ALLOGENEIC CAR-T CELL, PREPARATION THEREFOR, AND APPLICATION THEREOF
20220313736 · 2022-10-06
Inventors
- Jun Li (Jiangsu, CN)
- Pengchao Zhang (Jiangsu, CN)
- Zhao Xu (Jiangsu, CN)
- Ling He (Jiangsu, CN)
- Weikang Liu (Jiangsu, CN)
- Yuchen Jiang (Jiangsu, CN)
- Hanxiao Qin (Jiangsu, CN)
- Yu Xia (Jiangsu, CN)
Cpc classification
C12N2740/15043
CHEMISTRY; METALLURGY
A61K35/17
HUMAN NECESSITIES
C12N2740/16043
CHEMISTRY; METALLURGY
C12N15/86
CHEMISTRY; METALLURGY
A61P35/00
HUMAN NECESSITIES
International classification
A61K35/17
HUMAN NECESSITIES
C12N15/86
CHEMISTRY; METALLURGY
Abstract
Provided is an engineered T cell. The expression level of an HLA class I molecule on the surface of the T cell is down-regulated to 10-50% of that of a non-engineered T cell. The expression of the T cell down-regulates a functional protein of the HLA class I molecule. The functional protein down-regulates at least one of HLA-A, HLA-B, and HLA-E molecules of the HLA class I molecule. The T cell may be an allogeneic CAR-T cell. Also provided is an application of the T cell or the allogeneic CAR-T cell.
Claims
1.-14. (canceled)
15. An engineered T cell, wherein the expression level of HLA class I molecules on the surface of the engineered T cell is partially inhibited after engineering.
16. The engineered T cell according to claim 15, wherein, the expression level of HLA class I molecules on the surface of the engineered T cell is reduced to 50% or less.
17. The engineered T cell according to claim 15, wherein the engineered T cell: (1) contains a coding sequence of a functional protein capable of down regulating HLA class I molecules on the cell surface; and/or (2) expresses a functional protein capable of down regulating HLA class I molecules on the cell surface.
18. The engineered T cell according to claim 17, wherein the functional protein down regulates at least one, two or all of three molecules of HLA-A, HLA-B and HLA-E.
19. The engineered T cell according to claim 15, wherein the engineered T cell further expresses a chimeric antigen receptor, which is a CAR-T cell.
20. The engineered T cell according to claim 19, wherein the CAR-T cell contains a coding sequence of the chimeric antigen receptor and a coding sequence of the functional protein.
21. The engineered T cell according to claim 20, wherein the CAR-T cell contains an expression frame of the chimeric antigen receptor and an expression frame of the functional protein, or the coding sequence of the chimeric antigen receptor and the coding sequence of the functional protein are in the same expression frame.
22. The engineered T cell according to claim 19, wherein, the chimeric antigen receptor specifically binds one or more tumor antigens selected from the group consisting of: EGFRvIII, mesothelin, gD2, Tn antigen, sTn antigen, Tn-O-glycopeptide, sTn-O-glycopeptide, PSMA, CD97, TAG72, CD44v6, CEA, EpCAM, KIT, IL-13RA2, Leguman, GD3, CD171, IL-11RA, PSCA, MAD-CT-1, MAD-CT-2, VEGFR2, LewisY, CD24, PDGFR-β, SSEA-4, folate receptor α, ERBB, HER2/neu, MUC1, EGFR, NCAM, Ephrin B2, CAIX, LMP2, SLE, HMWMAA, o-acetyl-GD2, folate receptor β, TEM1/CD248, TEM7R, FAP, Legumain, HPV E6 or E7, ML-IAP, CLDN6, TSHR, GPRC5d, ALK, polysialic acid, FOS related antigen, neutrophil elastase, TRP-2, CYP1B1, sperm protein 17, β Human chorionic gonadotropin, AFP, thyroglobulin, PLAC1, globoH, RAGE1, MN-CA IX, human telomerase reverse transcriptase, intestinal carboxylesterase, mut HSP 70-2, NA-17, NY-BR-1, UPK2, HAVCR1, ADRB3, PANX3, NY-ESO-1, GPR20, Ly6k, OR51E2, TARP, GFRα4 and the polypeptide fragments of any of these antigens presented on MHC, as well as CD5, CD10, CD19, CD20, CD21, CD22, CD23, CD24, CD25, CD27, CD30, CD34, CD37, CD38, CD40, CD53, CD69, CD72, CD73, CD74, CD75, CD77, CD79A, CD79B, CD80, CD81, CD82, CD83, CD84, CD85, CD86, CD123, CD135, CD138, CD179, CD269, Flt3, ROR1, BCMA, FcRn5, FcRn2, CS-1, CXCR4, CXCR5, CXCR7, IL-7/3R, IL-7/4/3R, and IL4R.
23. The engineered T cell according to claim 17, wherein, the functional proteins capable of down regulating the expression of HLA class I molecules on the cell surface are selected from HLA class I in HSV, BHV-1, EHV-1/4, PRV, HSV-1/2, VZV, EBV, HCMV, MCMV, RhCMV, HHV-6/7, KSHV, MHV-68, functional proteins that can directly target degrade HLA class I in cowpox virus and adenovirus, functional proteins that can down regulate the expression of HLA class I molecules through TAP protein and functional proteins that can down regulate the expression of HLA class I molecules through lysosomes.
24. The engineered T cell according to claim 23, wherein, the functional protein is selected from the group consisting of: proteins US11 and US6 from HCMV, protein UL49.5 from BHV-1, protein UL49.5 from EHV-1 and protein k5 from KSHV.
25. A nucleic acid molecule, wherein the nucleic acid molecule is selected from: (1) a nucleic acid molecules containing a coding sequence of a chimeric antigen receptor and a coding sequence of a functional protein capable of down regulating the expression of HLA class I molecules on the cell surface; and (2) a complementary sequence of the nucleic acid molecule of (1).
26. The nucleic acid molecule according to claim 25, wherein, the chimeric antigen receptor specifically binds one or more tumor antigens selected from the group consisting of: EGFRvIII, mesothelin, gD2, Tn antigen, sTn antigen, Tn-O-glycopeptide, sTn-O-glycopeptide, PSMA, CD97, TAG72, CD44v6, CEA, EpCAM, KIT, IL-13RA2, Leguman, GD3, CD171, IL-11RA, PSCA, MAD-CT-1, MAD-CT-2, VEGFR2, LewisY, CD24, PDGFR-β, SSEA-4, folate receptor α, ERBB, HER2/neu, MUC1, EGFR, NCAM, Ephrin B2, CAIX, LMP2, SLE, HMWMAA, o-acetyl-GD2, folate receptor β, TEM1/CD248, TEM7R, FAP, Legumain, HPV E6 or E7, ML-IAP, CLDN6, TSHR, GPRC5d, ALK, polysialic acid, FOS related antigen, neutrophil elastase, TRP-2, CYP1B1, sperm protein 17, β Human chorionic gonadotropin, AFP, thyroglobulin, PLAC1, globoH, RAGE1, MN-CA IX, human telomerase reverse transcriptase, intestinal carboxylesterase, mut HSP 70-2, NA-17, NY-BR-1, UPK2, HAVCR1, ADRB3, PANX3, NY-ESO-1, GPR20, Ly6k, OR51E2, TARP, GFRα4 and the polypeptide fragments of any of these antigens presented on MHC, as well as CDS, CD10, CD19, CD20, CD21, CD22, CD23, CD24, CD25, CD27, CD30, CD34, CD37, CD38, CD40, CD53, CD69, CD72, CD73, CD74, CD75, CD77, CD79A, CD79B, CD80, CD81, CD82, CD83, CD84, CD85, CD86, CD123, CD135, CD138, CD179, CD269, Flt3, ROR1, BCMA, FcRn5, FcRn2, CS-1, CXCR4, CXCR5, CXCR7, IL-7/3R, IL-7/4/3R, and IL4R, and the functional protein are selected from the group consisting of: HLA class I in HSV, BHV-1, EHV-1/4, PRV, HSV-1/2, VZV, EBV, HCMV, MCMV, RhCMV, HHV-6/7, KSHV, MHV-68, functional proteins that can directly target degrade HLA class I in cowpox virus and adenovirus, functional proteins that can down regulate the expression of HLA class I molecules through TAP protein and functional proteins that can down regulate the expression of HLA class I molecules through lysosomes.
27. A nucleic acid construct, wherein the nucleic acid construct contains the nucleic acid molecule according to claim 26.
28. The nucleic acid construct according to claim 27, wherein, the nucleic acid construct comprises an expression frame of the chimeric antigen receptor and an expression frame of the functional protein; or the nucleic acid construct is an expression frame, wherein the coding sequence of the chimeric antigen receptor and the coding sequence of the functional protein are in the expression frame; or the nucleic acid construct is a cloning vector or an expression vector.
29. A lentivirus containing the nucleic acid construct according to claim 26.
30. A host cell containing the nucleic acid molecule according to claim 25.
31. A pharmaceutical composition, wherein the pharmaceutical composition contains the engineered T cells according to claim 15.
32. A method of reducing expression of HLA class I molecules on the T cell surface, comprising introducing a coding sequence of a functional protein capable of down regulating HLA class I molecules on the cell surface into T cell; and/or expressing a functional protein capable of down regulating HLA class I molecules on the cell surface in the T cell, wherein the functional protein are selected from the group consisting of: HLA class I in HSV, BHV-1, EHV-1/4, PRV, HSV-1/2, VZV, EBV, HCMV, MCMV, RhCMV, HHV-6/7, KSHV, MHV-68, functional proteins that can directly target degrade HLA class I in cowpox virus and adenovirus, functional proteins that can down regulate the expression of HLA class I molecules through TAP protein and functional proteins that can down regulate the expression of HLA class I molecules through lysosomes.
33. The method according to claim 32, wherein the T cells are CAR-T cells.
34. A method for preventing or treating cancer or tumor of a patient, comprising administering a therapeutically effective amount of the cell according to claim 15 to a patient with cancer or tumor.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
[0046]
[0047]
[0048]
[0049]
[0050]
[0051]
[0052]
[0053]
DETAILED DESCRIPTION
Embodiments
[0054] It should be understood that within the scope of the disclosure, the above technical features of the disclosure and the technical features specifically described below (according to the examples) can be combined with each other to form a preferred technical solution.
[0055] Because gene editing technology can efficiently and completely eliminate the expression of one or more targeted genes at the genomic level, they have quickly become the mainstream technical means for preparing allogeneic CAR-T to completely knockout the expression of TCR and HLA class I molecules of allogeneic CAR-T cells, which is expected to effectively prevent GVHD and host rejection in clinic.
[0056] The basic principle of preparing allogeneic T cells by gene editing is: producing site-specific double strand break (DSB) at specific positions of the genome (such as TCR gene and HLA class I molecular chaperone b2m gene), and then repairing it by non-homologous end joining (NHEJ) or homology directed recombination repair (HDR), thereby resulting in the complete deletion of targeted genes (such as TCR and b2m genes), which is designed to fundamentally avoid GVHD and host immune cell-mediated rejection of allogeneic CAR-T cells.
[0057] However, so far, allogeneic CAR-T cells based on gene editing technology have not shown the same therapeutic advantages as autologous CAR-T cells in clinical trials. In-depth studies have found that allogeneic CAR-T cells produced by gene editing have poor persistence in patients, one of the reasons is that b2m gene knockout leads to the lack of the expression of all HLA class I molecules, especially HLA-A, HLA-B and HLA-E in allogeneic CAR-T cells. The allogeneic CAR-T cells are prone to attack by patient's autoimmune cells, which seriously affects the persistence and efficacy of allogeneic CAR-T in patients (Torikai et al. 2013).
[0058] In order to prolong the in vivo persistence of reinfused allogeneic CAR-T cells, Precision Biosciences used Arcus genome editing technology to knockout only TCR gene, but did not edit b2m gene (i.e. without changing the expression of HLA class I molecules on the surface of CAR-T cells). Therefore, its allogeneic CAR-T cells express normal HLA class I molecules. After the first and second dose climbing tests, it submitted a clinical amendment of allogeneic CAR-T to FDA in early 2020, applied for enhancing the chemotherapy pretreatment before reinfusion, and applied for significantly increasing the reinfusion dose of allogeneic CAR-T cells in order to achieve the expected therapeutic effect.
[0059] Cellectis and Allogene Therapeutics used TALEN gene editing technology to knockout TCR and CD52 genes of donor T cells (i.e. without changing the expression of HLA class I molecules on the surface of CAR-T cells), and then combine it with anti-CD52 monoclonal antibody to utilize its lymph elimination activity in order to inhibit the rejection of patient immune cells to allogeneic CAR-T cells.
[0060] Obviously, those skilled in the art are facing an insurmountable dilemma; on one hand, without changing the expression of HLA class I molecules, the risk of attack by the patient's immune system on CAR-T cells remains; on the other hand, the loss of expression of HLA class I molecules caused by gene editing cannot eliminate the attack of the patient's immune system on CAR-T cells; through these studies, those skilled in the art come to a frustrating logical conclusion that regulating the expression of HLA class I molecules cannot eliminate the risk of attack by the patient's immune system on CAR-T cells. Cellectis and Allogene Therapeutics, without changing the expression of HLA class I molecules on the surface of CAR-T cells, removed the attack by the patient's immune system on CAR-T cells through the deletion of CD52 gene of CAR-T cells and then use of anti-CD52 antibody, which is an attempt to get out of the dilemma that also further proves this frustrating logical conclusion.
[0061] Viruses regulate HLA molecules of host cells through some viral proteins to achieve immune escape. However, it is generally considered in the art that viral proteins cannot completely inhibit the expression of HLA (0%), so viral proteins would not provide ideal effects to CAR-T cells. On the contrary, after years of deep and persistent research, the inventor of the disclosure and his research team unexpectedly found that when the expression level of HLA class I molecules on the surface of allogeneic T cells (especially CAR-T cells) are partially inhibited, it has an unexpected technical effect, that is, it is neither attacked by host T cells nor NK cells, which can perfectly eliminate the risk of attack of the patient's immune system on T cells (especially CAR-T cells).
[0062] Further, the allogeneic T cells prepared by the method of the disclosure express a certain amount of HLA class I molecules on the surface, which can eliminate the rejection of the patient's immune system to allogeneic T cells, and have an excellent therapeutic effect. More specifically, the allogeneic CAR-T cells prepared by the method of the disclosure express a certain amount of HLA class I molecules on the surface, which can eliminate the patient's immune system to allogeneic CAR-T cells, and have an excellent therapeutic effect. In some embodiments, the expression level of HLA class I molecules on the surface of allogeneic T cells (especially CAR-T cells) is down regulated to 10-50%, 10-45%, 10-40%, 15-50%, or 20-50%, or 20-45%.
[0063] In some embodiments, the expression level of HLA class I molecules on the surface of allogeneic T cells (especially CAR-T cells) is down regulated by knocking down the target polynucleotide sequence or a portion thereof through siRNA, shRNA, microRNA, antisense RNA or other RNA mediated inhibition techniques. The targets of siRNA, shRNA, microRNA, antisense RNA or other RNA mediated inhibition techniques are selected from HLA class I molecule signaling pathway related proteins.
[0064] In some embodiments, the expression level of HLA class I molecules on the surface of allogeneic CAR-T cells is down regulated with compound molecules, and the compound molecule target is selected from HLA class I molecule signaling pathway related proteins.
[0065] In some embodiments, the expression level of HLA class I molecules on the surface of allogeneic CAR-T cells is down regulated by expressing at least one functional protein that down regulates HLA class I molecules. The functional proteins include but are not limited to:
[0066] UL49.5 or those having at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% homology with UL49.5; UL49.5 is from BHV-1 (SEQ ID No: 8) or EHV-1/4 (SEQ ID No: 9), which can induce conformational arrest of TAP, or induce conformational arrest and degradation of TAP, or block the binding of ATP and TAP, so as to inhibit the expression of MHC-I molecules on the cell surface. The results were verified on bovine renal cells and equine epidermal cells respectively (Koppers-Lalic et al. 2008);
[0067] ICP47 (SEQ ID No: 10), or a variant of ICP47, which has at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% homology with SEQ ID No: 10; ICP47 is from HSV-1/2, which can bind and block the peptide binding site of TAP, thereby inhibiting the expression of MHC-I molecules on the cell surface. This result has been verified on human cervical cancer cells (Fruh et al. 1995);
[0068] BNLF2a (SEQ ID No: 11), or a variant of BNLF2a, which has at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% homology with SEQ ID No: 11; BNLF2a is from EBV, which can block the binding of peptide and ATP to TAP, thereby inhibiting the expression of MHC-I molecules on the cell surface. This result has been verified on human melanoma cells (Hislop et al. 2007);
[0069] US2/gp24 (SEQ ID No: 12), or a variant of US2/gp24, which has at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% homology with SEQ ID No: 12; US3/gp23 (SEQ ID No: 13), or a variant of US3/gp23, which has at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% homology with SEQ ID No: 13; US6/gp21 (SEQ ID No: 14), or a variant of US6/gp21, which has at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% homology with SEQ ID No: 14; US11/gp33 (SEQ ID No: 15), or a variant of US11/gp33, which has at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% homology with SEQ ID No: 15; US2/gp24, US3/gp23, US6/gp21 and US11/gp33 are from HCMV, which can respectively target MHC I to cause endoplasmic reticulum mediated protein degradation, bind methionine and inhibit methionine dependent peptide loading, induce TAP conformational changes to prevent ATP binding, and target MHC-I to cause endoplasmic reticulum mediated protein degradation, thereby inhibiting the expression of MHC-I molecules on the cell surface. The results were verified on Chinese hamster ovary cells, human myeloid leukemia cells, human lung tumor cells and human astrocytoma cells (Wiertz et al. 1996, Park et al. 2004, Hewitt et al. 2001);
[0070] rh178/VIHCE (SEQ ID No: 16), or a variant of rh178/VIHCE, which has at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% homology with SEQ ID No: 16; Rh178/VIHCE is from RhCMV, which inhibits the translation of MHC-I HC in a signal peptide dependent manner, thereby inhibiting the expression of MHC-I molecules on the cell surface. This result has been verified on human fibroblasts (Powers et al. 2008);
[0071] kK3/MIR1 (SEQ ID No: 17), or a variant of kK3/MIR1, which has at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% homology with SEQ ID No: 17; kK5/MIR2 (SEQ ID No: 18), or a variant of kK5/MIR2, which has at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% homology with SEQ ID No: 18; kK3/MIR1 and kK5/MIR2 are from KSHV, which ubiquitinate MHC-I to be internalized and degraded by lysosomes, thereby inhibiting the expression of MHC-I molecules on the cell surface. This result has been verified on human cervical cancer cells (Coscoy et al. 2005);
[0072] mK3 (SEQ ID No: 19), or a variant of mK3, which has at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% homology with SEQ ID No: 19; mK3 is from MHV-68, which can ubiquitinate MHC-I HC to be retained in Golgi apparatus, thereby inhibiting the expression of MHC-I molecules on cell surface. This result has been verified in murine fibroblasts (Wang et al. 2006);
[0073] CPXV012 (SEQ ID No: 20), or a variant of CPXV012, which has at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% homology with SEQ ID No: 20; CPXV203 (SEQ ID No: 21), or a variant of CPXV203, which has at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% homology with SEQ ID No: 21; CPXV012 and CPXV203 come from cowpox virus, which can inhibit peptide transport by inhibiting the binding of ATP and TAP, and retain MHC-I in ER, respectively, thereby inhibiting the expression of MHC-I molecules on the cell surface. This result has been verified on human melanoma cells (Luteijn et al. 2014);
[0074] E3-19K (SEQ ID No: 22), or a variant of E3-19K, which has at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% homology with SEQ ID No: 22; E3-19K is from adenovirus, which can retain MHC-I in ER, thereby inhibiting the expression of MHC-I molecules on the cell surface. This result has been verified on human renal epithelial cells (Burgert et al. 1985).
[0075] Although the above functions of HLA class I down-regulating proteins partially inhibit the expression of HLA class I molecules in specific cell types of specific species or natural susceptible cells, it remains unknown whether to the expression of HLA class I molecules is down regulated in target cell types (such as T cells) of target species (such as human), and even in the situation wherein chimeric antigen receptor (CAR) is expressed in T cells at the same time. In one or more embodiments, mK3 of MHV-68, US3/gp23 of hCMV, CPXV012 of cowpox virus, rh178/VIHCE of RhCMV and E3-19K of adenovirus failed to show the ability to down regulate HLA class I molecules in T cells. In one or more embodiments, the inventor found that a plurality of cross species viruses showed an unexpected effect of down regulating HLA class I molecules in human T cells, such as EHV-1 (equine Rhinopneumonia virus) UL49.5, etc.
[0076] The disclosure down regulates HLA class I molecules on the cell surface by expressing HLA class I down regulating functional protein and preparing engineered T cells capable of inhibiting the expression of HLA class I molecules on the cell surface; one type of the engineered T cells is allogeneic CAR-T cells. In the CAR-T cells prepared by the method of the disclosure, the expression of HLA class I molecules is not completely inhibited, and these T cells still express a certain amount of HLA class I molecules on the cell surface, so it can well avoid the attack by patient's immune cells and solve the rejection reaction of receptors. Preferably, by flow cytometry, the expression level of HLA class I molecules in the engineered T cells of the disclosure is less than 80%, preferably less than 60%, more preferably less than 50%, more preferably less than 30%, more preferably less than 25% of the expression level of HLA class I molecules when the functional protein is not expressed. In some embodiments, by flow cytometry, the expression level of HLA class I molecules in the engineered T cells of the disclosure is 10-50%, such as 15-50% of the expression level of HLA class I molecules when the functional protein is not expressed. In some embodiments, even after stimulation with the same target cell, the expression level of HLA class I molecules in the engineered T cells of the disclosure is still 10-50%, such as 15-50% of the expression level of HLA class I molecules when the functional protein is not expressed.
[0077] Therefore, the disclosure provides a class of CAR-T cells, which contain nucleic acid molecules encoding chimeric antigen receptors (CARs) targeting tumor antigens of interest and nucleic acid molecules encoding functional proteins capable of down regulating the expression of HLA class I molecules on the cell surface. In this disclosure, suitable T cells can be various T cells known in the art, especially various T cells commonly used in cellular immunotherapy, including but not limited to peripheral blood T lymphocytes, cytotoxic T cells, helper T cells, inhibitory/regulatory T cells, γδT cells, cytokine induced killer cells and tumor infiltrating lymphocytes, as well as mixtures of any one or more of above cells. In this disclosure, CAR-T cells refer to T cells that express at least chimeric antigen receptors.
[0078] In this disclosure, chimeric antigen receptor has a well-known meaning in the art. It is an artificially modified receptor, which can anchor specific molecules (such as antibodies) that recognize tumor cell surface antigens on immune cells (such as T cells), so that the immune cells can recognize tumor antigens and kill tumor cells.
[0079] The suitable chimeric antigen receptor in this disclosure can be various CARs well known in the art. Generally, CAR contains a polypeptide binding to tumor antigen, hinge region, transmembrane region and intracellular signaling region in turn. The polypeptide binding to tumor antigen can be a natural polypeptide or synthetic polypeptide; preferably, the synthetic polypeptide is a single chain antibody or Fab fragment.
[0080] In this disclosure, tumor antigens of interest include, but are not limited to, solid tumor antigens, myeloid tumor antigens, and antigens of non-B-cell lineage blood tumors. Suitable solid tumor antigens include but are not limited to EGFRvIII, mesothelin, gD2, Tn antigen, sTn antigen, Tn-O-glycopeptide, sTn-O-glycopeptide, PSMA, CD97, TAG72, CD44v6, CEA, EpCAM, KIT, IL-13RA2, Leguman, GD3, CD171, IL-11RA, PSCA, MAD-CT-1, MAD-CT-2, VEGFR2, LewisY, CD24, PDGFR-β, SSEA-4, folate receptor α, ERBB, HER2/neu, MUC1, EGFR, NCAM, Ephrin B2, CAIX, LMP2, SLE, HMWMAA, o-acetyl-GD2, folate receptor β, TEM1/CD248, TEM7R, FAP, Legumain, HPV E6 or E7, ML-IAP, CLDN6, TSHR, GPRC5d, ALK, polysialic acid, FOS related antigen, neutrophil elastase, TRP-2, CYP1B1, sperm protein 17, β Human chorionic gonadotropin, AFP, thyroglobulin, PLAC1, globoH, RAGE1, MN-CA IX, human telomerase reverse transcriptase, intestinal carboxylesterase, mut HSP 70-2, NA-17, NY-BR-1, UPK2, HAVCR1, ADRB3, PANX3, NY-ESO-1, GPR20, Ly6k, 0101E2, TARP, GFRα4 and the polypeptide fragments of any of these antigens presented on MHC. Suitable B cell antigens include, but are not limited to, CD5, CD10, CD19, CD20, CD21, CD22, CD23, CD24, CD25, CD27, CD30, CD34, CD37, CD38, CD40, CD53, CD69, CD72, CD73, CD74, CD75, CD77, CD79A, CD79B, CD80, CD81, CD82, CD83, CD84, CD85, CD86, CD123, CD135, CD138, CD179, CD269, FLT3, ROR1, BCMA, FcRn5, FcRn2, CS-1, CXCR4, CXCR5, CXCR7, IL-7/3R, IL7/4/3R, and IL4R.
[0081] In a preferred embodiment, the polypeptide binding to the tumor antigen of the disclosure is a single chain antibody specifically binding to any of the above tumor antigens. In this disclosure, single chain antibody (scFv) refers to an antibody fragment with antigen binding ability formed by hinge connection of an amino acid sequence of antibody light chain variable region (VL region) and an amino acid sequence of heavy chain variable region (VH region). scFvs of interest may be from antibodies of interest. Antibodies of interest may be human antibodies, including human murine chimeric antibodies and humanized antibodies. The antibody can be secretory or membrane anchored, preferably membrane anchored. In this disclosure, specific binding refers to the reaction between an antibody or its antigen binding fragment and its target antigen. In some embodiments, an antibody that specifically binds to an antigen (or an antibody that is specific to an antigen) means that the antibody binds to the antigen with an affinity (KD) of less than about 10.sup.−5 M, such as less than about 10.sup.−6 M, 10.sup.−7 M, 10.sup.−8 M, 10.sup.−9 M or 10.sup.10 M or less.
[0082] A single chain antibody may contain a heavy chain variable region and a light chain variable region of the antibody of interest, or consist of a heavy chain variable region, a light chain variable region and an optional linker. The heavy chain variable region and the light chain variable region can be connected by a well-known linker. In this disclosure, the linker or hinge is a polypeptide fragment connecting different proteins or polypeptides, of which the purpose is to keep the connected proteins or polypeptides in their respective spatial conformations, so as to maintain the function or activity of proteins or polypeptides. Exemplary linkers include linkers containing G and/or S, and Furin 2A peptide (F2A). The length of the linker can be 3-25 amino acid residues, such as 3-15, 5-15, 10-20 amino acid residues. In some embodiments, the linker sequence is a polyglycine linker sequence. The number of glycine in the linker sequence is not particularly limited, usually is 2-20, such as 2-15, 2-10 and 2-8. In addition to glycine and serine, the linker may also contain other known amino acid residues, such as alanine (A), leucine (L), threonine (T), glutamate (E), phenylalanine (F), arginine (R), glutamine (Q), etc. The linker length is usually 15-20 amino acids. In some embodiments, the linker is (GGGS).sub.n, and n is an integer of 1-5.
[0083] In some embodiments, the tumor antigen of interest is CD19, and the scFv of interest is a scFv that specifically binds to CD19. The amino acid sequence of an exemplary scFv that specifically binds to CD19 is shown as amino acid residues 23-267 of SEQ ID No: 2, wherein the heavy chain variable region and the light chain variable region are connected by a linker sequence containing G and S.
[0084] Other parts contained in CAR, such as hinge region, transmembrane region and intracellular signaling region, can be hinge region, transmembrane region and intracellular signaling region conventionally used to construct various CARs.
[0085] In this disclosure, the hinge region refers to the region between the functional regions of immunoglobulin heavy chain CH1 and CH2, which is rich in proline, does not form α-helix, and is easy to stretch and twist to a certain extent, which is conducive to the complementary binding between the antigen binding site of the antibody and the antigen epitope. The suitable hinge region in this disclosure can be selected from CD8 extracellular hinge region, IgG1 FC CH2CH3 hinge region, IgD hinge region, CD28 extracellular hinge region, IgG4 FC CH2CH3 hinge region and CD4 extracellular hinge region. In some embodiments, CD8a hinge region is used herein.
[0086] In this disclosure, the transmembrane region can be selected from one or more of CD28 transmembrane region, CD8 transmembrane region and CD3t transmembrane region, CD134 transmembrane region, CD137 transmembrane region, ICOS transmembrane region and DAP10 transmembrane region. Preferably, the transmembrane region of the chimeric antigen receptor used herein is CD8 transmembrane region. The amino acid sequences of the exemplary hinge region and transmembrane region can be shown as amino acid residues 268-336 of SEQ ID No: 2.
[0087] In this disclosure, the intracellular signal region can be selected from any one or more intracellular signaling regions of CD28, CD134/OX40, CD137/4-1BB, LCK, ICOS, DAP10 and CD3ζ and Fc310, preferably 4-1BB intracellular signaling region and CD3ζ intracellular signaling region. The amino acid sequence of the exemplary intracellular signaling region in this disclosure can be shown as amino acid residues 337-490 of SEQ ID No: 2.
[0088] The chimeric antigen receptor may also include a signal peptide. A signal peptide is a short peptide chain (5-30 amino acids in length) that guides the transfer of newly synthesized proteins to the secretory pathway. It often refers to the N-terminal amino acid sequence used to guide the transmembrane transfer (localization) of proteins in the newly synthesized peptide chain. The signal peptide can be a membrane protein signal peptide, such as CD8 signal peptide, CD28 signal peptide and CD4 signal peptide. An exemplary signal peptide amino acid sequence may be shown as amino acid residues 1-22 of SEQ ID No: 2.
[0089] Therefore, the amino acid sequence of the chimeric antigen receptor of the disclosure, from the N-end to the C-end, is usually an optional signal peptide, a single chain antibody targeting the heavy chain antigen of interest, a hinge region, a transmembrane region and an intracellular signaling region. The amino acid sequence of an exemplary chimeric antigen receptor may be shown as amino acid residues 23-490 of SEQ ID No: 2, or as amino acid residues 1-490 of SEQ ID No: 2.
[0090] The above parts forming the chimeric antigen receptor herein, such as signal peptide, light chain variable region and heavy chain variable region of single chain antibody, hinge region, transmembrane region and intracellular signaling region, can be directly connected with each other, or can be connected through linker sequences well known in the art, such as G and S-containing linker sequences described above.
[0091] In this disclosure, the functional protein capable of down regulating the expression of HLA class I molecules on the cell surface can be a protein from a virus, preferably a protein from a virus whose natural host cell is not a T cell. Although HIV-1 is the natural host of T cells, and HIV-1 nef virus protein can down regulate the expression of HLA class I molecules on the surface of T cells, the introduction of HIV-1 nef protein into lentivirus to prepare CAR-T will cause RCL (replication competent lentivirus). Therefore, the disclosure preferably uses viral proteins such as those from HSV, BHV-1, EHV-1/4, PRV, HSV-1/2, VZV, EBV, HCMV, MCMV, RhCMV, HHV-6/7, KSHV, MHV-68, cowpox virus and adenovirus, including but not limited to: UL41/VHS protein from HSV, UL49.5 from BHV-1, EHV-1/4 or PRV, ICP47 from HSV-1/2, ORF66 from VZV, EBNA1, BNLF2a, BGLF5 and BILF1 from EBV, US2/gp24, US3/gp23, US6/gp21, US10 and US11/gp33 from hCMV, m4/gp34, m6/gp48, m27 and m152/gp40 from mCMV, rh178/VIHCE from RhCMV, U21 and LANAI from HHV-6/7, ORF37/SOX, kK3/MIR1 and kK5/MIR2 from KSHV, mK3 from MHV-68, CPXV012 and CPXV203 from cowpox virus, and E3-19K from adenovirus.
[0092] The preferred functional protein is a functional protein that can directly target degrade HLA class I molecules, or a functional protein that can down regulate the expression of HLA class I molecules through TAP proteins (such as inhibiting TAP, including preventing TAP proteins from binding ATP and/or inducing TAP protein degradation), or a functional protein that can down regulate the expression of HLA class I molecules through lysosomes. Exemplary preferred proteins include, but are not limited to, viral proteins from HCMV, such as US11 and US6, viral proteins from BHV-1, such as UL49.5, viral proteins from EHV-1, such as UL49.5, and viral proteins from KSHV, such as k5. In some embodiments, the disclosure uses UL49.5 from EHV-1, and its amino acid sequence can be shown as amino acid residues 516-615 of SEQ ID No: 2.
[0093] The viral protein can be connected to the CAR of the disclosure through a linker commonly used in the art. For example, in some embodiments, the linker is a conventional F2A sequence. The amino acid sequence of an exemplary F2A may be shown as amino acid residues 494-515 of SEQ ID No: 2. F2A can also be connected to CAR through conventional linkers containing G and S.
[0094] The nucleic acid molecule of the disclosure can be in the form of DNA or RNA. DNA forms include cDNA, genomic DNA or synthetic DNA. DNA can be single stranded or double stranded. The nucleic acid molecule of the disclosure can be the coding sequence of CAR and the coding sequence of functional protein capable of down regulating the expression of HLA class I molecules on the cell surface, or the expression frame of CAR and the expression frame of the functional protein. In this disclosure, the coding sequence refers to the part of the nucleic acid sequence that directly determines the amino acid sequence of its protein product (such as CAR, single chain antibody, hinge region, transmembrane region, intracellular signaling region, viral protein or its fusion protein, etc.). The boundary of the coding sequence is usually determined by the ribosome binding site immediately upstream of the mRNA 5′ open reading frame (for prokaryotic cells) and the transcription termination sequence immediately downstream of the mRNA 3′ open reading frame. Coding sequences may include, but are not limited to, DNA, cDNA and recombinant nucleic acid sequences. In this disclosure, the expression frame refers to the complete elements required to express the gene of interest, including promoter, gene coding sequence and polyA tailing signal sequence. The nucleic acid molecule described herein can be two independent nucleic acid molecules, respectively containing the coding sequence of CAR and the coding sequence of the functional protein, such as the expression frame of CAR and the expression frame of functional protein; alternatively, the coding sequence containing CAR and the coding sequence of the functional protein can be connected in one nucleic acid molecule through a linker, for example, the coding sequence of CAR and the coding sequence of the functional protein are in the same expression frame, or the two expression frames are connected into the same nucleic acid molecule through a suitable linker. In some embodiments, the nucleic acid molecule of the disclosure is a nucleic acid molecule in which the coding sequence of CAR and the coding sequence of functional protein are in the same expression frame, which contains a promoter, a nucleic acid sequence encoding the chimeric antigen receptor and a functional protein, and a polyA tailing signal.
[0095] In some embodiments, the coding sequence or expression frame is integrated into the genome of CAR-T cells. Therefore, in these embodiments, the genome of CAR-T cells described herein is stably integrated with an expression frame encoding CAR and functional protein described herein.
[0096] In some embodiments, the nucleic acid molecule is a nucleic acid construct containing the coding sequences of CAR and/or functional protein described herein, and one or more regulatory sequences operably connected to these sequences. The regulatory sequence can be a suitable promoter sequence. The promoter sequence is usually operably linked to the coding sequence of the protein to be expressed. The promoter may be any nucleotide sequence exhibiting transcriptional activity in the selected host cell, including mutant, truncated and heterozygous promoters, and may be obtained from genes encoding extracellular or intracellular polypeptides homologous or heterologous to the host cell. The regulatory sequence can also be a suitable transcription terminator sequence recognized by the host cell to terminate transcription. The terminator sequence is operably linked to the 3′ end of the nucleotide sequence encoding the polypeptide. Any terminator that functions in the selected host cell can be used in this disclosure.
[0097] In some embodiments, the nucleic acid construct is a vector. The vector can be a cloning vector, expression vector or homologous recombination vector. Specifically, the coding sequences of CAR and/or functional protein herein can be cloned into many types of vectors, including but not limited to plasmids, phages, phage derivatives, animal viruses and cosmids. The cloning vector can be used to provide the coding sequences of CAR and functional protein of the disclosure, such as a nucleic acid molecule containing the coding sequence of CAR and the coding sequence of functional protein. Expression vectors can be provided to cells in the form of viral vectors. Viruses that can be used as vectors include but are not limited to retroviruses, adenoviruses, adeno-associated viruses, herpesviruses and lentiviruses. The homologous recombinant vector is used to integrate the expression frame described herein into the host genome.
[0098] In general, a suitable vector includes a replication starting point, a promoter sequence, a convenient restriction site, and one or more selectable markers that function in at least one organism. For example, when a retroviral vector is used, the retroviral vector usually contains a replication start site, 3′LTR, 5′LTR, the coding sequence of the fusion protein described herein, and an optional selectable marker.
[0099] Suitable promoters include but are not limited to immediate early cytomegalovirus (CMV) promoter sequence, extended growth factor-1 (EF-1), simian virus 40 (SV40) early promoter, mouse breast cancer virus (MMTV), human immunodeficiency virus (HIV) long terminal repeat (LTR) promoter, MoMuLV promoter, avian leukemia virus promoter, EB virus immediate early promoter, Rutherford sarcoma virus promoter, and human gene promoter, such as but not limited to actin promoter, myosin promoter, heme promoter and creatine kinase promoter.
[0100] Selectable markers include any or both of selectable marker genes or reporter genes to facilitate the identification and selection of expressing cells from cell populations infected with viral vectors. Useful selectable marker genes include, for example, antibiotic resistance genes, such as neo. Suitable reporter genes may include genes encoding luciferase, β-galactosidase, chloramphenicol acetyltransferase, secretory alkaline phosphatase or green fluorescent protein.
[0101] The nucleic acid molecules described herein can usually be obtained by PCR amplification. Specifically, primers can be designed according to the nucleotide sequences disclosed herein, and the relevant sequences can be amplified by using a commercially available cDNA library or a cDNA library prepared by a conventional method known to those skilled in the art as a template. When the sequence is long, two or more PCR amplification is often required, and then the amplified fragments are spliced together in the correct order. Alternatively, the nucleic acid molecules described herein may be synthesized directly.
[0102] The nucleotide sequence of an exemplary nucleic acid molecule containing the coding sequence of CAR and functional protein can be shown in SEQ ID No: 1. The nucleic acid molecules (especially vectors) described herein can be introduced into host cells by conventional methods, including microinjection, gene gun, electroporation, virus mediated transformation, electron bombardment, calcium phosphate precipitation, etc.
[0103] As described herein, the host cell contains the nucleic acid molecules described herein. Host cells include not only T cells ultimately used for disease treatment purposes, but also various cells used in the production of CAR-T cells, such as E. coli cells, for providing the coding sequence of the protein of the disclosure or the vector described herein. In some embodiments, a CAR-T cell stably expressing the functional protein described herein is provided herein.
[0104] The nucleic acid molecules described herein are also included herein. As described above, the nucleic acid molecules described herein can be prepared by conventional methods in the art. In some embodiments, this disclosure also includes a lentivirus, which includes the expression frame described herein and can integrate the expression frame described herein into the genome of the host cell. The lentivirus described herein can be prepared by a method well known in the art. For example, a lentivirus vector containing the expression frame described herein is prepared firstly, then the virus is packaged in a suitable host cell, and the required lentivirus is isolated and purified. The reagents used for lentivirus packaging are well known in the art. For example, the conventional lentivirus vector system (Tronolab) includes pRsv-REV, pMD1g-pRRE, pMD2G and target interference plasmid.
[0105] This paper also includes a CAR-T cell culture containing the CAR-T cells described herein and a suitable medium. The culture medium may be a culture medium conventionally used in the art for culturing CAR-T cells.
[0106] The disclosure also provides a pharmaceutical composition containing CAR-T cells and pharmaceutically acceptable excipients. In this disclosure, pharmaceutically acceptable excipients refer to carriers and/or excipients that are pharmacologically and/or physiologically compatible with subjects and active ingredients, including but not limited to pH regulators, surfactants, adjuvants and ionic strength enhancers. More specifically, suitable pharmaceutically acceptable excipients can be excipients commonly used in CAR-T cell administration in the art.
[0107] Generally, the pharmaceutical composition contains a therapeutically effective amount of CAR-T cells. Therapeutic effective dose refers to the dose that can treat, prevent, reduce and/or alleviate diseases or conditions in a subject. The effective amount of treatment can be determined according to the patient's age, gender, disease and its severity, other physical conditions and other factors. In this disclosure, subjects or patients usually refer to mammals, especially humans.
[0108] In this disclosure, diseases suitable for treatment using the nucleic acid molecules, CAR-T cells and pharmaceutical compositions described herein are related to single chain antibodies in the chimeric antigen receptors expressed by the nucleic acid molecules and CAR-T cells. Therefore, the diseases described herein include various types of cancer related to tumor antigens mentioned above, including solid tumors and hematologic tumors, such as adenocarcinoma, lung cancer, colon cancer, colorectal cancer, breast cancer, ovarian cancer, cervical cancer, gastric cancer, cholangiocarcinoma, gallbladder cancer, esophageal cancer, pancreatic cancer and prostate cancer, and other solid tumors, and leukemia and lymphoma, such as B cell lymphoma, mantle cell lymphoma, acute lymphocytic leukemia, chronic lymphocytic leukemia, hairy cell leukemia and acute myeloid leukemia, etc.
[0109] In some embodiments, a kit containing the vector described herein is also provided. The kit may also contain various reagents suitable for transfecting the vector into cells and optional instructions for guiding those skilled in the art to transfect the recombinant expression vector into cells.
[0110] The disclosure also provides a method of treatment of diseases, which includes the step of administrating a therapeutic effective amount of engineered T cells described in any embodiment herein to a subject in need thereof. According to the existing cellular immunotherapy, the drug can be administered in an appropriate way (such as intravenous infusion) according to the patient's disease, severity, age, gender and other factors. In some embodiments, the engineered T cells are CAR-T cells described in any embodiment herein. Preferably, the disease is the disease described in any embodiment herein.
[0111] The disclosure comprises the following embodiments:
[0112] Item 1. A CAR-T cell, wherein the CAR-T cell expresses a chimeric antigen receptor and a functional protein capable of down regulating the expression of HLA class I molecules on the cell surface; preferably, the expression level of HLA class I molecules on the surface of the CAR-T cells expressing the chimeric antigen receptor and the functional protein is less than 50% of that of the control CAR-T cells expressing the same chimeric antigen receptor but not the functional protein.
[0113] Item 2. The CAR-T cell according to Item 1, wherein the CAR-T cell contains a coding sequence of the chimeric antigen receptor and a coding sequence of the functional protein; preferably, the CAR-T cell contains an expression frame of the chimeric antigen receptor and an expression frame of the functional protein, or the coding sequence of the chimeric antigen receptor and the coding sequence of the functional protein are in the same expression frame.
[0114] Item 3. CAR-T cells according to Item 1 or 2, wherein,
[0115] The chimeric antigen receptor specifically binds one or more of the following tumor antigens selected from the group consisting of EGFRvIII, mesothelin, gD2, Tn antigen, sTn antigen, Tn-O-glycopeptide, sTn-O-glycopeptide, PSMA, CD97, TAG72, CD44v6, CEA, EpCAM, KIT, IL-13RA2, Leguman, GD3, CD171, IL-11RA, PSCA, MAD-CT-1, MAD-CT-2, VEGFR2, LewisY, CD24, PDGFR-β, SSEA-4, folate receptor α, ERBB, HER2/neu, MUC1, EGFR, NCAM, Ephrin B2, CAIX, LMP2, SLE, HMWMAA, o-acetyl-GD2, folate receptor β, TEM1/CD248, TEM7R, FAP, Legumain, HPV E6 or E7, ML-IAP, CLDN6, TSHR, GPRC5d, ALK, polysialic acid, FOS related antigen, neutrophil elastase, TRP-2, CYP1B1, sperm protein 17, β Human chorionic gonadotropin, AFP, thyroglobulin, PLAC1, globoH, RAGE1, MN-CA IX, human telomerase reverse transcriptase, intestinal carboxylesterase, mut HSP 70-2, NA-17, NY-BR-1, UPK2, HAVCR1, ADRB3, PANX3, NY-ESO-1, GPR20, Ly6k, OR51E2, TARP, GFRα4 and the polypeptide fragments of any of these antigens presented on MHC, as well as CD5, CD10, CD19, CD20, CD21, CD22, CD23, CD24, CD25, CD27, CD30, CD34, CD37, CD38, CD40, CD53, CD69, CD72, CD73, CD74, CD75, CD77, CD79A, CD79B, CD80, CD81, CD82, CD83, CD84, CD85, CD86, CD123, CD135, CD138, CD179, CD269, Flt3, ROR1, BCMA, FcRn5, FcRn2, CS-1, CXCR4, CXCR5, CXCR7, IL-7/3R, IL-7/4/3R, and IL4R; or
[0116] The functional proteins capable of down regulating the expression of HLA class I molecules on the cell surface are selected from HSV, BHV-1, EHV-1/4, PRV, HSV-1/2, VZV, EBV, HCMV, MCMV, RhCMV, HHV-6/7, KSHV, MHV-68, the functional proteins that can directly target degrade HLA class I in cowpox virus and adenovirus, functional proteins that can down regulate the expression of HLA class I molecules through TAP proteins and functional proteins that can down regulate the expression of HLA class I molecules through lysosomes; preferably, the functional protein is selected from proteins US11 and US6 from HCMV, protein UL49.5 from BHV-1, protein UL49.5 from EHV-1 and protein k5 from KSHV.
[0117] Item 4. A nucleic acid molecule, wherein the nucleic acid molecule is selected from:
[0118] (1) A nucleic acid molecule containing a coding sequence of chimeric antigen receptor and a coding sequence of a functional protein capable of down regulating the expression of HLA class I molecules on the cell surface; and
[0119] (2) A complementary sequence of the nucleic acid molecule of (1);
[0120] Preferably, the chimeric antigen receptor and the functional protein are as described in Item 3.
[0121] Item 5. A nucleic acid construct, wherein the nucleic acid construct contains the nucleic acid molecule described in Item 4.
[0122] Item 6. The nucleic acid construct according to Item 5, wherein,
[0123] The nucleic acid construct comprises an expression frame of the chimeric antigen receptor and an expression frame of the functional protein; or the nucleic acid construct is an expression frame, wherein the coding sequence of the chimeric antigen receptor and the coding sequence of the functional protein are in the expression frame; or
[0124] The nucleic acid construct is a cloning vector or an expression vector.
[0125] Item 7. A lentivirus containing the nucleic acid construct according to Item 5 or 6.
[0126] Item 8. A host cell containing the nucleic acid molecule according to Item 4 or the nucleic acid construct according to Item 5 or 6 or the lentivirus according to Item 7.
[0127] Item 9. A pharmaceutical composition, wherein the pharmaceutical composition contains CAR-T cells according to any one of Items 1-3.
[0128] Use of the functional protein or its coding sequence according to Item 10 and Item 3 in the preparation of CAR-T cells with down regulated expression of HLA class I molecules on the cell surface, or in the preparation of CAR-T cells for cancer treatment.
[0129] The embodiment of the disclosure will be described in detail below in combination with an example. Those skilled in the art will understand that the following examples are only used to illustrate the disclosure and should not be regarded as limiting the scope of the disclosure. If the specific technology or conditions are not indicated in the example, it shall be carried out in accordance with the technology or conditions described in the literature in the field (e.g., J. Sambrook et al., Molecular Cloning: A Laboratory Manual, 3rd ed., translated by Huang Peitang et al., Science Press) or in accordance with the product instruction. The reagents or instruments used without the manufacturer indicated are conventional products that can be commercially obtained.
1. Experimental Materials and Results
(1) Instruments and Materials
[0130] Instruments: biosafety cabinet (Haier, HR40-IIA2), CO2 incubator (Thermo, 3111), Flow cytometry (BD, FACSCantoll), plate reader (Molecular Derices, SpectraMax M4)
[0131] Reagents: Anti-HLA class I antibody (APC) (Biolegend, 311410), anti-CD3 antibody (BV421) (Biolegend, 300434), anti-TCR antibody (PE-Cy7) (Biolegend, 306720), FBS (Lonsera, S711-001S), X-vivo 15 (Lonza, 04-418q), Dynabeads CD3/CD28 (Lifetechnology, 40203d), Ficoll (Dayou, DKW-LSH-0250), Tscm (Novoprotein, GMP-1647), Novonectin (Novoprotein, GMP-CH38), anti-human CCR7 (BV421) (BD, 562555), anti-human CD45RA (PE-Cy7) (BD, 560675), Luciferase test (Promega, E6120), anti-human CD3 (FITC) (BD, 562555), anti-human CD4 (BV510) (BD, 563094), anti-human CD8 (APC-Cy7) (BD, 557834), anti-human CD25 (PE) (BD, 555432), anti-human CD69 (APC) (BD, 553237), CAR19-ideotype (self-standard), INF-r ELISA Kit (R & D, DIF50).
(2) Test Method
I. Experimental Method
1) Vector Construction
[0132] Human CD8α hinge region, human CD8 transmembrane region, 41BB intracellular region, human CD3, and EHV1 UL49.5 gene sequence information were searched and obtained from NCBI website database, and the clone number of anti-CD19 scFv is FMC63. These sequences are codon optimized on the web site of https://www.thermofisher.com/order/geneartgenes to ensure that they are more suitable for human cell expression without changing the coded amino acid sequence.
[0133] Overlapping PCR was used to connect the above sequences according to the order of anti-CD19 scFv gene, human CD8 hinge region gene, human CD8 transmembrane region gene, 4-1BB intracellular region gene, human CD3 intracellular region, F2A and EHV1 UL49.5 gene sequence to form complete CD19-CAR-F2A-EHV1 UL49.5 gene sequence information (the sequence containing the coding sequence of signal peptide is shown in SEQ ID No: 1, and the amino acid sequence is shown in SEQ ID No: 2).
[0134] The nucleotide sequence of the CAR molecule was seamlessly cloned into Bamhl-Ecorl site of lentivirus plasmid pWPXL (Addgene) and transformed into competent E. coli (DH5α, Beijing bomaide Biotechnology Co., Ltd.).
[0135] The recombinant plasmid was sent to Suzhou Jinweizhi Biotechnology Co., Ltd. for sequencing. The sequencing results were compared with the sequence of the fitted CD19-CAR-F2A-EHV1 UL49.5 to verify whether the sequence was correct. The sequencing primer was TCAAGCCTCAGACAGTGGTTC (SEQ ID No: 3).
[0136] After confirmation by sequencing, the plasmid was extracted and purified using the plasmid purification kit of Qiagen. The purified plasmid was transfected into 293T cells by calcium phosphate method for lentivirus packaging experiment (Molecular Therapy-Methods & Clinical Development, 2016, 3: 16017). The prepared lentivirus was named PCTL206.
[0137] Lentiviruses PCTL135 (CAR19-F2A-GFP, control), PCTL199 (CAR19-F2A-HCMV US2), PCTL200 (CAR19-F2A-HCMV US11), PCTL201 (CAR19-F2A-HCMV US6), PCTL202 (CAR19-F2A-HSV-1 ICP47), PCTL203 (CAR19-F2A-5 E3-19K), PCTL204 (CAR19-F2A-RHCMV Rh178), PCTL205 (CAR19-F2A-BHV-1 UL49.5), PCTL207 (CAR19-F2A-EBV BNLF2a), PCTL208 (CAR19-F2A-CPXV012), PCTL209 (CAR19-F2A-HCMV US3), PCTL210 (CAR19-F2A-MHV68 mK3), PCTL211 (CAR19-F2A-CPXV203), PCTL212 (CAR19-F2A-KSHV k3), PCTL213 (CAR19-F2A-KSHV k5) were prepared using the same method with different viral proteins to replace that in PCTL206, wherein the amino acid sequences of viral proteins HCMV US2, HSV-1 ICP47, human adenovirus 5 E3-19K, RhCMV Rh178, EBV BNLF2a, cowpox virus CPXV012, HCMV US3, MHV68 mK3, cowpox virus CPXV203, KSHV k3, HCMV US11, HCMV US6, BHV-1 UL49.5 and KSHV k5 are respectively shown in the amino acid sequences shown in the following UniprotKB accession numbers: C8CFI0, P03170, Q8BEL5, Q7TFG4, P0C739, U5TIW7, Q910T7, O41933, G0XWR7, A0A386AVI8, P09727, P14334, Q77CE4 and F5H9K4. More specifically, the coding sequence of HCMV US11 is shown as 1546-2193 bases of SEQ ID No: 4; the coding sequence of HCMV US6 is shown as 1546-2097 bases of SEQ ID No: 5; the coding sequence of BHV-1 UL49.5 is shown as 1546-2097 bases of SEQ ID No: 6; the coding sequence of KSHV k5 is shown as 1546-2316 bases of SEQ ID No: 7.
2) Isolation of PBMC From Peripheral Blood, Isolation and Activation of T Cells, Lentivirus Transduction and In Vitro Culture
[0138] Healthy donors with negative HBV, HCV and HIV tests were selected. 100 ml blood was drawn from the median vein of elbow, and the buffy coat of PBMC was separated by Ficoll density gradient centrifugation. The percentage of CD3+ T cells was detected by whole blood flow cytometry, and the number of CD3+ T cells was calculated. According to the ratio of Dynabeans CD3/CD28 to CD3+ T cells of 3:1, the use amount of magnetic beads was absorbed, incubated with buffy coat cells for 30 min, and CD3+ T cells were isolated, CD3+ T cells were activated by Dynabeads CD3/CD28 (Lifetechnology, 40203D) for 24 hours, and the proportion of CD25+CD69+ T cells was detected by flow cytometry. After CD3+ T activation, lentivirus transduction was conducted. The 24 well plate coated with Novonectin was incubated at 37° C. for 2 hours. The cell suspension and various lentiviruses (MOI=8), F108 (10 ug/ml) and Tscm (2 U/ml) prepared above were configured into a transduction system placed in the coated 24 well plate, the cell density was adjusted to 1.0E+06/ml, centrifuged at 500 g for 30 minutes, and then cultured in a 37° C. CO.sub.2 incubator for 48 hours. After transfection, the cells were cultured in Xvivo15 medium containing 5% FBS, supplemented with TSCM (final concentration of 2 U/ml) every other day, counted, adjusted to the cell density of 0.5E+06/ml, and cultured to harvest the cells on Day 8-10.
3) Target Cells Stimulated CAR-T Cells in Each Group
[0139] CAR-T cells in each group were cultured in vitro for 8-10 days, 1.0E+07 cells were counted, the cell density was adjusted to 1.0E+06/ml, cultured with Xvivo15 (excluding TSCM), and the target cell K562-CD19 was added according to the effect target ratio of 10:1 to stimulate CAR-T cells. The CAR positive rate of cells in each group and the average fluorescence intensity of HLA class I of Car positive cells were detected by flow cytometry.
4) The CAR Positive Rate of CAR-T cells and the average fluorescence intensity of HLA Class I of CAR+ T cells in each group were detected by flow cytometry
[0140] CAR-T cells in each group were counted, 5.0E+05 cells were taken into different 1.5 ml EP tubes, centrifuged at 2000 rpm for 5 min, the cells were collected, the culture medium was discarded, the cells were resuspended and washed twice with sterile 4% BSA, and then the cells were resuspended with 100 ul 4% BSA. 8 ul of anti-human HLA class I antibody (APC) (Biolegend, Cat #: 311410) antibody was added to each tube, vortex mixed evenly, and incubated at 4° C. for 30 min; after dyeing, the cells were washed repeatedly, CAR19-ideatype antibody was diluted at 1:500, the cells were resuspended with diluted antibody solution, 200 ul per tube, vortex mixed evenly, incubated at 4° C. for 30 min. After dyeing, the cells were washed repeatedly, resuspended with 500 ul 4% BSA, with 4 ul of 7AAD antibody added to each tube, vortex mixed evenly, incubated at room temperature in dark for 10 min. After incubation, the cells were transferred to flow tube, and tested on the machine.
5) Cell Phenotype Analysis
[0141] CAR-T cells in each group were counted, and 1.0E+06 cells were taken into different 1.5 ml EP tubes, centrifuged at 2000 rpm for 5 min, the cells were collected, the culture medium was discarded, the cells were resuspended and washed twice with sterile 4% BSA, and then the cells were resuspended with 200 ul 4% BSA. 5 ul of anti-human CD45RA (PE-Cy7) and anti-human CCR7 (BV421) antibodies were added to each sample tube, mixed with a vortex mixer, and incubated at 4° C. for 30min. After the staining was completed, the cells were washed repeatedly, resuspended with 500 ul 4% BSA, with 4 ul of 7AAD antibody added to each tube, vortex mixed evenly, incubated at room temperature in the dark for 10 min, transferred to the flow tube after incubation, and tested on the machine.
6) Cell Killing
[0142] NC-T (T cells not transfected with lentivirus) and CAR-T cells in each group were taken, observed under the microscope whether the cell growth state was normal, blown and mixed evenly, and NC-T and CAR-T cells in each group were collected in a centrifuge tube, counted, collected by centrifugation, and the cell precipitation collected by centrifugation was resuspended with T cell culture medium X-VIVO 15 (excluding Tscm), the cell density was adjusted to 5.0E+07 cells/ml; the target cells were taken, observed whether under the microscope the cell state was normal, the target cells were collected in 15 ml or 50 ml centrifuge tubes respectively, counted, and the cell precipitation collected by centrifugation was resuspended with RPMI 1640 (excluding FBS), and the cell density was adjusted to 5.0E+06 cells/ml; the effector cells NC-T and CAR-T with adjusted density were mixed with the target cells according to different effect target ratios (1:1, 2.5:1, 5:1, 10:1 and 20:1) in a 1.5 ml centrifuge tube, the total volume was made up by 200 with x-vivo 15 (the target cells are 10 ul, and the amount of effector cells was determined according to the effect target ratio). The 200 prepared killing system was moved into 96 well V-shaped plates for 24 hours, the cells in 96 well V-plate were gently blown and mixed, and 100 cells μ0 cell suspension was respectively transferred into 96 well plate with impermeable white wall bottom, and 80 μL ONE-Glo™ Luciferase Assay Substrate was added, mixed evenly by blowing and suction, incubated in the dark at room temperature for 10 minutes, and then the fluorescence intensity was tested with Luminoskan Ascent chemiluminescence analyzer.
II. Experimental Results
1. Functional Proteins Capable of down Regulating the Expression of HLA Class I Molecules on the Surface of CAR-T Cells Were Screened
[0143] Fourteen viral proteins with down-regulated cell surface function were synthesized and constructed into CAR19 lentivirus. Each group of lentivirus was transfected into T cells, and T cells were cultured in vitro until Day 8. The transfection efficiency of CAR19 and the average fluorescence intensity of HLA class I of CAR19+ T cell population were detected by flow cytometry (
TABLE-US-00001 TABLE 1 Average fluorescence intensity of HLA class I of T cells in each group Average fluorescence Down Viral intensity of regulated to vector CAR + % HLA class I (sample/control) PCTL199 54.6 10997 68% PCTL200 51.1 5975 37% PCTL201 54.8 6098 38% PCTL202 57.8 10616 66% PCTL203 63.4 16150 100% PCTL204 49.7 15797 98% PCTL205 48.5 7495 46% PCTL206 44.8 3118 19% PCTL207 44.2 10478 65% PCTL208 58.7 12826 80% PCTL209 45.6 14454 90% PCTL210 53.3 15649 97% PCTL211 41.7 9971 62% PCTL212 36 8534 53% PCTL213 68 6888 43% PCTL135 30.5 16133 100%
[0144] On Day 9 of in vitro culture, T cells in each group were stimulated with target cell K562-CD19, the effect target ratio was 10:1, and stimulated repeatedly for 2 days. The average fluorescence intensity of HLA class I of T cell CAR19+ cell population in each group was detected by flow cytometry. The results were shown in
2. Functional Determination of PCTL200, PCTL201, PCTL205, PCTL206 and PCTL213 Molecules
1) PBMCs Isolated From Peripheral Blood and T Cell Activation
[0145] 1.24E+08 PBMCs were isolated from 100 ml peripheral blood, and the proportions of CD3+ T, CD4+ T and CD8+ T in peripheral blood were detected by flow cytometry. Among them, CD3+ T accounted for 62.4% of buffy coat (monocytes and lymphocytes), CD4+ T/CD8+ T was 1.2, and dynabeans CD3/CD28 sorted and activated CD3+ T, and the activation efficiency was 68.9% after 24 h (
2) T Cell Transfection Efficiency, Average Fluorescence Intensity of HLA Class I, In Vitro Proliferation Multiple, Cytotoxicity Test, T Cell Phenotype Analysis
[0146] T cells were transfected with lentivirus in each group, T cells were counted every other day, T cells were cultured in vitro until Day 8, the transfection efficiency of CAR19 was detected by flow cytometry, and the cell proliferation multiple (the number of cells on Day 8/the number of cells used for transfection) was calculated. The results are shown in Table 2 and
TABLE-US-00002 TABLE 2 transfection efficiency and proliferation multiple of T cells in each group Transfection efficiency Proliferation Group Viral vector Titer (Day 8) multiple 1 PCTL135 1.36E+07 65.6% 165.60 2 PCTL200 7.20E+07 37.4% 284.40 3 PCTL201 1.40E+08 46% 206.15 4 PCTL205 1.32E+08 55.8% 477.00 5 PCTL206 1.22E+08 54.6% 274.00 6 PCTL213 1.04E+08 55.7% 306.25
[0147] The average fluorescence intensity of HLA class I in CAR19 + T cell population was analyzed by flow cytometry. Results as shown in Table 3 and
TABLE-US-00003 TABLE 3 Average fluorescence intensity of HLA class I of T cells in each group Average fluorescence Down Transduction intensity of HLA regulated to Viral vector efficiency % class 1 (sample/control) PCTL135 65.6% 9273 100% PCTL200 37.4% 4100 44% PCTL201 46% 3382 36% PCTL205 55.8% 4179 45% PCTL206 54.6% 2090 23% PCTL213 55.7% 2776 30%
[0148] T cells in each group were cultured in vitro until Day 8, and co cultured with the target cell line k562-CD19-luc for 24 h according to the effect target ratio of 20:1, 10:1, 5:1, 2.5:1 and 1:1 respectively. The cytotoxicity of T cells in each group was detected by luciferase reporter gene detection system. The results are shown in Table 4 and
TABLE-US-00004 TABLE 4 in vitro killing efficiency of T cells in each group Effect target ratio PCTL135 PCTL200 PCTL201 PCTL205 PCTL206 PCTL213 1:1 −247% 46% 68% 45% −6% 3% 2.5:1 −42% 93% 81% 94% 90% 83% 5:1 91% 99% 95% 99% 97% 97% 10:1 95% 100% 99% 99% 95% 99% 20:1 95% 100% 99% 100% 100% 100%
[0149] The T cells of each group were cultured in vitro until Day 8. The expression of CCR7 and CD45RA of T cells in each group was detected by flow cytometry, and the T cell phenotype was analyzed. There was no significant difference among the cell phenotypes of each group, and about 60% of the cells were in T-naive differentiation stage (
3) The Average Fluorescence Intensity of HLA Class I of T Cells in Each Group After Stimulation by Target Cells
[0150] On Day 9 of in vitro culture, the target cell K562-CD19 was used to stimulate T cells in each group for 2 days, with an effect target ratio of 10:1. The average fluorescence intensity of
[0151] HLA class I of CAR19+ cell population of T cells in each group was detected by flow cytometry. The results are shown in Table 5 and
TABLE-US-00005 TABLE 5 average fluorescence intensity of HLA class I of T cells in each group after stimulation by target cells Average Killing fluorescence efficiency % intensity of HLA Viral vector (E:T = 10:1) class 1 molecules PCTL135 69.5 14259 PCTL200 52.9 6328 PCTL201 61.8 3839 PCTL205 69.8 4525 PCTL206 68.7 2598 PCTL213 71.8 4300