.2 mm 12.5 5.6 22.3  8.6 10.3 11.7 94 1.5 mm 12.5 16.8 23.5 11.5 22.0 18.4 147 1.8 mm 12.5 17.6 4.8 13.3 14.5 12.5 100 2.0 mm 12.5 22.8 14.3 10.8 16.5 16.1 129 3.0 mm 12.5 — — — — — — 30 μL 1.2 mm 12.5 8.1 3.2 17.4 18.4 11.8 94 1.5 mm 12.5 26.1 20.1 10.2 20.8 19.3 154 1.8 mm 12.5 6.1 6.6 16.8  6.4  8.9 72 2.0 mm 12.5 5.5 14.3 20.0  2.4 10.6 85 3.0 mm 12.5 — — — — — — 40 μL 1.2 mm 12.5 — 7.1  6.0 19.9 11.0 88 1.5 mm 12.5 10.2 5.6 12.0 19.8 11.9 95 1.8 mm 12.5 23.3 14.7  9.2 10.1 14.3 115 2.0 mm 12.5 10.5 9.1  8.4  7.1  8.8 70 3.0 mm 12.5 44.8 — — 33.8 39.3 314 50 μL 1.2 mm 12.5 23.0 9.9 11.5 26.1 17.6 141 1.5 mm 12.5 5.6 20.2 16.5 11.8 13.5 108 1.8 mm 12.5 44.6 6.8 11.3  8.0 17.7 141 2.0 mm 12.5 6.7 20.8 19.4 11.0 14.5 116 3.0 mm 12.5 65.2 220.2 10.8 — 98.7 790

TABLE-US-00005 TABLE 2 KREC Measurement Results Amount of PCR Size of KREC Average Reaction Punched (copy/μL (copy/μL Recovery Solution Piece W.B.) N = 1 N = 2 N = 3 N = 4 W.B.) Rate % 20 μL 1.2 mm 12.5 — 7.8 21.9 9.9 13.2 106 1.5 mm 12.5 6.5 20.3 9.0 20.8 14.2 113 1.8 mm 12.5 22.2 10.0 14.7 10.1 14.2 114 2.0 mm 12.5 10.0 17.2 7.6 13.0 11.9 96 3.0 mm 12.5 — — — — — — 30 μL 1.2 mm 12.5 3.1 2.4 13.8 36.7 14.0 112 1.5 mm 12.5 9.4 5.7 11.1 8.2 8.6 69 1.8 mm 12.5 5.6 8.1 6.7 6.1 6.6 53 2.0 mm 12.5 14.2 7.6 14.2 14.5 12.6 101 3.0 mm 12.5 56.3 — — — 56.3 450 40 μL 1.2 mm 12.5 15.6 14.1 — 14.7 14.8 119 1.5 mm 12.5 13.1 5.3 11.9 6.7 9.3 74 1.8 mm 12.5 9.3 28.4 4.5 15.3 14.4 115 2.0 mm 12.5 8.7 14.8 11.7 17.0 13.0 104 3.0 mm 12.5 — — 98.7 31.4 65.0 520 50 μL 1.2 mm 12.5 34.3 7.6 23.9 29.4 23.8 190 1.5 mm 12.5 21.6 27.9 20.8 33.0 25.8 207 1.8 mm 12.5 14.1 17.6 6.4 8.7 11.7 93 2.0 mm 12.5 31.7 16.1 20.2 21.1 22.3 178 3.0 mm 12.5 129.5 101.9 20.2 131.1 95.7 765

TABLE-US-00006 TABLE 3 RNase P Measurement Results (Reference) Amount of PCR Size of Average Reaction Punched (copy/μL Solution Piece N = 1 N = 2 N = 3 N = 4 W.B.) 20 μL 1.2 mm 795 770 958 643 791 1.5 mm 972 700 723 657 763 1.8 mm 517 497 603 527 536 2.0 mm 1462  1337  469 1891  1290  3.0 mm — — — — — 30 μL 1.2 mm 695 499 942 672 702 1.5 mm 556 724 590 854 681 1.8 mm 525 479 466 576 511 2.0 mm 574 483 527 452 509 3.0 mm — — — — — 40 μL 1.2 mm 567 517 556 638 570 1.5 mm 651 864 830 1350  924 1.8 mm 525 615 2426  561 1032  2.0 mm 489 512 1320  806 782 3.0 mm — — — — — 50 μL 1.2 mm 645 560 1336  593 783 1.5 mm 670 649 522 911 688 1.8 mm 635 531 580 664 602 2.0 mm 618 551 681 668 629 3.0 mm — — 1283  — 1283 

INDUSTRIAL APPLICABILITY

[0094] According to the invention, specific and rapid detection and quantification of a slight amount of a target nucleic acid contained in a dried blood spot in a filter paper by real-time PCR are enabled.