Compositions and methods for derivation of trophoblast stem cells
12545890 ยท 2026-02-10
Assignee
Inventors
Cpc classification
C12N2501/999
CHEMISTRY; METALLURGY
C12N2506/025
CHEMISTRY; METALLURGY
C12N5/0606
CHEMISTRY; METALLURGY
C12N2501/119
CHEMISTRY; METALLURGY
C12N2501/16
CHEMISTRY; METALLURGY
C12N2506/45
CHEMISTRY; METALLURGY
C12N2501/155
CHEMISTRY; METALLURGY
C12N5/0605
CHEMISTRY; METALLURGY
International classification
Abstract
The present disclosure provides compositions and methods related to the derivation of trophoblast stem cells. In particular, the present disclosure provides novel formulations and methods for deriving and maintaining trophoblast stem cells from human pluripotent stem cells, which can be used for basic research purposes as well as for developing treatments for pregnancy-associated pathologies such as preeclampsia, recurrent loss of pregnancy, placenta accreta, and intrauterine growth restriction.
Claims
1. A method for inducing differentiation of human embryonic stem cells (hESCs) into cytotrophoblasts (CTBs) or CTB-like cells, the method comprising: culturing the hESCs in a chemically defined cell culture medium comprising a sphingosine 1-phosphate receptor (SIPR) agonist, an activin/nodal inhibitor, and at least one growth factor; and assessing the hESCs for one or more phenotypic characteristics of CTBs or CTB-like cells.
2. The method of claim 1, wherein the SIPR agonist is an agonist of S1PR1, S1PR2, or S1PR3.
3. The method of claim 1, wherein the S1PR agonist is an agonist of S1PR3.
4. The method of claim 1, wherein the S1PR agonist is selected from the group consisting of CYM5442, CYM5541, CYM55220, A971432, Ceralifimod, CS2100, CYM50260, CYM50308, FTY720, GSK2018682, RP001, SEW2871, TC-G1006, and TC-SP14.
5. The method of claim 1, wherein the activin/nodal inhibitor is SB431542 or A83-01.
6. The method of claim 1, wherein the at least one growth factor is bone morphogenic protein-4 (BMP4).
7. The method of claim 1, wherein the medium further comprises ascorbic acid at a concentration ranging from about 0.5 g/ml to about 40 g/ml.
8. The method of claim 1, wherein the medium further comprises glucose at a concentration of 20 mM or less.
9. The method of claim 1, wherein the CTBs or CTB-like cells exhibit altered expression of one or more of CDX2, TFAP2C, YAP, ELF5, TEAD4, KRT7, p63, GATA3, and HAND1.
10. The method of claim 1, wherein the CTBs or CTB-like cells are capable of forming a spherical structure.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
DETAILED DESCRIPTION
(17) The use of human trophoblast stem (TS) cells as a model for studies of early placental development is hampered by limited genetic diversity of existing TS cell lines, and constraints on using human fetal tissue or embryos needed to generate additional lines. Embodiments of the present disclosure report the derivation of two distinct stem cells of the trophectoderm lineage from human pluripotent stem cells. Analogous to villous cytotrophoblasts in vivo, the first is a CDX2.sup. stem cell comparable to placenta-derived TS cellsthey both exhibit identical expression of key markers, are maintained in culture and differentiate under similar conditions, and share high transcriptome similarity. The second is a more primitive CDX2.sup.+ stem cell with distinct cell culture requirements, and differences in gene expression and differentiation, relative to CDX2.sup. stem cells. As described further herein, the compositions and methods of the present disclosure facilitate the derivation and maintenance of these two distinct trophectoderm lineage stem cells from human embryonic stem cells (hESCs) and hiPSCs in chemically defined culture conditions. The isolation of self-renewing stem cell populations allowed a direct comparison of placenta-derived TS cells with TS cells from hPSCs; genome wide transcriptomic analysis and functional differentiation assays demonstrated very high similarity between placenta- and hPSC-derived CDX2.sup. TS cells. The routine derivation of TS cells from hPSCs will provide powerful tools for mechanistic studies on normal and pathological early trophoblast development. In particular, derivation of TS cells from pluripotent stem cells will enable construction of models for normal and pathological placental development.
(18) Embodiments of the present disclosure demonstrate that two distinct stem cell populations of the trophectoderm lineagehPSC-TS and hPSC-TS.sup.CDX2can be derived from hESCs and hiPSCs under chemically defined culture conditions. Whether bonafide trophoblast could be obtained from hPSCs has been a subject of debate. Despite extensive research in this area, conducting a rigorous head-to-head comparison between hPSC-derived and primary trophoblasts has been challenging. The isolation of trophoblast stem cell populations from hPSCs in the present disclosure, in conjunction with the recent derivation of primary TS cells from blastocysts and early gestation placental samples (e.g., Okae et al., 2018) enables such a comparison. Embodiments of the present disclosure demonstrate that hPSCs can be differentiated to TS cells that express markers consistent with primary (placenta-derived) TS cells (P63, TEAD4, TFAP2C, YAP, and GATA3). The hPSC-derived hPSC-TS cells are cultured in the same medium as primary TS cells. They differentiate to EVT and STB using similar protocols as those used for primary TS cells. Further, hPSC-derived hPSC-TS and primary TS have highly similar transcriptomes. Taken together, these results demonstrate that hPSC-derived TS cells are analogous to primary TS cells, and that hPSCs can indeed differentiate to bonafide trophoblasts.
(19) Role of culture medium in trophoblast differentiation of hESCs. Previous studies on trophoblast differentiation of hESCs have employed differing protocols, resulting in significantly different outcomes in some cases. Notably, Benardo et al. (2011) reported that BMP treatment of hESCs results in differentiation of hESCs to mesoderm and not trophoblast. The results provided herein demonstrate two potential explanations for discrepancies in previous studies. First, data provided herein demonstrate that receptor-mediated signaling by the albumin-associated sphingolipid S1P plays a critical role in hESC differentiation to trophoblast in the medium. Differences in results reported by previous studies may be due to variability in the lipid composition of media used during trophoblast differentiation of hESCs. Second, the medium used for routine maintenance of undifferentiated hESCs likely contributes significantly to their differentiation potential. For instance, unlike hESCs cultured in the presence of KSR, hESCs in E8 medium exhibit features of nave pluripotency. Recent studies report the conversion of hESCs to expanded potential stem cells (EPSCs) by transitioning hESCs to a human EPSC medium. Significantly, TS-like cells can be obtained by passaging EPSCsbut not hESCs in KSR containing mediumin TSCM used for culture of primary TS (Gao et al., 2019). Along similar lines, Dong et al. report the derivation of TS cells from nave hPSCs, but not primed hPSCs routinely cultured under conditions different from those used in this study (Dong et al., 2020). Taken together these studies underscore the importance of hPSC culture conditions in their differentiation potential. Differences in hPSC culture conditions may lead to inconsistent results during trophoblast differentiation.
(20) Differences between hPSC-TS.sup.CDX2 and hPSC-TS cells. Marker expression analysis, functional differentiation assays, and genome-wide transcriptome analysis confirm the high similarity between hPSC-TS and placenta-derived TS cells that are similar to villous CTB. However, hPSC-TS.sup.CDX2 cells differ significantly from hPSC-TS cells. They do not undergo differentiation to EVTs under the culture conditions used for differentiating hPSC-TS and primary TS cells. Transcriptome analysis shows that genes associated with several key pathways and biological processes are differentially regulated between hPSC-TS.sup.CDX2 and hPSC-TS cells. Significantly, hPSC-TS.sup.CDX2 cells, but not hPSC-TS, express high levels of the trophectoderm-associated markers CDX2 and HAND1, associated with putative trophectoderm stem cells as proposed by Knfler et al. (2019). Consistent with the more primitive nature of hPSC-TS.sup.CDX2, they can be readily transitioned into TSCM used for culturing hPSC-TS, as was seen by Okae et al. (2018) when transitioning trophectoderm cells of blastocysts into TSCM. Subsequently, hPSC-TS.sup.CDX2 lose expression of CDX2 and express higher levels of P63 in TSCM, and can differentiate to form EVTs and STB. Note that TS cells derived from the trophectoderm in the blastocyst stage embryo lose expression of CDX2 (Okae et al., 2018). On the other hand, it has not been possible yet to revert hPSC-TS to hPSC-TS.sup.CDX2 by culturing in TM4 medium. Overall, the results provided herein clearly demonstrate that hPSC-TS.sup.CDX2 Cells are a more primitive cell type than hPSC-TS cells.
(21) Transcriptome data for hPSC-TS, hPSC-TS.sup.CDX2 and placenta-derived TS cells were compared with previously published data for trophectoderm cells from human embryos (Petropoulos et al., 2016). However, analysis from the present disclosure demonstrated greater similarity in average expression levels among different TS cell types in culture than between hPSC-TS.sup.CDX2 and primary trophectoderm cells. This could be due to differences between cells in culture and primary human embryos, and experimental protocols for transcriptome analysis.
(22) Considerations for derivation and culture of hPSC-TS.sup.CDX2 cells. To derive hPSC-TS.sup.CDX2 Cells, undifferentiated hESCs maintained in E8 medium were treated for 3 days with the S1PR3 agonist, BMP4 and the activin/nodal inhibitor SB4315432, to obtain CDX2.sup.+ cells. Subsequently, CDX2.sup.+ cells were passaged in TM4 medium to obtain hPSC-TS.sup.CDX2. Using this protocol, increased differentiation of H1 hESC-derived cells were observed upon passage into TM4 medium, relative to H9 hESC- and SBli006-A hiPSC-derived cells. Shortening the initial treatment step in case of H1 hESCs to 2 days eliminated excessive differentiation and facilitated derivation of hPSC-TS.sup.CDX2 Cells.
(23) The initial hESC differentiation step was carried out in E7 medium that contains bFGF. Differentiation of hESCs to trophoblast has been carried out in the presence or absence of exogenous FGF (Amita et al., 2013; Das et al., 2007). Consistent with this, it was found that hPSC-TS.sup.CDX2 could be formed even if the initial treatment was carried out in E6 medium lacking bFGF, instead of E7 medium.
(24) In some cases, hPSC-TS.sup.CDX2 cells proliferated more slowly in culture than hPSC-TS cells. Attachment of hPSC-TS.sup.CDX2 cells to tissue culture plates was less efficient than TS cells. Additionally, excessive differentiation in TM4 medium during early passages could be countered by reducing the concentration of ascorbic acid (32 g/mL instead of 64 g/mL) in TM4. Additional studies on composition of TM4 medium or the substrates used to coat tissue culture plates may lead to improved growth rate and attachment efficiency. Alternatively, the slower growth rate and less efficient attachment characteristics may be an inherent feature of the hPSC-TS.sup.CDX2 state. Nonetheless, data provided herein demonstrate successful maintenance of hPSC-TS.sup.CDX2 derived from all cell lines studied for at least 20 passages, in several independent runs over 5+ months.
(25) Derivation of hPSC-TS.sup.CDX2 and hPSC-TS cells from hiPSCs. Embodiments of the present disclosure demonstrate that hPSC-TS.sup.CDX2 and hPSC-TS cells can be derived from hiPSCs. Since hiPSCs can be derived by reprogramming easily accessible somatic tissues, hPSC-TS and hPSC-TS.sup.CDX2 cells derived from hiPSCs can greatly accelerate research in placental biology. Further, arguably a limitation of blastocyst- or placenta-derived hPSC-TS cells is that pregnancy outcomes at term for the early gestation placental samples or blastocyst stage embryos used cannot be predicted accurately. In contrast, hiPSC-derived hPSC-TS and hPSC-TS.sup.CDX2, from hiPSCs generated using somatic tissues obtained at term, will potentially enable development of models of validated normal and pathological trophoblast development. Pertinently, Sheridan et al. (2019) have derived hiPSCs from umbilical cords of normal pregnancies and those associated with early onset preeclampsia. The results provided herein also gain particular significance in light of restrictions on research with fetal tissue.
(26) Taken together, using optimized cell culture protocols detailed in the various embodiments of the present disclosure, two distinct stem cell populations of the trophectoderm lineagehPSC-TS.sup.CDX2 and hPSC-TShave been derived from human pluripotent stem cells. These stem cell models will be powerful tools for in vitro studies on human trophoblast development
(27) Section headings as used in this section and the entire disclosure herein are merely for organizational purposes and are not intended to be limiting.
1. DEFINITIONS
(28) Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. In case of conflict, the present document, including definitions, will control. Preferred methods and materials are described below, although methods and materials similar or equivalent to those described herein can be used in practice or testing of the present disclosure. All publications, patent applications, patents and other references mentioned herein are incorporated by reference in their entirety. The materials, methods, and examples disclosed herein are illustrative only and not intended to be limiting.
(29) The terms comprise(s), include(s), having, has, can, contain(s), and variants thereof, as used herein, are intended to be open-ended transitional phrases, terms, or words that do not preclude the possibility of additional acts or structures. The singular forms a, and and the include plural references unless the context clearly dictates otherwise. The present disclosure also contemplates other embodiments comprising, consisting of and consisting essentially of, the embodiments or elements presented herein, whether explicitly set forth or not.
(30) For the recitation of numeric ranges herein, each intervening number there between with the same degree of precision is explicitly contemplated. For example, for the range of 6-9, the numbers 7 and 8 are contemplated in addition to 6 and 9, and for the range 6.0-7.0, the number 6.0, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, and 7.0 are explicitly contemplated.
(31) For the recitation of numeric ranges herein, each intervening number there between with the same degree of precision is explicitly contemplated. For example, for the range of 6-9, the numbers 7 and 8 are contemplated in addition to 6 and 9, and for the range 6.0-7.0, the number 6.0, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, and 7.0 are explicitly contemplated.
(32) Correlated to as used herein refers to compared to.
(33) As used herein, the term animal refers to any animal (e.g., a mammal), including, but not limited to, humans, non-human primates, pigs, rodents (e.g., mice, rats, etc.), flies, and the like.
(34) The term cell culture process generally refers to the process by which cells are grown or maintained under controlled conditions. The cell culture process may take place in vitro or ex vivo. In some embodiments, a cell culture process has both an expansion phase and a production phase. In some embodiments, the expansion and production phases are separated by a transition or shift phase. Culturing a cell refers to contacting a cell with a cell culture medium under conditions suitable to for growing or maintaining the cell. A cell culture can also refer to a solution containing cells.
(35) The terms medium and cell culture medium (plural, media) generally refer to a nutrient source used for growing or maintaining cells. As is understood by a person of ordinary skill in the art, the nutrient source may contain components required by the cell for growth and/or survival or may contain components that aid in cell growth and/or survival. Vitamins, essential or non-essential amino acids (e.g., cysteine and cystine), and trace elements (e.g., copper) are examples of medium components. A cell culture medium may also be supplemented (e.g., with a medium supplement or supplement with any one or more of a component that aids the cell culture process.
(36) As used herein, the term subject and patient as used herein interchangeably refers to any vertebrate, including, but not limited to, a mammal (e.g., cow, pig, camel, llama, horse, goat, rabbit, sheep, hamsters, guinea pig, cat, dog, rat, and mouse, a non-human primate (e.g., a monkey, such as a cynomolgus or rhesus monkey, chimpanzee, etc.) and a human). In some embodiments, the subject may be a human or a non-human. In one embodiment, the subject is a human. The subject or patient may be undergoing various forms of treatment.
(37) As used herein, the term treat, treating or treatment are each used interchangeably herein to describe reversing, alleviating, or inhibiting the progress of a disease and/or injury, or one or more symptoms of such disease, to which such term applies. Depending on the condition of the subject, the term also refers to preventing a disease, and includes preventing the onset of a disease, or preventing the symptoms associated with a disease. A treatment may be either performed in an acute or chronic way. The term also refers to reducing the severity of a disease or symptoms associated with such disease prior to affliction with the disease. Such prevention or reduction of the severity of a disease prior to affliction refers to administration of a treatment to a subject that is not at the time of administration afflicted with the disease. Preventing also refers to preventing the recurrence of a disease or of one or more symptoms associated with such disease.
(38) Unless otherwise defined herein, scientific and technical terms used in connection with the present disclosure shall have the meanings that are commonly understood by those of ordinary skill in the art. For example, any nomenclatures used in connection with, and techniques of, cell and tissue culture, molecular biology, immunology, microbiology, genetics and protein and nucleic acid chemistry and hybridization described herein are those that are well known and commonly used in the art. The meaning and scope of the terms should be clear; in the event, however of any latent ambiguity, definitions provided herein take precedent over any dictionary or extrinsic definition. Further, unless otherwise required by context, singular terms shall include pluralities and plural terms shall include the singular.
2. COMPOSITIONS AND METHODS
(39) Embodiments of the present disclosure include compositions and methods related to the derivation of trophoblast stem cells. In particular, the present disclosure provides novel formulations and methods for deriving and maintaining trophoblast stem cells from human pluripotent stem cells, which can be used for basic research purposes, for developing treatments for pregnancy-associated pathologies such as preeclampsia, recurrent loss of pregnancy, placenta accreta, and intrauterine growth restriction, and developing diagnostics for assessing endometrial receptivity to embryo implantation.
(40) In accordance with these embodiments, the cell culture medium formulations provided herein generally include chemically defined medium, or growth medium suitable for the in vitro cell culture of human or animal cells. As would be recognized by one of ordinary skill in the art, serum-free media and chemically defined media are distinct. For example, serum-free media may contain undefined animal-derived products such as serum (purified from blood), hydrolysates, growth factors, hormones, carrier proteins, and attachment factors. These undefined animal-derived products will contain complex contaminants, such as the lipid content of albumin. In contrast, chemically defined media requires that the components be identified and have their exact concentrations known and is generally free of animal-derived components (e.g., fetal bovine serum, bovine serum, human serum).
(41) As described herein, one embodiment of the chemically defined cell culture medium used in the formulations of the present disclosure includes E7TM medium, which is E8 medium that lacks TGF. In some embodiments, the chemically defined cell culture medium used in the formulations of the present disclosure includes TeSR-E7 medium. In other embodiments, the chemically defined cell culture medium used in the formulations of the present disclosure includes E6 medium, which is E7 medium that lacks FGF2. In some embodiments, the chemically defined cell culture medium used in the formulations of the present disclosure includes TeSR-E6 medium.
(42) In some embodiments, the chemically defined cell culture medium of the present disclosure is capable of inducing differentiation of human embryonic stem cells (hESCs) into cytotrophoblasts (CTBs) or CTB-like cells. In accordance with these embodiments, the medium can include a sphingosine 1-phosphate receptor (STPR) agonist, an activin/nodal inhibitor, and at least one growth factor.
(43) In some embodiments, the S1PR agonist is an agonist of S1PR1 or S1PR3. In some embodiments, the S1PR agonist can include, but is not limited to, CYM5442, CYM5541, CYM55220, A971432, Ceralifimod, CS2100, CYM50260, CYM50308, FTY720, GSK2018682, RP001, SEW2871, TC-G1006, TC-SP14, and any derivatives or variants thereof. In some embodiments, a combination of S1PR agonists can be used.
(44) In some embodiments, the activin/nodal inhibitor can include, but is not limited to, SB431542, A83-01, and any derivatives or variants thereof. In some embodiments, a combination of activin/nodal inhibitors can be used.
(45) In some embodiments, the chemically defined cell culture medium used in the formulations of the present disclosure can include one or more growth factors. In some embodiments, the growth factor is bone morphogenic protein-4 (BMP4).
(46) In some embodiments, the chemically defined cell culture medium used in the formulations of the present disclosure can include one or more chemical compounds to enhance one or more aspects of the formulation. In some embodiments, the medium can include ascorbic acid. In some embodiments, the ascorbic acid is present in the medium at a concentration ranging from about 0.5 g/ml to about 40 g/ml.
(47) In some embodiments, the medium further comprises glucose. In some embodiments, the medium includes glucose at a concentration of 20 mM or less. In some embodiments, the medium includes glucose at a concentration of 19 mM or less. In some embodiments, the medium includes glucose at a concentration of 18 mM or less. In some embodiments, the medium includes glucose at a concentration of 17 mM or less. In some embodiments, the medium includes glucose at a concentration of 16 mM or less. In some embodiments, the medium includes glucose at a concentration of 15 mM or less. In some embodiments, the medium includes glucose at a concentration of 14 mM or less. In some embodiments, the medium includes glucose at a concentration of 13 mM or less. In some embodiments, the medium includes glucose at a concentration of 12 mM or less. In some embodiments, the medium includes glucose at a concentration of 11 mM or less. In some embodiments, the medium includes glucose at a concentration of 10 mM or less. In some embodiments, the medium includes glucose at a concentration of 9 mM or less. In some embodiments, the medium includes glucose at a concentration of 8 mM or less. In some embodiments, the medium includes glucose at a concentration of 7 mM or less. In some embodiments, the medium includes glucose at a concentration of 6 mM or less. In some embodiments, the medium includes glucose at a concentration of 5 mM or less. In some embodiments, the medium includes glucose at a concentration of 4 mM or less. In some embodiments, the medium includes glucose at a concentration of 3 mM or less. In some embodiments, the medium includes glucose at a concentration of 2 mM or less. In some embodiments, the medium includes glucose at a concentration of 1 mM or less.
(48) In some embodiments, the medium includes glucose at a concentration ranging from about 1 mM to about 20 mM. In some embodiments, the medium includes glucose at a concentration ranging from about 1 mM to about 18 mM. In some embodiments, the medium includes glucose at a concentration ranging from about 1 mM to about 16 mM. In some embodiments, the medium includes glucose at a concentration ranging from about 1 mM to about 14 mM. In some embodiments, the medium includes glucose at a concentration ranging from about 1 mM to about 12 mM. In some embodiments, the medium includes glucose at a concentration ranging from about 1 mM to about 10 mM. In some embodiments, the medium includes glucose at a concentration ranging from about 1 mM to about 9 mM. In some embodiments, the medium includes glucose at a concentration ranging from about 1 mM to about 8 mM. In some embodiments, the medium includes glucose at a concentration ranging from about 1 mM to about 7 mM. In some embodiments, the medium includes glucose at a concentration ranging from about 1 mM to about 6 mM. In some embodiments, the medium includes glucose at a concentration ranging from about 1 mM to about 5 mM. In some embodiments, the medium includes glucose at a concentration ranging from about 2 mM to about 20 mM. In some embodiments, the medium includes glucose at a concentration ranging from about 3 mM to about 15 mM. In some embodiments, the medium includes glucose at a concentration ranging from about 4 mM to about 10 mM. In some embodiments, the medium includes glucose at a concentration ranging from about 5 mM to about 20 mM. In some embodiments, the medium includes glucose at a concentration ranging from about 5 mM to about 15 mM. In some embodiments, the medium includes glucose at a concentration ranging from about 5 mM to about 10 mM. In some embodiments, the medium includes glucose at a concentration ranging from about 2 mM to about 8 mM. In some embodiments, the medium includes glucose at a concentration ranging from about 3 mM to about 6 mM. In some embodiments, the medium includes glucose at a concentration ranging from about 4 mM to about 5 mM.
(49) In some embodiments, CTBs cultured in the chemically defined cell culture medium of the present disclosure can exhibit altered expression of one or more of CDX2, TFAP2C, YAP, ELF5, TEAD4, KRT7, p63, GATA3, HAND1, or any combinations thereof. Altered expression can include decreases or increases in expression of these genes/proteins, which reflect, or are characteristic of, CTBs or CTB-like cells. Other phenotypic characteristics of CTBs or CTB-like cells can also be assessed. For example, in some embodiments, the CTBs can form a spherical structure (e.g., trophectoderm sphere).
(50) Embodiments of the present disclosure also include methods for inducing differentiation of human embryonic stem cells (hESCs) into cytotrophoblasts (CTBs) or CTB like cells. In accordance with these embodiments, the method can include culturing the hESCs in the chemically defined cell culture medium described herein, and assessing the hESCs for one or more phenotypic characteristics of CTBs (e.g., biomarker expression, trophectoderm sphere formation, etc.).
(51) In some embodiments, the chemically defined cell culture medium of the present disclosure is capable of inducing and maintaining differentiation of human cytotrophoblasts (CTBs) or CTB-like cells into trophoblast stem cells (hTSCs). In accordance with these embodiments, the medium can include a sphingosine 1-phosphate receptor (STPR) agonist, a GSK30 inhibitor, a TGF inhibitor, and at least one growth factor.
(52) In some embodiments, the S1PR agonist is an agonist of S1PR1, S1PR2, or S1PR3. In some embodiments, the S1PR agonist is an agonist of S1PR3. In some embodiments, the S1PR agonist includes, but is not limited to, CYM5442, CYM5541, CYM55220, A971432, Ceralifimod, CS2100, CYM50260, CYM50308, FTY720, GSK2018682, RP001, SEW2871, TC-G1006, TC-SP14, and any derivatives or variants thereof. In some embodiments, a combination of S1PR1, S1PR2, or S1PR3 agonists can be used.
(53) In some embodiments, the GSK30 inhibitor can include, but is not limited to, CHIR99021 and any derivatives or variants thereof.
(54) In some embodiments, the chemically defined cell culture medium used in the formulations of the present disclosure can include one or more growth factors. In some embodiments, the at least one growth factor is from the fibroblast growth factor (FGF) family of growth factors. In some embodiments, the growth factor includes fibroblast growth factor 7 (FGF7), fibroblast growth factor 10 (FGF10), and any derivatives or variants thereof. In some embodiments, a combination of FGF growth factors can be used.
(55) In some embodiments, the chemically defined cell culture medium used in the formulations of the present disclosure can include one or more chemical compounds to enhance one or more aspects of the formulation. In some embodiments, the medium can include ascorbic acid. In some embodiments, the ascorbic acid is present in the medium at a concentration ranging from about 0.5 g/ml to about 40 g/ml.
(56) In some embodiments, hTSCs cultured in the chemically defined cell culture medium of the present disclosure can exhibit altered expression of one or more of CDX2, TFAP2C, YAP, ELF5, TEAD4, KRT7, p63, GATA3, HAND1, or any combinations thereof. Altered expression can include decreases or increases in expression of these genes/proteins, which reflect, or are characteristic of, hTSCs or hTSC-like cells. Other phenotypic characteristics of hTSCs or hTSC-like cells can also be assessed. For example, in some embodiments, the hTSCs or hTSC-like cells can form a spherical structure (e.g., trophectoderm sphere).
(57) Embodiments of the present disclosure also include methods for inducing and maintaining differentiation of human cytotrophoblasts (CTBs) or CTB-like cells into trophoblast stem cells (hTSCs). In accordance with these embodiments, the method can include culturing the CTBs or CTB-like cells in the chemically defined cell culture medium described herein, and assessing the CTBs or CTB-like cells for one or more phenotypic characteristics of hTSCs (e.g., biomarker expression, trophectoderm sphere formation, etc.).
(58) In some embodiments, assessing the CTBs or CTB-like cells comprises measuring or detecting at least one of CDX2, TFAP2C, YAP, ELF5, TEAD4, KRT7, p63, GATA3, and HAND1. In some embodiments, assessing the CTBs or CTB-like cells comprises measuring or detecting at least two of CDX2, TFAP2C, YAP, ELF5, TEAD4, KRT7, p63, GATA3, and HAND1. In some embodiments, assessing the CTBs or CTB-like cells comprises measuring or detecting at least three of CDX2, TFAP2C, YAP, ELF5, TEAD4, KRT7, p63, GATA3, and HAND1. In some embodiments, assessing the CTBs or CTB-like cells comprises measuring or detecting at least four of CDX2, TFAP2C, YAP, ELF5, TEAD4, KRT7, p63, GATA3, and HAND1. In some embodiments, assessing the CTBs or CTB-like cells comprises measuring or detecting at least five of CDX2, TFAP2C, YAP, ELF5, TEAD4, KRT7, p63, GATA3, and HAND1. In some embodiments, assessing the CTBs or CTB-like cells comprises measuring or detecting at least six of CDX2, TFAP2C, YAP, ELF5, TEAD4, KRT7, p63, GATA3, and HAND1. In some embodiments, assessing the CTBs or CTB-like cells comprises measuring or detecting at least seven of CDX2, TFAP2C, YAP, ELF5, TEAD4, KRT7, p63, GATA3, and HAND1. In some embodiments, assessing the CTBs or CTB-like cells comprises measuring or detecting at least eight of CDX2, TFAP2C, YAP, ELF5, TEAD4, KRT7, p63, GATA3, and HAND1. In some embodiments, assessing the CTBs or CTB-like cells comprises measuring or detecting all nine of CDX2, TFAP2C, YAP, ELF5, TEAD4, KRT7, p63, GATA3, and HAND1.
(59) In some embodiments, assessing the CTBs or CTB-like cells comprises determining the shape or dimensions of the CTBs or CTB-like cells. In some embodiments, determining the shape or dimensions of the CTBs or CTB-like cells indicates whether they have formed a spherical structure and are considered hTSCs.
3. MATERIALS AND METHODS
(60) Culture of hESCs and hiPSCs. H1 and H9 hESCs and SBli006-A hiPSCs were cultured on plates coated with vitronectin (5 g/ml) at room temperature for at least one hour. Cells were cultured in 2 ml of TeSR-E8 medium at 37 C. in 5% CO.sub.2 in 6-well plates and culture medium was replaced every day. When cells reached confluency, they were passaged using ReLeSR according to the manufacturer's protocol, at a 1:10 split ratio.
(61) Differentiation of hPSCs (6 days protocol). The day after passaging, differentiation was initiated in H1 or H9 hESCs by treatment with S1P (10 M), SB431542 (25 M) and BMP4 (20 ng/ml) in TeSR-E7 for 6 days. In some experiments, the S1PR agonists CYM5442 hydrochloride (10 nM), CYM5520 (5 M), or CYM5541 (2 M) was added during the differentiation process. The medium was replaced every day. At day 6 of treatment, cells were dissociated with TrypLE for 5 min at 37 C. For differentiation to EVTs, cells were seeded in a 6-well plate pre-coated with 5 g/ml of vitronectin at a density of 710.sup.4 cells per well and cultured in 2 ml of EVT medium (TeSR-E8 medium supplemented with SB431542 (25 M) and EGF (2.5 ng/ml)). Medium was replaced every other day and analyzed at day 12 of total treatment. For differentiation to STB, cells were seeded in a 6-well plate pre-coated with 5 g/ml of vitronectin at a density of 410.sup.4 cells per well and cultured in 2 ml of STB medium (TeSR-E6 supplemented with Activin A (20 ng/ml) and EGF (50 ng/ml)). Medium was replaced every other day and analyzed at day 14 of total treatment.
(62) Differentiation of hPSCs to hPSC-TS.sup.CDX2 and hPSC-TS cells. The day after passaging, hESCs or hiPSCs were differentiated by treatment with CYM5541 (2 M), SB431542 (25 M), BMP4 (20 ng/ml) in TeSR-E7 for 2 and 3 days for H1 and H9 hESCs, respectively. The medium was replaced every day. After 2 or 3 days of treatment, cells were dissociated with TrypLE for 5 minutes at 37 C. For propagation of hPSC-TS.sup.CDX2 cells, all cells were seeded in a 6-well plate pre-coated with 3 g/ml of vitronectin and 1 g/ml of Laminin 521 at a density of 510.sup.4 cells per well and cultured in 2 ml of TM4 medium (TeSR-E6 medium supplemented with CYM5541 (2 M), A 83-01 (0.5 M), FGF10 (25 ng/ml) and CHIR99021 (2 M)). For establishment of hPSC-TS cells, all cells were seeded in a 6-well plate pre-coated with 3 g/ml of vitronectin and 1 g/ml of Laminin 521 at a density of -510.sup.4 cells per well and cultured in 2 ml of TSCM developed by Okae et al. (2018) (DMEM/F12 supplemented with 0.1 mM 2-mercaptoethanol, 0.2% FBS, 0.5% Penicillin-Streptomycin, 0.3% BSA, 1% ITS-X supplement, 1.5 g/ml L-ascorbic acid, 50 ng/ml EGF, 2 M CHIR99021, 0.5 M A83-01, 1 M SB431542, 0.8 mM VPA and 5 M Y27632). hPSC-TS.sup.CDX2 cells were directly passaged into TSCM for formation of hPSC-TS cells s; complete transition took 5 passages. Alternatively, hPSCs after 2 or 3 days of differentiation were directly passaged into TSCM.
(63) Culture of hPSC-TS.sup.CDX2 and hPSC-TS cells. hPSC-TS.sup.CDX2 and hPSC-TS cells were cultured in TM4 and TSCM, respectively, in 2 ml of culture medium at 37C in 5% CO.sub.2. Culture medium was replaced every 2 days. When hPSC-TS.sup.CDX2 and hPSC-TS cells reached 70-90% confluence, they were dissociated with TrypLE at 37 C. for 5-10 minutes and passaged to a new 6-well plate pre-coated with 3 g/ml of vitronectin and 1 g/ml of Laminin 521 at a 1:3-1:4 split ratio for hPSC-TS.sup.CDX2 and 1:4-1:6 split ratio for hPSC-TS cells. hPSC-TS.sup.CDX2 cells grown in TM4 medium were supplemented with Y-27632 upon passage to aid in single cell attachment. Cells were routinely passaged approximately every 4-6 days. hPSC-TS.sup.CDX2 and hPSC-TS cells at passages 5.sup.+ were used for analysis, with the exception of one replicate of H1-derived hPSC-TS.sup.CDX2 used in RNA-sequencing analysis where cells at passage 2 in TM4 were used. Placenta-derived TS cellsCT30 (female) and CT29 (male), a kind gift from Drs. Hiroaki Okae and Takahiro Arima (Tohoku University, (Okae et al., 2018))were grown and passaged the same way in TSCM as hPSC-TS cells.
(64) Differentiation of hPSC-TS.sup.CDX2 and hPSC-TS cells. hPSC-TS cells were grown to 80-90% confluence in TSCM and dissociated with TrypLE for 10 min at 37 C. For differentiation to EVTs and STB, slightly modified versions of protocols developed by Okae et al. (2018) were used. For differentiation to EVTs, hPSC-TS cells were seeded in 6-well plates pre-coated with 3 g/ml vitronectin and 1 g/ml of Laminin 521 at a density of 1.2510.sup.5 cells per well and cultured in 2 mL of EVT medium (DMEM/F12 supplemented with 0.1 mM 2-mercaptoethanol, 0.5% Penicillin-Streptomycin, 0.3% BSA, 1% ITS-X supplement, 100 ng/ml NRG1, 7.5 M A83-01, 2.5 M Y27632, and 4% KSR). MATRIGEL was added to a final media concentration of 2% after suspending the cells in EVT medium. At day 3, the medium was replaced with the EVT medium without NRG1, and MATRIGEL was added to a final concentration of 0.5%. At day 6, cells were dissociated with TrypLE for 15 min at 37 C. and passaged to a new vitronectin/laminin-coated 6-well plates at a 1:2 split ratio. The cells were suspended in the EVT medium without NRG1 and KSR. MATRIGEL was added to a final concentration of 0.5%, and cells were analyzed after two additional days of culturing. For differentiation to STB, cells were seeded in 6-well plates pre-coated 3 g/ml vitronectin and 1 g/ml of Laminin 521 at a density of 1.5 10.sup.5 cells per well and cultured in 2 mL of DMEM/F12 supplemented with 0.1 mM 2-mercaptoethanol, 0.5% Penicillin-Streptomycin, 0.3% BSA, 1% ITS-X supplement, 2.5 M Y27632, 2 M forskolin, and 4% KSR. The medium was replaced at day 3, and cells were analyzed at day 6.
(65) RNA Isolation, cDNA synthesis and Quantitative PCR. RNA was isolated using TRIZOL reagent using the manufacturer's protocol. For cDNA synthesis, the RNA pellet was dissolved in diethyl pyrocarbonate (DEPC)-treated water. The RNA was purified using Baseline-ZERO DNase buffer and Baseline-ZERO DNase enzyme and incubating at 37 C. for 30 min. The purification was stopped with Baseline-ZERO DNase stop solution and heated at 65 C. for 10 min. cDNA was synthesized using 18-mer Oligo-dT and dNTP mix and heated to 65 C. for 5 min and quickly chilled on ice. First strand buffer and DTT was added and incubated at 42 C. for 2 min then superscript II RT enzyme was added and incubated at 42 C. for 50 min. The enzyme was inactivated at 70 C. for 15 min. The cDNA was stored at 20 C. until further used. The Quantitative PCR (qPCR) reaction was carried out using SYBR Green Supermix in a C1000 Touch Thermal Cycler CFX384 Real-Time System (Rio-Rad). The primers used for qPCR analysis are listed below. ANOVA analysis of gene expression data was carried out with SAS and package PCR in R software using the Ct method to determine gene expression changes (Livak and Schmittgen, 2001). QPCR analysis was carryout out using at least 3 biological replicates.
(66) Immunofluorescence analysis. For immunofluorescence analysis, cells were grown on glass-bottom culture dishes coated with 3 g/ml vitronectin and 1 g/ml of Laminin 521. Cells were fixed either using 4% paraformaldehyde in PBS for 10 min, permeabilized with 0.5% Triton X-100 for 5 min and blocked in 3% BSA/PBS with 0.1% human IgG and 0.3% Triton X-100 for 1 hr. Cells were then incubated overnight with the primary antibody diluted in blocking buffer. The following primary antibodies were used: anti-KRT7 (SCB, 1:50), anti-KRT7 (CST, 1:500), rabbit anti-hCG (1:100), mouse anti-hCG (1:100), anti-YAP (1:200), anti-TFAP2C (1:400), anti-P63 (1:600), anti-GATA3 (1:500), anti-TEAD4 (1:250), anti-CDX2 (1:300), anti-VE-Cadherin (1:400), anti-HLA-G (1:300), anti-syncytin (1:50). Corresponding isotype controls (rabbit polyclonal IgG, rabbit XP IgG, mouse IgG1, and mouse IgG2a) were used at primary antibody concentrations. ALEXA FLUOR 488- or ALEXA FLUOR 647-conjugated secondary antibodies were used as secondary antibodies. Nuclei were stained with DAPI and all samples were imaged using a Zeiss LSM 710 or 880 laser scanning confocal microscope (Carl Zeiss, Germany).
(67) Confocal image analysis. Image analysis was conducted using an image processing algorithm created in MATLAB. First, the DAPI stain was isolated, binarized, and processed to accurately represent the number of cells in each image. The primary-antibody stain of interest was isolated and processed in the same manner. Only primary-antibody pixels that overlap DAPI pixels were considered for analysis, and the average intensities of those pixels were measured and correlated to the nearest nuclei. This was performed for one control image and multiple experimental images. Each cell in the experimental images was considered positively stained if the average intensity of that cell was greater than the average intensity of all of the cells in the control image. Statistical analysis was done using a two-tailed t-test evaluating percent positive cells from different treatment periods.
(68) Flow cytometry analysis. For flow cytometry analysis, cells were dissociated with TrypLE for 5 min at 37 C. Cells were fixed in suspension in 2% paraformaldehyde in PBS for 5 minutes at room temperature. Cells were permeabilized and blocked in 1% BSA/PBS with 1 mg/mL Saponin (Sigma 47036-50G-F) for 15 minutes at room temperature. Cells were then incubated for one hour on ice with the primary antibody diluted in the blocking buffer. The corresponding isotype control was used at the primary antibody concentration. Subsequently, cells were incubated in an ALEXA FLUOR 488-conjugated secondary antibody on ice protected from light for one hour and analyzed immediately in a 1% BSA/PBS buffer. A BD Accuri C6 Plus Flow Cytometer was used for analysis. Data from 10,000 events were collected.
(69) RNA sequencing analysis using next generation sequencing. Total RNA was extracted with TRIZOL reagent using manufacturer's protocol. RNA was purified using GeneJET RNA Purification Kit using manufacturer's protocol. Isolated RNA samples were then used to evaluate genome-wide mRNA expression profiles using next generation RNA-sequencing, conducted at GENEWIZ, LLC. (South Plainfield, NJ, USA). RNA samples received at GENEWIZ were quantified using Qubit 2.0 Fluorometer (Life Technologies, Carlsbad, CA, USA) and RNA integrity was checked using Agilent TapeStation 4200 (Agilent Technologies, Palo Alto, CA, USA).
(70) RNA sequencing libraries were prepared using the NEBNext Ultra RNA Library Prep Kit for ILLUMINA following manufacturer's instructions (NEB, Ipswich, MA, USA). Briefly, mRNAs were first enriched with Oligo(dT) beads. Enriched mRNAs were fragmented for 15 minutes at 94 C. First strand and second strand cDNAs were subsequently synthesized. cDNA fragments were end repaired and adenylated at 3ends, and universal adapters were ligated to cDNA fragments, followed by index addition and library enrichment by limited-cycle PCR. The sequencing libraries were validated on the Agilent TapeStation (Agilent Technologies, Palo Alto, CA, USA), and quantified by using Qubit 2.0 Fluorometer (Invitrogen, Carlsbad, CA) as well as by quantitative PCR (KAPA Biosystems, Wilmington, MA, USA).
(71) The sequencing libraries were clustered on 4 lanes of a flowcell. After clustering, the flowcell was loaded on the ILLUMINA HiSeq 4000 instrument according to manufacturer's instructions. The samples were sequenced using a 2150 bp Paired End (PE) configuration. Image analysis and base calling were conducted by the HiSeq Control Software (HCS). Raw sequence data (.bcl files) generated from ILLUMINA HiSeq was converted into fastq files and de-multiplexed using ILLUMINA's bcl2fastq 2.17 software. One mismatch was allowed for index sequence identification.
(72) After investigating the quality of the raw data, sequence reads were trimmed to remove possible adapter sequences and nucleotides with poor quality using Trimmomatic v.0.36. The trimmed reads were mapped to the Homo sapiens GRCh38 reference genome available on ENSEMBL using the STAR aligner v.2.5.2b. The STAR aligner is a splice aligner that detects splice junctions and incorporates them to help align the entire read sequences. BAM files were generated as a result of this step. Unique gene hit counts were calculated by using feature Counts from the Subread package v.1.5.2. Only unique reads that fell within exon regions were counted.
(73) Analysis of gene expression profiles. After extraction of gene hit counts, the gene hit counts table was used for downstream differential expression analysis. Genome-wide RNA sequencing count data were processed and statistically assessed using the DESeq2 package (v1.22.2) in R Software (3.6.0) (The R Foundation, 2019). Count data were first filtered to include transcripts expressed above background, requiring the median across samples to be greater than the overall median signal intensity, as implemented in DESeq2. Count data were then normalized by median signal intensity using algorithms enabled within DESeq2, resulting in variance stabilized expression values (Love et al., 2014). These normalized values were used to carry out a principal component analysis (PCA) comparing data-reduced global expression signatures across samples. Principal components were calculated and visualized using the prcomp function in R (R-core, 2019). The average gene expression levels of different cell types was compared using the Spearman rank correlation test. Transcriptome profiles obtained by single cell RNA sequencing of human embryos, and annotated as trophectoderm (Petropoulos et al., 2016), were combined for comparison with gene expression data from human trophectoderm cells. Heat maps were generated using Partek Genomics Suite Software (v7.18.0723) and gene-specific plots using GraphPad Prism Software (v8.2.0)), based on normalized expression values.
(74) Statistical and gene set enrichment analysis of differentially expressed genes. Genes that showed the greatest difference in expression between the day 3 differentiated hESCs and undifferentiated hESCs, and hPSC-TS.sup.CDX2 and hPSC-TS cells were identified using an analysis of variance analysis (ANOVA) comparing the normalized expression levels between these two groups. Genes showing the greatest difference in expression between hPSC-TS.sup.CDX2 and hPSC-TS cells were identified using the following statistical filters: (1) a false discovery rate-corrected q-value<0.05 (Storey, 2003), and (2) a fold change in expression (ratio of average across hPSC-TS.sup.CDX2 and hPSC-TS cells samples)1.5. To evaluate the biological role of these genes, a gene set enrichment analysis was carried out on the genes identified as significantly differentially expressed between groups. Specifically, all Gene Ontology (GO) gene sets (n=9996) from the Molecular Signature Database (MSigDB) (The Broad Institute, 2019) were queried for using the right-tailed Fisher's Exact test, as enabled through the platform for integrative analysis of omics data (PIANO) packing in R (Varemo et al., 2013). Gene sets were required to have an enrichment p-value<0.01 to be considered significant, consistent with previously published methods (Klaren et al., 2019; Rager et al., 2019). Genes that were identified at higher expression levels were evaluated separately from genes identified at significantly lower expression levels in day 3 differentiated hESCs vs. undifferentiated hESCs, and hPSC-TS.sup.CDX2 vs. hPSC-TS cells.
(75) TABLE-US-00001 TABLE 1 Reagents and resources REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-KRT7 Santa Cruz Biotechnology Cat#sc-23876, RRID:AB_2265604 Anti-KRT7 Cell Signaling Technologies Cat# 4465, RRID:AB_11178382 Anti-hCG Abcam Cat# ab9582, RRID:AB_296507 Anti-hCG Abcam Cat# ab9376, RRID:AB_307221 Anti-P63 Cell Signaling Technologies Cat# 13109, RRID:AB_2637091 Anti-GATA3 Cell Signaling Technologies Cat# 5852, RRID:AB_10835690 Anti-TFAP2C Cell Signaling Technologies Cat# 2320, RRID:AB_2202287 Anti-YAP Cell Signaling Technologies Cat# 4912, RRID:AB_2218911 Anti-TEAD4 Abcam Cat# ab58310, RRID:AB_945789 Anti-CDX2 Abcam Cat# ab76541, RRID:AB_1523334 Anti-VE-Cadherin Cell Signaling Technologies Cat# 2500, RRID:AB_10839118 Anti-HLA-G Abeam Cat# ab52455, RRID:AB_880552 Anti-Syncytin Santa Cruz Biotechnology Cat# sc-50369, RRID:AB_2101536 Rabbit Polyclonal IgG R&D Systems Cat# AB-105-C, RRID:AB_354266 Rabbit XP IgG Cell Signaling Technologies Cat# 3900, RRID:AB_1550038 Mouse IgG1 Abcam Cat# ab18447, RRID:AB_2722536 Mouse IgG2a Abcam Cat# 554126, RRID:AB_479661 Alexa Fluor 488-conjugated Thermo Fisher Scientific Cat# A-11034, anti-rabbit IgG RRID:AB_2576217 Alexa Fluor 647-conjugated Thermo Fisher Scientific Cat# A-21052, anti-rabbit IgG RRID:AB_2535719 DAPI R&D Systems Cat#5748 CellMask deep red plasma Invitrogen Cat#C10046 membrane stain Chemicals, Peptides, and Recombinant Proteins TrypLE Thermo Fisher Scientific Cat#12604013 Vitronectin Thermo Fisher Scientific Cat#A14700 Laminin 521 Stem Cell Technologies Cat#77003 Human FGF-10 Stem Cell Technologies Cat#78037 TeSR-E8 Stem Cell Technologies Cat#05990 TeSR-E7 Stem Cell Technologies Cat#05914 TeSR-E6 Stem Cell Technologies Cat#05946 ReLeSR Stem Cell Technologies Cat#05872 Sphingosine-1-phosphate Tocris Cat#1370 D-erythro- Abcam Cat#ab141750 dihydrosphingosine-1- phosphate SB431542 Tocris Cat#1614 BMP4 Thermo Fisher Scientific Cat#PHC9534 CYM5442 hydrochloride Tocris Cat#3601 CYM5520 Tocris Cat#5418 CYM5541 Tocris Cat#4897 Y-27632 dihydrochloride Tocris Cat#1254 EGF R&D Systems Cat#236-EG Doxycycline hyclate Tocris Cat#4090 Puromycin dihydrochloride Tocris Cat#4089 Activin A R&D Systems Cat#338-AC Greiner Bio-one Cell View Greiner Bio-one Cat#627965 glass plates 4% Paraformaldehyde in Thermo Fisher Scientific Cat#R37814 PBS Triton X-100 Sigma Cat#T8787 PBS w/o CaMg Sigma Cat#D5773 PBS w/ CaMg Sigma Cat#D8662 Human IgG Immunoreagents Cat#Hu-003-C BSA Fisher Scientific Cat#BP9703 10% BSA fatty acid free in Sigma Cat#A1595 PBS VPA Sigma Cat#P6273 A83-01 Tocris Cat#2939 2-mercaptoethanol Sigma Cat#M3148 FBS Thermo Fisher Scientific Cat#16141-061 DMEM/F12 Thermo Fisher Scientific Cat#11320033 ITS-X Thermo Fisher Scientific Cat#51500-056 L-ascorbic acid Sigma Cat#A8960 Pen/Strep Thermo Fisher Scientific Cat#15140122 Forskolin Tocris Cat#1099 Neuregulin Cell Signaling Technologies Cat#5218SC Matrigel Corning Cat#354234 KSR Thermo Fisher Scientific Cat#10828028 TRIZOL Reagent Thermo Fisher Scientific Cat#15596018 DEPC Sigma Cat#95284 Baseline Zero DNAase Kit VWR Cat#76081-624 Oligo-dT IDT Cat#51-01-15-07 dNTP mix Thermo Fisher Scientific Cat#10297018 Superscript II RT Thermo Fisher Scientific Cat#18064014 SYBR Green Supermix Bio-rad Cat#1725272 Methanol Fisher Scientific Cat#A412-500 Acetone Fisher Scientific Cat#A18-500 Critical Commercial Kits GeneJET RNA Purification Thermo Fisher Scientific Cat#K0731 Kit Oligonucleotides qPCR Primers IDT Methods S1 for primer sequences Software and Algorithms R (v3.6.0) http://www.R-project.org/ N/A DESeq2 package (v1.22.2) PCR package (v1.2.2) SAS Software N/A Zeiss Zen Software https://www.zeiss.com/microscopy/us/ N/A products/microscope-sofware/zen-lite.html
4. EXAMPLES
(76) It will be readily apparent to those skilled in the art that other suitable modifications and adaptations of the methods of the present disclosure described herein are readily applicable and appreciable, and may be made using suitable equivalents without departing from the scope of the present disclosure or the aspects and embodiments disclosed herein. Having now described the present disclosure in detail, the same will be more clearly understood by reference to the following examples, which are merely intended only to illustrate some aspects and embodiments of the disclosure, and should not be viewed as limiting to the scope of the disclosure. The disclosures of all journal references, U.S. patents, and publications referred to herein are hereby incorporated by reference in their entireties.
(77) The present disclosure has multiple aspects, illustrated by the following non-limiting examples.
Example 1
(78) A chemically defined medium containing S1P enables differentiation of hESCs to CTB. Media formulations in previous studies on trophoblast differentiation of hESCs included components such as knockout serum replacement (KSR) or bovine serum albumin (BSA) that act as carriers for lipids. Albumin-associated lipids have been implicated in activation of G-protein coupled receptor (GPCR)-mediated signaling. For instance, the phospholipid sphingosine-1 phosphate (S1P) present in KSR can activate YAP signaling; YAP plays a critical role in specification of the trophectoderm in mouse. The use of S1P in the context of trophoblast differentiation of hESCs was investigated under chemically defined culture conditions, by modifying previous protocols that utilized KSR (Sarkar et al., 2016, 2015). H1 and H9 hESCs cultured in E8 medium were differentiated for 6 days in E7 medium (E8 without transforming growth factor-beta1 (TGF1)) supplemented with S1P, by treatment with BMP4 and the activin/nodal inhibitor SB431542 (
(79) The putative CTB cells obtained at day 6 were investigated for their ability to differentiate to EVTs and STB, using protocols similar to those previously employed (Sarkar et al., 2015). Cells underwent an epithelial to mesenchymal transition over a 6-day period when passaged into E8 medium supplemented with epidermal growth factor (EGF) and SB431542. Immunofluorescence analysis showed expression of KRT7 and the EVT markers VE-Cadherin and HLA-G (
(80) Taken together, these results show that CTB-like cells can be obtained by differentiation of hESCs in a chemically defined medium containing S1P. Further, inclusion of S1P is important for hESC differentiation to trophoblast in the chemically defined culture medium of the present disclosure.
Example 2
(81) S1P mediates its effects on trophoblast differentiation of hESCs through its receptors. S1P acts through both receptor-mediated and receptor-independent pathways. To investigate the specific mechanism of S1P action during hESC differentiation to trophoblast, S1P was replaced with D-erythro-dihydrospingosine-1-phosphate (dhS1P). dhS1P acts as an agonist for the S1P receptors (S1PRs) but does not mediate an intracellular effect (Van Brocklyn et al., 1998). Replacing S1P with dhS1P yielded similar resultsCTB-like cells showed expression of CDX2, GATA3, P63, and TEAD4 (
(82) S1P acts extracellularly through S1PR1-5, however TBs have been shown to only express S1PR1-3. To identify specific S1PRs involved in trophoblast differentiation of hESCs in the culture systems used herein, selective chemical agonists were used for S1PR1-3CYM5442 hydrochloride, CYM5520 and CYM5541, respectivelyto replace S1P in differentiation protocols previously discussed. Expression of CDX2, GATA3, P63, and TEAD4 was observed in CTB-like cells for all three agonists (
(83) Taken together, these results show that receptor-mediated effects of exogenous S1P are sufficient for trophoblast differentiation of hESCs in the culture systems used herein. Since these qualitative observations showed that use of the S1PR3 agonist resulted in high CDX2 expression, and both multinucleate STB and mesenchymal EVTs could be obtained when the S1PR3 agonist was used, the S1PR3 agonist was chosen for subsequent studies.
Example 3
(84) Optimizing timing of hESC differentiation enables derivation of CDX2.sup.+ TS cells. The question of whether CTB-like cells obtained by treatment of hESCs with BMP4 and SB431542 in E7 medium supplemented with the S1PR3 agonist CYM5541 for 6 days could be passaged and maintained under conditions used for culture of blastocyst- and placenta-derived primary TS cells was investigated. Upon plating in trophoblast stem cell medium (TSCM) developed by Okae et al. (2018), hESC-derived CTB-like cells underwent differentiation, and epithelial colonies could not be retained after a single passage. CDX2 expression is upregulated significantly in as little as 2 days after initiation of hESC differentiation, but decreases by day 6 (
(85) CDX2.sup.+ cells at day 3 were passaged into a chemically defined medium containing four major components (denoted TM4)the S1PR3 agonist CYM5541, the GSK30 inhibitor CHIR99021, the TGF inhibitor A83-01, and FGF10. CHIR99021 and A83-01 are components of TSCM used for culture of primary TS cells; FGF10 was included because FGFR2b signaling is active in blastocyst- and placenta-derived TS cells and the early placenta. Cells in TM4 could be maintained as epithelial colonies for 30.sup.+ passages over the course of 5 months. In TM4 medium, cells derived from H9 and H1 hESCs retained expression of the trophoblast markers CDX2, TFAP2C, YAP, TEAD4, and GATA3 (
(86) The differentiation potential of hPSC-TS.sup.CDX2 cells was further evaluated using same protocols as those used by Okae et al. (2018) for differentiation of primary TS cells to EVTs and STB (Okae et al., 2018). Cells were able to form multinucleate STB that expressed hCG and KRT7 (
Example 4
(87) CDX2.sup./P63.sup.+ TS cells derived from hESCs can be maintained in medium used for primary TS cells. The question of whether hPSC-TS.sup.CDX2 cells could be maintained in TSCM used for culturing primary TS cells was evaluated (
(88) The differentiation potential of hPSC-TS cells was further evaluated using the same protocols as those used by Okae et al. (2018) for differentiation of primary TS cells to EVTs and STB (Okae et al., 2018). Similar to placenta-derived TS cell controls (
(89) Taken together along with differences in culture conditions for maintenance, differentiation behavior, and expression of the trophectoderm marker CDX2, these results suggest that hPSC-TS.sup.CDX2 and hPSC-TS cells represent two distinct stem cell populations, with hPSC-TS.sup.CDX2 being a more primitive cell type.
Example 5
(90) Transcriptome analysis confirms high similarity between hPSC-TS cells and placenta-derived TS cells and reveals differences between hPSC-TS.sup.CDX2 and hPSC-TS cells. Genome wide transcriptome analysis was performed on hPSC-TS.sup.CDX2, hPSC-TS and placenta-derived TS (control) cells using RNA sequencing. Note that since hPSC-TS and placenta-derived TS cells are cultured under identical conditions, the analysis represents a direct comparison between transcriptome profiles across these two cell types. Principal component analysis (PCA) of transcriptomic signatures showed that hESC-derived and primary TS cells cluster together, indicating similarities in overall gene expression (
(91) PCA also showed that hPSC-TS.sup.CDX2 cells are a distinct cell type that cluster differently from hPSC-TS cells and hESCs differentiated to the trophoblast lineage for 3 days (
(92) Additionally, the transcriptome profiles of hPSC-TS.sup.CDX2, hPSC-TS, and placenta-derived TS cells were compared with the transcriptome of trophectoderm cells from human embryos. The Spearman Rank correlation test was used to correlate gene expression levels between primary trophectoderm cells and hPSC-TS.sup.CDX2, hPSC-TS, or placenta-derived TS cells (data not shown but can be available upon request). The correlation R values were similar for all three TS cell types, and lower than those generating when comparing between hPSC-TS cells and placenta-derived TS cells or hPSC-TS.sup.CDX2 and hPSC-TS cells. The lower correlation R values are likely due to the differences between cells in culture and primary human embryos and experimental protocols for transcriptome analysis; trophectoderm cells from human embryos were analyzed using single cell RNA sequencing, as opposed to bulk RNA sequencing in the present disclosure.
Example 6
(93) hPSC-TS.sup.CDX2 and hPSC-TS cells can be generated from hiPSCs. Experiments were also conducted to test whether the results obtained on derivation of hPSC-TS.sup.CDX2 and hPSC-TS cells from hESCs could be extended to hiPSCs. Accordingly, previously described protocols were used (
Example 7
(94) hTSC.sup.CDX2 and hTSC.sup.P63 can be generated from human iPSCs. Lastly, whether the results on derivation of hTSCs from hESCs could be extended to human iPSCs was investigated. Accordingly, the previously described protocols were used to derive hTSC.sup.CDX2 and hTSC.sup.P63 the human iPSC line SBli006-A. hTSC.sup.CDX2 derived from SBli006-A hiPSCs maintained expression of CDX2, TFAP2C, GATA3, YAP KRT7, and TEAD4, along with low expression level of P63 (
Example 8
(95) Cells in TM4 medium express markers consistent with a putative trophectoderm stem cell. Previous studies have proposed that putative trophectodermal stem cells are characterized by expression of the markers CDX2, HAND1, and TEAD4. Immunofluorescence and RNA-seq analysis confirms expression of CDX2 and HAND1 in hTSC.sup.CDX2 (cultured in TM4) but not in hTSC.sup.p63 (
Example 9
(96) Spherical structures representative of the trophectoderm in the blastocyst-stage embryo can be obtained from TM4 cells but not cells in TSCM. Spherical structurestermed trophectoderm spheresthat correspond to empty blastocyst shells can be obtained using the protocol in the Materials and Methods. In the protocol used, 50-100 cells are cultured in suspension, in E6 medium supplemented with A83-01 (2-8 M), FGF10 (0-25 ng/ml), Y-27632 (5 M), and 2% MATRIGEL. Note that, this medium is similar to TM4 but has key differences, namely, the GSK3-beta inhibitor CHIR99021 is absent. The ROCK inhibitor Y-27632 is included. MATRIGEL was included in the medium. The extracellular matrix components in MATRIGEL (e.g., laminin, collagen) are likely involved in formation of the trophectoderm spheres. MATRIGEL also contains growth factors (e.g., EGF and TGF). The addition of the TGF inhibitor A83-01 may also be involved (e.g., to counterbalance the effect of MATRIGEL addition). These spherical structures were not formed using cells cultured in TSCM, which further confirms differences between cells cultured in TSCM vs. TM4. Thus, the ability of cells cultured TM4 medium to form trophectoderm underscores their physiological relevance to in vivo settings and provides a useful model of implantation.
Example 10
(97) Transcriptome analysis confirms equivalence of hESC-derived and primary hTSCs and reveal differences between hTSC.sup.CDX2 and hTSC.sup.P63. Genome wide transcriptome analysis was conducted on hTSC.sup.CDX2 and hESC-derived and primary hTSCs (hTSC.sup.P63) using RNA sequencing. Principal component analysis (PCA) of transcriptome data showed that hESC-derived and primary hTSC.sup.P63 cluster together, indicating similarities in overall gene expression (
(98) PCA also showed that hTSC.sup.CDX2 are a distinct population of cells that cluster differently from hTSC.sup.P63 and hESCs differentiated to the trophoblast lineage for 3 days. Higher expression of the trophectoderm-associated markers CDX2 and HAND1 is observed in hTESCs relative to hTSCs. On the other hand, expression of TP63, which is associated with villous CTB, is higher in hTSCs relative to hTESCs (
(99) Taken together, along with distinct medium requirements for maintenance in cell culture, and differences in EVT differentiation under identical assay conditions, these results demonstrate that hTSC.sup.CDX2 and hTSC.sup.P63 represent distinct stem cell populations.
Example 11
(100) Generation of trophectospheres from hiPSCs. Treatment of hiPSCs for 3 days with BMP4, S1PR3 agonist and the activin/nodal inhibitor SB431532 in chemically defined medium, resulted in formation of CDX2.sup.+ cells (denoted here as day 3 cells). Subsequently, day 3 cells are cultured in TM4 medium to obtain CDX2T putative hTESCs. Further culture of hTESCs under conditions described by Okae et al., results in formation of CDX2.sup./p63.sup.+ hTSCs.
(101) In the present disclosure, data demonstrates that culture of day 3 cells or hTESCs at very low initial seeding density (e.g., 1-5 cells per well in Aggrewell plates) in TM4 medium in the presence of soluble extracellular matrix protein (MATRIGEL), results in the formation of empty blastocyst like structures termed trophectospheres (
(102) Experiments were conducted to determine whether trophectospheres can attach to a cell-free surface on tissue culture plates. As shown in
(103) Experiments were also conducted to determine whether trophectospheres attach to confluent Ishikawa cells. Trophectospheres were co-cultured with a confluent monolayer of Ishikawa cells using medium for culture of Ishikawa cells. Under these conditions, data indicated attachment of trophectospheres using staining for the pan-trophoblast marker KRT7 (
(104) Additionally, results indicated that the sphere structures can be made from both the day 3 cells (e.g., hiPSCs treated as described) and before establishment of the CDX2+ stem cell line cultured in TM4. Furthermore, the concentration of glucose in TM4 medium for CDX2+ stem cell culture affects sphere formation. For example, as shown in
5. SEQUENCES
(105) Sequences referenced in accordance with the various embodiments of the present disclosure are provided below, as well as in a contemporaneously filed sequence listing.
(106) TABLE-US-00002 TABLE2 Sequences SEQ ID Gene Primer Sequence NO: CDX2 Forward GGCAGCCAAGTGAAAACCAG 1 CDX2 Reverse GGTGATGTAGCGACTGTAGTGAA 2 CGB Forward CAGCATCCTATCACCTCCTGGT 3 CGB Reverse CTGGAACATCTCCATCCTTGGT 4 CSH1/2 Forward CATGACTCCCAGACCTCCTTCT 5 CSH1/2 Reverse ATTTCTGTTGCGTTTCCTCCAT 6 ELF5 Forward GCTGCGACCAGTACAAGTTG 7 ELF5 Reverse CTGCCTCGACGAACTCCTC 8 GAPDH Forward CTCCACGACGTACTCAGCG 9 GAPDH Reverse TGTTGCCATCAATGACCCCTT 10 HLA-G Forward CCACCACCCTGTCTTTGACTAT 11 HLA-G Reverse ACGTCCTGGGTCTGGTCCT 12 KDR Forward GGCCCAATAATCAGAGTGGCA 13 KDR Reverse CCAGTGTCATTTCCGATCACTTT 14 LMO2 Forward GGCCATCGAAAGGAAGAGCC 15 LMO2 Reverse GGCCCAGTTTGTAGTAGAGGC 16 MMP2 Forward TGGCACCCATTTACACCTACAC 17 MMP2 Reverse ATGTCAGGAGAGGCCCCATAGA 18 MSI1 Forward TAAAGTGCTGGCGCAATCG 19 MSI1 Reverse TCTTCTTCGTTCGAGTCACCA 20 NES Forward CTGCTACCCTTGAGACACCTG 21 NES Reverse GGGCTCTGATCTCTGCATCTAC 22 OLIG3 Forward AGCCGTCTCAACTCGGTCT 23 OLIG3 Reverse CATGGCTAGGTTCAGGTCGTG 24 SDC1 Forward CTATTCCCACGTCTCCAGAACC 25 SDC1 Reverse GGACTACAGCCTCTCCCTCCTT 26 T Forward CTGGGTACTCCCAATGGGG 27 T Reverse GGTTGGAGAATTGTTCCGATGA 28 TBX4 Forward TGTTCCCCAGCTACAAGGTAA 29 TBX4 Reverse GCAGGGACAATGTCAATCAGC 30 TEAD4 Forward CAGGTGGTGGAGAAAGTTGAGA 31 TEAD4 Reverse GTGCTTGAGCTTGTGGATGAAG 32 TP63 Forward AGAAACGAAGATCCCCAGATGA 33 TP63 Reverse CTGTTGCTGTTGCCTGTACGTT 34