An Aptamer for Dengue Virus and Related Methods and Products

Abstract

There is provided an aptamer for dengue virus, optionally an aptamer for dengue virus NS1 protein. The aptamer comprising at least one unnatural base, wherein the unnatural base may be 7-(2thienyl)imidazo[4,5-b]pyridine (Ds), pyrrole2-carbaldehyde (Pa) or 2-nitro-4-propynylpyrrole (Px). The aptamers of the invention may be used to identify a dengue infection in a subject. Also provided are mixtures and kits comprising the aptamer.

Claims

1. An aptamer for dengue virus (DENV), the aptamer comprising at least one unnatural base.

2. The aptamer according to claim 1, wherein the at least one unnatural base resides in a loop structure and/or a bulge of the aptamer.

3. The aptamer according to claim 1, wherein the at least one unnatural base is selected from the group consisting of: 7-(2thienyl)imidazo[4,5-b]pyridine (Ds); 7-(2,2′-bithien-5-yl)imidazo[4,5-b]pyridin-3-yl group (Dss); pyrrole2-carbaldehyde (Pa); 2-nitro-4-propynylpyrrole (Px); 7-(2,2′,5′,2″-terthien-5-yl)imidazo[4,5-b]pyridin-3-yl group (Dsss); 2-amino-6-(2-thienyl)purin-9-yl group (s); 2-amino-6-(2,2′-bithien-5-yl)purin-9-yl group (ss); 2-amino-6-(2,2′,5′,2″-terthien-5-yl)purin-9-yl group (sss); 4-(2-thienyl)-pyrrolo[2,3-b]pyridin-1-yl group (dDsa); 4-(2,2′-bithien-5-yl)-pyrrolo[2,3-b]pyridin-1-yl group (Dsas); 4-[2-(2-thiazolyl)thien-5-yl]pyrrolo[2,3-b]pyridin-1-yl group (Dsav); 4-(2-thiazolyl)-pyrrolo[2,3-b]pyridin-1-yl group (dDva); 4-[5-(2-thienyl)thiazol-2-yl]pyrrolo[2,3-b]pyridin-1-yl group (Dvas); 4-(2-imidazolyl)-pyrrolo[2,3-b]pyridin-1-yl group (dDia); derivatives thereof; and combinations thereof.

4. The aptamer according to claim 1, wherein the aptamer comprises a DNA-based aptamer.

5. The aptamer according to claim 1, wherein the dissociation constant of the aptamer for DENV is no more than 200 pM.

6. The aptamer according to claim 1, wherein the aptamer is capable of binding to the NS1 protein of DENV.

7. The aptamer according to claim 1, wherein the aptamer is capable of binding specifically to a single serotype of DENV selected from the group consisting of serotype 1, serotype 2, serotype 3 and serotype 4.

8. The aptamer according to claim 1, wherein the aptamer comprises a sequence set out in the table below: TABLE-US-00016 Sequence (L = Biotin-dT, x= dDs, SEQ ID NO. d = Diol1-dPa, y = Diol1-dPx, w = Diol1-dPa or Diol1-dPx) 11 CCCCAGACGGACTGGTGTxCTCGGxATGGCCGTCTGGGGCGCGLAGCG 12 GGCTGGTCCGxCTGGGAACAAGxGGCGGGAGGGAdGGGTGTGGGTGCGACAAGCGGA CCAGCCCGCGLAGCG 13 CCGCTTGTCATCTAxCCTGGCCxTGTGGTACTGTAACGGCTGACAAGCGGCGCGLAG CG 14 CGGCGGAGACGTAACGCxTATCAAATCxAAACAGCTTAGGGTCCGCCGCGCGLAGCG 15 Biotin-TTTCGCACTCCATGATATGGTCTACTGAGCGAGACGATGCTGCTAAAxTA CGCCGTGGTxACGAAGACAGACAAGCGGAGTAGTTAGACCGTGAAA 16 GCACTCCATGATATGGTCTACTGAGCGAGACGATGCTGCTAAAxTACGCCGTGGTxA CGAAGACAGACAAGCGGAGTGTCGCGLAGCG 17 LGATATGGTCTACTGTGTGAxGTCCTACAATGGACTGGTGTxCTCGGxATGGCCATT GACAAGCGGAGTAGTTAGACC 18 CAGACGGACTGGTGTxCTCGGxATGGCCGTCTGCGCGLAGCG 19 LTTTCGCACTCCATGATATGGTCTACTGGTCCGxCTGGGAACAAGxGGCGGGAGGGA dGGGTGTGGGTGCGACAAGCGGAGTAGTTAGACCGTCAAA 20 Biotin-TTTCGCACTCCATGATATGGTCTACTGGTCCGxCTGGGAACAAGxGGCGG GAGGGAyGGGTGTGGGTGCGACAAGCGGAGTAGTTAGACCGTCAAA 21 LTTTCGCACTCCATGATATGGTCTACTGGTCCGxCTGGGAACAAGxGGCGGGAGGGA dGGGTGTGGGTGCGACAAGCGGAGTAG 22 LCATGATATGGTCTACTGGTCCGxCTGGGAACAAGxGGCGGGAGGGAdGGGTGTGGG TGCGACAAGCGGAGTAG 23 GACGGTCTACTGGTCCGxCTGGGAACAAGxGGCGGGAGGGAdGGGTGTGGGTGCGAC AAGCGGAGTAGTTAGACCGTCCGCGLAGCG 24 GGTCTACTGGTCCGxCTGGGAACAAGxGGCGGGAGGGAdGGGTGTGGGTGCGACAAG CGGAGTAGACCCGCGLAGCG 25 GGTCCGxCTGGGAACAAGxGGCGGGAGGGAdGGGTGTGGGTGCGACAAGCGGCGCGL AGCG 26 LGATATGGTCTACTGAAGTGTTGTCATCTAxCCTGGCCxTGTGGTACTGTAACGGCT GACAAGCGGAGTAGTTAGACC 27 LGATATGGTCTACTGTGGCGCGAGGGAATCxACGCxTATCAAATAxAAACAGCTAAT GACAAGCGGAGTAGTTAGACC 28 LGATATGGTCTACTGAGGAGCGCATGTCGAGATACCAACCxCCATCCAATCxTTCTT GACAAGCGGAGTAGTTAGACC 29 LTGATATGGTCTACTGACGCCGGGGCCCGTAxTCAGACGTATACxCATCAGGGCACA TACAAGCGGAGTAGTTAGACC 30 CGAGGCCCGTAxTCAGACGTATACxCATCAGGGCCTCGCGCGLAGCG 31 GGCAGCGCGTCGATTGxCCAATCTTAGCCAACCCAAAATTACAAGCGCTGCCCGCGL AGCG 32 GCTGCCTxGTACCAACCCCCTCCAATCxATTAGGCAGCCGCGLAGCG 33 CGTGCGACGAxGTCCAACCAGTCCCAATCxACAAGTCGCACGCGCGLAGCG 34 GCGGTCCGTGCxGTCGCCAATCCGTGdTCCAACCCCGACAAGCGGACCGCCGCGLAG CG 35 GCCCGCTTTCGxCCAACCCGTGdTCCAATCCCAGAAAGCGGGCCGCGLAGCG 36 CGCCCGTCAAGGxCTCCAATCCGTGdTCCAACCAGTTTTGACGGGCGCGCGLAGCG 37 GCCCGCGTGCTCAACCTTACCAATCTGxCACGCGGGCCGCGLAGCG 38 GCCCTGCGxGCTCAACCTTACCAATCTGxCACGCAGGGCCGCGLAGCG 39 LACTCCATGATATGGTCTACTGATAGTACTCCxGTTTAACTCTGAxACTTGACGTCC ATTCATAGACAAGCGGAGTAGTTAGACC 40 LGATATGGTCTACTGGGGCTTGGTCTTGCGTxTGCAGATTAACTTGCGTGCCAGTAA GACAAGCGGAGTAGTTAGACC 41 LGATATGGTCTACTGTCTCAACGGTTGTCAAACGGxTATCACGGCxACACACCTGCG GACAAGCGGAGTAGTTAGACC 42 CTCCGCTGTCAAACGGxTATCACGGCxACACACCTGCGGACAGCGGAGCGCGLAGCG 43 LGATATGGTCTACTGTCACAxATCGCCGTAAAGxCGAAGAGCTGCGGAATCTAAGGT GACAAGCGGAGTAGTTAGACC 44 LGATATGGTCTACTGTATAATCCGCxTTCGTCATGTGGxTTGGATCTGGGTCTGGCA GACAAGCGGAGTAGTTAGACC 45 LGATATGGTCTACTGCCCAAxCTTGTCTGTAAGGGxTTGGxTAGGGCTGGCAAAAAA GACAAGCGGAGTAGTTAGACC 46 CGGCCGATGCTGCTAAAxTACGCCGTGGTxACGAAGACAGACAAGCGGAGTAGTTAG ACCGGCCGCGCGLAGCG 47 GCGCCAAAxTACGCCGTGGTxCGAAGACAGACAAGCGGAGTAGTTGGCGCCGCGLAG CG 48 GCACTCCGTCTACTGAGCGAGACGATGCTGCTAAAxTACGCCGTGGTxACGAAGACG GAGTGTCGCGLAGCG 49 GCACTCCGCTACTGAGCGAGACGATGCTGCTAAAxTACGCCGTGGTxACGAAGACAG CGGAGTGTCGCGLAGCG 50 GGCTGGTCCGACTGGGAACAAGxGGCGGGAGGGAdGGGTGTGGGTGCGACAAGCGGA CCAGCCCGCGLAGCG 51 ACTGGTGTxCTCGGxATGG 52 TGGGAACAAGxGGCGGGAGGGAwGGGTGTGGGTGCGACAAG 53 TCTAxCCTGGCCxTGTGGTACTGTAACGGC 54 GACGTAACGCxTATCAAATCxAAACAGCT 55 ATGATATGGTCTACTGAGCGAGACGATGCTGCTAAAxTACGCCGTGGTxACGAAGAC AGACAAGC 56 GAGGGAATCxACGCxTATCAAATAxAAACAGCT 57 AAACGGxTATCACGGCxACACACCTGCG or; a sequence sharing at least 75% sequence identity thereto; or a sequence differing by one, two, three, four, five, six, seven, eight, nine or ten bases thereto; or portions thereof.

9. The aptamer according to claim 1 in combination with at least one, at least two or at least three other aptamers, wherein the mixture of aptamers are specific to different serotypes.

10. A method of identifying a DENV infection in a subject, the method comprising: contacting a sample of the subject with the at least one, at least two, at least three or at least four of the aptamers according to claim 1, optionally wherein each aptamer is specific to a different serotype; and detecting a binding event at the aptamer(s).

11. The method according to claim 10, wherein the method is a method of identifying a current DENV infection in the subject, and a binding event at any of the aptamer(s) is indicative of a current DENV infection in the subject, optionally wherein the bound aptamer is specific to single DENV serotype and the binding event is indicative of a current DENV infection of said serotype in the subject.

12. The method according to claim 11, wherein where the subject is indicated for a current DENV infection, further comprising: contacting a sample of the subject with at least one, at least two, at least three or at least four of the aptamers, optionally wherein each aptamer is specific to a different serotype; and detecting a binding event at the aptamer(s), wherein an absence of a binding event at any of the aptamer(s) is indicative that the current DENV infection is a secondary or further DENV infection, optionally wherein the unbound aptamer(s) is specific to a DENV serotype and the absence of the binding event(s) is indicative of a past DENV infection of said serotype(s) in the subject.

13. The method according to claim 10, wherein the method is a method of identifying a past DENV infection in the subject, the contacting is performed in the presence of a DENV protein, and an absence of a binding event at any of the aptamer(s) is indicative of a past DENV infection in the subject, optionally wherein the unbound aptamer(s) is specific to a DENV serotype and the absence of the binding event(s) is indicative of a past DENV infection of said serotype(s) in the subject.

14. The method according to claim 12, wherein the method comprises a competitive binding assay method.

15. The method according to claim 10, wherein the method is carried out within one week following fever onset in the subject.

16. The method according to claim 10, the method further comprising administering a DENV treatment regimen to the subject if the subject is indicated for a current DENV infection.

17. A method of evaluating a subject's suitability for a DENV vaccine, the method, comprising: contacting a sample of the subject with at least one, at least two, at least three or at least four of the aptamers according to claim 1 in the presence of a DENV protein; detecting a binding event at the aptamer(s); determining an immune history of the subject based on the binding event at the aptamer(s), wherein an absence of a binding event at any of the aptamer(s) is indicative of a past DENV infection in the subject; and concluding the suitability of the subject for the DENV vaccine based on the immune history.

18.-20. (canceled)

21. The method according to claim 13, wherein the method comprises a competitive binding assay method.

22. The aptamer according to claim 1 in combination with a DENV protein.

Description

BRIEF DESCRIPTION OF FIGURES

[0126] FIG. 1. ExSELEX scheme to generate UB-DNA aptamers targeting each DEN-NS1 serotype using an aptamer-antibody sandwich method. The Ds-containing DNA library was mixed with each target DEN-NS1. The DNA—protein complexes were captured with the immobilized anti-NS1 antibody. After washing to remove the unbound DNA species, the bound DNA species are recovered and subjected to PCR amplification involving the Ds-Px pair as a third base pair, to obtain the enriched DNA library for the next round of selection. After several ExSELEX rounds, the sequences in the enriched DNA libraries were determined by deep sequencing, and the aptamer candidates were optimized and stabilized by adding a mini-hairpin DNA. It was found that one of the aptamer candidates contained the Px base, which resulted from the mutation from the natural base to Px during PCR amplification. Since the Px nucleoside is unstable during DNA chemical synthesis, the aptamers were synthesized using the Pa(diol) nucleotide, instead of Px(diol).

[0127] FIG. 2. Binding analysis of DNA libraries by electrophoresis gel-mobility shift assays The enriched DNA libraries (50 nM) in the final round of three independent ExSELEX procedures (ExSELEX-1, ExSELEX-2, and ExSELEX-3 targeting each DEN-NS1 protein) were incubated with DEN1-NS1, DEN2-NS1, DEN3-NS1 or DEN4NS1 (25 nM, as hexamers) at 25° C. for 30 min, and the DNA-NS1 complexes were separated from the free DNA on native 4% acrylamide gels. The DNA band patterns on the gels were detected with a bio-imaging analyzer, after staining the DNA bands with SYBR Gold. To investigate the importance of the Ds bases in the DNA libraries, DNA libraries without the Ds bases were prepared the by replacement PCR, and compared the binding patterns (Ds vs. Ds.fwdarw.natural base (NB)). In all cases, the densities of the shifted bands corresponding to the respective complexes were reduced in the absence of the Ds bases, suggesting that the binding species are dependent on the Ds bases for their target binding.

[0128] FIG. 3. Alignment of the random-region DNA sequences obtained by the three ExSELEX procedures, targeting DEN1-NS1. The sequences were obtained by deep sequencing through replacement PCR, by using intermediate unnatural-base substrates. The unnatural-base positions, indicated by “x”, were predicted from the mutation spectra (natural-base composition rates) after replacement PCR. The ratio (%) of each family was calculated from the total counts categorized in the same family against the total extracted reads for the analysis. Several representative family sequences, from D1-1 to D1-7, were chosen for binding analyses by EMSA and SPR (summarized in Table E2).

[0129] FIG. 4. Alignment of the random-region DNA sequences obtained by the three ExSELEX procedures, targeting DEN2-NS1. The sequences were obtained by deep sequencing through replacement PCR, by using intermediate unnatural-base substrates. The unnatural-base positions, shown as “x”, were predicted from the mutation spectra (natural-base composition rates) after replacement PCR. The ratio (%) of each family was calculated from the total counts categorized in the same family against the total extracted reads for the analysis. Several representative family sequences, from D2-1 to D2-6, were chosen for binding analyses by EMSA and SPR (summarized in Table E2).

[0130] FIG. 5. Alignment of the random-region DNA sequences obtained by the three ExSELEX procedures, targeting DEN3-NS1. The sequences were obtained by deep sequencing through replacement PCR, by using intermediate unnatural-base substrates. The unnatural-base positions, indicated by “x”, were predicted from the mutation spectra (natural-base composition rates) after replacement PCR. The ratio (%) of each family was calculated from the total counts categorized in the same family against the total extracted reads for the analysis. Several representative family sequences, from D3-1 to D3-3, were chosen for binding analyses by EMSA and SPR (summarized in Table E2).

[0131] FIG. 6. Alignment of the random-region DNA sequences obtained by the three ExSELEX procedures, targeting DEN4-NS1. The sequences were obtained by deep sequencing through replacement PCR, by using intermediate unnatural-base substrates. The unnatural-base positions, indicated by “x”, were predicted from the mutation spectra (natural-base composition rates) after replacement PCR. The ratio (%) of each family was calculated from the total counts categorized in the same family against the total extracted reads for the analysis. Several representative family sequences, from D4-1 to D4-5, were chosen for binding analyses by EMSA and SPR (summarized in Table E2).

[0132] FIG. 7. Presumed secondary structures of UB-DNA aptamers that bind specifically to each DEN-NS1 serotype and serotype-specific DEN-NS1 detection by ELISA in combination with the UB-DNA aptamer and antibody (Ab#D06) pair. a, Each aptamer specifically bound to each DENNS1 serotype: AptD1 (D1-1-48 h) to DEN1-NS1, AptD2 (D2-1d-72 h) to DEN2-NS1, AptD3 (D3-2-59 h) to DEN3-NS1, and AptD4 (D4-3-57 h) to DEN4-NS1. Each aptamer's kinetic binding parameters, dissociation constant (K.sub.D), and association and dissociation rates (k.sub.on and k.sub.off) were determined by SPR analysis (FIG. 10). All aptamers contain two Ds bases, while AptD2 contains one Pa and two Ds bases, which are essential for tight binding to the target. The Ds and Pa bases are indicated in bigger circles, compared with those of the natural bases. AptD2 has several G-motifs, shown in bold, in a large loop region. The mini-hairpin DNA sequences, CGCGTAGCG, are attached to the 3′-terminus. The thymidines within the mini-hairpin DNA sequences are used as the biotinylation sites. b, Each UB-DNA aptamer specifically recognized the targeted DEN-NS1, allowing for specific NS1 detection. In ELISA, a 10-μl portion of a 100 ng/ml solution of each flavivirus NS1 protein (DENV serotype 1-4 NS1 proteins, and Zika virus NS1 proteins of a Brazilian strain and a Ugandan strain) was used in buffer. The sample size is two per each combination set, and the error bars represent one standard deviation. The bars with wavy lines indicate that at least one of the two sample wells showed overflow (OD.sub.450>4.000).

[0133] FIG. 8. Confirmation of the presence of diol-Px in the selected clone family, D2-1. (A) Scheme of the series of experiments. First, the D2-1 clones were isolated using a biotinylated specific probe from the enriched library of Round 7 in ExSLEX-3 targeting DEN2-NS1, and were amplified by 20-cycle PCR in the presence of unnatural substrates, dDsTP and diol-dPxTP. By denaturing PAGE, the aptamer strand was purified and its binding to the target was examined by EMSA, as shown in panel B. The aptamer strand was further amplified by PCR in the presence of dDsTP and Cy5-dPxTP, using a FAM-labeled primer, for the specific labeling of the aptamer strand at the 5′-end. To assess the presence of Px in the aptamer strand from the Cy5-Px incorporation, the PCR products of the aptamer strand were analyzed by denaturing PAGE and the product patterns were compared with those from the PCR product of the initial Ds-DNA library. The aptamer strand and FAM-labeled primer were detected by the FAM fluorescence and the presence of Px was detected by the Cy5 fluorescence (panel C). After purification of the FAM-labeled aptamer strand and the Ds-library strand, they were treated with a concentrated ammonia solution at 55° C. for 4 hours to cleave the DNA fragment at the Px position. After the treatment, the DNA band patterns were analyzed by denaturing PAGE. (B) Gel mobility shift patterns support the binding of the aptamer strand to the target DEN2 NS1, but the D2-1-96(3Ds), in which the predicted unnatural base positions are all Ds (see Table E2), did not bind to the target. (C) When the initial Ds-DNA library was used as the template for PCR, the band corresponding to the aptamer strand was detected only by FAM fluorescence while the band corresponding to the complementary strand was detected only by Cy5 fluorescence. However, when the isolated clone was used as the template for PCR, the band corresponding to the amplified aptamer strand was detected by FAM and Cy5 fluorescnes. The DNA band patterns on the gel indicate that the aptamer strand that was PCR-amplified from the isolated clone should contain a Px base, since PCR under the same conditions using an initial Ds-DNA library only produced the aptamer strand without Px bases and the complementary strand with Px bases. (D) The DNA band patterns on the gel indicate that the aptamer strand was cleaved at a specific position, probably due to the presence of the Px base, not the Ds base, at the specific position corresponding to the predicted, third Ds base.

[0134] FIG. 9. Electrophoresis gel-mobility shift assay (EMSA) of the aptamer—NS1 complex formation using anti-dengue-NS1 aptamers and their variants without unnatural bases. The DNA sequences used in the assay are listed in Table E2. DNA (50 nM) was incubated with 25 nM of the respective NS1 proteins (DEN1, DEN2, DEN3, DEN4, Zika Brazil strain (B), and Zika Uganda strain (U)) at 25° C. for 30 min, and the complexes were separated on 4% acrylamide gels. The DNA bands on the gels were stained with SYBR Gold and detected by a bio-imaging analyzer.

[0135] FIG. 10. Binding analysis of UB-DNA aptamers, D1-1-48 h, D2-1d-72 h, D3-2-59 h, and D4-3-57 h, to each target by a Biacore T200 SPR system at 25° C. Running buffer: 20 mM Tris-HCl (pH 7.5), 150 mM NaCl, 1 mM MgCl.sub.2, 2.7 mM KCl, and 0.05% Tween 20. Flow rate: 30 μl/min. Injection (association) time: 150 sec. Dissociation time: 600 sec (general) or 1,200 sec for determination of kinetic parameters. The kinetic parameters, association rates (k.sub.on), dissociation rates (k.sub.off), and dissociation constants (K.sub.D), were determined through 1:1 global curve fitting with the BIAevaluation software version 3.0, by using the double-reference subtraction method. Representative association and dissociation curves (thick lines) with fitting (thin lines) are shown. Regeneration was performed with a 5-sec injection of 50 mM NaOH, followed by a 10-min equilibration with running buffer.

[0136] FIG. 11: Limit of detection (LOD) and limit of quantification (LOQ) targeting each dengue serotype NS1 by a sandwich-type ELISA using UB-DNA aptamers as capture agents and an anti-DEN-NS1 monoclonal antibody (Ab#D06) as the primary detector agent. For the target binding process, 10 μl of serially diluted NS1 (0 to 100 ng/ml) was used in a buffer with and without human serum (10%). The sample size is two per each combination set, and the data are arranged from two independent experiments. The error bars represent one standard deviation. The bars with wavy lines indicate that at least one of the two sample wells showed overflow (OD.sub.450>4.000).

[0137] FIG. 12. Development of two ELISA formats for direct NS1 detection and IgG detection in patient blood samples. a, Schematic illustration of the general detection patterns of DENV, DENNS1, and DEN-reactive IgG and IgM in primary infection. b, Direct DEN-NS1 detection by ELISA using each UB-DNA aptamer as the capture agent and the anti-DEN-NS1 antibody (Ab#D06) as the primary detector agent. c, IgG antibody detection by a competitive ELISA format. The IgG antibodies to DEN-NS1 in the patient's serum inhibited the direct DEN-NS1 detection. Using the inhibition, the IgG detection method was developed by the competitive ELISA format by adding the authentic DENNS1 of each serotype. From the inhibition data, a simple quantification method for the IgG activities to each DEN-NS1 serotype was developed (FIG. 16).

[0138] FIG. 13. DEN-NS1 and IgG detection in eleven Singaporean clinical samples by the ELISA formats. The serotype of the current infection for each sample was determined by RT-PCR and DNA sequencing. The serotype of the past infection was estimated by the Anti-NS1 IgG detection method (the competitive ELISA). DEN-NS1, IgM, and IgG were also detected by using Alere's LFA (SD BIOLINE Dengue NS1 Ag rapid test (SD) for DEN-NS1 and Panbio Dengue Duo Cassette for IgM and IgG (Panbio)). The discrepancy of the results between by the competitive ELISA and Panbio Dengue Duo Cassette is found in PD1-1, PD2-1, PD3-2, and PD3-3. The amino-acid sequence homologies were determined from the sequence data (FIG. 14). The DEN-NS1 detection was performed by the ELISA formats, using aptamer-antibody (Ab#D06) and antibody (Ab#D25)-antibody (Ab#D06) pairs. Thick arrows in the NS1 direct detection column indicate the detectable DEN-NS1 serotypes. The DEN-NS1 proteins of the PD1-2, PD1-3, PD2-2, and PD2-3 samples were not detected by the aptamer—Ab#D06 ELISA format, because the homologies of these Singaporean DEN-NS1 proteins were lower than 96.9% of the initial target of DEN-NS1. The DEN-NS1 of PD3-4 was not detected by both the aptamer—Ab#D06 and Ab#D25—Ab#D06 ELISA formats, because of the inhibition by the IgG antibodies. The IgG detection was performed by the competitive ELISA format, using the longitudinal serum samples.

[0139] FIG. 14. Differences in the amino acid sequences of DEN-NS1 proteins in the clinical samples. (A) Alignment of the amino acid sequences of DEN-NS1 proteins in clinical samples and each recombinant DENV NS1 protein used in aptamer generation as the target. The common amino acids in the sequences are abbreviated as asterisks. Each serotype categorization is: DEN1-NS1 [D1 target (The Native Antigen Company), PD1-1 and PD1-2/1-3], DEN2-NS1 [D2 target (The Native Antigen Company), PD2-1 and PD2-2/2-3], DEN3-NS1 [D3 target (The Native Antigen Company), PD3-1, PD3-2, PD3-3, and PD3-4], and DEN4-NS1 [D4 target (The Native Antigen Company) and PD4-1]. Amino acids that are different from those in each targeted serotype NS1 protein are highlighted in light grey. (B) Summary of the homology (sequence identity) of the NS1 sequences, with mutation numbers, compared with each target NS1 protein sequence. The samples, in which NS1 was successfully detected with the ELISA format, using the specific UB-DNA aptamers, are highlighted in light grey.

[0140] FIG. 15. Inhibitory effects of human sera against direct NS1 detection. Inhibitory effects of different human serum samples were analyzed by ELISA, using the aptamer—Ab#D06 pair. Each UBDNA aptamer was used as the capture agent, and Ab#D06 was used as the primary detector agent. Each NS1 protein serotype was added to buffer (a), human serum purchased from Sigma (untreated (b) or treated with protein A resin for IgG removal (c)), or human sera obtained from different people (d, e, and f). The solutions were subjected to ELISA (final 10% human serum concentration). The amount of recombinant NS1 protein added to each well (50 μl) was 350 pg for DEN1-NS1, 350 pg for DEN2-NS1, 450 pg for DEN3-NS1, and 200 pg for DEN4-NS1.

[0141] FIG. 16. Quantification of relative anti-DEN-NS1 IgG activities in competitive IgG detection with the competitive ELISA format. The scheme to quantify the relative anti-DEN-NS1 IgG activity in human serum, based on the results of competitive IgG detection with ELISA, is illustrated by using the PD2-2 sample, obtained 9 days after the onset of fever, as an example.

[0142] FIG. 17. Comparison of sensitivities of competitive IgG detection by two different ELISA formats, Apt/Ab and Ab/Ab pairs. Inhibitory effects of each clinical human serum sample were analyzed with two ELISA formats. One uses Apt/Ab pairs, where the amount of recombinant NS1 protein added in each well is 350 pg for DEN1-NS1, 350 pg for DEN2-NS1, 450 pg for DEN3-NS1, and 200 pg for DEN4-NS1. The other uses the Ab/Ab pair (biotinylated Ab#D06 as the primary detector agent and Ab#D25 as the capture agent), where the amount of recombinant NS1 protein added in each well is 400 pg (DEN1-NS1), 250 pg (DEN2-NS1), 400 pg (DEN3-NS1), and 300 pg (DEN4NS1).

[0143] FIG. 18. Comparison of sensitivities of competitive IgG detection by two different ELISA formats, Apt/Ab and Ab/Ab pairs. Inhibitory effects of each clinical human serum sample were analyzed with the two ELISA formats. One uses Apt/Ab pairs, where the amount of recombinant NS1 protein added in each well is 350 pg for DEN1-NS1, 350 pg for DEN2-NS1, 450 pg for DEN3-NS1, and 200 pg for DEN4-NS1. The other uses the Ab/Ab pair (biotinylated Ab#D06 as the primary detector agent and Ab#D25 as the capture agent), where the amount of recombinant NS1 protein added in each well is 400 pg (DEN1-NS1), 250 pg (DEN2-NS1), 400 pg (DEN3-NS1), and 300 pg (DEN4-NS1).

[0144] FIG. 19. (A) NS1 sequence variations of dengue serotype 1 and 2 patient samples. (B) The amino acids that differed from those in each target dengue NS1 protein from the Native Antigen Company were mapped onto the tertiary structure of the dengue NS1 dimer (PDB: 4O6B). The amino acid variations found in PD1-1 and PD2-1 are indicated in grey, while those in PD1-2/PD1-3 and PD2-2/PD2-3, which might include critical amino acids for the aptamer binding, are indicated in bold with underlined.

[0145] FIG. 20. DEN-NS1 direct detection in five Singaporean clinical samples by the ELISA formats. For each sample, the serotype of the current infection was determined by RT-PCR and DNA sequencing. DEN-NS1, IgM, and IgG were detected by using Alere's LFA (SD BIOLINE Dengue NS1 Ag rapid test (SD) for DEN-NS1 and Panbio Dengue Duo Cassette for IgM and IgG (Panbio)). The amino-acid sequence homologies were determined from the sequence data in FIG. 21. The DEN-NS1 detection was performed by using the ELISA formats, with aptamer-antibody (Ab#D06) and antibody (Ab#D25)-antibody (Ab#D06) pairs. The DEN1-NS1 proteins of the PD1-2, PD1-3, and PD1-4 samples were not detected by the aptamer—Ab#D06 ELISA format, because the homologies of these Singaporean DEN1-NS1 proteins were lower than 96.9% of the initial target of DEN1-NS1, purchased from Native Antigen Company. The DEN1-NS1 of PD1-5 was detected less robustly by both the aptamer—Ab#D06 and Ab#D25—Ab#D06 ELISA formats, probably due to the low NS1 level.

[0146] FIG. 21. Comparison of the amino acid sequences of DEN1-NS1 proteins in the clinical samples. (A) Alignment of the amino acid sequences of dengue NS1 proteins in the clinical samples (PD1-1, PD1-2, PD1-3, PD1-4, and PD1-5) and the DEN1-NS1 protein used in the aptamer AptD1 generation as the target. NA DEN1-NS1: DEN1-NS1 purchased from Native Antigen Company. The amino acids that are identical to those in NA DEN1-NS1 are indicated in a grey background. (B) Summary of homology (sequence identity) of the NS1 sequences. (C) Purity check of NA_D1 and the prepared Singaporean DEN1-NS1 recombinant protein (SIN DEN1-NS1) by SDS-PAGE. The protein bands were detected by sliver staining (Bio-Rad Laboratories).

[0147] FIG. 22. Binding analysis of DNA libraries and isolated clones by gel-mobility shift assays. A 50 nM portion of the DNA library (A) or the isolated clone (B) in the final round of ExSELEX-4 was incubated with 25 nM (as hexamer) of Singaporean DEN1-NS1 (SIN DEN1-NS1), as well as DEN1-NS1, NA DEN2-NS1, NA DEN3-NS1 or NA DEN4-NS1, purchased from Native Antigen Company, at 25° C. for 30 min. The DNA-NS1complexes were separated from the free DNAs on native 4% acrylamide gels. The DNA band patterns on the gels were detected with a bio-imaging analyzer (LAS-4000, Fuji Film), after staining the DNA bands with SYBR Gold. The enriched library and the isolated clone specifically bound to Singaporean DEN1-NS1 (SIN DEN1-NS1). To investigate the importance of the Ds bases in the isolated clone, DNA without the Ds bases was prepared by replacement PCR, and compared the binding patterns (Ds vs. Ds.fwdarw.Natural Base). The densities of the shifted bands corresponding to the complexes were reduced in the absence of the Ds bases, suggesting that the binding species are dependent on the Ds bases for their target interactions.

[0148] FIG. 23. Alignment of the random-region DNA sequences obtained by the ExSELEX procedures, targeting SIN DEN1-NS1. (A) The sequences were obtained by deep sequencing, through replacement PCR using intermediate unnatural-base substrates. The unnatural-base positions, indicated by “X”, were predicted from the mutation spectra (natural-base compositions rates) after replacement PCR. The ratio (%) of Family 1 was calculated against the total read counts categorized in the same family against the total extracted reads (43,385) for the analysis. (B) Summary of oligonucleotide sequences used for 19D1F1 characterization in the ELISA and SPR analysis. The dissociation constants determined by SPR and the colorimetric absorbance data in ELISA are included. N.D.: not determined (too weak to calculate the dissociation constant). N.A.: not assayed. The oligonucleotides containing a mini-hairpin sequence, CGCG-(Biotin-T)-AGCG, at the 3′-terminus are underlined. The nucleotides that did not originate from the 19D1F1 sequence are shown in light grey.

[0149] FIG. 24. Binding analysis of UB-DNA aptamers, 19D1F1-3 and 19D1F1 (isolate) to Singaporean DEN1-NS1 and NA DEN1-NS1 by a Biacore T200 SPR system at 25° C. Running buffer: 20 mM Tris-HCl (pH 7.5), 150 mM NaCl, 1 mM MgCl.sub.2, 2.7 mM KCl, and 0.05% Tween20. Flow rate: 30 μl/min. Injection (association) time: 150 sec. Dissociation time: 600 sec (general) or 1,200 sec for determination of kinetic parameters. The kinetic parameters, association rates (k.sub.on), dissociation rates (k.sub.off), and dissociation constants (K.sub.D), were determined through 1:1 global curve fitting with the BIAevaluation software version 3.0, by using the double-reference subtraction method. Representative association and dissociation curves (thick lines) with fitting (thin lines) are shown. Regeneration was performed with a 5-sec injection of 50 mM NaOH, followed by a 10-min equilibration with running buffer. (A) Singaporean DEN1-NS1 and (B) NA DEN1-NS1 recombinant protein as the analytes were used for the K.sub.D measurements.

[0150] FIG. 25. Comparison of ELISA signal patterns using AptD1 (D1-1-48 h) and AptD1b (19D1F1 isolate) in direct NS1 detection. For the detection samples, different clinical serums (PD1-1, PD1-2, and PD1-3) and DEN-NS1 recombinant proteins from Native Antigen Company (D1 NA, D2 NA, D3 NA, and D4 NA) were used. The DEN-NS1 detection was performed by the ELISA formats, using the aptamer-antibody (Ab#D06) pair. The DEN1-NS1 proteins of the PD1-1 sample and D1 NA were detected by the AptD1-Ab#D06 ELISA format, while the DEN1-NS1 proteins of the PD1-2 and PD1-3 samples were detected only by the AptD1b-Ab#D06 ELISA format. In the top panel, the mutated amino acid positions are indicated in grey with or without circles. The circled residues are possibly involved in the aptamer recognition specificity.

[0151] FIG. 26. Characterisation of a protected diol-Pa phosphoramidite for chemical DNA synthesis in accordance with embodiments of the invention. The chart is .sup.1H NMR spectrum (400 MHz. DMSO-d.sub.6) of 1-(5-O-DMTr-2-deoxy-β-D-ribofuranosyl)-(S)-4-(4,5-dibenzoyloxy-pent-1-yn-1-yl)-1H-pyrrole-2-carbaldehyde phosphoramidite. The chemical structure of the compound is shown on the top on the left.

[0152] FIG. 27. Characterisation of a protected diol-Pa phosphoramidite for chemical DNA synthesis in accordance with embodiments of the invention. The chart is .sup.31 P NMR spectrum (162 MHz, DMSO-d.sub.6) of 1-(5-O-DMTr-2-deoxy-β-D-ribofuranosyl)-(S)-4-(4,5-dibenzoyloxy-pent-1-yn-1-yl)-1H-pyrrole-2-carbaldehyde phosphoramidite.

[0153] FIG. 28. Replacement of the unnatural bases in aptamer D2-1d-72 h. (A) Aptamers D2-1d-72 h-b, D2-1d-72 h-c and D2-1d-72 h-d were generated with a Ds.fwdarw.A replacement at the 11th position (D2-1d-72 h-b), a Ds.fwdarw.A replacement at the 23.sup.rd position (D2-1d-72 h-c) and a Diol-Pa.fwdarw.T replacement at the 35th position (D2-1d-72 h-d) respectively. (B) Aptamer D2-1d-72 h-b retained its binding affinity to DEN2-NS1, whereas the binding affinity was abolished in aptamers D2-1d-72-c and D2-1d-72 h-d. (C) Schematic diagram of aptamer D2-1d-72 h. The Ds base at position 2803 and the diol-Pa/diol-Px base at position 2805 are shown to contribute to the aptamer's binding affinity for DEN2-NS1. Base variation at position 2801 may be tolerated.

EXAMPLES

[0154] Example embodiments of the disclosure will be better understood and readily apparent to one of ordinary skill in the art from the following discussions and if applicable, in conjunction with the figures. It should be appreciated that other modifications related to structural, electrical and optical changes may be made without deviating from the scope of the invention. Example embodiments are not necessarily mutually exclusive as some may be combined with one or more embodiments to form new exemplary embodiments.

UB-DNA Aptamer Generation Targeting Each DEN-NS1 Serotype

[0155] To generate Ds-containing DNA aptamers targeting each DEN-NS1 serotype, the ExSELEX procedure was performed three times (Table E1).sup.33-35,38.

TABLE-US-00013 TABLE E1 ExSELEX conditions targeting each DEN-NS1 serotype. ExSELEX-1 DNA Target Volume Binding Counter PCR cycles Round Method [nM] [nM] [mL] Additives Buffer Time (min) Washing Selection D1 D2 D3 D4 1 A 500 5 8 — BB1 60 BB1 × 3 — 18 18 18 18 2 A 100 5 1 — BB1 30 BB1 × 5 Pre 10 12 10 12 3 B 20 4 0.2 0.1% BSA BB1 30 WB × 5 Pre 25 29 28 23 4 B 5 4 0.2 0.1% BSA, BB1 30 WB × 10 Pre, Post 14 18 22 22 5% HS 5 B 5 0.4 0.2 0.1% BSA, BB1 30 WB × 25 Pre, Post 15 17 14 17 10% HS 6 B 5 0.4 0.2 0.1% BSA, BB1 30 WB (+20% Pre, Post 12 15 12 14 20% HS HS) × 3, WB × 5 7 B 1 0.4 0.3 0.1% BSA, BB1 30 WB (+50% Pre, Post 13 16 16 18 50% HS HS) × 3, WB × 10 8 B 1 0.04 0.6 0.1% BSA, BB1 30 WB (+50% Pre, Post 20 21 23 23 50% HS HS) × 3, WB × 10 9 C 1 0.167 1 0.1% BSA BB1 30 WB (+2 M Pre, Post 28 22 24 19 urea) × 3, Total 155 168 167 166 WB × 2 ExSELEX-2 DNA Target Volume Binding Counter PCR cycles Round Method [nM] [nM] [mL] Additives Buffer Time (min) Washing Selection D1 D2 D3 D4 1 C 500 5 8 — BB1 60 BB1 × 3 — 20 20 20 20 2 C 100 5 1 — BB1 30 BB1 × 5 Pre 22 22 19 20 3 B 50 2.5 0.4 0.1% BSA, BB1 30 WB × 5 Pre 15 21 25 21 10% HS 4 B 10 1 0.4 0.1% BSA, BB1 30 WB × 10 Pre, Post 20 24 25 19 50% HS 5 C 3 1 1 0.1% BSA BB1 15 BB1 (+3 M Pre, Post 26 20 27 19 urea) × 3, BB1 × 2 6 B 3 1 0.4 0.1% BSA, BB1 30 WB × 10 Pre, Post 18 20 24 16 50% HS 7 C 3 1 1 0.1% BSA BB1 15 BB1 (+3 M Pre,Post 24 18 27 18 urea) × 3, BB1 × 2 8 B 1 0.5 0.4 0.1% BSA, BB1 30 WB × 10 Pre, Post 23 23 25 21 50% HS 9 B 1 0.5 0.4 0.1% BSA, BB1 30 WB × 20 Pre, Post 23 24 27 21 50% HS 10 D 20 10 0.02 — BB1 30 — — 12 12 12 12 Total 203 204 231 187 ExSELEX-3 DNA Target Volume Binding Counter PCR cycles Round Method [nM] [nM] [mL] Additives Buffer Time (min) Washing Selection D1 D2 D3 1 B 2500 5 0.8 0.1% BSA, BB2 30 WB × 3 — 21 22 20 10% HS 2 B 250 5 0.3 0.1% BSA, BB2 30 WB × 5 Pre 15 20 21 10% HS 3 B 50 5 0.3 0.1% BSA, BB2 30 WB × 5 Pre 15 15 15 20% HS 4 B 5 1 0.3 0.1% BSA, BB2 30 WB (+2 M Pre 24 27 23 45% HS urea) × 3, WB × 2 5 B 1 0.2 0.3 0.1% BSA, BB2 10 WB (+2 M Pre 24 25 28 45% HS urea) × 3, WB × 2 6 B 1 0.2 0.3 0.1% BSA, BB2 5 WB (+50% Pre 23 20 27 45% HS HS) × 2, WB (+2 M urea) × 2, WB × 2 7 B 0.5 0.2 0.3 0.1% BSA, BB2 5 WB (+50% Pre 25 25 29 45% HS HS) × 3, Total 147 154 163 WB (+3 M urea) × 3, WB × 3 Separation of DNA-target complexes (Method): A: Ultrafiltration (Amicon Ultra-100kDa) B: Sandwich (Capture with mAb#D06, in 96-well plates) C: Complex immobilization (Dynabeads ™ His-Tag Isolation and Pulldown) D: Separation by gel-mobility shift [4% PAGE (29:1 acrylamide-bisacrylatmide) supplemented with 5% glycerol and 2 M urea] Buffers: BB1: 20 mM Tris-HCl (pH 7.5), 150 mM NaCl, 1 mM MgCl.sub.2, 2.7 mM KCl, 0.005% Nonidet-P40 BB2: 20 mM Tris-HCl (pH 7.5), 150 mM NaCl, 1 mM MgCl.sub.2, 2.7 mM KCl, 2% Tween 20 WB: 20 mM Tris-HCl (pH 7.5), 150 mM NaCl, 1 mM MaCl.sub.2, 2.7 mM KCl, 0.05% Tween 20

[0156] ExSELEX was performed targeting each recombinant DEN-NS1 serotype protein, as follows: DEN1-NS1 (D1), DEN2-NS1 (D2), DEN3-NS1 (D3), and DEN4-NS1 (D4) in the column of PCR cycles. To increase the stringency of the selection conditions, human serum (HS) was added to the binding buffer (additives) and urea in the washing buffer in later rounds.

[0157] Four DEN-NS1 serotypes were purchased from The Native Antigen Company (Oxford, UK). In the ExSELEX procedure, a selection method using an anti-DEN-NS1 monoclonal antibody (Ab#D06) was employed (FIG. 1), which binds to all four serotypes of DEN-NS1 with 27-107 pM K.sub.D values. The Ds-containing DNA library was mixed with each DEN-NS1 serotype, and then the NS1-DNA complexes were captured with immobilized Ab#D06 on a plate. The unbound DNA species were washed from the plate, and the DNA species bound on the plate were isolated and amplified by PCR for subsequent rounds of selection.

[0158] After 7-10 rounds of selection, enriched DNA libraries were obtained and their high specificities to each DEN-NS1 serotype were confirmed by electrophoresis gel-mobility shift assays (EMSAs) (FIG. 2). The high Ds dependency was also confirmed by EMSAs using library variants with the Ds.fwdarw.natural base mutations.sup.39, which did not form clearly discernible complexes with any DEN-NS1 proteins (FIG. 2). The sequences in the enriched DNA libraries (FIGS. 3-6) were determined by sequencing methods.sup.34,39, from which several aptamer candidates for each serotype were selected (Table E2).

TABLE-US-00014 TABLE E2 Sequences of anti-DEN-NS1 DNA aptamer candidates. In parentheses: EMSA using 2M urea gel. Relative shifted ratio (%)−: <10%, +: 10-40%, ++: 40-60%, +++: >60% Original Name Name EMSA SPR Sequence (5′- to -3′: L = Biotin-dT, =  dDs) (++) +++ specific 132 pM +++ K.sub.D = specific 197 pM D1-1-46h +++ specific − Biol4D1Aib D2-1-78 (+) (78-mer) Biol5D1a02 D1-3-78 (+++) +++ K.sub.B = non- LTGATATGGTCTACTGACGCCGGGGCCCGTAxTCAGACGTATACx (78-mer) 55 pM specific CATCAGGGCACATACAAGCGGAGTAGTTAGACC 15D1A02h D1-3-47 +++ K.sub.D = non- (47-mer) 98 pM specific Biol5D1A01 D1-4-78 (−) (78-mer) 16D1-2h D1-5-61h ++ (61-mer) 16D1-3h D1-6-47h ++ (47-mer) 16D1-4h D1-7-51h ++ (51-mer) Sequence (5′- to -3′: 1 = Biotin, L = Biotin-dT, x = dDs,   = Diol1=dPa, Original Name Name EMSA SPR y = Diol1-dPx) D2-1-78 (−) 14D2A1-96 D2-1-96 − D2-1d-97 ++ D2-1y-96 +++ K.sub.b = 41 pM D2-1d-64 + D2-1d-74 ++ D2-1d- ++ K.sub.b = specific 87h 105 pM ++ ++/+++ specific AptD2b ++/+++ AptD1c D2-Dd- − 72h-c AptD2d D2-1d- − 72b-d AptD2e Cont-D2- − − D2-D1- +++ 62h − D2-2-78 (−) 15DCAixh D2-2d- + (59-mer) 59h Biol15D2A03 D3-3-78 (−) (78-mer) 15D2A3xh D3-3d-52h ++ (52-mer) Biol15D2A02 D2-4-79 (−) (78-mer) 15DCA2xh + (56-mer) 15D2A6ah D2-5-96h + (46-mer) 15D2A6bh D5-5-48h + (48-mer) D2-6-59h − (54-mer) Sequence (5′- to -3′: Original Name Name EMSA SPR L = Biotin-dT, z = dDs) Biol14D3A01 D3-1-85 (++) (65-mer) D3-2-76 (+++) specific (78-mer) +++ +++ specific − Biol15D3A02 (+) (78-mer) Sequence (5′- to -3′: Original Name Name EMSA SPR L = Biotin-dT, x - dDs) Biol14D4A01 D4-1-78 (+++) K.sub.p = specific (78-mer) +++ 62 pM 14D4Alah D4-1-57h +++ K.sub.p = specific (52-mer) 29 pM Biol14D4A02 D4-2-78 (+++) (78-mer) D4-3-78 (+++) K.sub.p = specific +++ 34 pM +++ specific D4-478 (+++) Biol14D4A05 D4-5-78 (++) (78-mer) indicates data missing or illegible when filed

[0159] In Table E2, the oligonucleotide sequences used for the binding analyses against each target DEN-NS1, are summarized with the results of the electrophoresis gel-mobility shift assay (EMSA) and surface plasmon resonance (SPR) analysis. The additional complementary sequences that form stems are underlined. The oligonucleotides containing a mini-hairpin sequence, CGCG-(Biotin-T)-AGCG, at the 3′-terminus have an additional “h” in the aptamer candidate names. In the SPR analysis with 20 nM of each dengue NS1 protein, “specific” means that the oligonucleotide only bound to the target serotype DEN-NS1, and not to the other serotype DEN-NS1, while “less-specific” means the oligonucleotide exhibited binding to not only target serotype NS1 but also to some of the other serotype NS1 proteins. The chemical structures of the unnatural bases, diol-Px (Px) and diol-Pa (Pa), referenced in the table are shown below.

##STR00035##

[0160] Most of the sequences contained complementary motifs at the 5′- and 3′-regions, and thus the complementary motifs were trimmed to form a clear stem structure. To increase the thermal and enzymatic stabilities of the aptamer candidates, a specific biotin-conjugated DNA sequence (mini-hairpin DNA).sup.40-42, CGCG(Biotin-T)AGCG, was added at their 3′-termini.sup.38,43,44 (FIG. 7a). The aptamer candidates and their variants were chemically synthesized for further experiments.

[0161] A notable case involved some candidates obtained by ExSELEX targeting DEN2-NS1. One of the sequence families (D2-1), which exhibited the highest affinity to DEN2-NS1, contained two Ds and one Px bases (refer to FIG. 8 and methods for the sequence determination involving the Px base). The additional Px in the aptamers resulted from the mutation of the natural bases to Px during PCR amplification in ExSELEX.sup.34. The Px-containing DNA fragments cannot be chemically synthesized, because the Px nucleoside degrades under the basic synthesis conditions. This instability of the Px nucleoside results from the combination of the nitro group and pyrrole ring of Px.sup.45, and thus the nitro group was replaced with an aldehyde group (Pa, pyrrole-2-carbaldehyde).sup.46,47 (FIG. 1 and Table E2). The amidite derivative of the diol-conjugated Pa nucleoside was newly synthesized for DNA chemical synthesis, and several D2-1 variants containing Ds and Pa were synthesized by the standard phosphoramidite method. The Px.fwdarw.Pa aptamer variants still retained the high affinity and specificity to DEN2-NS1. This may be attributed to the similarity between the two unnatural bases. Among other similarities, both unnatural bases contain a diol group. Finally, AptD2 (D2-1d-72 h) was developed, containing two Ds and one Pa bases, as a DEN2-NS1 binder. When the Ds base at the 11.sup.th position (or position 2801 in FIG. 28) was replaced with a natural alanine base, the aptamer retained its high affinity and specificity to DEN2-NS1. However, when the Ds base at the 23.sup.rd position (or position 2803 in FIG. 28) was replaced with a natural alanine base, the binding affinity of the aptamer to DEN2-NS1 was abolished. Similarly, when the diol-Pa/diol-Px base at the 35th position (or position 2805 in FIG. 28) was replaced with a natural thymine base, loss of binding was observed (FIG. 28). In some examples, when the diol-Pa/diol-Px base was replaced with a Ds base, loss of binding was also observed (see e.g. Table E2). Thus, the Ds base at the 23.sup.rd position and the diol-Pa/diol-Px base at the 35.sup.th position contribute to the aptamer's binding affinity for DEN2-NS1. The results also suggest that base variation at the 11.sup.th position or substituition of the Ds base at the 11.sup.th position may be tolerated.

[0162] Each aptamer sequence was finalized by adding the biotin-conjugated mini-hairpin sequence at its 3′-terminus (AptD1 (D1-1-48 h) for DEN1-NS1, AptD2 (D2-1d-72 h) for DEN2-NS1, AptD3 (D3-2-59 h) for DEN3-NS1, and AptD4 (D4-3-57 h) for DEN4-NS1) (FIG. 7a). The high specificity of each aptamer to its serotype-specific DEN-NS1 was confirmed by EMSA and surface plasmon resonance (SPR) analyses (FIGS. 9 and 10). The natural-base variants, in which the UBs were replaced with natural bases, significantly reduced their affinities to each target, indicating the necessity of these UBs for the aptamers' binding capabilities. The K.sub.D values of AptD1, AptD2, AptD3, and AptD4 to each target DEN-NS1 were 182, 104, 57, and 30 pM, respectively.

[0163] The detection of each DEN-NS1 serotype was examined by a sandwich-type ELISA format, using the antibody Ab#D06 as the primary detector agent and the aptamers as capture agents (FIG. 7b). The signal was detected by the colorimetric output, using a secondary anti-IgG HRP-conjugated antibody. Each aptamer specifically detected its target DEN-NS1 serotype, and no cross-reactivities with nontarget DEN-NS1 serotypes or Zika NS1 proteins were observed. The limit of detection (LOD) in buffer was 1.19-2.36 ng/ml for each DEN-NS1 (FIG. 11).

Serotype-Specific Detection of DEN-NS1 in Patient Samples

[0164] Using blood samples from eleven Singaporean patients (PD1-1-PD4-1) with acute DENV infection, the sensitivity and specificity of the ELISA format to detect each DEN-NS1 serotype were evaluated (FIGS. 12b and 13). The serotype of the current infection in each patient sample was also determined by RT-qPCR and sequencing (FIG. 13). The ELISA format detected each DEN-NS1 serotype in the PD1-1, PD2-1, PD3-1, PD3-2, PD3-3, and PD4-1 serum samples. However, PD1-2, PD1-3, PD2-2, PD2-3, and PD3-4 could not be detected, although the ELISA format using an antibody—antibody sandwich pair (Ab#D06 and Ab#D25 (1.6-138 pM K.sub.D values for DEN-NS1)) and the commercial LFA system (SD BIOLINE) detected DEN-NS1 in all of the samples (FIG. 13), except for PD3-4, which was not detected by the antibody-antibody pair (discussed below).

[0165] The false-negative results of PD1-2, PD1-3, PD2-2, and PD2-3 were caused by the subtle amino acid differences between the DEN-NS1 present in the samples and those in the DEN-NS1 purchased from The Native Antigen Company, which were used as the targets for the aptamer generation. The amino acid sequences of DEN-NS1 in the patient samples were determined, and many amino acid substitutions were found when compared to those of the target NS1 proteins (FIG. 14). The sequence data revealed that the aptamers could bind specifically to the target DEN-NS1 with amino acid sequence homology of at least 96.9%. The DEN1-NS1 and DEN2-NS1 detection clearly showed the relationship between the homology and the aptamer affinity. The DEN1-NS1 of PD1-1 had 98.9% homology with that of The Native Antigen Company, as detected by ELISA using AptD1. In contrast, PD1-2 and PD1-3 had 96.3% homologies with that from The Native Antigen Company, and were not detected with AptD1. Similarly, the homologies of the DEN2-NS1 of PD2-1, PD2-2, and PD2-3 to that of The Native Antigen Company were 98.0, 96.6, and 96.6%, respectively, and AptD2 detected only the PD2-1 sample. For DEN3-NS1 and DEN4-NS1, the homologies were 96.9-98.9% and AptD3 and AptD4 bound to each DEN-NS1.

Serotype-Specific Detection of Anti-DEN-NS1 IgG Antibodies in Patient Samples

[0166] Using the ELISA format, it was found that it can also be used for the detection of serotype-specific anti-NS1 IgG antibodies in patient serum samples. When the ELISA sensitivity of the aptamer-antibody pair for DEN-NS1 detection in the presence of human serum purchased from Sigma-Aldrich was examined, the detection was significantly inhibited (FIG. 15b), relative to that in buffer (FIG. 15a). One of the plausible causes is the presence of anti-DEN-NS1 IgG antibodies in the serum, which inhibited the binding of the aptamer to the additional NS1 proteins. To validate this contamination theory, the total IgG antibodies were removed from the serum by treating it with protein A-immobilized resin, and confirmed the absence of inhibition with the treated serum (FIG. 15c). An ELISA was also performed using a serum sample from a Singaporean who was not infected with dengue at the time, to determine whether the serum inhibited the detection. Interestingly, the serum showed the serotype-specific inhibitions in the DEN2-NS1 detection, as well as DEN1-NS1 to some extent (FIG. 15d), suggesting that the person might have previously been infected with the dengue serotype 2 and/or serotype 1 viruses. Therefore, two other serum samples were obtained from a dengue non-endemic country, and performed an ELISA. As expected, the two serum samples did not inhibit the DEN-NS1 detection in the ELISA format (FIGS. 15e and 15f). These results inspired us to develop a new method for the serotype-specific detection of anti-DEN-NS1 IgG antibodies in human serum samples (FIG. 12c), as well as for the direct DEN-NS1 detection (FIG. 12b).

[0167] For the serotype-specific IgG detection, a simple quantification method was developed for the anti-DEN-NS1 IgG activities (FIG. 16). To this end, competitive-inhibition ELISA was performed using a series of different volumes (0.05, 0.1, 0.2, 0.5, and 5 μl) of patient serum, in the presence of a certain amount of each serotype DEN-NS1 (The Native Antigen Company). After the absorbance measurement at 450 nm (OD.sub.450) in the ELISA format, the OD.sub.450 values were plotted against the volume of serum, and the serum volume required to give an OD.sub.450 of 1.0 was calculated. The relative IgG activity (Activity) was then defined by the following formula: Activity=5/(the serum volume required for an OD.sub.450 of 1.0).

[0168] Using this competitive ELISA format and quantification method, the longitudinal changes in the IgG production and the serotype specificities of the patient samples were measured (FIG. 13). Even in the recovered patients after one year, the IgG antibodies were detectable (PD2-3, PD3-1, and PD3-3). Furthermore, the method clearly identified the primary and secondary infections. The samples can be categorized into two groups by the IgG detection: one group included PD1-1, PD1-2, PD1-3, PD2-1, PD2-2, PD3-1, and PD3-2, in which the IgG was not detected within a week after fever onset, and the other group included PD2-3, PD3-3, PD3-4, and PD4-1, in which the IgG was detected in 3-5 days. The data suggested that the latter patients were previously infected by dengue. There were some discrepancies in PD1-1, PD3-2, and PD3-3 between the IgG detection and the conventional LFA method (Panbio) (FIG. 13). The visual judgement using the LFA format was often ambiguous, and all of the longitudinal IgG detection data supported the higher accuracy of the present method over that of the LFA format. Thus, it was concluded that the first group most likely represented the primary infection, and the second group was a secondary or higher infection. The IgG detection can identify the primary or secondary infection of patients within 3-5 days after fever onset. In addition, in each primary infected patient sample, the infected serotype determined by RT-qPCR is identical to the serotype showing the highest activity among the detected IgG antibodies in the competitive ELISA system. The competitive ELISA method is specific to IgG. In the samples of patients with the primary infection, IgM was detected in PD1-1, PD2-1, PD3-1, and PD3-2 by LFA (Panbio). However, no inhibitions of the DEN-NS1 detections in the competitive ELISA were detected within the first week of the fever onset, and the inhibitions were detected at 17 days or thereafter (FIG. 13). Thus, the aptamer binding was not inhibited by the IgM produced in the early phase of the infection (FIG. 12a).

[0169] The quantitative serotype analysis of PD2-3, PD3-3, and PD4-1 revealed that the initial IgG level reflected mainly the serotypes of the past infection. Even after one week, the production of the IgG antibodies that predominantly recognized the serotype resulting from the past infection increased sharply, as compared to the IgGs produced from the current secondary infection. Although the predominance of the past infection varied depending on the patient, the PD2-3 and PD3-3 patient samples revealed the massive production of the IgG antibodies to the past serotype infection.

[0170] As mentioned above, DEN3-NS1 of PD3-4 was not detected by ELISA, using both the antibody-aptamer and antibody-antibody (Ab#D06-Ab#D25) sandwich systems. This is because the serum sample already contained the anti-DEN3-NS1 IgG antibodies resulting from a past infection, which in turn inhibited the aptamer binding, as well as the Ab#D06 and/or Ab#D25 binding to DEN3NS1.

[0171] This IgG detection method using the aptamer-antibody sandwich pair exhibited higher sensitivity and serotype specificity, as compared to that using the antibody-antibody sandwich pair. To determine whether the antibody-antibody pair can also be used for IgG detection, the competitive inhibition in ELISA using the combination was compared with the antibody-antibody (Ab#D06-Ab#D25) pair for the patient sera with PD2-3, PD3-3, PD3-4, and PD4-1 (FIGS. 17 and 18). The DEN-NS1 ternary complex formation with the antibody-antibody sandwich pair was also inhibited by the anti-DEN-NS1 IgG in the patient serum. However, the antibody-antibody pair was not able to detect the IgG activities in the day 5 sample of PD2-3 and the day 3 sample of PD4-1. Overall, the serotype sensitivities and specificities of the aptamer-antibody pairs were higher than those of the antibody-antibody pair.

Discussion

[0172] Presented herein are serotype-specific detection methods for DEN-NS1 and IgG in human serum, using high-affinity and high-specific UB-DNA aptamers. Among the generated UB-DNA aptamers, AptD2, which bound to DEN2-NS1, contained two Ds and one Px bases as the fifth and sixth bases. The high affinity of AptD2 to DEN2-NS1 indicates the importance of the diol group of Px/Pa for the binding. The combination of the hydrophobic Ds and the hydrophilic Px/Pa bases creates a new type of six-letter DNA aptamers with high affinity and specificity to their targets.

[0173] The specificities of these UB-aptamers are extremely high, and they recognize the target variants with amino-acid sequences that are at least 96.9% identical to that of the initial targets (purchased from The Native Antigen Company). This degree of homology is much higher than that among the different NS1 serotypes (69-80%). Due to their high specificity, AptD1 and AptD2 could not bind to some of the DEN1-NS1 (PD1-2/1-3) and DEN1-NS2 proteins (PD2-2/2-3) of the Singaporean patients.

[0174] Remarkably, there are ten and eleven amino acid differences between the PD1-1 and PD1-2/1-3 DEN1-NS1 and between PD2-1 and PD2-2/2-3 DEN2-NS1 (352 amino acids), respectively. The locations of these amino acid differences suggest that they might participated in the aptamer binding site (FIG. 19); the substitution of nonpolar amino acids of PD1-1 and PD2-1 to other amino acids of PD1-2/1-3 and PD2-2/2-3 might facilitate interactions between the nonpolar amino acids and the hydrophobic Ds bases. The generation of a series of UB-aptamers corresponding to each variant of DEN-NS1 could open the door to rapid and precise diagnoses of DENV mutations beyond the serotype identifications used for pandemic surveys.

[0175] In contrast to the sensitive and direct DEN-NS1 detection, the present method for the serotype-specific IgG antibody detection can be used widely for DENV variants. To knowledge, this is the first simple method capable of identifying the IgG serotype specificities using DNA aptamers, although a direct IgG detection method by ELISA using antibodies has been reported.sup.36. A similar IgG detection concept using conventional DNA aptamers was reported, to detect the IgG antibodies to the P48 protein of M. bovis.sup.48. However, the affinities of the DNA aptamers to the target were relatively low (K.sub.D=16-33 nM), and thus the background in the IgG detection was high and the quantitative analysis was difficult. The IgG detection provides valuable information for the dengue diagnostics and the use of dengue vaccine. The secondary infection can be identified by the IgG detection within several days (during the febrile period) after fever onset. If anti-DEN-NS1 IgG antibodies are detected in patients within one week after fever onset, then this indicates a secondary infection and may warrant close monitoring. Serotype specific IgG detection will also provide valuable information for the usage and analyses of the dengue vaccines, for which documentation of prior infection is important prior to administration, due to the concern of ADE.

[0176] The tests using patient samples with secondary DENV infections revealed that the IgG antibodies that responded to the past infection were predominantly produced, even upon secondary infections with different dengue serotypes. The results correlate with other reports.sup.11-14,16,17 and support ADE where secondary heterologous infections occasionally result in severe symptoms and why the vaccination of dengue-naive individuals is risky. Patients with a primary infection produced IgG antibodies that mainly targeted the infected serotype. In the secondary infection, the initially produced IgG antibodies reacted more to the NS1 serotype of the past infection, and did not effectively react with the targets of the secondary infection. The application of this test in a larger cohort of dengue patients will allow us to understand the mechanism of dengue pathogenesis, through the serotype-specific sequence of DENV infection. The present method may potentially be expanded to test the efficacy of vaccine development.sup.36,37, and to diagnose other diseases and allergies.

High-Specificity Unnatural-Base DNA Aptamers that Selectively Distinguish Dengue NS1 Protein Variants with Several Amino Acid Mutations Beyond the Serotype Specificity

[0177] The foregoing described a series of unnatural-base-containing DNA (UB-DNA) aptamers that bind specifically to dengue NS1 protein variants with more than 96.9% amino-acid homologies to the initial targets (purchased from Native Antigen Company, NA) in each serotype of Singaporean patient serums. For example, one of the UB-DNA aptamers targeting the commercially available dengue serotype 1 NS1 protein detected only serotype 1 NS1 protein variants with more than 98.9% homologies in patient serums by the ELISA system (PD1-1 and PD1-5 in FIG. 20). Here, new UB-DNA aptamers that bind specifically to other variants of dengue serotype 1 NS1 proteins with 96.3% homologies in patient serums (PD1-2, 1-3, and 1-4) were generated.

[0178] The amino acid sequences of the dengue serotype 1 NS1 protein variants in the patient serums are the same (PD1-2, 1-3, and 1-4 in FIGS. 21A and 21B), in which 13 residues were mutated among the 352 amino-acid residues in the full-length protein. Thus, the recombinant NS1 protein variant (SIN DEN1-NS1) was prepared the in-house. The NS1 region of the cDNA obtained from another patient sample, which also encoded the same amino acid sequence with PD1-2, 1-3, and 1-4, was sub-cloned to an in-house expression vector generally used for rabbit monoclonal antibody expression. The SIN DEN1-NS1 proteins with a six-histidine tag at the C-terminus were expressed in cultured CHO cells, and purified by the histidine-tag pull-down method. The purities of the obtained SIN DEN1-NS1 proteins were analyzed by SDS-PAGE with silver staining detection, and the obtained SIN-D1 concentrations were determined by comparison with the band densities of the DEN1 NS1 protein purchased from Native Antigen Company as the standard (SIN in FIG. 21C).

[0179] Using SIN-D1, seven rounds of ExSELEX (ExSELEX-4) with Ds-containing DNA libraries were performed, using the selection conditions summarized in Table E3.

TABLE-US-00015 TABLE E3 ExSELEX conditions targeting SIN-DEN1 NS1. ExSELEX (ExSELEX-4) targeting Singaporean DEN1-NS1 was performed, using the prepared SIN-DEN1 NS1 recombinant protein and the clinical serums (PD1-4). To increase the stringency of the selection conditions, human serum (HS) was added to the binding buffer (additives) and urea was added to the washing buffer in later rounds. Target Recombinant Clinical Serum Selection DNA Protein [nM] (PD1-4) Volume Binding Counter PCR Round Method [nM] SIN DEN1-NS [μl] [ml] Aditives Buffer Time(min) Washing Selection Cycles 1 C 500 2.5 — 0.8 — BB1 60 WB1 × 3 — 20 2 C 200 2.5 — 0.3 — BB1 30 WB1 × 5 Pre 20 3 B 50 2.5 — 0.4 0.1% BSA BB2 30 WB2 × 5 Pre, Post 22 4 B 10 — 20 0.4 0.1% BSA, BB2 30 WB2 × 6 Pre, Post 15 10% HS 5 B 10 — 10 0.4 0.1% BSA, BB2 30 WB2 (+3 M Pre, Post 28 10% HS Urea) × 10 6 B 3 1 — 0.4 0.1% BSA, BB2 30 WB2 (+3 M Pre, Past 22 10% HS Urea) × 10 7 B 3 — 5 0.4 0.1% BSA, BB2 30 WB2 (+3 M Pre, Post 28 10% HS Urea) × 10 Total 155 Separation of DNA-Target Complexes (Method): B: Sandwich (Capture with mAb#D06, in 96-well plates) C: Complex immobilization (Dynabeads ™ His-Tag isolation & Pulldown) Buffers: BB1: 20 mM Tris-HCl pH7.5, 150 mM NaCl, 1 mM MgCl2, 2.7 mM KCl, 5 mM imidazol, 0.005% Nonidet-P40 BB2: 20 mM Tris-HCl pH7.5, 150 mM NaCl, 1 mM MgCl2, 2.7 mM KCl, 5 mM imidazol, 0.05% Tween20 WB1: 20 mM Tris-HCl pH7.5, 150 mM NaCl, 1mM MgCl2, 2.7 mM KCl, 0.005% Nonidet P-40 WB2: 20 mM Tris-HCl pH7.5, 150 mM NaCl, 1mM MgCl2, 2.7 mM KCl, 0.05% Tween20

[0180] As the target, the prepared recombinant SIN DEN1-NS1 protein in rounds 1, 2, 3, and 6 were used, while the PD1-4 clinical serums in rounds 4, 5, and 7 were used. After seven rounds of ExSELEX, the binding of the enriched library to the SIN DEN1-NS1 protein in a gel-mobility shift assay (FIG. 22A) was observed. The sequences of the enriched library were then analyzed, and it was found that the library sequences (total extracted reads: 43,385) converged into a single family (Family 1, 40,282 reads) containing two Ds bases, with 93% of the population in the enriched library (FIG. 23A). When the sequence patterns in Family 1 were scrutinized, the 19D1F1 sequence was the most common (57% of the total extracted reads), and thus 19D1F1 was chosen for further characterization. The clone of 19D1F1 was isolated from the enriched library, using a biotinylated hybridization probe (5′-Biotin-CCACGGCGTATTTTAGCAGCATC).

[0181] The isolated 19D1F1 DNA was amplified by PCR in the presence or absence of the unnatural base substrates, dDsTP and dPxTP. The amplified 19D1F1 containing two Ds bases bound specifically to the SIN DEN1-NS1 protein. However, the Ds.fwdarw.NB (natural base) variant lost the binding ability (FIG. 22B), which indicates the importance of the Ds bases for the strong binding. In addition, it was confirmed that 19D1F1 only bound to the SIN DEN1-NS1 protein, and not to DEN1-NS1 or the other serotype NS1 proteins purchased from Native Antigen Company (FIG. 22B).

[0182] Five 19D1F1 derivatives, 19D1F1-1, 19D1F1-2, 19D1F1-3, 19D1F1-4, and 19D1F1-5 (FIG. 23B) were chemically synthesized. Among these derivatives, only 19D1F1-3 exhibited strong binding affinity to the SIN DEN1-NS1 protein (FIG. 24). The dissociation constants (K.sub.D) of 19D1F1 UB-DNA aptamers, isolated from the enriched library (19D1F1 (isolate)) and chemically synthesized (19D1F1-3), were determined by SPR, and their K.sub.D values were 9.1 pM and 27 pM, respectively.

[0183] An ELISA with the sandwich system of the 19D1F1-3 (AptD1b) and an antibody pair was performed, using the clinical samples PD1-1, PD1-2 and PD1-3 (FIG. 25). The ELISA using the 19D1F1 isolate (AptD1b) efficiently and specifically detected PD1-2 and PD1-3, but not PD1-1 and the NS1 proteins (NA) of all serotypes. Therefore, the UB-DNA aptamers can recognize ˜97% amino acid homologies of target proteins beyond the serotype identification, which to knowledge are the highest specificities as ligands.

[0184] The sequences related to 19D1F1-3 are useful because the UB-DNA aptamers can be used for the detection of some variants of dengue serotype 1 NS1 proteins.

Biological Experiments

General Information for Biological Experiments and Materials

[0185] The DNA fragments, including DNA aptamer variants, DNA libraries, and primers, used in this study were chemically synthesized with an H8 DNA/RNA Synthesizer (K&A Laborgerate) in-house by using phosphoramidites, or purchased from Integrated DNA Technologies. The phosphoramidites of the natural bases were purchased from Glen Research, and the commercially available modified phosphoramidites were purchased from Glen Research, Link Technologies, and ChemGenes Corporation. The Ds and diolPa phosphoramidites were chemically synthesized in-house as described, previously.sup.38 for Ds, and in the later chemical synthesis for diol-Pa. The chemically synthesized DNAs were purified by denaturing gel electrophoresis or directly used without further purification (for some primers and probes, which were purchased from IDT). Unnatural-base substrates (dDsTP, diol-dPxTP, Cy5-dPxTP, and dPa′TP) were chemically synthesized as described previously.sup.38-41. Recombinant DEN-NS1 (DEN1-NS1, DEN2-NS1, DEN3-NS1, and DEN4-NS1 with a polyhistidine tag) were purchased from The Native Antigen Company (DEN1-NS: Nauru/Western Pacific/1974; DEN2-NS: Thailand/16681 /84; DEN3-NS1: Sri Lanka D3/H/IMTSSA-SRI/2000/1266; DEN4-NS1: Dominica/814669/1981). Recombinant Zika virus NS1 proteins (MR 766 Uganda strain and Brazil strain) were obtained from R&D Systems, Inc. and ACROBiosystems. Anti-dengue NS1 rabbit monoclonal antibodies were prepared in-house by the conventional method. Among the antibodies, Ab#D06 and Ab#D25, which had higher affinities than the others, were chosen. The streptavidin-HRP conjugate (1 mg/ml) was obtained from Jackson ImmunoResearch. The streptavidin, Tween 20, BSA, and anti-mouse IgG HRP conjugate (1 mg/ml) were obtained from Promega. General stock solutions and chemical compounds were purchased from Thermo Fisher Scientific, Nacalai Tesque, 1.sup.st BASE, Promega, Sigma-Aldrich, New England Biolabs, and Bio-Rad Laboratories. The TMB-substrate solution (SureBlue Reserve™ TMB 1-Component Microwell Peroxidase Substrate, #5120-0083) was purchased from KPL. Control human serum was purchased from Sigma-Aldrich (Sigma #H4522) or obtained from healthy volunteers recruited at Tan Tock Sen Hospital (TTSH, Singapore), in a study approved by the National Healthcare Group Domain Specific Review Board (NHG DSRB) (Reference 2009/00432). Whole-blood samples were collected in a Serum Separation Transport Tube or EDTA tubes (Becton Dickinson) from dengue patients referred by the Communicable Disease Centre, TTSH. Blood specimens were obtained from patients consenting to the study. All patients provided separate written informed consent. The study protocol was approved by the NHG DSRB (reference 2015/00528 and 2016/00076). The recruited patients were tested and confirmed as NS1 positive from routine hospital diagnostics, using the SD BIOLINE Dengue Duo test, and had fever for less than 5 days from illness onset. They were confirmed to be infected by the dengue virus by an RTqPCR analysis of the samples. Dengue serotypes were also determined by an FTD dengue differentiation RT-qPCR test from Fast Track Diagnostics, using a Bio-Rad CFX96 instrument for the samples, and Sanger sequencing of RT-PCR products (as described later). The samples of a few patients that were followed up longitudinally were tested and samples at the acute phase (7 days post fever) and the convalescent phases (>7 days post fever up to 1 year) of their dengue infection were provided. In the ELISA shown below, serum samples were used for PD1-1, PD1-2, PD1-3, PD2-2, PD2-3, PD3-1, PD3-2, PD3-3, PD34, and PD4-1, while a plasma sample was used for PD2-1.

ExSELEX.

[0186] In the first rounds of ExSELEX, two or four nmol of the single-stranded DNA libraries (88-mer, 5′-GCACTCCATGATATGGTCTACTG-N.sub.42-GACAAGCGGAGTAGTTAGACCGT-3′) were used, which are a mixture of 74 sub-libraries. Each sub-library contains two Ds bases in the 42-nucleotide randomized sequence region, at predetermined positions. The ExSELEX conditions are summarized in Table E1. In general, the DNA library, diluted in binding buffer (20 mM Tris-HCl, pH 7.5, 150 mM NaCl, 1 mM MgCl.sub.2, and 2.7 mM KCl), was denatured by heating at 95° C. for 5 min, immediately cooled on ice for 10 min, and then kept at room temperature (25° C.) for 10 min. To the diluted DNA library solution, Nonidet P-40 (Nacalai Tesque) or Tween 20 was added at the indicated concentrations. The library was incubated with each target protein (DEN1-NS1, DEN2-NS1, DEN3-NS1, or DEN4-NS1) at 25° C. in the presence or absence of additives (BSA and human serum). The DNA-NS1 complexes were separated from the unbound DNA species by using one of four different methods (Methods A-D), as shown in Table E1. Method A is ultrafiltration with Amicon Ultra Centrifugal Filter Units (MWCO: 100 kDa). Method B is capturing the complexes with an anti-DEN-NS1 antibody, Ab#D06, coated on microtiter plates (MaxiSorp™ 96-well plates from Thermo Fisher Scientific). Method C is a pull-down method, using Dynabeads His-Tag Isolation and Pulldown Magnetic Beads (Thermo Fisher Scientific). Method D is an electrophoresis gel-mobility shift assay.sup.42. In Methods A, B, and C, the captured DNA-NS1 complexes were washed several times, and the NS1-bound DNA was recovered by a treatment with 150 mM NaOH, followed by desalting with illustra MicroSpin G-25 Columns (GE Healthcare). The recovered DNA was amplified by PCR using forward 5′-PCR and reverse 3′-PCR primers, in the presence of unnatural substrates, dDsTP and diol-dPxTP.sup.42,43. The reverse 3′-PCR primer contains a linker and spacer at the 5′-terminus, to differentiate the length of the library and its complementary strands, which allows their separation by denaturing polyacrylamide gel electrophoresis.sup.44. The single-stranded Ds-DNA libraries were separated and purified by denaturing 8% PAGE, for the next round of selection. From Round 2, to remove the non-specific DNA binding species, pre-counter selections were performed, by incubating the DNA library solution with the magnetic beads only or in the antibody-coated wells on the plates, before the target binding. In ExSELEX-1 (Rounds 4-9) and ExSELEX-2 (Rounds 4-9), to remove the DNA species that bound to the other serotype NS1 proteins, post-counter selections were performed. In the post-counter selections, the DNA solutions, eluted from the DNA-NS1 complexes (before PCR), were incubated with the non-target serotype NS1 proteins at 25° C. for 30 min, and then the undesired DNA-NS1 complexes were removed from the solution with the magnetic beads. The resultant DNA solutions were subjected to PCR amplification.

Deep Sequencing.

[0187] The aptamer candidate sequences were determined from the enriched DNA libraries in the final rounds of ExSELEX-1, ExSELEX-2, and ExSELEX-3, by the sequencing method with an Ion PGM system (Thermo Fisher Scientific), as described previously.sup.42,43,45. The DNA libraries were amplified by replacement PCR without dDsTP, but with diol-dPxTP or dPa′TP.sup.45. After the purification of the PCR products, the sequencing samples were prepared by using an Ion Plus Fragment Library Kit with an Ion Express Barcode Adapters 1-16 Kit and an Ion PGM Hi-Q View OT2 Kit, followed by deep sequencing using an Ion PGM Hi-Q View Sequencing Kit and Ion PGM 314 v2 chips (Thermo Fisher Scientific). The obtained sequence data were processed and clustered into families, and the unnatural base positions in the randomized region of each family were estimated by using in-house perl scripts.

Identification of Px in the Aptamer Strand of 2D-1.

[0188] To identify the presence of diol-Px in the 2D-1 clones, the targeted family sequences were first captured from the enriched library in the final round of ExSELEX-3 targeting DEN2-NS1, by using a specific hybridization probe (5′-biotin-CCGCCTCTTGTTCCCAGTCGGAC-3′) (FIG. 8A). The DNA library (100 μl, 50 nM in probing buffer, 20 mM Tris-HCl, pH 7.6, 0.5 M NaCl, 10 mM MgCl.sub.2) was annealed with the probe (1 μl, 5 μM in water), by heating at 95° C. for 3 min, followed by cooling by −0.1° C./sec to 60° C., and maintaining the solution at 60° C. for 15 min. The mixture was incubated with Hydrophilic Streptavidin Magnetic Beads (New England Biolabs) at 60° C. for 5 min. The magnetic beads, on which the target clones were hybridized with the probe, were then collected and washed five times with 150 μl of probing buffer (prewarmed at 60° C.). The hybridized clones were recovered from the beads by an incubation with 120 μl of water at 75° C. for 5 min. The recovered DNA (100 μl) was subjected to 20-cycle PCR (400 μl) in the presence of dDsTP and diol-dPxTP (50 μM each), and the aptamer strand was purified by denaturing PAGE. The binding of the isolated aptamer strand to DEN2-NS1 was confirmed by an electrophoresis gel-mobility shift assay (EMSA) (FIG. 8B). The chemically synthesized D2-1 DNA, D2-1-96(3Ds), in which three Ds bases were added at each position, did not bind to DEN2-NS1 (FIG. 8B), and thus, one of the three UB positions might be Px. The isolated aptamer strand (0.5 pmol) was amplified by 8-cycle PCR (25 μl), in the presence of 10 μM Cy5-dPxTP and 50 μM dDsTP with a FAM-labeled 5′-PCR primer and the linker-conjugated 3′-primer, to label the 5′-terminus of the aptamer strand with FAM and the Px-containing strand with Cy5.sup.39. The PCR products were analyzed by denaturing 15% PAGE, and the band patterns were detected by the FAM and Cy5 fluorescence, with a bio-imaging analyzer, ChemiDoc™ MP (Bio-Rad) (FIG. 8C). By PCR using the linker-conjugated 3′-PCR primer, the mobility of the complementary strand of the aptamer sequence became slower than that of the aptamer strand, and both strands were identified separately on the gel (FIG. 8C). Both of the strands of the PCR products from the isolated D2-1 strand emitted Cy5 fluorescence (FIG. 8C), indicating that the D2-1 aptamer strand contains at least one Px base. The FAM-labeled aptamer strand in the remaining PCR product was purified by denaturing 8% PAGE for further experiments. Since the

[0189] Px nucleoside is degraded under basic conditions, the DNA fragments decompose at the Px position by a concentrated ammonia treatment at 55° C. for 4 hours. After removing the ammonia solution, the residue was suspended in 20 μl of Hi-Di Formamide (Thermo Fisher Scientific), and 10 μl aliquots were fractionated by denaturing 8% PAGE. The DNA band patterns on the gel were analyzed with a bio-imaging analyzer, LAS4000 (Fuji Film), before and after staining with SYBR Gold. From the digestion pattern on the gel, the Px position in D2-1 were assessed (FIG. 8D). The 5′-FAM fluorescence detection showed one band corresponding to the 5′-digested fragment (˜57-mer), and the detection by SYBR Gold staining showed two bands corresponding to the 5′-(˜57mer) and 3′-digested (˜39-mer) fragments. These digestion patterns indicated that the DNA fragment contained one Px base at the third unnatural base position (position 57) from the 5′ end (D2-1y-97 in Table E2).

Preparation of the Authentic D2-1, D2-1y-96.

[0190] The authentic D2-1 aptamer, D2-1y-96, was prepared by using two chemically synthesized fragments (5-half: 5′-ACTCCATGATATGGTCTACTGGTCCG-Ds-CTGGGAACAAG-Ds-GGCGGGAGGGA-3′, 3-half: 5′-GGTCTAACTACTCCGCTTGTCGCACCCACACCC-Ds-TCCCTCCCGCC-3′, the complementary sequences are underlined), via primer extension and PCR amplification. The primer extension (100 μl) was performed by using 2 μM of each 5-half and 3-half in the presence of 50 μM dioldPxTP, followed by purification using a QIAquick Gel Extraction Kit (QIAGEN). By using the primer extension product as the template, 8-cycle PCR was performed in the presence of 50 μM each dDsTP and diol-dPxTP, and the aptamer strand was purified by denaturing 8% PAGE. The binding of the prepared aptamer strand, D2-1y-96, was analyzed by SPR and EMSA.

Electrophoresis Gel-Mobility Shift Assays (EMSA).

[0191] For the DNA folding, the DNA fragments diluted in binding buffer were heated at 95° C. for 5 min, followed by immediate cooling on ice for 10 min. The DNA solution (50 nM) was mixed with or without the respective NS1 protein (25 nM) in binding buffer supplemented with 0.05% Nonidet P-40, and incubated at 25° C. for 30 min. After the incubation, the samples were mixed with glycerol (final concentration 5%), and the complex formation was analyzed by PAGE (4% polyacrylamide gel containing 44.5 mM Tris-Borate, 1 mM MgCl.sub.2, 2.7 mM KCl, 5% glycerol, with or without 2 M urea). Gel electrophoresis was performed at 26-28° C. for 50 min, in the constant temperature mode (at a 3 W setting with a temperature probe set at 30° C.). The DNA band patterns on the gels were detected with the LAS4000 imager after staining with SYBR Gold. The band densities corresponding to free DNAs were quantified using the Multi Gauge software, to quantify the relative shifted ratios for comparing the degrees of complex formation.

Surface Plasmon Resonance (SPR) Analysis.

[0192] Binding affinity profiles were obtained at 25° C. on a Biacore T200 (GE Healthcare), using running buffer (binding buffer supplemented with 0.05% Tween 20). For the immobilization of each ligand (aptamer variant), streptavidin-coated sensor chips were used and the biotinylated aptamer variant was immobilized on the flow cell, by injecting 0.5 nM of the ligand solution in running buffer, at a flow rate of 0.5 μl/min for 960 sec. For some of the Ds-DNA aptamers (D1 and D2 aptamer variants), it was found that the immobilization in the presence of NS1 gave reproducible target binding profiles, which would result from the aptamer immobilization at an appropriately separated distance, to ensure efficient binding with the multimeric NS1 proteins. Binding kinetic profiles were monitored by injecting at least five different concentrations of the analyte solutions (0.625 nM to 20 nM) for 150 sec (binding), at a flow rate of 30 μl/min. The analyte dissociation patterns were then recorded for 600 sec or 1,200 sec (for D1-1-48 h, D21d-72 h, D3-2-59 h, and D4-3-57 h). To regenerate the ligand on the flow cell surface, a denaturation solution (50 mM NaOH) was injected for 5 sec, and then the ligand was equilibrated in running buffer for 10 min. The kinetic parameters for the target binding, association rates (k.sub.on), dissociation rates (k.sub.off), and dissociation constants (K.sub.D=k.sub.off/k.sub.on), were determined with the BIAevaluation software, version 3.0, by using the double-reference subtraction method and global curve fitting (more than twice at each concentration) to a 1:1 Langmuir model.

ELISA Using Aptamer-Antibody Pair (Apt/Ab ELISA).

[0193] All incubations were performed at room temperature. Microtiter plates (Maxisorp™ 96-well plates from Thermo Fisher Scientific) were coated with 100 μl/well of 10 μg/ml streptavidin overnight, in 0.1 M sodium carbonate buffer (pH 9.6). The streptavidin-coated wells were blocked with 300 μl of 10 mg/ml BSA in 1×D-PBS (Nacalai Tesque) for two hours, and then the wells were washed three times with 200 μl of washing buffer (20 mM Tris-HCl, pH 7.5, 150 mM NaCl, 1 mM MgCl.sub.2, 2.7 mM KCl, 0.05% Tween 20). Each UB-DNA aptamer was immobilized on the streptavidin-coated wells by a 2-hour incubation with 100 μl of 15 nM D1-1-48 h or 5 nM D2-1d-72 h, D3-3-59 h, or D4-3-57 h in dilution buffer (washing buffer supplemented with 1 mg/ml BSA), and then each well was washed three times with 200 μl of washing buffer. To the aptamer-coated wells, 100 μl of an NS1-Ab#D06 mixture solution was added and incubated for 30 min. The solutions were prepared beforehand at 1:9 ratios (vol/vol), by a 30-min incubation of each NS1 protein in dilution buffer or human serum with 11.1 nM of Ab#D06 in dilution buffer, supplemented with Tween 20 at a 2% final concentration (dilution buffer 2). After washing the wells once, 100 μl of secondary detector solution (anti-rabbit IgG HRP conjugate, diluted 1:2,500 with dilution buffer) was added to each well, and then incubated for 30 min. After washing the wells six times, 100 μl/well of TMB-substrate solution was added and incubated for 30 min. After adding 100 μl of 1 N HCl to the well to stop the reaction, the absorbance of the wells at 450 nm (OD.sub.450) was measured with a microplate reader, Cytation 3 (BioTek). The assays under each condition were performed in duplicate (n=2), and the average absorbance data are shown in the graphs with error bars, which represent one standard deviation. When at least one of the two sample wells showed overflow (OD.sub.450>4.000), the data are shown in the graphs with wavy lines.

ELISA Using an Antibody-Antibody Pair (Ab/Ab ELISA).

[0194] The Ab/Ab ELISA was performed in a similar manner to the Apt/Ab ELISA, with some modifications. Instead of the aptamer-coated plates, the antibody-coated plates were prepared by a 2-hour incubation with 2 μg/ml Ab#D25 (100 μl/well) in 0.1 M sodium carbonate buffer (pH 9.6), followed by blocking with BSA. In the process to prepare the NS1-Ab#D06 mixture solutions with dilution buffer 2, biotinylated Ab#D6 was used. For biotinylation, the Ab#D25 solution (6.67 μM in 1×D-PBS) was mixed with Thermo Scientific™ EZ-Link™ Sulfo-NHS-LC-Biotin (final concentration 117 μM), and the mixture was incubated at room temperature for 30 min. The antibody was then recovered after desalting, using Amicon Ultra-0.5 Centrifugal Filter Units (MWCO: 50 kDa). The biotinylated Ab#D06 solution in 1×D-PBS was kept at 4° C. until use. The secondary detector used was a streptavidin-HRP conjugate, diluted 1:20,000 with dilution buffer, instead of the anti-rabbit IgG HRP conjugate.

Treatment of Control Human Serum with Protein A Resin

[0195] To remove the IgG from human serum, protein A resin was utilized. Human serum from Sigma (500 μL, Lot#SLBT0310) was incubated with Amintra Protein A Resin (Expedeon, 500 μl of a slurry, washed three times with 1 ml of dilution buffer) at room temperature for two hours with rotation. After the incubation, the resin was removed by centrifugation, and the supernatant was recovered and kept at 4° C. until use.

Serology Testing and Dengue NS1 Detection

[0196] For control comparisons, anti-dengue IgG and IgM serology detection and dengue NS1 detection were performed using commercially available lateral flow assays, the Panbio Dengue Duo Cassette (Alere) and the SD BIOLINE Dengeu NS1 Ag rapid test (Alere) (FIG. 13), with acute phase samples. In the NS1 detection, 100 μl of each sample (human serum) was added to the sample well. After 20 min, the test and control lines were checked visually, with the naked eye. In the high-titer IgG and IgM detection, 10 μl of each sample (human serum) was dropped onto the sample well, and immediately two drops of the buffer included in the kit were added. After 15 min, the test lines for IgG and IgM, as well as the control line, were checked visually, with the naked eye. The presence of IgG indicates a secondary infection, whereas the absence of IgG indicates a primary infection.

Competitive IgG Detection

[0197] For the assays with Apt/Ab ELISA, the wells coated with each UB-DNA aptamer as the capture agent were used. For the preparation of loading samples, a serum sample (5 μl, directly or diluted 10-, 25-, 50- or 100-fold with dilution buffer) was first mixed with 0.5 μl of each NS1 protein (DEN1-NS1: 350 pg, DEN2-NS1: 350 pg, DEN3-NS1: 450 pg, DEN4-NS1 200 pg). The solution was then mixed with 45 μl of 11.1 nM Ab#D06 in dilution buffer 2, incubated for 30 min, and then loaded into the aptamer-coated well (50 μl) and incubated for 30 min. The subsequent procedures were performed as described above for the Apt/Ab ELISA.

[0198] For the assays with the Ab/Ab ELISA, the wells coated with Ab#D25 (overnight) as the capture agent were used. For the preparation of loading samples, a serum sample (5 μL or diluted 10-, 25-, 50- or 100-fold with dilution buffer) was first mixed with 0.5 μl of each NS1 protein (DEN1-NS1: 400 pg, DEN2-NS1: 250 pg, DEN3-NS1: 400 pg, DEN4-NS1: 300 pg). The solution was mixed with 45 μl of 11.1 nM biotinylated Ab#D06 in dilution buffer 2. The subsequent procedures were performed as described above for the Ab/Ab ELISA.

[0199] From the plots of OD.sub.450 against the volume of human serum used in the ELISA, the relative IgG activity was calculated through the normalization of the serum volume to lower the OD.sub.450 to 1.0 (5/[the serum volume required for the OD.sub.450 to be 1.0]) (FIG. 16).

DNA Sequencing of the Dengue NS1 Region in RNA Samples.

[0200] To compare the amino acid sequences of NS1 in the clinical samples with those of the targeted NS1 in the aptamer generation, sequencing analyses of the DENV NS1 gene RT-PCR products were performed, using Sanger capillary sequencing (for PD1-2, PD1-3, PD2-1, PD2-2, PD2-3, PD3-1, PD3-2, PD3-3, PD34, and PD4-1) or multiplex PCR followed by deep sequencing (PD1-1), with some modifications of the published protocol.sup.46. RNA from the clinical samples was reverse transcribed into cDNA using Superscript III RNase H(−) Reverse Transcriptase (Thermo Fisher Scientific) and specific primers or random hexamers.

[0201] The resulting cDNA was then used as the template for PCR amplification, using Taq DNA polymerase (New England Biolabs), AccuPrime Pfx DNA polymerase (Thermo Fisher Scientific), or Q5 HighFidelity DNA polymerase (New England Biolabs). After purification of the PCR products from the agarose gels or directly using a QIAquick gel extraction kit (Qiagen), the products were subjected to a cycle sequencing reaction with a BigDye™ Terminator v3.1 Cycle Sequencing Kit (Thermo Fisher Scientific) or deep sequencing with an Ion PGM system (Thermo Fisher Scientific), following the manufacturer's instructions. The capillary sequencing was performed on a 3500 Genetic Analyzer (Thermo Fisher Scientific), and the sequence reads were assembled manually. For PD1-1, the reads obtained with the Ion PGM system were mapped and analyzed, using PD1-2 as the reference sequence, with the CLC Genomics Workbench software (CLC bio).

Chemical Synthesis

General Information for Chemical Synthesis

[0202] All reagents and solvents were purchased from standard suppliers (Tokyo Chemical Industry Co., Ltd., Sigma-Aldrich, and Merck). Thin layer chromatography was performed using TLC silica gel 60 F254 (Merck). Compounds were visualized by UV shadowing or staining with a sulfuric acid-methanol solution. Nucleoside derivatives were purified on a Gilson HPLC system with a preparative C18 column (μBONDASPHERE, Waters, 19 mm×150 mm). .sup.1H NMR and .sup.31P NMR spectra were recorded on a Bruker magnetic resonance spectrometer. CDCl.sub.3 and DMSO-d.sub.6 were used as the solvents.

##STR00036##

[0203] (S)-Pent-4-yne-1,2-diyl dibenzoate (2). Lithium acetylide ethylenediamine complex (8.31 g, 81.2 mmol) was dissolved in hexamethylphosphoric triamide (20 ml) and dry THF (80 ml), and the resulting mixture was cooled to 0° C. Afterwards, (R)-(+)-glycidol, compound 1, (1786 μl, 27 mmol) in dry THF (40 ml) was added dropwise with stirring at 0° C. The reaction mixture was stirred for 15.5 hours at ambient temperature, and then saturated NH.sub.4Cl (200 ml) was added. The mixture was extracted with EtOAc (50 ml×3). The combined organic phase was dried over MgSO.sub.4 and concentrated under reduced pressure. The residue was co-evaporated with dry pyridine twice. Benzoyl chloride (12.5 ml, 108 mmol) was added to the residue in dry pyridine (60 ml). The resulting mixture was stirred for 19 hours at ambient temperature. The reaction was quenched by the addition of methanol (10 ml) and stirred for 30 min at ambient temperature, prior to concentration under reduced pressure. EtOAc (150 ml) and water (150 ml) were poured into the resulting residue. The organic layer was separated and washed with water (150 ml), saturated aq-NaHCO.sub.3 (150 ml), and brine (150 ml). The organic phase was dried over MgSO.sub.4 and concentrated under reduced pressure. The resulting residue was purified by silica gel column chromatography (150 g of silica gel, hexane/EtOAc=100:0 to 95:5) to give compound 2 (2.86 g, 9.26 mmol, 34%). .sup.1H NMR (400 MHz, CDCl.sub.3) δ 8.08-8.02 (m, 4H), 7.60-7.54 (m, 2H), 7.47-7.41 (m, 4H), 5.58-5.53 (m, 1H), 4.68 (dq, 2H, J=3.9, 12.0 Hz), 2.80 (dd, 2H, J=2.6, 6.2 Hz), 2.08 (t, 1H, J=2.6 Hz).

##STR00037##

[0204] 1-(2-Deoxy-β-D-ribofuranosyI)-(S)-4-(4,5-dibenzoyloxy-pent-1-yn-1-yl)-1H-pyrrole-2-carbaldehyde (3). A mixture of iodo-dPa (1.94 g, 5.75 mmol), copper iodide (175 mg, 0.92 mmol), tetrakis(triphenylphosphine)palladium(0) (332 mg, 0.288 mmol), triethylamine (1.6 ml, 11.5 mmol), and DMF (30 ml) was stirred and degassed for 10 min under reduced pressure and then flushed with argon. To this mixture was added compound 2 (2.22 g, 7.19 mmol), and the resulting mixture was further degassed for 10 min under reduced pressure and flushed with argon, prior to stirring for 4 hours at ambient temperature. The reaction mixture was concentrated under reduced pressure. The resulting dark liquid mixture was purified by silica gel column chromatography (60 g of silica gel, DCM/methanol=100:0 to 98:2) and C18 RP-HPLC (eluted by a gradient of CH.sub.3CN (40-80%) in H.sub.2O) to give compound 3 (2.35 g, 4.53 mmol, 79%). .sup.1H NMR (400 MHz, DMSO-d.sub.6) δ 9.47 (d, 1H, J=0.9 Hz), 8.00-7.95 (m, 4H), 7.87 (s, 1H), 7.70-7.64 (m, 2H), 7.56-7.50 (m, 4H), 7.08 (d, 1H, J=1.8 Hz), 6.66 (t, 1H, J=6.3 Hz), 5.57-5.52 (m, 1H), 5.27 (d, 1H, J=4.1 Hz), 5.03 (t, 1H, J=5.3 Hz), 4.74-4.70 (dd, 1H, J=3.3, 11.9 Hz), 4.64-4.59 (dd, 1H, J=6.7, 12.0 Hz), 4.24 (m, 1H), 3.81 (dt, 1H, J=3.6, 4.0 Hz), 3.62-3.50 (m, 2H), 3.03 (d, 2H, J=6.4 Hz), 2.32-2.08 (m, 2H).

[0205] 1-(5-O-DMTr-2-deoxyl-β-D-ribofuranosyl)-(S)-4-(4,5-dibenzoyloxy-pent-1-yn-1-yl)-1H-pyrrole-2carbaldehyde (4). Compound 3 (2.35 g, 4.53 mmol) was co-evaporated with dry pyridine three times. The residue in dry pyridine (40 ml) was mixed with 4,4′-dimethoxytrityl chloride (DMTrCl, 1.84 g, 5.44 mmol). The resulting mixture was stirred for 2 hours at ambient temperature, prior to concentration under reduced pressure. EtOAc (150 ml) and water (150 ml) was poured into the resulting residue. The organic layer was separated and washed with saturated aq-NaHCO.sub.3 (150 ml×1) and brine (150 ml×1). After drying with MgSO.sub.4, the solvent was evaporated under reduced pressure. The residue was purified by silica gel column chromatography (60 g of silica gel, hexane/EtOAc=100:0 to 70:30) to give compound 4 (2.98 g, 3.63 mmol, 80%). .sup.1H NMR (400 MHz, DMSO-d.sub.6) δ 9.47 (d, 1H, J=0.8 Hz), 7.98-7.94 (m, 4H), 7.68-7.63 (m, 3H), 7.57-7.47 (m, 4H), 7.39-7.37 (m, 2H), 7.31-7.19 (m 6H), 7.11 (d, 1H, J=1.8 Hz), 6.89-6.87 (m, 4H), 6.67 (t, 1H, J=5.9 Hz), 5.54-5.49 (m, 1H), 5.36 (d, 1H, J=3.8 Hz), 4.71-4.67 (dd, 1H, J=3.3, 11.9 Hz), 4.60-4.55 (dd, 1H, J=6.7, 12.0 Hz), 4.26 (m, 1H), 3.97-3.93 (m, 1H), 3.73 (d, 6H, J=1.0 Hz), 3.22-3.18 (dd, 1H, J=5.8, 10.4 Hz), 3.14-3.11 (dd, 1H, J=3.1, 10.4 Hz), 2.99 (d, 2H, J=6.4 Hz), 2.36-2.18 (m, 2H).

[0206] 1-(5-O-DMTr-2-deoxyl3-D-ribofuranosyl)-(S)-4-(4,5-dibenzoyloxy-pent-1-yn-1-yl)-1H-pyrrole-2carbaldehyde phosphoramidite (5). Compound 4 (2.98 g, 3.63 mmol) was co-evaporated with pyridine three times and then with dry THF three times. N,N-Diisopropylethylamine (950 μl, 5.45 mmol) and 2cyanoethyl N,N-diisopropylchlorophosphoramidite (893 μl, 4 mmol) were added to the residue in anhydrous THF (35 ml), and the resulting mixture was stirred for 3 hours at ambient temperature. Dry methanol (500 μl) was added to the mixture to quench the reaction. EtOAc/triethylamine (150 ml, 99/1) and saturated aq-NaHCO.sub.3 (150 ml) were poured into the resulting residue. The organic layer was separated and washed with aq-NaHCO.sub.3 (150 ml) and brine (150 ml). After drying with MgSO.sub.4, the solvent was evaporated under reduced pressure. The residue was purified by silica gel column chromatography (80 g, hexane/EtOAc=100/0 to 80/20 containing 1% triethylamine) to give compound 5 (2.84 g, 2.78 mmol, 76%). .sup.1H NMR (400 MHz, DMSO-d.sub.6) δ 9.52-9.50 (m, 1H), 7.97-7.94 (m, 4H), 7.69-7.62 (m, 3H), 7.52-7.47 (m, 4H), 7.40-7.36 (m, 2H), 7.31-7.18 (m, 6H), 7.12 (m, 1H), 6.89-6.86 (m, 4H), 6.74-6.68 (m, 1H), 5.55-5.48 (m, 1H), 4.71-4.46 (m, 3H), 4.12-4.04 (m, 1H), 3.73-3.72 (m, 6H), 3.67-3.46 (m, 3H), 3.27-3.17 (m, 2H), 2.99 (t, 2H, J=5.9 Hz), 2.76 (t, 1H, J=5.9 Hz), 2.66 (t, 1H, J=5.9 Hz), 2.49-2.32 (m, 2H), 1.14-0.99 (m, 12H) (FIG. 26). .sup.31P NMR (162 MHz, DMSO-d.sub.6) δ 147.8 and 147.5 (diastereoisomers) (FIG. 27).

REFERENCES

[0207] 1 Bhatt, S. et al. The global distribution and burden of dengue. Nature 496, 504-507 (2013). [0208] 2 WHO. Dengue and severe dengue, <https://www.who.int/news-room/factHYPERLINK “https://www.who.int/news-room/fact-sheets/detail/dengue-and-severe-dengue”sheets/detail/dengue-and-severe-dengue>(2019). [0209] 3 Halstead, S. B. & O'Rourke, E. J. Dengue viruses and mononuclear phagocytes. I. Infection enhancement by non-neutralizing antibody. J. Exp. Med. 146, 201-217 (1977). [0210] 4 Halstead, S. B. & O'Rourke, E. J. Antibody-enhanced dengue virus infection in primate leukocytes. Nature 265, 739-741 (1977). [0211] 5 Halstead, S. B. In vivo enhancement of dengue virus infection in rhesus monkeys by passively transferred antibody. J. Infect. Dis. 140, 527-533 (1979). [0212] 6 Halstead, S. B. Dengue. Lancet 370, 1644-1652 (2007). [0213] 7 Guzman, M. G. & Harris, E. Dengue. Lancet 385, 453-465 (2015). [0214] 8 Guzman, M. G., Gubler, D. J., Izquierdo, A., Martinez, E. & Halstead, S. B. Dengue infection. Nat. Rev. Dis. Primers 2, 16055 (2016). [0215] 9 Wilder-Smith, A., Ooi, E. E., Horstick, O. & Wills, B. Dengue. Lancet 393, 350-363 (2019). [0216] 10 Priyamvada, L. et al. Human antibody responses after dengue virus infection are highly crossreactive to Zika virus. Proc. Natl. Acad. Sci. USA 113, 7852-7857 (2016). [0217] 11 Mathew, A. et al. B-cell responses during primary and secondary dengue virus infections in humans. J. Infect. Dis. 204, 1514-1522 (2011). [0218] 12 Corbett, K. S. et al. Preexisting neutralizing antibody responses distinguish clinically inapparent and apparent dengue virus infections in a Sri Lankan pediatric cohort. J. Infect. Dis. 211, 590-599 (2015). [0219] 13 Priyamvada, L. et al. B Cell Responses during Secondary Dengue Virus Infection Are Dominated by Highly Cross-Reactive, Memory-Derived Plasmablasts. J. Virol. 90, 5574-5585 (2016). [0220] 14 Katzelnick, L. C. et al. Antibody-dependent enhancement of severe dengue disease in humans. Science 358, 929-932 (2017). [0221] 15 St John, A. L. & Rathore, A. P. S. Adaptive immune responses to primary and secondary dengue virus infections. Nat. Rev. Immunol. 19, 218-230 (2019). [0222] 16 Patel, B. et al. Dissecting the human serum antibody response to secondary dengue virus infections. PLoS NegL Trop. Dis. 11, e0005554 (2017). [0223] 17 Reich, N. G. et al. Interactions between serotypes of dengue highlight epidemiological impact of cross-immunity. J. R. Soc. Interface 10, 20130414 (2013). [0224] 18 Villar, L. et al. Efficacy of a tetravalent dengue vaccine in children in Latin America. N. Engl. J. Med. 372, 113-123 (2015). [0225] 19 Capeding, M. R. et al. Clinical efficacy and safety of a novel tetravalent dengue vaccine in healthy children in Asia: a phase 3, randomised, observer-masked, placebo-controlled trial. Lancet 384, 1358-1365 (2014). [0226] 20 Ferguson, N. M. et al. Benefits and risks of the Sanofi-Pasteur dengue vaccine: Modeling optimal deployment. Science 353, 1033-1036 (2016). [0227] 21 Sridhar, S. et al. Effect of Dengue Serostatus on Dengue Vaccine Safety and Efficacy. N. Engl. J. Med. 379, 327-340 (2018). [0228] 22 Aguiar, M., Halstead, S. B. & Stollenwerk, N. Consider stopping dengvaxia administration without immunological screening. Expert. Rev. Vaccines 16, 301-302 (2017). [0229] 23 Halstead, S. B. Dengvaxia sensitizes seronegatives to vaccine enhanced disease regardless of age. Vaccine 35, 6355-6358 (2017). [0230] 24 Luo, R. et al. Rapid diagnostic tests for determining dengue serostatus: a systematic review and key informant interviews. Clin. Microbiol. Infect. (2019). [0231] 25 Bosch, I. et al. Rapid antigen tests for dengue virus serotypes and Zika virus in patient serum. Sci. Transl. Med. 9 (2017). [0232] 26 Lebani, K. et al. Isolation of serotype-specific antibodies against dengue virus non-structural protein 1 using phage display and application in a multiplexed serotyping assay. PLoS One 12, e0180669 (2017). [0233] 27 Ellington, A. D. & Szostak, J. W. In vitro selection of RNA molecules that bind specific ligands. Nature 346, 818-822 (1990). [0234] 28 Tuerk, C. & Gold, L. Systematic evolution of ligands by exponential enrichment: RNA ligands to bacteriophage T4 DNA polymerase. Science 249, 505-510 (1990). [0235] 29 Rothlisberger, P. & Hollenstein, M. Aptamer chemistry. Adv. Drug. Deliv. Rev. 134, 3-21 (2018). [0236] 30 Zhou, J. & Rossi, J. Aptamers as targeted therapeutics: current potential and challenges. Nat. Rev. Drug Discov. 16, 181-202 (2017). [0237] 31 Nimjee, S. M., White, R. R., Becker, R. C. & Sullenger, B. A. Aptamers as Therapeutics. Annu. Rev. Pharmacol. Toxicol. 57, 61-79 (2017). [0238] 32 McKeague, M. et al. Analysis of In Vitro Aptamer Selection Parameters. J. Mol. Evol. 81, 150161 (2015). [0239] 33 Kimoto, M., Yamashige, R., Matsunaga, K., Yokoyama, S. & Hirao, I. Generation of highaffinity DNA aptamers using an expanded genetic alphabet. Nat. Biotechnol. 31, 453-457 (2013). [0240] 34 Matsunaga, K., Kimoto, M. & Hirao, I. High-Affinity DNA Aptamer Generation Targeting von Willebrand Factor A1-Domain by Genetic Alphabet Expansion for Systematic Evolution of Ligands by Exponential Enrichment Using Two Types of Libraries Composed of Five Different Bases. J. Am. Chem. Soc. 139, 324-334 (2017). [0241] 35 Futami, K., Kimoto, M., Lim, Y. W. S. & Hirao, I. Genetic Alphabet Expansion Provides Versatile Specificities and Activities of Unnatural-Base DNA Aptamers Targeting Cancer Cells. Mol. Ther. Nucleic Acids 14, 158-170 (2019). [0242] 36 Sharma, M. et al. Magnitude and Functionality of the NS1-Specific Antibody Response Elicited by a Live-Attenuated Tetravalent Dengue Vaccine Candidate. J. Infect. Dis. (2019). [0243] 37 Halstead, S. B., Russell, P. K. & Brandt, W. E. NS1, Dengue's Dagger. J. Infect. Dis. (2019). [0244] 38 Hirao, I. et al. An unnatural hydrophobic base pair system: site-specific incorporation of nucleotide analogs into DNA and RNA. Nat. Methods 3, 729-735 (2006). [0245] 39 Yamashige, R. et al. Highly specific unnatural base pair systems as a third base pair for PCR amplification. Nucleic Acids Res. 40, 2793-2806 (2012). [0246] 40 Yamashige, R., Kimoto, M., Mitsui, T., Yokoyama, S. & Hirao, I. Monitoring the site-specific incorporation of dual fluorophore-quencher base analogues for target DNA detection by an unnatural base pair system. Org. Biomol. Chem. 9, 7504-7509 (2011). [0247] 41 Mitsui, T., Kimoto, M., Sato, A., Yokoyama, S. & Hirao, I. An unnatural hydrophobic base, 4propynylpyrrole-2-carbaldehyde, as an efficient pairing partner of 9-methylimidazo[(4,5)-b]pyridine. Bioorg. Med. Chem. Lett. 13, 4515-4518 (2003). [0248] 42 Matsunaga, K., Kimoto, M. & Hirao, I. High-Affinity DNA Aptamer Generation Targeting von Willebrand Factor A1-Domain by Genetic Alphabet Expansion for Systematic Evolution of Ligands by Exponential Enrichment Using Two Types of Libraries Composed of Five Different Bases. J. Am. Chem. Soc. 139, 324334 (2017). [0249] 43 Kimoto, M., Yamashige, R., Matsunaga, K., Yokoyama, S. & Hirao, I. Generation of high-affinity DNA aptamers using an expanded genetic alphabet. Nat. Biotechnol. 31, 453-457 (2013). [0250] 44 Kimoto, M., Matsunaga, K. I. & Hirao, I. Evolving Aptamers with Unnatural Base Pairs. Curr. Protoc. Chem. Biol. 9, 315-339 (2017). [0251] 45 Hamashima, K., Soong, Y. T., Matsunaga, K. I., Kimoto, M. & Hirao, I. DNA Sequencing Method Including Unnatural Bases for DNA Aptamer Generation by Genetic Alphabet Expansion. ACS Synth. Biol. (2019). [0252] 46 Quick, J. et al. Multiplex PCR method for MinION and Illumina sequencing of Zika and other virus genomes directly from clinical samples. Nat. Protoc. 12, 1261-1276 (2017).

Applications

[0253] Embodiments of the aptamers are high-affinity and high-specificity unnatural-base (UB) DNA aptamers capable of binding to each serotype of dengue NS1 proteins. In some examples, embodiments of the aptamers have a hK.sub.D of between from 30 pM to 182 pM. Embodiments of the aptamers can recognize target dengue NS1 proteins with amino-acid sequences that are more than 96.3% identical to that of the initial targets. Embodiments of the UB-DNA aptamers contain Ds (7-(2-thienyl)imidazo[4,5-b]pyridine) and/or diol-modified Pa (pyrrole-2-carbaldehyde) as a fifth and sixth base components.

[0254] Using embodiments of these UB-DNA aptamers, a simple and highly specific method to detect serotype-specific DENV infection is developed. In embodiments of the method, each serotype antigen of DEN-NS1 can be detected using UB-DNA aptamers that bind specifically to each DEN-NS1 serotype, by a sandwich-type ELISA format with an aptamer-antibody combination.

[0255] It was also found that anti-DEN-NS1 IgG in the patient's serum samples inhibit the aptamer's binding to the NS1 proteins. Further, from an analysis of sera from Singaporean patients with primary or secondary infection, it was further found that the IgG production initially reflected the serotype of the past infection, rather than that of the recent infection. Leveraging on these findings, a method to quantitatively identify the serotype-specific IgG antibodies to DEN-NS1 in serum was developed. In embodiments of the method, detection of serotype-specific IgG antibodies to dengue NS1 proteins was performed using a competitive ELISA format. In some examples, the detection of anti-DEN-NS1 IgG antibodies in a patient within one week after fever onset (e.g. during a febrile period) is indicative of a secondary infection in the patient, which may warrnt close monitoring.

[0256] Embodiments of the method trace serotype-specific dengue infection by detecting both viral NS1 proteins and their IgG antibodies in the early and later phase of dengue infection, by using ELISA with high-affinity DNA aptamers. Embodiments of the method allow the diagnosis of both past and current dengue infection, including serotype identification, and therefore facilitate early medical care and vaccine use decisions and analysis.

[0257] Embodiments of the method can potentially be expanded to test the efficacy in vaccine development, as well as the diagnoses of other diseases and allergies.