Starter strain and sourdough using the same

Abstract

A starter for producing sourdough is provided. The starter includes Saccharomyces cerevisiae Y3-1 (KCTC 15070BP) and Leuconostoc mesenteroides M1-2 (KCTC 15071BP). The Saccharomyces cerevisiae Y3-1 (KCTC 15070BP), Leuconostoc mesenteroides M1-2 (KCTC 15071BP), and Bacillus belezensis Kh2-2 (KCTC 14642BP) are used in a weight ratio of 6 to 7:2 to 3:1 to 2.

Claims

1. A starter for preparing sourdough comprising: Saccharomyces cerevisiae Y3-1 (KCTC 15070BP), Leuconostoc mesenteroides M1-2 (KCTC 15071BP), and Bacillus belezensis Kh2-2 (KCTC 14642BP).

2. The Starter of claim 1, wherein the Saccharomyces cerevisiae Y3-1 (KCTC 15070BP), Leuconostoc mesenteroides M1-2 (KCTC 15071BP), and Bacillus belezensis Kh2-2 (KCTC 14642BP) are used in a weight ratio of 6 to 7:2 to 3:1 to 2.

3. Sourdough produced using the starter of claim 1.

4. A bakery product comprising the sourdough of claim 3.

5. The bakery product of claim 4, wherein the bakery product is bread, biscuits, pies, crackers or wafers.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIG. 1 is a photograph showing the results of a starter and baking test using a starter produced by using an isolated strain, according to one embodiment of the present disclosure.

(2) FIG. 2 is a photograph showing the results of a starter and baking test using a starter produced by using an isolated strain, according to one embodiment of the present disclosure.

(3) FIG. 3 is a photograph showing the results of a starter and baking test using a starter produced by using an isolated strain, according to one embodiment of the present disclosure.

(4) FIG. 4 is a photograph showing the test results of a starter produced by using the applicant's own natural yeast, according to one embodiment of the present disclosure.

(5) FIG. 5 is a photograph showing the results of a baking test using a starter produced by using the applicant's own natural yeast, according to one embodiment of the present disclosure.

(6) FIG. 6 is a graph showing the results of viscosity analysis for the dough of wheat flour (Bob's Red Mill, made in USA) without treatment of starter produced using the isolated strain according to the present disclosure, in Experimental Example 1 of the present disclosure.

(7) FIG. 7 is a graph showing the results of viscosity analysis for the dough of wheat flour (Bob's Red Mill, made in USA) without treatment of starter produced using the isolated strain according to the present disclosure, in Experimental Example 1 of the present disclosure.

(8) FIG. 8 is a graph showing the results of viscosity analysis for the dough of wheat flour (Bob's Red Mill, made in USA) treated with starter produced using the isolated strain according to the present disclosure, in Experimental Example 1 of the present disclosure.

(9) FIG. 9 is a graph showing the results of viscosity analysis of the dough of wheat flour (Bob's Red Mill, made in USA) treated with starter produced using the isolated strain according to the present disclosure in Experimental Example 1 of the present disclosure.

(10) FIG. 10 is a graph showing the results of analyzing the content of free amino acid (cysteine) depending on the type of produced feed used in Experimental Example 2 of the present disclosure.

(11) FIG. 11 is a graph showing the results of analyzing the content of dominant free amino acids in Sample B1 used in Experimental Example 2 of the present disclosure.

(12) FIG. 12 is a graph showing the results of analyzing the content of dominant free amino acids in Sample Glu used in Experimental Example 2 of the present disclosure.

(13) FIG. 13 is a graph showing the results of analyzing the content of dominant free amino acids in Sample B2 used in Experimental Example 2 of the present disclosure.

(14) FIG. 14 is a graph showing the results of analyzing the content of dominant free amino acids in Sample B3 used in Experimental Example 2 of the present disclosure.

(15) FIG. 15 is a graph showing body weight changes for an untreated group, a DSS only treated group, a DSS/B1 administration group, a DSS/B2 administration group, and a DSS/B3 administration group in Experimental Example 2 of the present disclosure.

(16) FIG. 16 is a graph showing changes of disease activity index (DAI) for an untreated group, a DSS only treated group, a DSS/B1 administration group, a DSS/B2 administration group, and a DSS/B3 administration group in Experimental Example 2 of the present disclosure.

(17) FIG. 17 is a photograph showing the results of measuring the colon length for an untreated group, a DSS only treated group, a DSS/B1 administration group, a DSS/B2 administration group, and a DSS/B3 administration group in Experimental Example 2 of the present disclosure.

(18) FIG. 18 is a graph showing the results of measuring the colon length for an untreated group, a DSS only treated group, a DSS/B1 administration group, a DSS/B2 administration group, and a DSS/B3 administration group in Experimental Example 2 of the present disclosure.

(19) FIG. 19 is a graph showing the mRNA expression levels of IL-1, TNF-, and IL-6 for an untreated group, a DSS only treated group, a DSS/B1 administration group, a DSS/B2 administration group, and a DSS/B3 administration group in Experimental Example 2 of the present disclosure.

(20) FIG. 20 is a graph showing the expression degree of vinculin, -E-catenin, occludin, E-cadherin and vinculin proteins for an untreated group, a DSS only treated group, a DSS/B1 administration group, a DSS/B2 administration group, and a DSS/B3 administration group in Experimental Example 2 of the present disclosure.

(21) FIG. 21 is a photograph showing the results of observing the degree of inflammation and cell changes in the colonic mucosa from a histological perspective for an untreated group, a DSS only treated group, a DSS/B1 administration group, a DSS/B2 administration group, and a DSS/B3 administration group in Experimental Example 2 of the present disclosure.

(22) FIG. 22 is a graph showing the species diversity and phylogenetic diversity of intestinal microorganisms for an untreated group, a DSS only treated group, a DSS/B1 administration group, a DSS/B2 administration group, and a DSS/B3 administration group in Experimental Example 2 of the present disclosure.

(23) FIG. 23 is a graph showing the Firmicutes/Bacteroidetes ratio and Bacteroidetes/Firmicutes ratio of intestinal microorganisms for an untreated group, a DSS only treated group, a DSS/B1 administration group, a DSS/B2 administration group, and a DSS/B3 administration group in Experimental Example 2 of the present disclosure.

(24) FIG. 24 is a graph showing the dendrogram cluster analysis generated according to 14 species of intestinal microorganisms for an untreated group, a DSS only treated group, a DSS/B1 administration group, a DSS/B2 administration group, and a DSS/B3 administration group in Experimental Example 2 of the present disclosure.

(25) FIG. 25 is a graph showing the distribution of the phylum of intestinal microorganisms for an untreated group, a DSS only treated group, a DSS/B1 administration group, a DSS/B2 administration group, and a DSS/B3 administration group in Experimental Example 2 of the present disclosure.

(26) FIG. 26 is a graph showing the distribution of intestinal microbial species observed in the feces of intestinal microorganisms for an untreated group, a DSS only treated group, a DSS/B1 administration group, a DSS/B2 administration group, and a DSS/B3 administration group in Experimental Example 2 of the present disclosure.

(27) FIG. 27 is a graph showing changes in blood glucose for an untreated group, a DSS only treated group, a DSS/B1 administration group, a DSS/B2 administration group, and a DSS/B3 administration group in Experimental Example 2 of the present disclosure.

DETAILED DESCRIPTION

(28) According to the present disclosure, there is provided a new strain that may be used for a sourdough starter. In the present disclosure, Saccharomyces cerevisiae Y3-1, isolated through the experiment described below, was deposited and given the deposit number KCTC 15070BP. In addition, Leuconostoc mesenteroides M1-2 was deposited and given the deposit number KTCT 15071BP.

(29) The new strains, Saccharomyces cerevisiae Y3-1 (KCTC 15070BP) and Leuconostoc mesenteroides M1-2 (KTCT 15071BP) provided in the present disclosure have excellent fermentability and is suitable as a starter for sourdough, when used as a starter in the preparation of sourdough.

(30) In particular, it is desirable to use Saccharomyces cerevisiae Y3-1 (KCTC 15070BP), Leuconostoc mesenteroides M1-2 (KTCT 15071BP), and Bacillus belezensis Kh2-2 (KCTC 14642BP) together as a starter for sourdough. The Bacillus belezensis Kh2-2 (KCTC 14642BP) is a strain isolated from salted squid as described in a document in the related art (Food Research International Volume 152, February 2022, 110911). It is preferable to use Saccharomyces cerevisiae Y3-1 (KCTC 15070BP), Leuconostoc mesenteroides M1-2 (KTCT 15071BP), and Bacillus belezensis Kh2-2 (KCTC14642BP) in a weight ratio of 6 to 7:2 to 3:1 to 2 in terms of sourdough fermentability, preference, and the effect of improving the intestinal function of bread produced using sourdough.

(31) According to the present disclosure, there is provided sourdough produced using a starter including the above strain and a bakery product including the sourdough. The bakery product may be bread, biscuits, pies, crackers, or wafers, but is not limited thereto.

(32) According to one embodiment of the present disclosure, when a feed produced from bread obtained by baking sourdough produced using a starter including the new strain of the present disclosure and Bacillus valegansis Kh2-2 is provided to an animal model of acute colitis caused by dextran sodium sulfate (DSS), disease activity index (DAI) was reduced, the increased IL-1 and TNF- mRNA levels induced by DSS were significantly reduced, and inflammatory cytokines such as IL-1, IL-6, and TNF- were suppressed. Through these results, it was found that bread including sourdough produced using a starter including the new strain of the present disclosure has an intestinal improvement effect through alleviating intestinal inflammation, suppressing pathogens and harmful intestinal bacteria in feces, and increasing beneficial bacteria (see Experimental Example 2).

Preparation Example 1: Sourdough Preparation to Isolate Strains for Sourdough

(33) Sourdough was produced using American organic wheat flour (Bob's Red Mill and KingArthur), and then microorganisms were isolated from a sourdough sample. The preparation method is as follows.

(34) Day 1: 50 g of wheat flour and 50 g of warm water were mixed in a bottle container, and the bottle was capped.

(35) Day 2: 50 g of the same wheat flour and 50 g of warm water were put and mixed in the bottle container, and then the bottle was capped.

(36) Day 3: Bubbles start to appear on top. 50 g of wheat flour and 50 g of warm water were put and mixed in the bottle container, and then the bottle was capped.

(37) Day 4: A few clear foams should be visible below the surface and may have a slightly fruity smell. 70 g of unprocessed bread crumbs, 30 g of rye flour, and 100 g of lukewarm water were mixed and feed, and the bottle was capped.

(38) Day 5: The starter was newly cultured. 90% of the mixture was removed. The attached starter provides seeds for the next feeding. 70 g of unprocessed bread crumbs, 30 g of rye flour, and 100 g of lukewarm water were mixed and feed, and the bottle was capped.

(39) Day 6: The amount of starter increases and there may be a layer of bubbles and foams. 70 g of unprocessed bread crumbs, 30 g of rye flour, and 100 g of lukewarm water were mixed and feed, and the bottle was capped.

(40) Day 7: A 50/50 flour to water mix was maintained throughout the life of the starter. The starter activates for up to 6-12 hours while it increases in volume (more than doubles) and has a thick bubble layer on top and a rich foam network below the surface.

Example 1: Isolation and Identification of MicroorganismsLeuconostoc mesenteroides M1-2

(41) As described above, a sourdough starter was produced using organic wheat flour made in USA and then isolated from this starter sample. The sample was smeared on an appropriately high MRS agar plates in phosphate buffer (pH 7.0), and then left and incubated at 37 C. for 24 to 48 hours. After dilution, pure isolated colonies were identified, streaked on separate MRS agar plates, and then isolated as pure strains. For long-term storage, it was suspended in 3000 glycerol and stored at 80 C. Identification was performed by requesting CJ Bioscience Co., Ltd. (formerly Cheonlab) and implementing total 16S rRNA base sequencing. The identification results are shown in Table 1 below, and showed 9900 homology with Leuconostoc mesenteroides.

(42) TABLE-US-00001 TABLE1 Query=M1-2 (1437letters) Database:16salldb 29,456sequences;39,657,981totalletters Searching..................................................done Score E Sequencesproducingsignificantalignments: (bits) Value gi|631252714|ref|NR_113912.1|LeuconostocmesenteroidesstrainN... 2611 0.0 gi|631252713|ref|NR_113911.1|Leuconostocmesenteroidessubsp.d... 2611 0.0 gi|444439642|ref|NR_074957.1|LeuconostocmesenteroidesstrainA... 2611 0.0 gi|343200130|ref|NR_040817.1|Leuconostocmesenteroidessubsp.d... 2611 0.0 gi|631252056|ref|NR_113254.1|Leuconostocmesenteroidessubsp.d... 2611 0.0 gi|631252053|ref|NR_113251.1|LeuconostocmesenteroidesstrainJ... 2611 0.0 gi|1441204190|ref|NR_157602.1|Leuconostocmesenteroidessubsp.... 2603 0.0 gi|645321640|ref|NR_118557.1|LeuconostocmesenteroidesstrainA... 2603 0.0 gi|343200131|ref|NR_040818.1|Leuconostocmesenteroidessubsp.c... 2603 0.0 gi|661903049|ref|NR_109003.1|LeuconostocsuionicumstrainLMG8... 2595 0.0 gi|343200127|ref|NR_040814.1|Leuconostocpseudomesenteroidesst... 2571 0.0 gi|631250774|ref|NR_109004.1|LeuconostocpseudomesenteroidesKC... 2571 0.0 gi|1269801505|ref|NR_074997.2|Leuconostocgelidumsubsp.gasico... 2428 0.0 gi|959494902|ref|NR_133769.1|Leuconostocgelidumsubsp.aenigma... 2428 0.0 gi|265678474|ref|NR_028777.1|Leuconostocgelidumsubsp.gasicom... 2428 0.0 gi|1024974774|ref|NR_136799.1|LeuconostocrapistrainLMG27676... 2420 0.0 gi|1269801500|ref|NR_075014.2|LeuconostockimchiistrainIMSNU... 2407 0.0 gi|343200136|ref|NR_040823.1|LeuconostoclactisstrainKCTC352... 2405 0.0 gi|343202334|ref|NR_042620.1|LeuconostocholzapfeliistrainBFE... 2405 0.0 gi|219857447|ref|NR_025035.1|Leuconostocgelidumsubsp.gelidum... 2405 0.0 >gi|631252714|ref|NR_113912.1|LeuconostocmesenteroidesstrainNBRC 10049616S ribosomalRNA,partialsequenceLength=1476 Score=2611bits(1317),Expect=0.0Identities=1361/1373(99%), Gaps=2/1373(0%) Strand=Plus/Plus Query:SEQIDNO:1 Sbjct:SEQIDNO:2 Query:32gaaaggtgcttgcacctttca-gtgagtggcgaacgggtgagtaacacgtggacaacctg90 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct:48gaaaggtgcttgcacctttcaagtgagtggcgaacgggtgagtaacacgtggacaacctg107 Query:91cctcaaggctggggataacatttggaaacagatgctaataccgaataaaacttagtgtcg150 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct:108cctcaaggctggggataacatttggaaacagatgctaataccgaataaaacttagtgtcg167 Query:151caggacacaaagttaaaaggcgcttcggcgtcacctagagatggatccgcggtgcattag210 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct:168catgacacaaagttaaaaggcgcttcggcgtcacctagagatggatccgcggtgcattag227 Query:211ttagttggtggggtaaaggcctaccaagacaatgatgcatagcctaattgagagactgat270 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct:228ttagttggtggggtaaaggcctaccaagacaatgatgcatagccgagttgagagactgat287 Query:271cggccacattgggactgaaacacggcccaaactcctacgggaggctgcagtagggaatct330 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct:288cggccacattgggactgagacacggcccaaactcctacgggaggctgcagtagggaatct347 Query:331tccacaatgggcgaaagcctgatggagcaacgccacgtgtgtgatgaaggctttcgggtc390 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct:348tccacaatgggcgaaagcctgatggagcaacgccgcgtgtgtgatgaaggctttcgggtc407 Query:391gtaaagcactgttggatgggaaaaacagctagaataggaaatgattttagtttgacggta450 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct:408gtaaagcactgttgtatgggaagaacagctagaataggaaatgattttagtttgacggta467 Query:451ccataccagaaagggacggctaaatacgtgccagcagccgcggtaatacgtatgtcccga510 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct:468ccataccagaaagggacggctaaatacgtgccagcagccgcggtaatacgtatgtcccga527 Query:511gcgttatccggatttattgggcgtaaagcgagcgcagacggtttattaagtctgatgtga570 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct:528gcgttatccggatttattgggcgtaaagcgagcgcagacggtttattaagtctgatgtga587 Query:571aagcccggagctcaactccggaatggcattggaaactggttaacttgagtgcagtagagg630 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct:588aagcccggagctcaactccggaatggcattggaaactggttaacttgagtgcagtagagg647 Query:631taagtggaactccatgtgtagcggtggaatgcgtagatatatggaagaacaccagtggcg690 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct:648taagtggaactccatgtgtagcggtggaatgcgtagatatatggaagaacaccagtggcg707 Query:691aaggcggcttactggactgcaactgacgttgaggctcgaaagtgtgggtagcaaacagga750 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct:708aaggcggcttactggactgcaactgacgttgaggctcgaaagtgtgggtagcaaacagga767 Query:751ttagataccctggtagtccacacegtaaacgatgaacactaggtgttaggaggtttccgc810 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct:768ttagataccctggtagtccacaccgtaaacgatgaacactaggtgttaggaggtttccgc827 Query:811ctcttagtgccgaagctaacgcattaagtgttccgcctggggagtacgaccgcaaggttg870 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct:828ctcttagtgccgaagctaacgcattaagtgttccgcctggggagtacgaccgcaaggttg887 Query:871aaactcaaaggaattgacggggacccgcacaagcggtggagcatgtggtttaattcgaag930 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct:888aaactcaaaggaattgacggggacccgcacaagcggtggagcatgtggtttaattcgaag947 Query:931caacgcgaagaaccttaccaggtcttgacatcctttgaagcttttagagatagaagtgtt990 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct:948caacgcgaagaaccttaccaggtcttgacatcctttgaagcttttagagatagaagtgtt1007 Query:991ctcttcggagacaaagtgacaggtggtgcatggtcgtcgtcagctcgtgtcgtgagatgt1050 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct:1008ctcttcggagacaaagtgacaggtggtgcatggtcgtcgtcagctcgtgtcgtgagatgt1067 Query:1051tgggttaagtcccgcaacgagcgcaacccttactgttagttgccagcattcagatgggca1110 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct:1068tgggttaagtcccgcaacgagcgcaacccttattgttagttgccagcattcagatgggca1127 Query:1111ctctagegagactgccggtgacaaaccggaggaaggcggggacgacgtcagatcatcatg1170 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct:1128ctctagcgagactgccggtgacaaaccggaggaaggcggggacgacgtcagatcatcatg1187 Query:1171ccccttatgacctgggctacacacgtgctacaatggcgtatacaacgagttgccaacccg1230 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct:1188ccccttatgacctgggctacacacgtgctacaatggcgtatacaacgagttgccaacccg1247 Query:1231cgagggtgagctaatctcttaaagtacgtctcagttcggattgtcgtctgcaactcgact1290 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct:1248cgagggtgagctaatctcttaaagtacgtctcagttcggattgtagtctgcaactcgact1307 Query:1291acatgaagttggaatcgctagtaatcgcggatcagcacgccgcggtgaatacgttcccgg1350 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct:1308acatgaagtcggaatcgctagtaatcgcggatcagcacgccgcggtgaatacgttcccgg1367 Query:1351gtcttgtacacaccgcccgtcacaccatgggagtttg-aatgcccaaagccgg1402 |||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct:1368gtcttgtacacaccgcccgtcacaccatgggagtttgtaatgcccaaagccgg1420

Example 2: Isolation and Identification of MicroorganismsSaccharomyces cerevisiae Y3-1

(43) As described above, a sourdough starter was produced using organic wheat flour made in USA and then isolated from this starter sample. The sample was appropriately diluted in phosphate buffer (pH 7.0), smeared YPD agar plates, and then incubated at 37 C. for 24 to 48 hours. Thereafter, pure isolated colonies were identified, streaked on separate YPD agar plates, and then isolated as pure strains. For long-term storage, it was suspended in 3000 glycerol and stored at 80 C. Identification was performed by requesting CJ Bioscience Co., Ltd. (formerly Cheonlab) and implementing base sequencing of the 18SrRNA ITS (internal transcribed spacer) 1 and 4 regions. The identification results are shown in Table 2 below, and showed 960% homology with the Saccharomyces cerevisiae CBS 1171 ITS region.

(44) TABLE-US-00002 TABLE2 Query=Y3-1 (818letters) Database:16Salldb.fna 43,045sequences;50,890,384totalletters Searching..................................................done Score E Sequencesproducingsignificantalignments: (bits) Value NR_111007.1SaccharomycescerevisiaeCBS1171ITSregion;fromT... 1205 0.0 NR_144772.1SaccharomycescariocanusNRRL27337ITSregion;from... 1195 0.0 NR_138272.1SaccharomycesparadoxusCBS432ITSregion;fromTYP... 1191 0.0 NR_111354.1SaccharomycesmikataeATCCMYA-4448ITSregion;from... 1138 0.0 NR_111355.1SaccharomyceskudriavzeviiATCCMYA-4449ITSregion;... 1118 0.0 NR_153296.1SaccharomycesarboricolaCBS10644ITSregion;from... 1080 0.0 NR_138273.1SaccharomycespastorianusNRRLY-27171ITSregion;f... 1068 0.0 NR_153310.1SaccharomycesuvarumCBS395ITSregion;fromTYPEm... 1068 0.0 NR_138274.1SaccharomycesbayanusNRRLY-12624ITSregion;from... 1068 0.0 NR_137586.1SaccharomyceseubayanusPYCC6148ITSregion;fromT... 1027 0.0 NR_163532.1KazachstaniazonataCBS10326ITSregion;fromTYPE... 293 1e78 NR_111088.1NaumovozymadairenensisCBS421ITSregion;fromTYP... 281 5e75 NR_111124.1VanderwaltozymapolysporaNRRLY-8283ITSregion;fr... 281 5e75 NR_136949.1TorulasporamaleeaeNBRC11061ITSregion;fromTYPE... 280 2e74 NR_138217.1TorulasporafranciscaeNRRLY-6686ITSregion;from... 280 2e74 NR_138199.1TorulasporamicroellipsoidesNRRLY-1549ITSregion;... 280 2e74 NR_137029.1TorulasporaquercuumCGMCCAS2.3768ITSregion;fro... 278 8e74 NR138187.1KazachstaniaunisporaCBS398ITSregion;fromTYPE... 278 8e74 NR_111006.1KazachstaniamartiniaeCBS6334ITSregion;fromTYP... 278 8e74 NR_138201.1ZygosaccharomycesbailiiNRRLY-2227ITSregion;fro... 276 3e73 >NR_111007.1SaccharomycescerevisiaeCBS1171ITSregion;fromTYPE materialLength=752 Score=1205bis(608),Expect=0.0 Identities=699/723(96%),Gaps=6/723(0%) Strand=Plus/Plus Query:SEQIDNO:3 Sbjct:SEQIDNO:4 Query:68tttttttgttttggcaagagcatgagagcttttactgggcaagaagacaagagatggaga127 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct:29tttttttgttttggcaagagcatgagagcttttactgggcaagaagacaagagatggaga88 Query:128gtccagccgggcctgcgcttaagtgcgcggtcttgctaggcttgtaagtttctttcttgc187 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct:89gtccagccgggcctgcgcttaagtgcgcggtcttgctaggcttgtaagtttctttcttgc148 Query:188tattccaaacggtgagagatttttgtgcttttgttataggacaattaaaaccgtttcaat247 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct:149tattccaaacggtgagagatttctgtgcttttgttataggacaattaaaaccgtttcaat208 Query:248acaacacactgtggagttttcatatctttgcaactttttctttgggcattcgagcaatcg307 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct:209acaacacactgtggagttttcatatctttgcaactttttctttgggcattcgagcaatcg268 Query:308gggcccagaggttaacaaacccaaacaattttatttattcattaaatttttgtcaaaaac367 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct:269gggcccagagg-taacaaacacaaacaattttatctattcattaaatttttgtcaaaaac327 Query:368aagaatttttgtaactggaaatttt-aaaatattaaaaactttcaacaacggattttttg426 |||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct:328aagaattttcgtaactggaaattttaaaaatattaaaaactttcaacaacggatctcttg387 Query:427gttttcgcatcgatgaagaacgcagcgaaatgcaaaacgtaatgtgaattgcagaattcc486 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct:388gttctcgcatcgatgaagaacgcagcgaaatgcgatacgtaatgtgaattgcagaattcc447 Query:487gggaatcatcgaatttttgaacgcccattgcgccccttggtattccggggggcatgcctg546 ||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct:448gtgaatcatcgaatctttgaacgcacattgc-ccccttggtattccagggggcatgcctg506 Query:547tttgagggtcatttccttttcaaacattttgtttggtagggagggatactctttggagtt606 ||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct:507tttgagcgtcatttccttctcaaacattctgtttggtagtgagtgatactctttggagtt566 Query:607aacttgaaattgctggccttttcattggatgttttttttttccaaagagaggtttctctg666 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct:567aacttgaaattgctggccttttcattggatg--ttttttttccaaagagaggtttctctg624 Query:667cgtgcttgaggtataatgcaagtacggtcgttttaggttttaccaactgcggctaatctt726 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct:625cgtgcttgaggtataatgcaagtacggtcgttttaggttttaccaactgcggctaatctt684 Query:727ttttatactgagcgtattggaacgttatcgataagaagagagcgtctaggcgaacaatgt786 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct:685ttttatactgagcgtattggaacgttatcgataagaagagagcgtctaggc-aacaatgt743 Query:787tct789 ||| Sbjct:744tct746

Example 3: Preparation and Baking Tests of Sourdough Starter Using Mixed Strains

(45) 3-1. Sourdough Starter Culture and Baking Testing

(46) As shown in Table 3 below, eight tests were set up and starter culture tests were performed.

(47) TABLE-US-00003 TABLE 3 Test port number Starter strain used Wheat flour Remarks 1 Natural fermentation KingArthur (made in USA) Self-owned natural 2 species Bob's Red Mill (made in fermentation species + USA) corresponding wheat flour 3 Gompyo wheat flour (made feeding in Korea) 4 Mcsun (made in Korea) 5 * Saccharomyces KingArthur (made in USA) Yeast: Lactobacillus: 6 cerevisiae Y3-1 Bob's Red Mill (made in Bacillus = used in a weight (KCTC 15070BP) USA) ratio of 7:2;1 7 (yeast) Gompyo wheat flour (made Leuconostoc in Korea) 8 mezenteroid M1-2 Mcsun (made in Korea) (KTCT 15071BP) (Lactobacillus) Bacillus belezensis Kh2-2 (KCTC14642BP) * Strains are in powder form (including dextrin)

(48) The characteristics of the flour for testing are shown in Table 4 below.

(49) TABLE-US-00004 TABLE 4 Made in USA (milled Domestic (imported wheat, Items locally in USA) domestic flour milling) Product name Bob's Red Mill KingArthur Gompyo Mcsun Organic or not x Classification Medium flour Medium flour Strong flour Strong flour by use Particle Slightly dark Slightly dark Bright Slightly bright brightness (relative) Bleached or not x x x x Country of origin USA USA Canada, USA Canada, Turkey Includes other x Organic barley x x materials flour Gluten strength Bob's Red Mill < KingArthur Gompyo Mcsun (relative)
<Second Round of Starter Using Wheat Flour from USATest Ports 5 and 6 in Table 3>

(50) The culture conditions for the strain used as a starter strain are as follows. For culturing yeast and Lactobacillus, a medium (250 L medium was used in a 500 L fermenter) including glucose 10 (g/L), polypeptone 20, yeast extract 20, NH.sub.4NO.sub.3 2, and potassium phosphate (dibasic; K.sub.2T-IPO.sub.4) 2 was used, and the yeast culture conditions were 28 C. for 2 days, and the culture conditions for Lactobacillus were 30 C. for 1.5 days. After culturing, 1 kg each of maltodextrin and trehalose were input as cryoprotectants to the culture fluid, and then freeze-dried. In addition, the culture of the Bacillus strain used a medium (60 L medium was used in a 100 L fermenter) including tryptone (g/L) 17, soytone 3, glucose 2.5, NaCl 0.5, and dipotassium phosphate 1, and the culture conditions were 30 C. for 2 days, after culturing, 6 kg dextran (1000 weight ratio) was added to the culture fluid as a cryoprotectant and then freeze-dried. The starter strains were produced in a ratio (weight ratio) of yeast:Lactobacillus:Bacillus=7:2:1, and were diluted 50-100 times in maltodextrin. The starter was made at a ratio of water:wheat flour=50 g: 50 g, and the starter strains were added at a weight ratio of 1%. Preparation of the starter took about 10-12 hours at room temperature (24-25 C.). In the case of Bob's Red Mill, the initial pH was 6.1 and at the end of fermentation it was 5.4, and in the case of KingArthur, the initial pH was 6.1 and at the end of fermentation it was 5.4.

(51) <Second Sourdough Preparation and Baking Test Using Wheat Flour from USA>

(52) A baking test was performed using the second normal fermentation starter from USA as shown in Table 8 below, the first fermentation took 4 hours, and the second fermentation took 1 hour 45 minutes and 2 hours 47 minutes, respectively.

(53) TABLE-US-00005 TABLE 5 Fermentation process Bob's Red Mill KingArthur Starting Autolyse 7:53 AM 8:58 AM First fermentation 8:25 AM 9:28 AM started pH 6.24 pH 6.09 23.4 C. 24.3 C. First fermentation 12:25 PM 1:28 PM completed pH 5.59 pH 5.45 25.2 C. 24.7 C. Second fermentation 12:35 PM 1:41 PM started 25.2 C. 24.5 C. Second fermentation 2:20 PM 4:28 PM completed 24.4 C. 24.1 C. Baking Starts at 2:25 PM Starts at 4:30 PM Completed at 2:52 PM Completed at 5:03 PM

(54) The fermentation and baking of the starter are shown in FIG. 1.

(55) <First Round of Starter Using Domestic Wheat FlourTest Ports 7 and 8 in Table 3>

(56) The starter strains were produced in a ratio (weight ratio) of yeast:Lactobacillus:Bacillus=7:2:1, and were diluted 50-100 times in maltodextrin. The starter was made at a ratio of water:wheat flour=50 g: 50 g, and the starter strains were added at a weight ratio of 1%. Preparation of the starter took about 10-12 hours at room temperature (23-25 C.). In the case of Gompyo strong flour, the initial pH was 6.05 and at the end of fermentation, it was 5.36, and in the case of strong flour from Mcsun, the initial pH was 6.12 and at the end of fermentation it was 5.50.

(57) <First Sourdough Preparation and Baking Test Using Domestic Wheat Flour>

(58) A baking test was performed as shown in Table 6 below using a starter (first starter using domestic wheat flour) that was normally fermented using the domestic wheat flour. The first fermentation took 4 hours 19 minutes/3 hours 53 minutes respectively, and the second fermentation took 2 hours 35 minutes/1 hour 13 minutes respectively.

(59) TABLE-US-00006 TABLE 6 Fermentation process Gompyo strong flour Mcsun strong flour Start Autolyse 8:51 AM 9:32 AM * Check Gompyo first during every pH test First fermentation 9:21 AM 10:02 AM started pH 6.31 pH 6.21 24.0 C. 24.1 C. First fermentation 1:40 PM 1:55 PM completed pH 5.90 pH 5.69 24.6 C. 24.6 C. Second fermentation 1:57 PM 2:07 PM started 24.5 C. 24.5 C. Second fermentation 4:32 PM 3:20 PM completed 24.5 C. 24.2 C. Baking Starts at 4:34 PM Starts at 3:22 PM Completed at 5:05 PM Completed at 3:54 PM

(60) The fermentation and baking of the starter are shown in FIGS. 2 and 3.

(61) 3-2. Flavor and Texture Evaluation of Bread Tested and Produced with Isolated Strain Starters

(62) The results of the flavor and texture evaluation of bread produced with the isolated strain starter performed in 3-1 are shown in Tables 7 and 8 below.

(63) TABLE-US-00007 TABLE 7 Normal fermentation starter Normal fermentation starter 1st/2nd test 1st/2nd test Made in USA (milled Made in Korea (imported wheat, Evaluation locally in USA) domestic flour milling) items Bob's Red Mill KingArthur Gompyo Mcsun Crust There were samples that were baked a little longer depending on the circumstances, such as adjusting the heat, but there was no significant difference and the taste was still delicate and sweet. Acidity There were subtle differences in pH values, but they were very, very mild. Crumb Bland taste Bland taste Feels blander than the USA product In particular, the savory taste of Mcsun is lacking. Texture When tasted on the same day after baking and cooling, the texture is generally tough. When tasting after two days, the texture is generally much softer. From the time of kneading Domestic mill products appear to KingArthur have strong gluten from the time Seems to have stronger gluten they are kneaded. than Bob's Red Mill

(64) TABLE-US-00008 TABLE 8 Evaluation items Integration Color Bob's Red Mill > KingArthur > Mcsun Flavor Macsun > KingArthur > Bob's Red Mill Taste Bob's Red Mill > KingArthur > Mcsun External shape KingArthur > Bob's Red Mill > Mcsun Texture Bob's Red Mill > Mcsun > KingArthur Overall preference Bob's Red Mill > KingArthur > Mcsun

(65) There was almost no acidity in the Korean product (Macsun), but acidity was felt in the USA product (Bob's Red Mill, KingArthur). There was a slight scent of fermented soybean paste, and Bob's Red Mill was evaluated as having good taste and texture (chewy, moderate acidity, and delicious bread crust). When eaten after some time (20 to 30 minutes), the acidity felt stronger, and there was an astringent feeling and a slightly numb tongue.

(66) 3-3. Preparation and Evaluation of Sourdough Bread Using Natural Yeast Starter

(67) The sourdough starter fermentation conditions are shown in Table 9 below and were applied equally regardless of the type of wheat flour.

(68) TABLE-US-00009 TABLE 9 Starter ratio 1:5.6:5.6 (Old fermented species:water:wheat flour) (10 g:56 g:56 g) Fermentation time 11 hours (Estimated 8 hours at 24 C.) Fermentation temperature 22.8 C.

(69) The dough fermentation conditions are shown in Table 10 below.

(70) TABLE-US-00010 TABLE 10 Made in USA (milled Made in Korea (imported wheat, locally in USA) domestic flour milling) Fermentation process Bob's Red Mill KingArthur Gompyo Mcsun First Time 4 hours 42 4 hours 19 4 hours 47 4 hours 36 fermentation minutes minutes minutes minutes (room Fermentation 23.2-24.1 C. 23.2-24.0 C. temperature) temperature Second Time 4 hours 43 4 hours 30 5 hours 3 hours 15 fermentation * minutes minutes minutes (Room Fermentation 24.0 C. (9 C. at low 24.2-24.0 C. (9 C. at low temperature + temperature temperature) temperature) low temperature)

(71) Due to the baking schedule, it was refrigerated and low-temperature fermented for a short period of time (fermented at room temperature for 1 hour each, then refrigerated and low-temperature fermented, and then fermented again at room temperature). Because Bob's Red Mill and Gompyo were left in the refrigerator for about 35 minutes longer, the time it took for them to come to room temperature also took longer. Although it is called low-temperature fermentation, it is not left long enough to enhance the flavor, and 100% white wheat does not require long-term low-temperature fermentation.

(72) The pH of the sourdough starter is shown in Table 11 below.

(73) TABLE-US-00011 TABLE 11 Made in USA (milled Made in Korea (imported locally in USA) wheat, domestic flour Measuring Bob's Red milling) items Mill KingArthur Gompyo Mcsun pH 4.90 4.92 4.84 4.87

(74) The pH change during baking is shown in Table 12 below.

(75) TABLE-US-00012 TABLE 12 Made in USA (milled Made in Korea (imported wheat, locally in USA) domestic flour milling) Fermentation process Bob's Red Mill KingArthur Gompyo* Mcsun First Fermentation 5.81 5.79 5.87 5.89 fermentation beginning pH Fermentation 5.37 5.50 5.36 5.66 completion

(76) The sourdough starter and the produced bread are shown in FIGS. 4 and 5.

(77) The sensory evaluation results of the sourdough bread are shown in Table 13 below.

(78) TABLE-US-00013 TABLE 13 Made in USA (milled Made in Korea (imported wheat, Evaluation locally in USA) domestic flour milling) items Bob's Red Mill KingArthur Gompyo Mcsun Crust flavor Taste is stronger than Korean flour More nutty and less sweet than USA milling products Crumb Rough texture Savory taste Bland taste More savory taste than Gompyo Pore Irregularly sized pores spread out Irregularly sized Pores are Good fermentation condition pores spread out somewhat large Good fermentation condition Acidity Acidity is more pronounced than that of bread for strain testing. Gluten strength Based on tasting on the first day, softer texture than bread for strain testing

Experimental Example 1: Viscosity Test of Wheat Flour (Bob's Red Mill) Dough

(79) Sample processing conditions Untreated group: 5 g wheat flour (Bob's Red Mill)+22 g water Treated group: 5 g wheat flour (Bob's Red Mill)+20 g water+2 g starter strains

(80) As in the case above, in the starter strains, Saccharomyces cerevisiae Y3-1 (KCTC 15070B3P), Leuconostoc mezenteroid M1-2 (KTCT 15071B3P), and Bacillus belezensis Kh2-2 (KCTC14642BP) were used as yeast, Lactobacillus, and Bacillus bacteria, respectively, and tests were performed based on the strain ratio (yeast: Lactobacillus: Bacillus=7:2:1 weight ratio). Analysis instrument: Rapid viscosity meter (RVA: N103802, Perten, Pty.) (from Australia) Instrument operating conditions: See Table 14 (viscosity test conditions for dough of representative wheat flour (Bob's Red Mill, USA) used in sourdough)

(81) TABLE-US-00014 TABLE 14 Time (hh:mm:ss) Function type Value 00:00:00 Temperature 50 C. 00:00:00 Speed 960 rpm 00:00:10 Speed 160 rpm 00:04:00 Temperature 95 C. 00:06:00 Temperature 95 C. 00:10:00 Temperature 50 C. 00:12:00 Temperature 50 C. 00:13:00 End

(82) First, the results of viscosity analysis of Bob's Red Mill wheat flour with and without treatment of the isolated strain starter are shown in FIGS. 6 to 9. Referring to FIGS. 6 to 9, in the processed case, almost all viscosity analysis steps except peak time [peak viscosity (cP), trough (cP), break down (cP), final viscosity (cP), and set back (cP)] showed an viscosity increase of 78.5, 44.2, 96.2, 73.8, and 90.9%, respectively. The reason for the viscosity increase is not clear, but it is believed that the cause is a temporary increase in the viscosity of the gluten component of the wheat flour due to the action of added microorganisms (yeast, Lactobacillus, and Bacillus bacteria) for a short period of time (13 minutes).

Experimental Example 2: Review of Intestinal Improvement Effects Through Analysis of Changes in Alleviating Inflammation, Strengthening Immunity, Suppressing Pathogens and Harmful Intestinal Bacteria in Feces, and Increasing Beneficial Bacteria

(83) 2-1. Preparation of Feed for Mouse Experiments

(84) Before preparing the test feed, sourdough bread and yeast bread of the isolated strains were first produced according to the method below. The main materials used in the production of sourdough starter and bread was white refined wheat flour (USA produce: Bob's Red Mill and KingArthur; Korean product: Gompyo and Mcsun). The mixed ingredients of the starter consisted of water (40 ml), wheat flour (40 g), and starter (2 g), and as new strain starters, Saccharomyces cerevisiae Y3-1 (KCTC 15070BP), Leuconostoc mesenteroide M1-2 (KTCT 15071BP) and Bacillus velegensis Kh2-2 (KCTC14642BP) were produced in a weight ratio of 7:2:1. In addition, in the case of natural yeast sourdough, the research team's own natural fermentation strain was used as a starter strain. The mixture of ingredients was incubated at 24-25 C. for approximately 10 hours. The sourdough was then prepared using starter (80 g), wheat flour (230 g), whole wheat flour (10 g) and water (160 ml or more). Thereafter, the sourdough was autolyzed for 30 minutes at 24-25 C. After autolysis, salt (4 g) was added to the sourdough and first fermentation was performed at 24-25 C. for 4 hours. Stretch and fold were performed once at 15-30 minute intervals during fermentation. After molding, second fermentation was performed at 24 to 25 C. for about 1.5 hours and scoring was made. The oven was preheated to 250 C. for 30 minutes, the sourdough was baked at 250 C. for 8 to 10 minutes with hot steam, the steam was removed, the temperature was lowered to 220 C. until the crust turns black, and was baked for 20 to 25 minutes.

(85) Yeast bread was produced by mixing wheat flour (280 g), whole wheat flour (10 g), yeast (6 g; Baker's yeast, Lesaffre, Inc., France), and water (200 ml) and kneading the sourdough at once. First fermentation was then performed at 24 to 25 C. for 40 to 50 minutes. After molding, second fermentation was performed at 24 to 25 C. for 30 minutes. Subsequent scoring and baking were performed in the same manner as in the sourdough case. The produced bread was subjected to a drying process (105 C. for 24 hours), and as shown in Table 15 below, regular feed (AIN-93G) was used as the base feed, and 43% (weight ratio) was added when producing other feeds.

(86) TABLE-US-00015 TABLE 15 Regular feed Gluten Components (AIN-93G) B1* B2** B3*** Feed**** Casein 200 149.10 149.10 149.10 155.00 Sucrose 100 100 100 100 100 Dextrose 132 132 132 132 132 Corn Starch 397.486 39.32 39.32 39.32 384 Cellulose 50 35.57 35.57 35.57 49.57 Soybean Oil 70 63.50 63.50 63.50 68.93 Mineral mix 35 35 35 35 35 Vitamin mix 10 10 10 10 10 L-Cystine 3 3 3 3 3 Choline Bitartrate 2.5 2.5 2.5 2.5 2.5 Produced of dry 0 430 430 430 60 bread or gluten Total, g 1000.0 1000.0 1000.0 1000.0 1000.0 *Feed supplemented with sourdough bread (43%) produced using the isolated strain; **Feed supplemented with yeast bread (43%); ***Feed supplemented with sourdough bread (43%) produced using natural yeast strains; ****Only 6% of gluten supplemented with regular feed (Glu)

(87) The content of free amino acid (cystine) according to the type of produced feed was analyzed, and the results are shown in FIG. 10. Referring to FIG. 10, sample Glu (176 mg/100 g) was the lowest, and other samples showed similar levels in the range of 211-227 mg/100 g.

(88) The content of dominant free amino acid according to the type of produced feed was analyzed, and the results are shown in FIGS. 11 to 14. In the case of feed B1, an average content was 1.75 mg/100 g, and alanine, asparagine, and glutamic acid showed above-average content; in the case of feed Glu, an average content was 1.10 mg/100 g, and alanine, glutamic acid, lysine, and threonine showed above-average content. In the case of feed B2, an average content was 2.12 mg/100 g, and alanine, glutamic acid, lysine, and proline showed above-average content. For feed B3, an average content was 1.48 mg/100 g, and alanine, asparagine, glutamic acid, and lysine showed above-average content.

(89) 2-2. Changes in Immune Activity of Mice According to Addition of Feed: DSS-Induced Colitis Rat Test

(90) Inflammatory reactions generally occur in response to stimuli such as viral and microbial infections or foreign substances. Recently, many types of drugs for anti-inflammatory and immune system suppression have been studied, but side effects have been reported, so that efforts are being made to minimize side effects and utilize biological ingredients obtained from natural products and foods as much as possible. Bread is an important food in the daily diet of many people around the world. Although it is generally produced from refined white wheat flour, which lacks the nutrients, fiber, and bioactive components present in bran, the nutritional value of bread can be increased by adding functional ingredients. Probiotics are live microorganisms that can provide health benefits to humans, in this study, bread was produced using Saccharomyces cerevisiae Y3-1 (KCTC 15070BP), Leuconostoc mesenteroides M1-2 (KTCT 15071BP), and Bacillus belezensis Kh2-2 (KCTC14642BP) as yeast, lactic acid bacteria and bacillus bacteria, respectively, and the effect on anti-inflammatory activity was investigated in mice fed a feed produced from bread in a dextran sodium sulfate (DSS)-induced colitis model.

(91) In Vivo Experiments: Experimental Design, Animals and Diet

(92) Balb/c aged mice (11 months old) were reared at 23 C. for 12 hours in the animal laboratory of KYUNG HEE UNIVERSITY All animal studies were performed according to the instructions of the KYUNG HEE UNIVERSITY Laboratory Animal Use Ethics Committee. Basically, the test feed used in the diet was produced in three types: B1, B2, and B3. In other words, B1 was added to sourdough bread made with the sourdough starter (yeast:lactic acid bacteria:Bacillus species: 7:2:1 weight combination) developed in this study, and B2 was added to bread made without fermentation using commercial yeast, and B3 was added to bread made from sourdough as a natural starter by this research team.

(93) Acute Colitis Caused by DSS

(94) The test was implemented based on the dextran sulfate sodium (DSS) (MP Biomedicals, Ontario, CA, USA) colitis model proposed by Okayasu et al. The experimental animals were weighed after an adaptation period of one week, randomly divided into five groups, and each group was composed of 6 mice. Rats in the normal group (control) were orally administered distilled water and fed regular feed without DSS for 28 days. The colitis group (DSS) was administered distilled water for 28 days, diluted 2.5% DSS was freely supplied for 8 days (28 to 35 days), and regular feed was fed. The remaining three groups were fed B1, B2, and B3 feed groups ad libitum, respectively.

(95) Disease Activity Index (DAI) of DSS-Induced Colitis Model

(96) The intestinal disease activity index was evaluated using the scoring system in Table 16 below, and the disease activity index (DAI) was quantified using the following formula.
DAI=(Weight Loss Score)+(Stool Consistency Score (the thinner the higher the score: check for diarrhea))+(Rectal Bleeding Score)/3

(97) After evaluating three factors for each treated group, the average value was calculated.

(98) TABLE-US-00016 TABLE 16 Score Weight loss Stool consistency Rectal bleeding 0 Normal Normal 1 1 to 5% Trace amount 2 5 to 10% Loose feces Occult blood + 3 10 to 20% Occult blood ++ 4 >20% Diarrhea Severe bleeding
Cytokine Secretion in Rat Serum

(99) Blood samples were collected in test tubes and centrifuged (2000 g) for 10 min at 4 C., and the supernatant (serum) was stored at 80 C. until further analysis. Enzyme-linked immunosorbent assay (ELISA) was tested to quantify serum levels of interleukin (IL)-6, IL-17, IL-10, MPO, and granulocyte macrophage colony-stimulating factor (GM-CSF).

(100) Western Blot Analysis

(101) After pulverizing the colon tissue, Pierce RIPA Buffer (Thermo Scientific, Rockford, USA) was added and centrifuged at 12,000 rpm for 20 minutes at 4 C. The Bradford method was used to measure protein concentration. Total protein (50 ng) was run on a 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) gel, and the separated protein bands were transferred to a polyvinylidene fluoride (PVDF) membrane. After 1 hour, the membrane was blocked with 5% skim milk and then investigated using the appropriate primary antibody overnight at 4 C. The membrane was cultured with horseradish peroxidase-linked secondary antibody (goat anti-mouse/rabbit IgG 1:2000) for 2 hours at room temperature. Lastly, the degree of quantitative expression was measured by the enhanced intensity of chemical expression in the Alliance Mini HD9 (Uvitec) detection system (GenDEPot, USA).

(102) Clinical Test Symptom Test Results Due to DSS Induction in Mice

(103) To evaluate the preventive effect of feeds B1, B2, and B3, B1, B2, and B3 were fed for 28 days. After that, DSS was administered for 8 days to induce acute colitis, and the preventive effects of B1, B2, and B3 on DSS-induced acute colitis were analyzed in a mouse model.

(104) It is known that the early symptom of ulcerative colitis in rats is weight loss. Therefore, as a result of checking the mouse body weight once every two days for 8 days, weight loss was confirmed after ingestion of 2.5% DSS and in all experimental groups. However, mice in the B1, B2, and B3 treated groups showed a slight recovery in body weight compared to mice in a DSS single group. The these study results suggested that although there was no significant weight gain on day 8, oral administration of B1, B2, and B3 may have an effect in preventing weight loss in the ulcerative colitis mouse model.

(105) Next, when DSS was administered for 8 days, the degree of induction and improvement of colitis was analyzed by measuring body weight change, stool consistency, and rectal bleeding every 2 days, and the results are shown in FIGS. 15 and 16. Referring to FIG. 16, from the day 4 of DSS administration, DAI began to decrease along with B1 and B2, but the B3 treated group did not recover. The most notable improvement in 8-day colitis was confirmed in the B1 treated group. In particular, DAI was found to be strongly reduced in the group administered B1 for 35 days compared to the DSS single group. In addition, DAI decreased in the B2 administered group, but was not significant compared to the DSS single group.

(106) Mice were administered 2.5% DSS for 8 days and then sacrificed on the day 9, large intestine length of each mouse was measured, and the results are shown in FIGS. 17 and 18. Referring to FIGS. 17 and 18, it was confirmed that the colon length of DSS-administered mice was shortened by treatment with B1, B2, and B3. In addition, it was confirmed that the B1 administration group showed better colon and cecum morphology than the normal group. These results suggest that B1 can improve the severity of colitis in mice.

(107) To further demonstrate the anti-inflammatory capacity of B1, B2 and B3, effects on cytokine expression was evaluated and the results are shown in FIG. 19. Referring to FIG. 19, the mRNA expression of IL-1, TNF-, and IL-6 was dramatically increased through DSS treatment in the mouse colon. However, the B1 group strongly suppressed the DSS-induced increase in IL-1 and TNF- mRNA levels compared to the B2 and B3 groups. The B3 group slightly reduced TNF- gene expression, but did not suppress IL-10 gene expression in DSS-induced mice. As a result, B1 showed anti-inflammatory activity in mice with DSS-induced colitis by suppressing inflammatory cytokines such as IL-1, IL-6, and TNF-.

(108) Effects of B1. B2. B3 on Large Intestine Leukocyte Involvement in DSS-Induced Colitis in Mice

(109) The expression of the five proteins shown in the graph above was tested using Western blotting, and the DSS treated group showed lower expression of the five proteins compared to the control group (FIG. 20). In the case of B1, protein expression was higher than in the DSS group, and enterocyte-specific protein expression was higher than that of the control group, with B1 showing the highest expression, and in the case of B2, higher protein expression was observed compared to the DSS group, but lower than that of B1. In the case of B3, although the expression of Occludin protein was low, it showed a significantly higher expression value compared to the DSS group.

(110) The results of observing the degree of inflammation and cellular changes in the large intestine mucosa from a histological perspective are shown in FIG. 21. As shown in FIG. 21, the DSS treated group showed significant inflammation and movement damage compared to the control group, but in the case of the sourdough bread-containing feed groups (B1 and B3), there was a tendency for some degree of recovery. In addition, looking at the loss of goblet cells, it was found that the lost goblet cells were recovered to some extent in the cases of B1 and B3 compared to the DSS treated group.

(111) 2-3. Changes in Intestinal Microbial Community of Mice According to the Addition of Feed

(112) Three or five replicate samples from each group were collected and analyzed. In microbial community analysis, total DNA was extracted using analysis at CJ Bioscience (formerly Chunlab Co., Ltd.) (Seoul, Korea), the 16rRNA gene sequence was analyzed using the NGS analysis system, and then alpha diversity and beta diversity were analyzed using an own analysis platform. Dendrogram cluster analysis of the microbial community at the species level was performed using SPSS Statistics version 29. The intestinal microorganisms of five feed groups used in the experiment were compared by analyzing the microorganisms present in the stool of mice.

(113) The species diversity of intestinal microorganisms present in rat feces for five groups was compared (FIG. 22). ACE and phylogenetic diversity were highest in the control group, and was highest in the order of the B3 feed administration group and the B1 feed administration group. Species diversity was lowest in the DSS treated group. Therefore, similar to the above results, the intestinal microbial community changed by DSS was thought to restore species diversity to some extent when administered B3 and B1 feed.

(114) The firmicutes/bacteroidetes (F/B) ratio of intestinal microorganisms present in rat feces for the five groups was compared (FIG. 23). The F/B ratio showed the highest value in the feed treated group (1.89) and DSS treated group (1.39), while the control group (0.93), B2 feed administration group (0.43), and B3 feed administration group (0.62) showed low values. This indicates that there is no clear correlation between the F/B ratio between the sourdough bread-based feed diet group and the general feed diet group. It is widely accepted that the F/B ratio has an important impact on maintaining normal intestinal homeostasis. An increase or decrease in the F/B ratio is considered a dysbiosis, with the former commonly observed in obesity and the latter in inflammatory bowel disease (IBD) (Stojanov et al., 2020). Meanwhile, the high F/B ratio known to be associated with obesity is an index that takes into account a high level of taxonomic rank, i.e. phylum, and is therefore considered unreliable in future studies with more data. The meta-analysis could not find a clear trend between F/B ratio and obesity, suggesting that the complexity of how intestinal microorganisms regulate obesity is much greater than a simple imbalance between these two phyla (Tseng & Wu, 2019). In addition, it is difficult to relate the F/B ratio to a determined health status and more specifically to consider it as a characteristic of obesity (Magne et al., 2020). Therefore, in the present disclosure, it is considered difficult to use the F/B ratio as a marker for predicting inflammation in the mouse intestine.

(115) Bacteroidetes phylum showed the highest level (49.6%) in the control group and the lowest level (18.3%) in the DSS treated group (FIG. 25). In the case of Firmicutes, the B1 treated group and the control group showed relatively high levels (53.4% and 46%, respectively), while the B2, DSS, and B3 treated groups showed relatively low levels (21-28%). In the case of Proteobacteria containing pathogens compared to the control group, the DSS treated group (55.1%) was the highest and the control and B1 treated groups (1.4% and 16.9%, respectively) was the lowest. In other words, it was judged to restore the intestinal microflora changed by DSS to a normal state. Changes in the microbial community appeared to contribute to alleviating intestinal DSS-induced pathogen proliferation and inflammation, as beneficial bacteria in the mouse's gut became dominated by sourdough bread feeding.

(116) FIG. 26 shows the species distribution of intestinal microorganisms in mouse stool for five groups. In the control group, Alistipes PAC001060_s (12.3%), Acetatifactor PAC002332_s (9%), and Bacteroides acidifaciens (5.9%) were dominant, and in the DSS treated group, Bacteroides vulgatus, Escherichia coli, and Enterococcus faecium showed a distribution of 28.9, 26.4, and 24.4%, respectively. In the case of the B1 diet, Bacteroides vulgatus, Romboutsia timonensis, and Bacteroides HM124113_s were dominant at 18.7, 18.5, and 9.3%, respectively. In addition, in the B2 treated group, E. coli (43.1%), Bacteroides HM124113_s (9.4%), and Enterococcus faecium (6.0%) showed the highest distribution in that order. In addition, in the B3 treated group, Bacteroides vulgatus (22.9%), Escherichia coli (13.9%), and Bacteroides acidifaciens (13.2%) were dominant in that order.

(117) The genus Alistipes has recently been recognized as an intestinal microbial community associated with intestinal inflammation, cancer, and mental disorder, and this genus has been shown to have preventive effects against some diseases, including liver fibrosis, colitis, cancer immunotherapy, and cardiovascular disease (Parker et al., 2020). Rats fed a tryptophan-deficient diet significantly increased IL-6, IL-17A, and IL-1 and increased abundance of the Acetatifactor genus (Yusufu et al., 2021). In addition, these genera did not dominate in the control group, where microbial diversity was higher than in the other treated groups. Production of inflammatory cytokines GM-CSF, IL-6, and IFN-7 was found to be evidence of severe inflammation induced by E. coli strains of sequence type 129 (ST129) and ST375 after DSS administration (Kittana et al., 2018). E. faecium strains derived from UC patients may represent an inflammatory genotype that causes colitis (Seishima et al., 2019). In this study, the Escherichia co/i and Enterococcus faecium groups composed 49-51% of the entire population in the DSS and B2 diet groups, indicating that these genera were dominant in inflammatory conditions. The protective role of B. vulgatus FTJ appears to be due to the regulation of cytokine production in colonic tissue and structural regulation of the intestinal microbiota (Wang et al., 2022).

(118) Feeding live B. vulgatus and B. dorei significantly improved endotoxemia by attenuating the formation of atherosclerotic lesions in mice prone to atherosclerosis and then reduced pro-inflammatory immune responses by reducing intestinal microbial lipopolysaccharide production (Yoshida et al., 2018). Microbial taxa such as Faecalibacterium, Bacteroides, and Romboutsia appear to be deficient in cancer-causing mucosal and adenomatous polyps, suggesting that this genus may be used as a microbial biomarker for early tumorigenesis (Mangifesta et al., 2018). Therefore, the presence of Bacteroides vulgatus, Romboutsia timonensis, and Bacteroides HMI124113_s in the B1 diet was considered to reduce inflammation in mice in this study. E. coli and Enterococcus faecium groups were significantly decreased in the B1 and B3 diet groups, indicating that Bacteroides vulgatus, Romboutsia timonensis, and Bacteroides acidifaciens in sourdough bread may have inhibited the growth of colitis-causing bacteria. B. vulgatus 7K1 supplementation is a potentially effective treatment for alleviating colitis and provides a scientific basis for screening probiotics with anti-colitis effects (Li et al., 2021).

Experimental Example 3: Analysis of Effect on Blood Glucose in Mice According to the Addition of Sourdough-Based Feed

(119) As a result of evaluating blood glucose over time by implementing a glucose tolerance test, the B1 treated group showed the best effect in lowering blood glucose within 1 hour (FIG. 27). However, blood glucose returned to normal within 2 hours in all treated groups. One interesting thing is that when B1 feed was administered, blood glucose level was lowest within 1 hour after feeding, showing inhibition of blood glucose increase.

REFERENCES

(120) 1. Arora et al., 2021. Thirty years of knowledge on sourdough fermentation: A systematic review, Trends in Food Science & Technology Volume 108, February 2021, Pages 71-83 2. Parker, B J. 2020. The Genus Alistipes: Gut Bacteria With Emerging Implications to Inflammation, Cancer, and Mental Health. Front. Immunol., https://doi.org/10.3389/fimmu.2020.00906 3. Yusufu, I.; Ding, K.; Smith, K.; Wankhade, U. D.; Sahay, B.; Patterson, G. T.; Pacholczyk, R.; Adusumilli, S.; Hamrick, M. W.; Hill, W. D.; et al. A Tryptophan-Deficient Diet Induces Gut Microbiota Dysbiosis and Increases Systemic Inflammation in Aged Mice. Int. J. Mol. Sci. 2021, 22, 5005. https://doi.org/10.3390/ijms22095005 4. Kittana H, Gomes-Neto J C, Heck K, Geis A L, Segura Munoz R R, Cody L A, Schmaltz R J, Bindels L B, Sinha R, Hostetter J M, Benson A K and Ramer-Tait A E (2018) Commensal Escherichia coli Strains Can Promote Intestinal Inflammation via Differential Interleukin-6 Production. Front. Immunol. 9:2318. doi: 10.3389/fimmu.2018.02318 5. Seishima, J., Iida, N., Kitamura, K. et al. Gut-derived Enterococcus faecium from ulcerative colitis patients promotes colitis in a genetically susceptible mouse host. Genome Biol 20, 252 (2019). https://doi.org/10.1186/s13059-019-1879-9 6. Wang, Hesuiyuan Qing Wang, Chengmao Yang, Mingming Guo, Xiaoyue Cui, Zhe Jing, Yujie Liu, Wanjin Qiao, Hang Qi, Hongyang Zhang, Xu Zhang, Na Zhao, Mengjuan Zhang, Min Chen, Song Zhang, Haijin Xu, Liging Zhao, Mingqiang Qiao & Zhenzhou Wu (2022) Bacteroidesacidifaciens in the gut plays a protective role against CD95-mediated liver injury, Gut Microbes, 14:1, 2027853, DOI: 10.1080/19490976.2022.2027853 7. Naofumi Yoshida, Takuo Emoto, Tomoya Yamashita, Hikaru Watanabe, Tomohiro Hayashi, Tokiko Tabata, Namiko Hoshi, Naoya Hatano, Genki Ozawa, Naoto Sasaki, Taiji Mizoguchi, Hilman Zulkifli Amin, Yushi Hirota, Wataru Ogawa, Takuji Yamada and Ken-ichi Hirata. Bacteroides vulgatus and Bacteroides dorei Reduce Gut Microbial Lipopolysaccharide Production and Inhibit Atherosclerosis, Originally published 15 Aug. 2018https://doi.org/10.1161/CIRCULATIONAHA.118.033714Circulation. 2018; 138:2486-2498 8. Mangifesta, M., Mancabelli, L., Milani, C. et al. 2018. Mucosal microbiota of intestinal polyps reveals putative biomarkers of colorectal cancer. Sci Rep 8, 13974 https://doi.org/10.1038/s41598-018-32413-2 9. Sijia Li, Chen Wang, Chengcheng Zhang, Yanhong Luo, .sup.1,2Qiangian Cheng, Leilei Yu, and Zhen Sun. 2021. Evaluation of the Effects of Different Bacteroides vulgatus Strains against DSS-Induced Colitis. Journal of Immunology Research https://doi.org/10.1155/2021/9117805 Volume 2021|Article ID 9117805| 10. Stojanov, S., Ales Berlec and Borut Strukelj. 2020. The Influence of Probiotics on the Firmicutes/Bacteroidetes Ratio in the Treatment of Obesity and Inflammatory Bowel disease. Microorganisms 2020, 8, 1715; doi:10.3390/microorganisms8111715 w 11. Tseng, Ching-Hung and Chun-Ying Wu. 2019. The gut microbiome in obesity. Journal of the Formosan Medical Association 118, Supplement 1, Pages S3-S9 12. Magne, F., Martin Gotteland, Lea Gauthier, Alejandra Zazueta, Susana Pesoa, Paola Navarrete and Ramadass Balamurugan. The Firmicutes/Bacteroidetes Ratio: A Relevant Marker of Gut Dysbiosis in Obese Patients? Nutrients 2020, 12, 1474; doi:10.3390/nu12051474

DEPOSIT NUMBERS

(121) Depository Institution Name: Korea Institute of Biotechnology and Biotechnology Deposit number: KCTC15070BP Deposit Date: 20220901 Depository Institution Name: Korea Institute of Biotechnology and Biotechnology Deposit number: KCTC15071BP Deposit Date: 20220901 Depository Institution Name: Korea Institute of Biotechnology and Biotechnology Deposit number: KCTC14642BP Deposit Date: 20210722