Method for efficiently producing L-homophenylalanine and strain producing L- homophenylalanine

Abstract

The present invention provides a method for efficiently producing L-homophenylalanine and a strain producing L-homophenylalanine. In the present invention, a new route for the synthesis of L-homophenylalanine by a cascade enzymatic method using cheap benzaldehyde and pyruvic acid as raw materials is designed. By constructing the pathway-related enzymes into the same E. coli strain, a recombinant E. coli is obtained, with which L-homophenylalanine is catalytically produced through reaction in a 5 L reactor, with a yield of 100.9 g/L, a conversion rate of 94%, and ee>99%. Compared with the existing main methods for producing L-HPA, the production cost of L-homophenylalanine is greatly reduced. Thus, the present invention has good application prospects.

Claims

1. A genetically engineered strain producing L-homophenylalanine, wherein the engineered strain co-expresses an aldolase, a quinone oxidoreductase, a phenylalanine dehydrogenase and a formate dehydrogenase, wherein the aldolase has the amino acid sequence as shown in SEQ ID NO: 2; the quinone oxidoreductase has the amino acid sequence as shown in SEQ ID NO: 4; the phenylalanine dehydrogenase has the amino acid sequence as shown in SEQ ID NO.6 or SEQ ID NO: 10; and the formate dehydrogenase has the amino acid sequence as shown in SEQ ID NO: 8.

2. The genetically engineered strain according to claim 1, wherein the engineered strain is produced with E. coli as a host.

3. The genetically engineered strain according to claim 2, wherein the E. coli is Escherichia coli BL21 (DE3).

4. The genetically engineered strain according to claim 1, wherein the aldolase and the quinone oxidoreductase are expressed with pCDFDuet-1 as a vector, and the phenylalanine dehydrogenase and the formate dehydrogenase are expressed with pRSFDuet-1 as a vector.

5. A method of producing L-homophenylalanine, comprising: using the genetically engineered strain according to claim 1 to produce the L-homophenylalanine.

6. The method according to claim 5, comprising: catalytically synthesizing L-homophenylalanine with benzaldehyde and pyruvic acid using the genetically engineered strain as a catalyst, wherein the amount of the genetically engineered strain is 20-30 g/L; the content of the coenzyme NAD.sup.+ is 0.1-0.3 mM; the pH of the reaction system is 7.5-8.5; the reaction temperature is 28-32 C.; during the reaction, the substrates benzaldehyde and pyruvic acid are fed in batches, and the substrates are fed in an amount of 40-60 mM benzaldehyde and 40-60 mM pyruvic acid in each batch; and during the reaction, ammonium formate is also fed in batches, in an amount of 90-130 mM in each batch.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIG. 1 shows the synthesis route of L-homophenylalanine;

(2) FIG. 2 shows the identification by HPLC (A) and MS (B) of the product in enzymatic conversion of benzaldehyde and pyruvic acid to synthesize 2-oxo-4-phenyl-3-butenoic acid;

(3) FIG. 3 shows the identification by HPLC (A) and MS (B) of the product in enzymatic conversion of 2-oxo-4-phenyl-3-butenoic acid to synthesize 2-oxo-4-phenylbutyric acid;

(4) FIG. 4 shows the identification by HPLC (A) and MS (C) and chiral identification of the product in enzymatic conversion of 2-oxo-4-phenylbutyric acid to synthesize L-homophenylalanine;

(5) FIG. 5 shows the optimization of reaction conditions for W13 strain; and

(6) FIG. 6 shows the fed-batch production of L-HPA by W13 strain in a 5 L reactor.

DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

(7) The present invention will be further described below in connection with specific examples, so that those skilled in the art can better understand and implement the present invention; however, the present invention is not limited thereto.

Example 1: Cascade Pathway of L-Homophenylalanine

(8) As shown in FIG. 1, in a first step, benzaldehyde (1) and pyruvic acid (2) used as raw materials were converted into 4-hydroxy-2-oxo-4-phenylbutyric acid (3) by an aldolase (PpNahE), and then (3) underwent spontaneous dehydration to form (E)-2-oxo-4-phenyl-3-butenoic acid (4). In a second step, using NAD.sup.+ as a coenzyme, Compound (4) was converted into the compound 2-oxo-4-phenylbutyric acid (5) by a quinone oxidoreductase (EcQOR). In a third step, using NAD.sup.+ as a coenzyme and free ammonium ions as a donor, Compound (5) was converted into the compound L-homophenylalanine (6) by a phenylalanine dehydrogenase (TiPheDH). During the process, since both EcQOR and TiPheDH need to consume the coenzyme, a formate dehydrogenase(CbFDH) was used to regenerate NADH by consuming sodium formate.

Example 2: Construction, Expression, and Product Identification of Engineered Strain PpNahE-pET28a-BL21 (DE3)

(9) A target protein sequence (as shown in SEQ ID NO. 1) in Pseudomonas putida was synthesized by GENEWIZ, Inc., subjected to codon optimization and then ligated to the vector pET28a enzymatically cleaved with NdeI and XhoI. A recombinant expression plasmid PpNahE-pET-28a was obtained. The recombinant expression plasmid PpNahE-pET-28a was transformed into E. coli BL21 (DE3), to obtain a positive engineered strain, which was designated as PpNahE-pET28a-BL21 (DE3).

(10) The strain PpNahE-pET28a-BL21 (DE3) was transferred to 5 mL of LB liquid medium (tryptone 10 g/L, yeast powder 5 g/L, and sodium chloride 10 g/L) and incubated overnight at 37 C. Subsequently, the strain was transferred to 200 mL of TB liquid medium (tryptone 12 g/L, yeast extract 24 g/L, glycerol 4 mL/L, KH.sub.2PO.sub.4 2.31 g/L and K.sub.2HPO.sub.4 12.31 g/L), and incubated at 200 rpm and a constant temperature of 37 C. When the OD value reached 0.6-0.8, IPTG at a final concentration of 0.5 mM was added, for induction culture at 16 C. for 18 hrs. After centrifugation, the cells were collected.

(11) Subsequently, 5 mL of a catalytic reaction system containing 50 mM sodium phosphate buffer solution (pH 8.0), 20 g/L wet cells, benzaldehyde (1) and pyruvic acid (2) of 50 mM each, was reacted at 30 C. A sample was taken and filtered through a 0.22 mol filter membrane.

(12) The substrate consumption and product formation were detected by the Agilent 1260 HPLC system with an UV detector at 210 nm. Mobile phase A is an aqueous solution containing 0.1% TFA, mobile phase B was an acetonitrile solution containing 0.1% TFA, the column was ZORBAX SB-C18 (4.6150 mm, 5 m), the flow rate was 1 mL, and the column temperature was 25 C. The procedure run with 75% A and 25% B for 25 min. As shown in A in FIG. 2, Compound (4) obtained by enzymatic reaction has consistent peak time with the standard product. The sample was then analyzed by anion mass spectrometry. As shown in B in FIG. 2, the formation of the product was further confirmed.

Example 3: Construction, Expression, and Product Identification of Engineered Strain EcQOR-pET28a-BL21(DE3)

(13) Taking the nucleotide sequence (as shown in SEQ ID NO.3) of a target protein coding gene in the genome of E. coli. 1655 as a template and using F1 and R1 as primers (underlined are NdeI and XhoI restriction sites, respectively), PCR amplification was carried out. Amplification procedure: 30 s at 98 C., 30 cycles (10 s at 98 C., 15 s at 55 C., and 10 s at 72 C.), and 10 min at 72 C. F1: GGAATTCCATATGGCAACACGAATTGAATTTC (SEQ ID NO.11); R1: CCGCTCGAGTTATGGAATCAGCAGGCTGG (SEQ ID NO.12).

(14) A cDNA sequence of the EcQOR gene coding region was obtained. After the PCR product was collected, it was enzymatically cleaved and ligated to the pET-28a plasmid vector that had been enzymatically cleaved with the same two restriction enzymes, to obtain a recombinant expression plasmid. The recombinant plasmid was transformed into E. coli BL21(DE3). The obtained positive engineered strain was identified by PCR, and designated as EcQOR-pET28a-BL21(DE3).

(15) The cells were obtained following the expression conditions in Example 2. Subsequently, 5 mL of a catalytic reaction system containing 50 mM sodium phosphate buffer solution (pH 8.0), 20 g/L wet cells, 20 mM Compound (4), and 30 mM NADH was reacted at 30 C. A sample was taken and filtered through a 0.22 mol filter membrane.

(16) The substrate consumption and product formation were detected by the Agilent 1260 HPLC system with an UV detector at 210 nm. The column was ZORBAX SB-C18 (4.6150 mm, 5 m), the flow rate was 1 mL/min, the column temperature was 25 C., mobile phase A was pure acetonitrile, and mobile phase B was 50 mM diammonium hydrogen phosphate. The procedure run with 16% A and 84% B for 15 min. As shown in A in FIG. 3, after the biocatalytic reaction, the same peak as that of the standard appears, indicating the production of Compound (5). Anion mass spectrometry, as shown in B in FIG. 3, further proves the formation of product (5).

Example 4: Construction, Expression, and Product Identification of Engineered Strain TiPheDH-pET22b-BL21 (DE3)

(17) A target protein sequence (as shown in SEQ ID NO. 5) in Thermoactinomyces intermedius was synthesized by GENEWIZ, Inc., and ligated to the vector pET22b enzymatically cleaved with NdeI and XhoI. A recombinant expression plasmid TiPheDH-pET-22b was obtained. The recombinant expression plasmid TiPheDH-pET-22b was transformed into E. coli BL21(DE3), to obtain a positive engineered strain, which was designated as TiPheDH-pET22b-BL21(DE3).

(18) The same induction method as that in Example 2 was adopted, and the cells were collected. 5 mL of a catalytic reaction system containing 50 mM sodium phosphate buffer solution (pH 8.0), 20 g/L wet cells, 20 mM Compound (5), and 30 mM NADH was reacted at 30 C. A sample was taken and filtered through a 0.22 mol filter membrane. The same methods as those in Example 2 were used for detection. As shown in A in FIG. 4, the same peak as that of the standard appears, indicating the production of L-HPA (6). Anion mass spectrometry, as shown in C in FIG. 4, further proves the formation of L-HPA (6).

(19) Subsequently, the chirality of the product was detected by a Waters Alliance e2695 HPLC system using a UV detector at 210 nm. The column was DAICEL CHIRALPAK AD-H (2504.6 mm, 5 m), the flow rate was 1 mL/min, the column temperature was 25 C., and the mobile phase was n-hexane/ethanol=90/10 containing 0.1% TFA, and the running time was 10 min. As shown in B in FIG. 4, the peak of the product occurs at the same time as that of the standard L-homophenylalanine product, and ee of the product is >99%.

Example 5: Construction, Expression, and Screening of Strain Co-Expressing Four Enzymes

(20) The nucleotide sequence (as shown in SEQ ID NO.7) of a target protein coding gene in the genome of Candida boidinii, and SEQ ID NO.1, SEQ ID NO.3 and SEQ ID NO.5 in Examples 2, 3 and 4 were used as templates. PCR was performed using the primers shown in Table 1 to obtain a target gene. PpNahE and TipheDH enzymatically cleaved with EcoRI and HindIII were ligated to pCDFDuet-1, pACYCDuet-1, pETDuet-1, and pRSFDuet-1 plasmid vectors enzymatically cleaved with the same enzymes by T4 ligase. The CbFDH and EcQOR were enzymatically cleaved with NdeI and XhoI and ligated by T4 ligase. 8 plasmids were obtained.

(21) TABLE-US-00001 TABLE1 Primersequence Primername Sequence(5-3) No. EcQOR-F-NdeI GGAATTCCATATGGCAACACGAATTGAATTTC SEQIDNO.11 EcQOR-R-Xhol CCGCTCGAGTTATGGAATCAGCAGGCTGG SEQIDNO.12 CbFDH-F-NdeI GGAATTCCATATGAAGATTGTCTTAGTTCTTTATG SEQIDNO.13 CbFDH-F-XhoI CCGCTCGAGTTATTTCTTATCGTGTTTACCG SEQIDNO.14 TiPheDH-F-EcoRI CGGAATTCGATGCGCGACGTGTTTGAAATGATGG SEQIDNO.15 TiPheDH-R-HindIII CCCAAGCTTTTACCTCCTTGCGCTGTTGCGGG SEQIDNO.16 PpNahE-F-EcoRI CGGAATTCGATGCTGAACAAAGTGATTAAAACC SEQIDNO.17 PpNahE-R-HindIII CCCAAGCTTTTATTTGCTATATTTCGCATGC SEQIDNO.18
Note: The underlined represents the restriction endonuclease cleavage site

(22) TABLE-US-00002 TABLE 2 Strains co-expressing four-enzymes Con- version Strain Yield rate name Plasmids contained in the strain (g/L) (%) W1 pACYC-PpNahE-EcQOR, pCDF-TipheDH-cbFDH 0.18 5.0 W2 pACYC-PpNahE-EcQOR, pET-TipheDH-cbFDH 0.44 12.4 W3 pACYC-PpNahE-EcQOR, pRSF-TipheDH-cbFDH 1.25 35.0 W4 pET-PpNahE-EcQOR, pCDF-TipheDH-cbFDH 0.22 6.1 W5 pET-PpNahE-EcQOR, PACYC-TipheDH-cbFDH 0.33 9.2 W6 pET-PpNahE-EcQOR, pRSF-TipheDH-cbFDH 0.83 23.2 W7 pRSF-PpNahE-EcQOR, pCDF-TipheDH-cbFDH 0.20 5.5 W8 pRSF-PpNahE-EcQOR, pET-TipheDH-cbFDH 0.15 4.3 W9 pRSF-PpNahE-EcQOR, PACYC-TipheDH-cbFDH 0.12 3.5 W10 pCDF-PpNahE-EcQOR, pACYC-TipheDH-cbFDH 1.47 41.0 W11 pCDF-PpNahE-EcQOR, pRSF-TipheDH-cbFDH 1.8 51.5 W12 pCDF-PpNahE-EcQOR, pET-TipheDH-cbFDH 0.08 2.3

(23) Subsequently, the obtained 8 recombinant plasmids were transformation to BL21(DE3) by a double-resistant plate, to obtain genetically engineered strains W1-W12 (as shown in Table 2). The same induction method as that in Example 2 was adopted, and the cells were collected. Subsequently, the cells were screened in 5 mL of a screening system containing 50 mM sodium phosphate buffer solution (pH 8.0), 20 mM benzaldehyde, 20 mM pyruvic acid, 0.2 mM NAD.sup.+, 50 mM ammonium formate and 20 g/L wet cells. As shown in Table 2, the strain W11 achieves a conversion rate of 51.5%, and is the optimum strain.

Example 6: Modification of Rate-Limiting Enzyme Phenylalanine Dehydrogenase TipheDH

(24) To further increase the production of L-HPA, the rate-limiting enzyme (TipheDH) in strain W11 was modified, by half-saturation mutations at sites C70 and T115 to obtain a dual-mutantTipheDH.sup.C70A/T115E, then site-directed mutagenesis of two cysteine residues C256 and C282 on the surface of the protein, on the basis of the dual mutant to obtain a tetra-mutant TipheDH.sup.C70A//T115E/C256A/C282L, and finally truncation of 6 amino acids at the C terminus on the basis of the tetra-mutant, to finally obtain the mutant r360TipheDH.sup.C70A//T115E/C256A/C282L, having gene sequence information and an amino acid sequence as shown in SEQ ID NO. 9 and SEQ ID NO. 10. Compared to the wild type, the activity is increased by 0.82 times, and the expression level is increased by 2.54 times. By replacing the wild-type TipheDH in strain W11 by the mutant r360TipheDH.sup.C70A//T115E/C256A/C282L, An optimum strain W13 was obtained, with which a conversion rate of 95.3% of achieved. The mutant was obtained by whole plasmid PCR, and the primers used were listed in Table 3.

(25) The protein purification method adopted was as follows. The collected mutants were ultrasonically homogenized, and the obtained homogenate was centrifuged at a low temperature of 4 C. and a high speed of 8000 rpm for 30 min, to obtain a crude enzyme solution. After nickel affinity chromatography, a pure protein was obtained.

(26) The enzyme activity detection method used was as follows. The activity of the phenylalanine dehydrogenase was evaluated by detecting the ultraviolet absorption at a wavelength of 340 nm on a microplate reader. The system includes 50 mM sodium phosphate buffer (pH 8.0), 10 mM (5), 1 mM NADH and 5 M TipheDH. One unit of enzyme activity is the amount of enzyme required to convert 1 M NADH in 1 minute.

(27) TABLE-US-00003 TABLE3 Primersequence Primername Sequence(5-3) No. C70X-F CATGACCTATAAANBTAGTCTG SEQIDNO.19 C70X-R CAGACTAVNTTTATAGGTCATG SEQIDNO.20 T115X-F TCTATACCGGAGNNGACATG SEQIDNO.21 T115X-R CATGTCNNCTCCGGTATAGA SEQIDNO.22 C256A-F ATTGACGAGTTCCGTGCCCTGGC SEQIDNO.23 C256A-R GCCAGGGCACGGAACTCGTCAAT SEQIDNO.24 C256V-F ATTGACGAGTTCCGTGTCCTGGC SEQIDNO.25 C256V-R GCCAGGACACGGAACTCGTCAAT SEQIDNO.26 C282L-F CAAAAACGGAGCATTCTGTATGC SEQIDNO.27 C282L-R GCATACAGAATGCTCCGTTTTTG SEQIDNO.28 C282V-F CAAAAACGGAGCATTGTGTATGC SEQIDNO.29 C282V-R GCATACACAATGCTCCGTTTTTG SEQIDNO.30 r360TipheDH-F GGATCTTGTTGGAGGATCCCCTCGAGCACCACCACCACC SEQIDNO.31 r360TipheDH-R GGTGGTGGTGGTGCTCGAGGGGATCCTCCAACAAGATCC SEQIDNO.32

Example 7: 5 L Scale Production

(28) The reaction conditions for the production of L-HPA from benzaldehyde and pyruvic acid were optimized by the strain W13. As shown in FIG. 5. the optimal reaction conditions include pH 8.0, a temperature of 30 C., a cell concentration of 25 g/L, and co-enzyme NAD.sup.+ at a concentration of 0.2 mM.

(29) Finally, the reaction was carried out in a 5 L fermentor. Under optimal reaction conditions, the W13 strain was fed in batches for catalysis. 50 mM benzaldehyde and pyruvic acid and 110 mM ammonium formate were added in each batch. A total of 12 batches of reaction were carried out. During the reaction, the pH was controlled at 8.0 with 6M HCl. As shown in FIG. 6. during the 12 batches of reaction, the yield is 100.9 g/L, and the conversion rate is 94%.

(30) The above-described embodiments are merely preferred embodiments for the purpose of fully illustrating the present invention, and the scope of the present invention is not limited thereto. Equivalent substitutions or modifications can be made by those skilled in the art based on the present invention, which are within the scope of the present invention as defined by the claims.