AAV gene therapy for treating nephrotic syndrome

12544460 ยท 2026-02-10

Assignee

Inventors

Cpc classification

International classification

Abstract

The present invention provides an adeno-associated virus (AAV) vector gene therapy for use in treating a monogenic form of nephrotic syndrome, wherein the AAV vector comprises a NS-associated transgene and minimal nephrin promoter NPHIS1 or podocin promoter NPHIS2.

Claims

1. A method of treating a monogenic form of nephrotic syndrome (NS), wherein the method comprises administering an adeno-associated virus (AAV) vector to a subject in need thereof, wherein the AAV vector comprises: a NS-associated transgene under the control of a podocyte-specific promoter; wherein the NS-associated transgene is NPHS2; ADCK4; ALG1; ARHGAP24; ARGHDIA; CD151; CD2AP; COQ2; COQ6; DGKE; E2F3; EMP2; KANK2; LAGE3; LMNA; LMX1B; MAFB; NUP85; NUP93; NXF5; OSGEP; PAX2; PDSS2; PMM2; PODXL; SCARB2; SGPL1; Smad7; TP53RK; TPRKB; VDR; WDR73; WT1; ZMPSTE24; or APOL1; and wherein the AAV vector is AAV serotype LK03 or 3B.

2. The method according to claim 1, wherein the AAV vector additionally comprises a Woodchuck hepatitis post-transcriptional regulatory element (WPRE).

3. The method according to claim 1, wherein the NS-associated transgene is human and/or comprises a hemagglutinin (HA) tag.

4. The method according to claim 1, wherein the AAV vector additionally comprises a Kozak sequence between the podocyte-specific promoter and the NS-associated transgene.

5. The method according to claim 1, wherein the AAV vector additionally comprises a polyadenylation signal.

6. The method according to claim 1, wherein the subject is a human patient.

7. The method according to claim 6, wherein the patient is a paediatric patient.

8. The method according to claim 1, wherein the monogenic form of nephrotic syndrome is a monogenic form of steroid-resistant nephrotic syndrome.

9. The method according to claim 1, wherein the AAV vector is administered systemically.

10. The method according to claim 1, wherein the AAV vector is administered by intravenous injection.

11. The method according to claim 1, wherein the AAV vector is administered by injection into the renal artery.

12. The method according to claim 1, wherein the podocyte-specific promoter is a minimal nephrin promoter or podocin promoter.

13. The method according to claim 5, wherein the polyadenylation signal is a bovine growth hormone (bGH) polyadenylation signal.

14. The method according to claim 1, wherein the NS-associated transgene is NPHS2.

15. The method according to claim 14, wherein the monogenic form of nephrotic syndrome is a monogenic form of steroid-resistant nephrotic syndrome caused by one or more mutations in NPHS2.

16. The method according to claim 1, wherein the AAV vector is AAV serotype LK03.

17. The method according to claim 12, wherein the podocyte-specific promoter is a minimal nephrin promoter.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) The invention will now be described in detail, by way of example only, with reference to the figures.

(2) FIGS. 1A-1D show that AAV 2/9 administered by tail vein injection transduces the kidney and expresses HA-tagged podocin in the podocyte. FIG. 1A) AAV vectors used to express mouse or human podocin or GFP. All vectors contained the Kozak sequence between the promoter and the transgene, as well as WPRE (Woodchuck hepatitis post-transcriptional regulatory element) and the bovine growth hormone (bGH) polyadenylation signal. FIG. 1B) Vector or saline was injected via tail vein in iPod NPHS2.sup.fl/fl mice at 8 weeks of age, and induction with doxycycline commenced 10-14 days later. FIG. 1C) qPCR showing presence of AAV ITRs in mouse kidney cortex in mice injected with the viral vector. FIG. 1D) Representative immunofluorescence showing expression of HA tagged podocin with podocyte-specific proteins nephrin and podocin in iPod NPHS2.sup.fl/fl mice injected with AAV 2/9. Control (saline) images are of mice without the full iPod NPHS2.sup.fl/fl genotype injected and hence did not develop proteinuria or diseased glomeruli, as mice with diseased glomeruli showed loss of podocyte markers.

(3) FIGS. 2A-2G show that tail vein injection of AAV 2/9 expressing wild-type podocin under a podocyte-specific promoter ameliorates proteinuria in the conditional podocin knock-out mouse model (iPod NPHS2.sup.fl/fl) FIG. 2A) Urinary albumin:creatinine ratio of mice injected with AAV 2/9 mNPHS1.mpod versus AAV 2/9 hNPHS1.mpod versus saline (n=9 in each group, **p<0.01***p<0.001). FIG. 2B) Coomassie staining showing representative images of degree of albuminuria in one mouse from each experimental group. The saline group showed proteinuria from day 14 onwards and showed a large amount of albumin while the vector treated groups showed later onset of albuminuria and milder albuminuria. FIG. 2C) Survival curve showing improved survival in mice injected with either AAV 2/9 hNPHS1.mpod or AAV 2/9 mNPHS1.mpod (Log-rank (Mantel-Cox) test p=0.049, n=3 in each virus group and n=4 in the saline group). FIG. 2D) The number of copies of viral DNA per 50 ng total DNA has an inverse correlation with urinary albumin:creatinine ratio at day 42 (Spearman r=0.4596, p=0.0477) FIG. 2E) Blood results including cholesterol, albumin, urea, and creatinine at 6 weeks post-doxycycline. (n=minimum of 3 mice in each group except for cholesterol with minimum of n=2 in each group) FIG. 2F) Histology showing representative images from each group on light microscopy. Saline injected group showed glomerular hypertrophy, increased collagen deposition and segmental sclerosis, along with tubular dilatation, consistent with FSGS. Those injected with AAV 2/9 expressing mouse podocin exhibited a range of histological findings which roughly correlated with their urine albumin:creatinine ratio at death. Some mice had healthy normal glomeruli, while others showed mild evidence of disease like pseudo-crescent formation (arrow) seen in the mouse injected with AAV 2/9 mNPHS1.mpodHA. FIG. 2G) iPod NPHS2.sup.fl/fl mice injected with saline showed loss of podocin, while nephrin expression showed a change from predominantly membranous staining to a diffuse pattern.

(4) FIGS. 3A-3F. AAV LK03 shows efficient transduction of human podocytes in vitro with the minimal human nephrin promoter. FIG. 3A, 3C, 3E) immunofluorescence demonstrating transduction of human podocytes (Pod), glomerular endothelial cells (GEnC) and proximal tubule epithelial cells (PTEC) by AAV LK03 CMV GFP, with only expression of GFP in podocytes when using the minimal nephrin promoter AAV LK03 hNPHS1 GFP. FIG. 3B) Western blot demonstrating GFP expression in podocytes only when using the minimal human nephrin promoter using AAV LK03. FIG. 3D) Flow cytometry demonstrating highly efficient transduction of podocytes using AAV LK03 CMV GFP, and confirming the GFP expression using the minimal nephrin promoter was only seen in podocytes. In comparison, AAV 2/9 CMV GFP showed low transduction efficiencies in podocytes (n=3) FIG. 3F) Bar chart showing median fluorescence intensity in podocytes transduced with AAV LK03 and histogram showing the degree of green fluorescence in podocytes transduced with AAV LK03 CMV GFP (right-hand peak), AAV LK03 hNPHS1 GFP (central peak) and untransduced cells (left-hand peak).

(5) FIGS. 4A-4E. AAV LK03 expressing wild type human podocin shows functional rescue in the mutant podocin R138Q podocyte cell line. FIG. 4A) Western blot showing AAV LK03.CMV.hpodocinHA and AAV LK03.hNPHS1.hpodocinHA transduces R138Q podocytes and expresses HA-tagged podocin. FIG. 4B) Immunofluorescence demonstrating expression of HA tagged wild type podocin in the mutant podocin R138Q podocytes. FIG. 4C) Adhesion assay showing a decrease in adhesion in mutant podocin R138Q podocytes, with rescue of adhesion in R138Q podocytes treated with AAV LK03.hNPHS1.hpodHA.WPRE.bGH. FIG. 4D) confocal microscopy showing HA-tagged podocin does not colocalize with calnexin, an endoplasmic reticulum marker FIG. 4E) TIRF microscopy demonstrating expression of HA-tagged podocin within 100 nm of the plasma membrane with some colocalization with caveolin, a lipid raft marker.

(6) FIG. 5 (SEQ ID NO: 4) shows an example DNA sequence for the minimal human nephrin promoter (NPHS1).

(7) FIG. 6 (SEQ ID NO: 5) shows an example cDNA sequence for a human podocin transgene.

(8) FIG. 7 (SEQ ID NO: 6) shows an example DNA sequence for a WPRE sequence.

(9) FIG. 8 (SEQ ID NO: 7) shows an example DNA sequence for a bGH poly(A) signal sequence.

(10) FIG. 9 shows human podocytes transduced with either HAVDR (A) or HASmad7 (B) using AAV LK03 with the minimal human nephrin promoter.

EXAMPLES

Methods

(11) Vector Production

(12) We prepared pAV.hNPHS1.mpodHA.WPRE.bGH, pAV.mNPHS1.mpodHA.WPRE.bGH and pAV.hNPHS1.hpodHA.WPRE.bGH (FIG. 1A) pAV.mNPHS1.hHAVDR.WPRE.bGH and pAV.mNPHS1.hHASmad7.WPRE.bGH in our laboratory from a CMV eGFP L22Y pUC-AV2 construct (kind gift of Amit Nathwani) using human (FIG. 6 (SEQ ID NO: 5)) and mouse (sequence not shown) podocin cDNA (Origene, Herford, Germany) and human VDR and Smad7 cDNA. Human embryonic kidney 293T cells were transfected with a capsid plasmid (pAAV9 from Penn Vector Core, pAAV LK03 was the kind gift of Mark Kay), a helper plasmid with adenoviral genes and the transgene plasmid using polyethyleneimine. Cells and supernatant were harvested at 72 hours post-transfection. Cells underwent 5 freeze-thaw cycles, while the supernatant underwent PEG precipitation (8% PEG 0.5N NaCl). These were combined and incubated with 0.25% sodium deoxycholic acid and 70 units/ml Benzonase for 30 minutes at 37 C. The vector was purified by iodixanol gradient ultracentrifugation, and subsequently concentrated in PBS. Vectors were titrated by qPCR using the standard curve method using the following primers:

(13) TABLE-US-00002 (SEQIDNO:1) ITRFGGAACCCCTAGTGATGGAGTT, (SEQIDNO:2) ITRRCGGCCTCAGTGAGCGA, (SEQIDNO:3) ITRprobeFAM-5-CACTCCCTCTCTGCGCGCTCG-3-TAMRA.
Animals

(14) All animal experiments and procedures were approved by the UK Home Office in accordance with the Animals (Scientific Procedures) Act 1986, and the Guide for the Care and Use of Laboratory Animals was followed during experiments. NPHS2.sup.flox/flox mice (kind gift of Corinne Antignac, INSERM U983, Paris) were bred with NPHS2-rtTA/Tet-On Cre mice to generate offspring with NPHS2-rtTA/Tet-On Cre/NPHS2.sup.flox/flox. These mice develop a podocyte-specific knockout of podocin when exposed to doxycycline. These will be called iPod NPHS2.sup.fl/fl from hereon. Mice were on a mixed background and equal numbers of each sex were used. Mice were administered AAV via tail vein injection at 8 weeks of age. (FIG. 1B) 10 to 14 days later, mice were provided with drinking water supplemented with doxycycline 2 mg/ml and 5% sucrose for 3 weeks. Urine was taken weekly. Mice were culled by Schedule 1 methods at 6 weeks post initiation of doxycycline. A small number of mice were kept beyond 6 weeks to test for effect on survival. All mice were re-genotyped from tissue taken at death.

(15) Cell Culture

(16) Conditionally immortalised human podocytes (Pod) were cultured in RPMI with L-glutamine and NaHCO.sub.3 with 10% Fetal Bovine Serum (Sigma Aldrich, Gillingham, UK). Conditionally immortalised human glomerular endothelial cells (GEnC) were cultured in EBM-2 Endothelial Cell Growth Basal Medium-2 supplemented with EGM-2 Endothelial Cell Growth Medium-2 BulletKit (Lonza, Basel, Switzerland). Immortalised proximal tubule epithelial cells (ATCC, Teddington, UK) (PTEC) were cultured in DMEM/F12 supplemented with Insulin, Transferrin and Selenium, Hydrocortisone and 10% FBS.

(17) Cells were transduced with AAV at a MOI of 510.sup.5. For GFP expression, cells were used at 5-7 days post transduction to allow comparisons across different cell lines. For podocin, VDR and Smad7 expression, cells were used at 10-14 days post transduction when podocytes are maximally differentiated.

(18) Quantitative PCR

(19) DNA was extracted using DNeasy Blood and Tissue Kit (Qiagen, Manchester, UK) from mouse kidney cortex. AAV DNA was detected using the primers above for viral titration and normalised against mouse beta-actin.

(20) RNA was extracted using RNeasy Mini Kit with RNase-Free DNase set (Qiagen, Manchester, UK).

(21) Immunofluorescence

(22) 5 m sections were fixed using 4% PFA and blocked with 3% BSA 0.3% Triton X-100 and 5% of either goat or donkey serum. Primary antibodies were anti-HA High Affinity from rat IgG1 (Roche, Basel, Switzerland), Guinea Pig anti-Nephrin (1243-1256) Antibody (Origene, Herford, Germany), and Rabbit anti-NPHS2 Antibody (Proteintech, Manchester, UK).

(23) Cells were fixed with either 4% PFA and or ice cold methanol, incubated for 5 minutes with 0.03M glycine, permeabilised with 0.3% Triton then blocked with 3% BSA. Primary antibodies were mouse HA.11 Epitope Tag Antibody (Biolegend, San Diego, USA), mouse anti-GFP (Roche, Basel, Switzerland), rabbit anti-Calnexin (Merck Millipore, Darmstadt, Germany) and rabbit anti-Caveolin 1 (Cell Signaling, Danvers, USA).

(24) Secondary antibodies were AlexaFluor 488 donkey anti-mouse, AlexaFluor 488 donkey anti-rabbit, AlexaFluor 488 goat-anti guinea pig, AlexaFluor 555 goat anti-rabbit and AlexaFluor 633 goat anti-rat, and AlexaFluor 633 Phalloidin (Invitrogen, Thermo Fisher Scientific, Waltham, USA). Sections were counterstained with DAPI and mounted with Mowiol. Images were taken on a Leica SPE single channel confocal laser scanning microscope attached to a Leica DMi8 inverted epifluorescence microscope, or Leica SP5-II confocal laser scanning microscope attached to a Leica DMI 6000 inverted epifluorescence microscope, or Leica AM TIRF MC (multi-colour) system attached to a Leica DMI 6000 inverted epifluorescence microscope using LAS (Leica Application Suite) X Software.

(25) Western Blotting

(26) Cells were extracted in SDS lysis buffer. Samples were run on a 12.5% gel and transferred to PVDF membrane. Membranes were blocked in 5% milk in TBST 0.1%. Primary antibodies used were mouse HA.11 Epitope Tag Antibody (Biolegend, San Diego, USA), mouse anti-GFP (Roche, Basel, Switzerland) in 3% BSA in TBST 0.1%, or rabbit anti-NPHS2 antibody (Proteintech, Manchester, UK). Secondary antibodies were anti-rabbit or anti-mouse IgG Peroxidase (Sigma Aldrich, Gillingham, UK) in 3% BSA in TBST 0.1%. Membranes were imaged on Amersham Imager 600.

(27) Flow Cytometry

(28) Live cells were stained with propidium iodide and only live single cells were included in the analysis. Flow cytometry was carried out on the NovoCyte Flow Cytometer.

(29) Adhesion Assay

(30) Cells were trypsinised and resuspended at 10.sup.5/ml and allowed to recover for 10 minutes before plating 50 l of cells diluted 1 in 2 with PBS in a 96 well plate. Technical triplicates were used. Cells were left to adhere for about 1 hour at 37 C.

(31) Cells were washed with PBS to wash away non adherent cells, then fixed with 4% PFA for 20 minutes. Cells were washed with distilled water then stained with 0.1% crystal violet in 2% ethanol for 60 minutes at room temperature. Cells were washed and incubated with 10% acetic acid on a shaker for 5 minutes. Absorbance was measured at 570 nm and results were normalised against the wild type cell line transduced with AAV LK03 CMV GFP.

(32) Urine

(33) Albumin levels were measured using a mouse albumin ELISA kit (Bethyl Laboratories Inc, Montgomery, USA) and Creatinine levels were measured on the Konelab Prime 60i Analyzer.

(34) Blood Tests

(35) Mouse plasma was processed either using the Konelab Prime 60i analyser or the Roche Cobas system with reagents and protocols supplied by the manufacturer.

(36) Statistical Analysis

(37) All data is presented as mean #SEM unless stated otherwise. Statistical analyses were performed in GraphPad Prism (Graphpad softward, La Jolla, USA). Statistical tests used include two-tailed t-test, one-way ANOVA with Tukey's multiple comparison posthoc analysis, two-way ANOVA with Tukey's multiple comparison posthoc analysis, and Logrank (Mantel-Cox) test for survival analysis.

(38) Results

(39) Tail Vein Injection of AAV Serotype 9 Demonstrates Transduction of Kidney Cells And Expression in the Podocyte

(40) At 8 weeks of age, mice were administered 1.510.sup.12 vg via tail vein of either AAV2/9 hNPHS1.mpod or AAV2/9 mNPHS1.mpod, or saline. 6 weeks later, AAV ITRs were detected in the kidney cortex of mice injected with AAV (AAV 2/9 hNPHS1.mpod=39,06713,285 copies SSDNA, AAV 2/9 mNPHS1mpod=76,533.3332047 copies ssDNA, n=5-6/group) (FIG. 1C). HA-tagged podocin was shown to co-localise with podocyte markers nephrin and podocin (FIG. 1D).

(41) AAV2/9 expressing wild type podocin reduces albuminuria in iPod NPHS26/f mice Vector treated groups showed a reduction in urinary albumin:creatinine ratio (ACR) (FIG. 2A, 2B). The effect of tail vein injection of AAV 2/9 expressing podocin on urinary ACR yielded an F ratio of F (2, 24)=9.61, p<0.001 (n=9/group). At 14 days post-doxycycline, urinary ACR was higher in the saline group than either of the vector treated groups, although this was not significant (AAV 2/9 hNPHS1.mpod=758.1488.1 mg/mmol, AAV 2/9 mNPHS1.mpod=59.828.0 mg/mmol, saline=3,770.11337.6 mg/mmol, AAV 2/9 hNPHS1.mpod vs saline p=0.40, AAV 2/9 mNPHS1.mpod vs saline p=0.25). There was a significant reduction in urinary ACR in the vector treated groups at day 28 (AAV 2/9 hNPHS1.mpod=3,083.0932.8 mg/mmol, AAV 2/9 mNPHS1.mpod=2,195.1778.9 mg/mmol, saline=10,1983,189.5 mg/mmol, AAV 2/9 hNPHS1.mpod vs saline p=0.008, AAV 2/9 mNPHS1.mpod vs saline p=0.002) and day 42 (AAV 2/9 hNPHS1.mpod=3,266.81,212.2 mg/mmol, AAV 2/9 mNPHS1.mpod=3,553.31,477.87 mg/mmol, saline=13,488.83,877.3 mg/mmol, AAV 2/9 hNPHS1.mpod vs saline p<0.001, AAV 2/9 mNPHS1.mpod vs saline p<0.001). In the vector treated groups, 2 of 9 mice in AAV 2/9 hNPHS1.mpod group and 1 of 9 mice in AAV 2/9 mNPHS1.mpod group had urinary ACRs of less than 30 mg/mmol at day 42.

(42) Although the mice in vector treated groups showed an improvement, there was a large degree of variation within the groups which we hypothesised might be attributable to amount of vector that reached the kidney after a systemic injection. The amount of viral DNA detected in kidney cortex showed an inverse correlation with the degree of albuminuria at day 42 (Spearman r=0.4596, p=0.0477) (FIG. 2D).

(43) AAV2/9 Expressing Wild Type Podocin Partially Rescues the Phenotype in iPod NPHS2.sup.fl/Fl Mice

(44) Vector treated mice showed a reduction in creatinine (saline=39.08.5 mol/L, AAV 2/9 hNPHS1.mpod=27.37.9 mol/L, AAV 2/9 mNPHS1.mpod=18.64.4 mmol/L, p=0.1622), a reduction in urea (saline=39.417.6 mmol/L, AAV 2/9 hNPHS1.mpod=12.02.0 mmol/L, AAV 2/9 mNPHS1.mpod=11.61.6 mmol/L, p=0.058), an increase in albumin (saline=10.55.4 g/L, AAV 2/9 hNPHS1.mpod 17.1=4.8g/L, AAV 2/9 mNPHS1.mpod=17.13.6 g/L, p=0.5602) and a significant reduction in cholesterol (saline=15.761.75 mmol/L, AAV 2/9 hNPHS1.mpod=2.640.60 mmol/L, AAV 2/9 mNPHS2.mpod=4.860.76 mmol/L, p=0009) (FIG. 2E).

(45) Saline treated mice showed histological features of FSGS by 6 weeks. Vector treated mice did not show histological features of FSGS on light microscopy, but demonstrated a range of histological findings from completely normal glomeruli to pseudo-crescents or mesangial hypercellularity. (FIG. 2F)

(46) These mice also showed prolonged survival (n=3-4/group), with a median survival of 75.5 days (range 38 to 111 days) in the saline group, compared to median survival of 192 days (range 74 to still alive at 206 days) in AAV 2/9 hNPHS1.mpod and median survival of 192 days (range 131 to still alive at 206 days) in AAV 2/9 mNPHS1.mpod (p=0.049).

(47) Untreated mice show loss of expression of podocin with a change in pattern of expression of nephrin to a diffuse pattern (FIG. 2G). This is a stark contrast to the predominantly membranous pattern of expression of nephrin and podocin seen in vector treated mice (FIG. 1D).

(48) AAV LK03 Transduces Human Podocytes Efficiently In Vitro with the Minimal Human Nephrin Promoter

(49) AAV LK03 with CMV GFP and AAV LK03 hNPHS1 GFP were used to transduce human podocytes, glomerular endothelial cells and proximal tubular epithelial cells at a MOI of 510.sup.5. Flow cytometry (n=3) showed that AAV LK03 CMV GFP had highly efficient transduction the of podocyte (% GFP expression=98.830.84), AAV LK03 hNPHS1 GFP had good transduction (% GFP expression=71.33.39) and untransduced cells had unremarkable expression (% GFP expression=0.890.36) (FIG. 3D). This is reflected on immunofluorescence (FIG. 3A, 3C, 3E) and western blot (FIG. 3B). Although the proportion of cells positive for GFP expression is high in podocytes transduced with AAV LK03 hNPHS1 GFP, the cells have a lower fluorescence intensity than those transduced with AAV LK03 CMV GFP (FIG. 3F).

(50) Interestingly, AAV LK03 CMV GFP showed much lower transduction in glomerular endothelial cells (% GFP expression=7.350.19). AAV LK03 hNPHS1 GFP showed minimal transduction in endothelial glomerular cells GFP (% expression=0.590.10), on a similar level to untransduced glomerular endothelial cells (% GFP expression=0.230.02). As AAV 2/9 has been the serotype which has seen the best transduction in kidney cells in vivo in rodent kidneys, we tested the expression of AAV 2/9 CMV GFP on human kidney cell lines. AAV 2/9 CMV GFP showed low transduction efficiency in both podocytes (% GFP expression=13.91.98) and glomerular endothelial cells (% GFP expression=21.994.35) (FIG. 3D). AAV LK03 with AAV LK03 hNPHS1 HAVDR and AAV LK03 hNPHS1 hSmad7 were used to transduce human podocytes showing good expression of both proteins (FIG. 9).

(51) AAV LK03 Expressing Human Podocin Under the Minimal Nephrin Promoter Shows Functional Rescue in Mutant Podocin R138Q Podocyte Cell Line

(52) The R138Q podocin mutant results in mislocalization of podocin from the plasma membrane to the endoplasmic reticulum. The mutant podocin R138Q podocyte cell line was acquired from a patient kidney and conditionally immortalised using temperature sensitive SV40 T antigen. AAV LK03 hNPHS1 hpod transduces R138Q podocytes and expresses HA-tagged podocin (FIG. 4A, 4B). HA-tagged podocin is seen at the plasma membrane on confocal microscopy and colocalises with Caveolin-1, a lipid raft protein, as seen on TIRF microscopy (FIG. 4B, 4E). Untransduced R138Q podocytes do not show any podocin expression at the plasma membrane (FIG. 4B). HA-tagged podocin does not colocalise with Calnexin, an endoplasmic reticulum marker (FIG. 4D).

(53) Podocytes show a decrease or increase in adhesion in diseased states. Previous work in our laboratory has shown that the R138Q mutation causes a decrease in podocyte adhesion. AAV transduction causes a decrease in podocyte adhesion but the R138Q podocytes still show reduced adhesion compared to wild type podocytes, and transduction with AAV LK03 hNPHS1 hpod results in the rescue of the adhesional function of R138Q podocytes (FIG. 4C).

DISCUSSION

(54) Here we have successfully targeted the podocyte with AAV 2/9 using a minimal nephrin promoter to express mouse podocin in a conditional mouse knock-out model, with partial rescue of the phenotype and improvements in albuminuria seen in vector treated mice. As a first proof of principle study, we have chosen to inject the vector prior to doxycycline induction, so that effective rescue by the vector is in place when podocin is knocked out. The effect of doxycycline induction is rapid, and the progression to severe nephrosis (8-14 days) and FSGS is relative quick (about 6 weeks). We have shown here that in vitro, introducing wild type human podocin to R138Q podocytes enables expression of podocin that reaches the plasma membrane, and rescues podocyte adhesion.

(55) Although we have shown that the vector improves albuminuria and survival in these mice, there is large degree of variability in the degree of albuminuria both in treated and untreated mice. The variability within treated mice could be at least partially explained by the amount of viral transduction in the kidney (FIG. 2D).

(56) AAV LK03 has shown high transduction of close to 100% in human podocytes in vitro, which is reduced to 72.3% when using the minimal human nephrin promoter. We have shown that we can use this serotype to transduce podocytes specifically in vitro, and that expression of wild type podocin in R138Q mutant podocytes show functional rescue. Using AAV LK03 has implications on translation as such effective transduction of human podocytes might enable a significant reduction in effective dose in humans. A recent UK study has shown low anti AAV LK03 neutralising antibody seroprevalence of 23%, with a nadir in late childhood (Perocheau, D. P. et al.), which makes this particular serotype a promising candidate for translational studies.

(57) We describe a first proof of principle study that demonstrates AAV transduction of podocytes with a podocyte-specific promoter ameliorates albuminuria in the iPod NPHS2.sup.fl/fl mouse model. We also show that a synthetic capsid, AAV LK03, shows highly efficient transduction of human podocytes. In combination, this work is a first step towards translation of AAV gene therapy targeting monogenic disease of the podocyte.

REFERENCES

(58) LUO, X., HALL, G., LI, S., BIRD, A., LAVIN, P. J., WINN, M. P., KEMPER, A. R., BROWN, T. T. & KOEBERL, D. D. 2011. Hepatorenal correction in murine glycogen storage disease type I with a double-stranded adeno-associated virus vector. Mol Ther, 19, 1961-70. MOELLER, M. J., SANDEN, S. K., SOOFI, A., WIGGINS, R. C. & HOLZMAN, L. B. 2002. Two gene fragments that direct podocyte-specific expression in transgenic mice. J Am Soc Nephrol, 13, 1561-7. PEROCHEAU, D. P. et al. Age-Related Seroprevalence of Antibodies Against AAV-LK03 in a UK Population Cohort. doi: 10.1089/hum.2018.098. PICCONI, J. L., MUFF-LUETT, M. A., WU, D., BUNCHMAN, E., SCHAEFER, F. & BROPHY, P. D. 2014. Kidney-specific expression of GFP by in-utero delivery of pseudotyped adeno-associated virus 9. Molecular Therapy. Methods & Clinical Development, 1, 14014. ROCCA, C. J., UR, S. N., HARRISON, F. & CHERQUI, S. 2014. rAAV9 combined with renal vein injection is optimal for kidney-targeted gene delivery: conclusion of a comparative study. Gene therapy, 21, 618-628. SCHIEVENBUSCH, S., STRACK, I., SCHEFFLER, M., NISCHT, R., COUTELLE, O., HSEL, M., HALLEK, M., FRIES, J. W. U., DIENES, H. P., ODENTHAL, M. & BUNING, H. 2010. Combined Paracrine and Endocrine AAV9 mediated Expression of Hepatocyte Growth Factor for the Treatment of Renal Fibrosis. Molecular Therapy, 18, 1302-1309. SCHAMBACH, A., BOHNE, J., BAUM, C., HERMANN, F. G., EGERER, L., VON LAER, D. & GIROGLOU, T. 2005. Woodchuck hepatitis virus post-transcriptional regulatory element deleted from X protein and promoter sequences enhances retroviral vector titer and expression. Gene Therapy, 13, 641. VAN DER WOUDEN, E. A., SANDOVICI, M., HENNING, R. H., DE ZEEUW, D. & DEELMAN, L. E. 2004. Approaches and methods in gene therapy for kidney disease. J Pharmacol Toxicol Methods, 50, 13-24.

SEQUENCE LISTING FREE TEXT

(59) [SEQ ID NO: 1] shows the ITR Forward primer. [SEQ ID NO:2] shows the ITR Reverse primer. [SEQ ID NO:3] shows the DNA sequence of the ITR probe FAM-5-CACTCCCTCTCTGCGCGCTCG-3-TAMRA. [SEQ ID NO: 4] shows the example DNA sequence for the minimal human nephrin promoter (NPHS1) as shown in FIG. 5. [SEQ ID NO:5] shows the example cDNA sequence for the human podocin transgene shown in FIG. 6. [SEQ ID NO: 6] shows the example DNA sequence for the WPRE sequence shown in FIG. 7. [SEQ ID NO:7] shows the example DNA sequence for the bGH poly(A) signal sequence shown in FIG. 8.