Method for producing microbial oil from labyrinthulid microorganism capable of producing said microbial oil
12540343 ยท 2026-02-03
Assignee
- Kyushu University, National University Corporation (Fukuoka, JP)
- KONAN GAKUEN (Kobe, JP)
- Nippon Suisan Kaisha, Ltd. (Tokyo, JP)
Inventors
- Yuji Okita (Tokyo, JP)
- Makoto Ito (Fukuoka, JP)
- Rie Hamaguchi (Fukuoka, JP)
- Hatsumi Goda (Fukuoka, JP)
- Seiya Mochinaga (Fukuoka, JP)
- Daisuke Honda (Kobe, JP)
Cpc classification
C12N9/0071
CHEMISTRY; METALLURGY
C12Y114/19
CHEMISTRY; METALLURGY
C12P7/64
CHEMISTRY; METALLURGY
C12P7/6427
CHEMISTRY; METALLURGY
Y02P30/20
GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
C12P19/34
CHEMISTRY; METALLURGY
C12P1/00
CHEMISTRY; METALLURGY
C12Y602/01003
CHEMISTRY; METALLURGY
C12N1/00
CHEMISTRY; METALLURGY
C12N15/79
CHEMISTRY; METALLURGY
C12N9/1029
CHEMISTRY; METALLURGY
C12R2001/00
CHEMISTRY; METALLURGY
C10G3/00
CHEMISTRY; METALLURGY
International classification
C10G3/00
CHEMISTRY; METALLURGY
C12N1/00
CHEMISTRY; METALLURGY
C12N15/79
CHEMISTRY; METALLURGY
C12P1/00
CHEMISTRY; METALLURGY
C12P19/34
CHEMISTRY; METALLURGY
C12P7/64
CHEMISTRY; METALLURGY
C12P7/6427
CHEMISTRY; METALLURGY
C12P7/6472
CHEMISTRY; METALLURGY
Abstract
A method for producing a microbial oil includes genetically modifying a labyrinthulid which belongs to the genus Parietichytrium or the genus Schizochytrium by disrupting and/or silencing a 4 desaturase gene, a C20 elongase gene, and/or a C18 elongase gene, or by being transformed with an 3 desaturase gene; culturing the labyrinthulid; and collecting the microbial oil from the labyrinthulid. The labyrinthulid has an activity of synthesizing DHA via a PUFA-PKS pathway in an amount of not more than 1/100 of a total amount of DHA synthesized in the labyrinthulid or no activity of producing PUFAs via the PUFA-PKS pathway, and the labyrinthulid has an activity of producing PUFAs via an endogenous elongase-desaturase pathway.
Claims
1. A method for producing a microbial oil, comprising: genetically modifying a labyrinthulid which belongs to the genus Parietichytrium or the genus Schizochytrium by disrupting and/or silencing a 4 desaturase gene, a C20 elongase gene, and/or a C18 elongase gene, or by being transformed with an 3 desaturase gene; culturing the labyrinthulid; and collecting the microbial oil from the labyrinthulid, wherein the labyrinthulid has an activity of synthesizing DHA via a PUFA-PKS pathway in an amount of not more than 1/100 of a total amount of DHA synthesized in the labyrinthulid or no activity of producing PUFAs via the PUFA-PKS pathway, and the labyrinthulid has an activity of producing PUFAs via an endogenous elongase-desaturase pathway.
2. The method according to claim 1, wherein the microbial oil comprises an increased amount of DTA as compared with the microbial oil collected from the labyrinthulid whose 4 desaturase gene is not disrupted or silenced.
3. The method according to claim 1, wherein the microbial oil comprises an increased amount of n-3 DPA as compared with the microbial oil collected from the labyrinthulid whose 4 desaturase gene is not disrupted or silenced.
4. The method according to claim 1, wherein the microbial oil comprises an increased amount of EPA as compared with the microbial oil collected from the labyrinthulid whose C20 elongase gene is not disrupted or silenced.
5. The method according to claim 1, wherein the microbial oil comprises an increased amount of ARA as compared with the microbial oil collected from the labyrinthulid whose C20 elongase gene is not disrupted or silenced.
6. The method according to claim 1, wherein the microbial oil comprises an increased amount of STA as compared with the microbial oil collected from the labyrinthulid whose C18 elongase gene is not disrupted or silenced.
7. The method according to claim 1, wherein the microbial oil comprises an increased amount of GLA as compared with the microbial oil collected from the labyrinthulid whose C18 elongase gene is not disrupted or silenced.
8. The method according to claim 1, wherein the microbial oil comprises an increased amount of EPA as compared with the microbial oil collected from the labyrinthulid which is not transformed with the 03 desaturase gene.
9. The method according to claim 1, wherein the microbial oil comprises an increased amount of ETA as compared with the microbial oil collected from the labyrinthulid which is not transformed with the 03 desaturase gene.
10. The method according to claim 1, wherein the labyrinthulid belonging to the genus Parietichytrium is Parietichytrium sp. SEK358 (FERM BP-11405), Parietichytrium sarkarianum SEK364 (FERM BP-11298), or Parietichytrium sp. SEK571 (FERM BP 11406), and/or wherein the labyrinthulid belonging to the genus Schizochytrium is Schizochytrium aggregatum ATCC 28209.
Description
BRIEF DESCRIPTION OF DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
(18)
(19)
(20)
(21)
(22)
(23)
(24)
(25)
(26)
(27)
(28)
(29)
(30)
(31)
(32)
(33)
(34)
(35)
(36)
(37)
(38)
(39)
(40)
(41)
(42)
(43)
(44)
(45)
(46)
(47)
(48)
(49)
(50)
(51)
(52)
(53)
(54)
(55)
(56)
(57)
(58)
(59)
(60)
(61)
(62)
(63)
(64)
(65)
(66)
(67)
(68)
(69)
(70)
(71)
MODE FOR CARRYING OUT THE INVENTION
(72) The opportunity for the present invention came about due to the discovery of a new pattern of biosynthesis pathway of polyunsaturated fatty acids (PUFAs) in microorganisms called labyrinthulids. Specifically, it is known that PUFAs are generally biosynthesized via the elongase-desaturase pathway, but in some organisms. PUFAs are also biosynthesized via another pathway called the PUFA-PKS pathway. In the past, two types of labyrinthulids were found to exist, namely (I) the type that produces only via the PUFA-PKS pathway and (II) the type that produces via the elongase-desaturase pathway and PUFA-PKS pathway. This time, a third type, (III) a type that produces only via the elongase-desaturase pathway, was newly discovered. In short, a new pattern of PUFA biosynthesis pathway was discovered.
(73) Examples are as follows. (1) Labyrinthulids having very weak or no PUFA-producing activity via the endogenous PUFA-PKS pathway and having PUFA-producing activity via the endogenous elongase-desaturase pathway. The present invention relates to labyrinthulids of the above (III) type that produces only via the elongase-desaturase pathway. These labyrinthulids encompass labyrinthulids of type (III) produced by isolating, culturing, and amplifying a wild-type strain having a PUFA biosynthesis pathway, and labyrinthulids having very weak or no PUFA-producing activity via the PUFA-PKS pathway.
(74) (2) The labyrinthulids according to (1) above that do not have the endogenous PUFA-PKS pathway. The present invention is limited to (1) above, which are labyrinthulids having no genes or enzymes themselves that constitute the PUFA-PKS pathway.
(75) (3) The labyrinthulids according to (1) above that have very weak or no endogenous PUFA-PKS pathway activity. The present invention is limited to (1) above that have information related to genes of enzymes constituting the PUFA-PKS pathway on the genome but do not express them (and therefore have no activity), or that express them only very weakly or not at all.
(76) (4) The labyrinthulids according to any of (1) to (3) above, wherein DHA and/or n-6 DPA production activity has been lost or the produced quantity of DHA and/or n-6 DPA has been markedly decreased by endogenous 4 desaturase gene disruption.
(77) Labyrinthulids of type (III) which produce PUFAs only via the elongase-desaturase pathway differ from those of type (I) which produce only via the PUFA-PKS pathway and those of type (II) which produce via the elongase-desaturase pathway and PUFA-PKS pathway in that they have no PUFA-PKS pathway. Based on this viewpoint, the present invention defines labyrinthulids of the type that produces only via the elongase-desaturase pathway. In other words, the above endogenous 4 desaturase gene disruption can be considered a method for determining whether a labyrinthulid is of the type that produces only via the elongase-desaturase pathway.
(78) (5) The labyrinthulids according to (1) to (3) above, wherein DHA and/or n-6 DPA production activity has been lost or the produced quantity of DHA and/or n-6 DPA has been markedly decreased through endogenous C20 elongase gene disruption.
(79) Labyrinthulids of type (III) which produce only via the elongase-desaturase pathway differ from those of type (I) which produce only via the PUFA-PKS pathway and those of type (II) which produce via the elongase-desaturase pathway and PUFA-PKS pathway in that they have no PUFA-PKS pathway. Based on this viewpoint, the present invention defines labyrinthulids of the type that produces only via the elongase-desaturase pathway. In other words, the above endogenous C20 elongase gene disruption can be considered a method for determining whether a labyrinthulid is of the type that produces only via the elongase-desaturase pathway.
(80) (6) The labyrinthulids according to (1) to (5) above that is a microorganism belonging to either the genus Parietichytrium or the genus Schizochytrium.
(81) Labyrinthulids belonging to the genus Parietichytrium or the genus Schizochytrium were known before the filing date of the present application, but it was not known that they are labyrinthulids of type (III) which produce PUFAs only via the elongase-desaturase pathway.
(82) (7) The labyrinthulids according to (6) above, wherein the microorganism is Parietichytrium sp. SEK358 (FERM BP-11405), Parietichytrium sarkarianum SEK364 (FERM BP-11298), Parietichytrium sp. SEK517 (FERM BP-11406), or Schizochytrium aggregatum ATCC 28209.
(83) (8) A method for producing lipids containing PUFAs, the method including culturing the labyrinthulids described in any of (1) to (7) above in a culture medium and collecting the lipids from the culture.
(84) (9) A method for producing lipids containing PUFAs, the method including culturing labyrinthulids, that were transformed using the labyrinthulids described in any of (1) to (7) above as hosts with the objective of modifying the fatty acid composition and/or highy accumulating fatty acids, in a culture medium and collecting the lipids from the culture.
(85) (10) Lipids containing PUFAs, the lipids being produced by the method of (8) or (9) above.
(86) The present invention can provide labyrinthulea that produce PUFAs via only the elongase-desaturase pathway.
(87) The creation of labyrinthulids equivalent to type (III) which produce only via the elongase-desaturase pathway is also possible, by spontaneous mutation or genetic recombination from type (II) which produce via the elongase-desaturase pathway and PUFA-PKS pathway. Examples of these include microorganisms belonging to the genus Thraustochytrium. By using these microorganisms, it is possible to obtain the same polyunsaturated fatty acids as by labyrinthulids of type (III).
(88) [Microorganisms]
(89) Labyrinthulids having very weak or no activity of producing PUFAs via the PUFA-PKS pathway includes labyrinthulids that produce PUFAs only via the elongase-desaturase pathway. A labyrinthulid having very weak PUFA-producing activity means a labyrinthulid in which the elongase-desaturase pathway gene has been disrupted, and which cannot produce PUFAs, and cannot be cultured without supplementing the culture medium with PUFAs. It means that not greater than 1/100 of the DHA synthesized in the organism is DHA synthesized via the PUFA-PKS pathway. The labyrinthulid that has very weak or no activity of producing PUFAs via the endogenous PUFA-PKS pathway and is capable of producing PUFAs via the endogenous elongase-desaturase pathway is not particularly limited, but particularly preferred examples are labyrinthulids belonging to the genus Parietichytrium or the genus Schizochytrium. Particularly preferred among these are Parietichytrium sp. SEK358 (FERM BP-11405), Parietichytrium sarkarianum SEK364 (FERM BP-11298), Parietichytrium sp. SEK517 (FERM BP-11406), or Schizochytrium aggregatum ATCC 28209.
(90) Parietichytrium sp. SEK358 was obtained by the method described below. First, 10 mL of surface water collected in the Ishigakijima-Miyaragawa estuary region was placed in a test tube. Pine pollen was added, and the test tube was left to stand at room temperature. After 7 days, a sterilized agar culture medium (2 g of glucose, 1 g of peptone, 0.5 g of yeast extract, 0.2 g of chloramphenicol, 15 g of agar, 100 mL of distilled water, 900 mL of sea water) was swabed with this pine pollen, and colonies that emerged after 5 days were separated and cultured. This was repeated several times, and cells were separated. This strain was internationally deposited on Aug. 11, 2011 as accession number FERM BP-11405 at the International Patent Organism Depositary, National Institute of Advanced Industrial Science and Technology (Tsukuba Central 6, 1-1-1 Higashi, Tsukuba City, Ibaraki Prefecture), and can be procured therefrom.
(91) Parietichytrium sarkarianum SEK364 was obtained by culturing a sea water sample collected in the Ishigakijima-Fukidogawa estuary region and separating cells in the same manner as above. This strain was internationally deposited on Sep. 24, 2010 as accession number FERM BP-11298 at the International Patent Organism Depositary, National Institute of Advanced Industrial Science and Technology (Tsukuba Central 6, 1-1-1 Higashi, Tsukuba City, Ibaraki Prefecture), and can be procured therefrom.
(92) Parietichytrium sp. SEK571 was obtained by culturing a sea water sample collected in the Iriomotejima-Shiiragawa estuary region and separating cells in the same manner as above. This strain was internationally deposited on Aug. 11, 2011 as accession number FERM BP-11406 at the International Patent Organism Depositary, National Institute of Advanced Industrial Science and Technology (Tsukuba Central 6, 1-1-1 Higashi, Tsukuba City, Ibaraki Prefecture), and can be procured therefrom.
(93) Schizochytrium aggregatum ATCC 28209 has been deposited at ATCC, and can be procured therefrom. Labyrinthulids in which PUFA-PKS has been disrupted or expression has been inhibited to a very weak level include labyrinthulids that produce PUFAs via the elongase-desaturase pathway and PUFA-PKS pathway. The PUFA-PKS pathway is required to exist in labyrinthulids that produce PUFAs only via the PUFA-PKS pathway, and when disrupted, there is a requirement for PUFAs. Labyrinthulids that produce PUFAs via the elongase-desaturase pathway and PUFA-PKS pathway, even in a case where the PUFA-PKS pathway has been disrupted, differ in that there is no requirement for PUFAs.
(94) Disruption of the 4-desaturase gene using the present invention can dramatically reduce the produced quantities of DHA and n-6 DPA while maintaining the produced quantity of PUFAs overall.
(95) The properties of the microorganisms obtained by the present invention may be combined as desired.
(96) [Microbial Oil]
(97) The present invention relates to microbial oil containing the fatty acid profile of the present invention. The microorganism of the present invention contains not less than 15 wt. %, preferably not less than 30 wt. %, more preferably not less than 50 wt. %, and even more preferably not less than 70 wt. % of lipid components per gram of cells. The lipid components contain not less than 30 wt. %, preferably not less than 50 wt. %, and more preferably not less than 70 wt. % of fatty acid components. The fatty acid components accumulate as not less than 70 wt. %, preferably not less than 80 wt. %, and more preferably not less than 90 wt. % of triglycerides. The microbial oil of the present invention is crude oil or refined oil containing at least approximately 35 wt. % of triacylglycerol fraction. Crude oil is oil extracted from microbial biomass which has not undergone further treatment. Refined oil is oil obtained by treating crude oil by standard purification, decoloration, and/or deodorizing processes. The microbial oil further contains final oil, which is refined oil diluted with vegetable oil. The microorganisms are not limited, but include classifications taxonomically associated with any microalgae, labyrinthulids, and the deposited microorganisms described in the present specification. The terms labyrinthulid, genus Parietichytrium, genus Schizochytrium, and genus Thraustochytrium when used in association with any microbial oils of a deposited microorganism described herein are based on current taxonomic classification including phylogenetically usable information, and are not intended to be limiting if the taxonomic classification is revised after the filing date of the present application. Lipids
(98) In the present invention, lipids are lipids produced by labyrinthulids, and are mainly triglycerides, diglycerides, monoglycerides, phospholipids, free fatty acids, sterols, carotenoids, hydrocarbons, and the like.
(99) [Lipids]
(100) In the present invention, lipids are lipids produced by labyrinthulids, and are mainly triglycerides, diglycerides, monoglycerides, phospholipids, free fatty acids, sterols, carotenoids, hydrocarbons, and the like.
(101) [Polyunsaturated Fatty Acids]
(102) In the present invention, a polyunsaturated fatty acid (PUFA) is a fatty acid having not less than 18 carbon atoms and not less than three double bonds, and more preferably a fatty acid having not less than 20 carbon atoms and not less than three double bonds. Specific examples include linoleic acid (LA, 18:2n-6), -linolenic acid (ALA, 18:3n-3), -linolenic acid (GLA, 18:3n-6), stearidonic acid (STA, 18:4n-3), dihomo--linolenic acid (DGLA, 20:3n-6), eicosatetraenoic acid (ETA, 20:4n-3), arachidonic acid (ARA, 20:4n-6), eicosapentaenoic acid (EPA, 20:5n-3), docosatetraenoic acid (DTA, 22:4n-6), n-3 docosapentaenoic acid (n-3 DPA, 22:5n-3), n-6 docosapentaenoic acid (n-6 DPA, 22:5n-6), and docosahexaenoic acid (DHA, 22:6n-3). In the present specification, arachidonic acid is also expressed as ARA. The total fatty acid composition means the composition of fatty acids detected after a microorganism is cultured and freeze dried and the fatty acids are then methyl-esterified and analyzed by GC. Specifically, the total fatty acid composition is the composition of fatty acids having from 14 to 22 carbon chains. In the present invention, GC area means the peak area of the GC chart. A proportion relative to the total fatty acid composition means the proportion of the peak area of the targeting fatty acid relative to the total of peak areas of the entire fatty acid composition, and is expressed as a percentage. In the present invention, C20 PUFA/C22 PUFA means the value obtained by dividing the total of GC peak areas of polyunsaturated fatty acids having 20 carbon chains by the total of GC peak areas of polyunsaturated fatty acids having 22 carbon chains. In the present invention, n-6 PUFA/n-3 PUFA means the value obtained by dividing the total of peak areas of the GC chart of 6 fatty acids having not less than 20 carbon chains by the total of peak areas of the GC chart of 3 fatty acids having not less than 20 carbon chains.
(103) [PUFA Biosynthesis Pathways]
(104) Two different pathways associated with PUFA biosynthesis are known. One is a pathway that produces polyunsaturated fatty acids (PUFAs) using polyketide synthase (PKS). In the present invention, this metabolic pathway will be called the PUFA-PKS pathway or the PKS pathway. In the present invention, a PKS gene means a gene that encodes a protein that constitutes polyketide synthase. Polyketide synthase is an enzyme that catalyzes a reaction in which a long-chain substrate such as malonyl-CoA is condensed multiple times in a starter substrate such as acetyl-CoA. Polyketide synthase has generally been known as an enzyme involved in biosynthesis of secondary metabolites of plants, fungi, and the like, but it has also been reported to be involved in PUFA biosynthesis in certain organisms. For example, the marine bacillus Shewanella produces eicosapentaenoic acid (EPA) using this enzyme (Non-patent Document 8). Polyketide synthase is known to be similarly involved in PUFA biosynthesis in certain labyrinthulids as well.
(105) The other is a pathway in which, starting from a fatty acid such as palmitic acid, desaturation by desaturase and chain elongation by elongase are repeated to produce PUFAs such as EPA and DHA. In the present invention, this is called the elongase-desaturase pathway. Examples of the enzymes that constitute this system include fatty acid synthesis associated enzymes such as C20 elongase and 4 desaturase.
(106) [PUFA Biosynthesis Pathway Differentiation Method]
(107) A method for differentiating between PUFA biosynthesis pathways of labyrinthulids will be described below. However, this is only one example, and needless to say, differentiation does not have to be performed by this method.
(108) As stated above, two PUFA biosynthesis pathways in labyrinthulids are known. One is the PUFA-PKS pathway, by which DHA and n-6 DPA are produced. In this pathway, no PUFAs other than DHA and n-6 DPA are substantially produced such configuration differs greatly from the elongase-desaturase pathway, which is the other PUFA biosynthesis pathway.
(109) The other pathway, namely the elongase-desaturase pathway, is illustrated in
(110) It is also possible to select C20 elongase rather than 4 desaturase and disruption the gene of that enzyme instead. Specifically, C20 elongase is an enzyme involved in converting EPA to n-3 DPA. This enzyme is also involved in converting ARA to DTA. Thus, since these conversions do not take place when the gene of this enzyme is disrupted, EPA and ARA, which are substrates of this enzyme, accumulate, and conversely, n-3 DPA and DTA, which are products of this enzyme, decrease. As a result, DHA and n-6 DPA, which have n-3 DPA and DTA as substrates, also decrease. In a labyrinthulid in which this C20 elongase gene has been disrupted, when the products DHA and/or n-6 DPA are completely undetected or markedly decreased, it is judged that the labyrinthulid has very weak or no PUFA (particularly DHA and/or n-6 DPA) production activity via the endogenous PUFA-PKS pathway.
(111) Gene disruption is performed by transforming something designed such that gene products do not produce activity using an antibiotic resistance gene or the like in all or a portion of the target gene, into a target cell by a method such as a gene gun, electroporation, or gene editing. Gene silencing is performed by transforming an antisense gene designed such that expression of the target gene is inhibited or a gene in which RNAi is expressed, into a cell by a method such as a gene gun, electroporation, or gene editing. Gene disruption and silencing are not limited to these methods provided that expression of the target gene is hindered. When disruption or silencing is performed with a PKS gene as the target, the target is not limited provided that enzyme activity can be eliminated or inhibited, but OrfA is preferably used as the target.
(112) The present invention provides labyrinthulids having very weak or no PUFAproducing activity via the endogenous PUFA-PKS pathway and having PUFA-producing activity via the endogenous elongase-desaturase pathway.
(113) Furthermore, the present invention also includes changing the fatty acid composition produced by a labyrinthulid by manipulating the genes of enzymes constituting the elongase-desaturase pathway of the labyrinthulid. In particular, the fatty acid composition produced by a labyrinthulid can be modified by: (1) disruption and/or silencing of a fatty acid elongase gene, (2) disruption and/or silencing of a fatty acid desaturase gene, (3) transfer of a fatty acid elongase gene, (4) transfer of a fatty acid desaturase gene, and (5) a combination of the above. For example, when stearidonic acid (STA) is desired, a fatty acid elongase gene involved in conversion of stearidonic acid to eicosatetraenoic acid (ETA), specifically the C18 elongase gene, may be disrupted and/or silenced. Furthermore, for example, when eicosapentaenoic acid (EPA) is desired, a fatty acid elongase gene involved in conversion of eicosatetraenoic acid to docosapentaenoic acid (DPA), specifically the C20 elongase gene, may be disrupted and/or silenced. As another example, when eicosapentaenoic acid is desired, a fatty acid desaturase gene that converts arachidonic acid (ARA) to eicosapentaenoic acid, specifically the 3 desaturase gene, may be transformed. For a labyrinthulid that produces via the elongase-desaturase pathway and PUFA-PKS pathway, the fatty acid composition produced by the labyrinthulid can be modified by: (1) disruption and/or silencing of a fatty acid elongase gene, (2) disruption and/or silencing of a fatty acid desaturase gene, (3) transfer of a fatty acid elongase gene, (4) transfer of a fatty acid desaturase gene, and (5) a combination of the above, using a microorganism in which the PUFA-PKS pathway has been disrupted or silenced. For example, when stearidonic acid (STA) is desired, a fatty acid elongase gene involved in conversion of stearidonic acid to eicosatetraenoic acid (ETA), specifically the C18 elongase gene, may be disrupted and/or silenced. Furthermore, for example, when eicosapentaenoic acid (EPA) is desired, a fatty acid elongase gene involved in conversion of eicosatetraenoic acid to docosapentaenoic acid (DPA), specifically the C20 elongase gene, may be disrupted and/or silenced. As another example, when eicosapentaenoic acid is desired, a fatty acid desaturase gene that converts arachidonic acid (ARA) to eicosapentaenoic acid, specifically the 3 desaturase gene, may be transformed.
(114) A labyrinthulid (microorganism) in which the produced fatty acid composition has been modified is obtained by transformation of the labyrinthulid. A labyrinthulid in which a fatty acid biosynthesis associated gene has been transformed and/or disrupted can be used in, for example, production of unsaturated fatty acids. In production of unsaturated fatty acids, the conditions of other steps, production equipment and instruments and the like are not particularly limited provided that the labyrinthulid that is used has very weak or no PUFA production activity via the endogenous PUFA-PKS pathway and has PUFA production activity via the endogenous elongase-desaturase pathway, or is a labyrinthulid in which the produced fatty acid composition has been modified as described above. Production of unsaturated fatty acids includes a step of culturing a labyrinthulid that has very weak or no PUFA production activity via the endogenous PUFA-PKS pathway and has PUFA production activity via the endogenous elongase-desaturase pathway, or a labyrinthulid in which the produced fatty acid composition has been modified as described above. Unsaturated fatty acids are produced using these microorganisms and their culture medium.
(115) The above cell culturing conditions (culture medium, culture temperature, ventilation status, and the like) may be set as appropriate according to the type of cell, the targeted type and quantity of unsaturated fatty acids, and the like. Furthermore, an unsaturated fatty acid in the present invention means a substance containing an unsaturated fatty acid, without limitation on its content, purity, shape, composition, and the like. In other words, in the present invention, cells in which the fatty acid composition has been modified or their culture media are themselves considered to be unsaturated fatty acids. Additionally, a step of purifying the unsaturated fatty acids from these cells or culture media may be further included. As the method of purifying the unsaturated fatty acids, a method known as a purification method for lipids (including complex lipids) such as unsaturated fatty acids may be applied.
(116) [Method for Highly Accumulating Unsaturated Fatty Acids in Labyrinthulids]
(117) Accumulation of unsaturated fatty acids in a labyrinthulid is achieved by culturing a labyrinthulid having very weak or no PUFA production activity via the endogenous PUFA-PKS pathway and having PUFA production activity via the endogenous elongase-desaturase pathway, or a transformant thereof. The labyrinthulid may be cultured in, for example, a solid culture medium, liquid culture medium, or the like. The culture medium used at this time is not particularly limited provided that it is a medium commonly used for culturing labyrinthulids and appropriately combines, for example, glucose, fructose, saccharose, starch, glycerin, or the like as a carbon source, yeast extract, corn steep liquor, polypeptone, sodium glutamate, urea, ammonium acetate, ammonium sulfate, ammonium nitrate, ammonium chloride, sodium nitrate, or the like as a nitrogen source, potassium phosphate or the like as an inorganic salt, and other necessary components. However, yeast extract-glucose medium (GY medium) is particularly preferably used. After preparation of the culture medium, the pH is adjusted to within the range of 3.0 to 8.0, and then the culture medium is sterilized by autoclave or the like. Culturing may be performed by aerated and agitated culturing, shake culturing, or static culturing at 10 to 40 C., preferably 15 to 35 C., for 1 to 14 days.
(118) To collect the produced unsaturated fatty acids, the labyrinthulids are grown in a culture medium and the microorganism cells obtained from that culture medium are treated, the lipids (polyunsaturated fatty acids or oil- and fat-containing matter containing polyunsaturated fatty acids) inside the cells are released and collected. Specifically, lipids containing PUFAs can be obtained by collecting the labyrinthulids cultured in this manner by centrifugation or the like, performing treatment such as drying and cell crushing as necessary, and performing extraction using an appropriate organic solvent or supercritical carbon dioxide, liquefied dimethylether, or the like according to conventional methods.
(119) The microbial oil obtained in the present invention is that which satisfies any of the following conditions. The microbial oil obtained in the present invention contains ARA in a proportion of not less than 5%, not less than 7%, not less than 10%, or not less than 15% of the total fatty acid composition. Oils and fats with high ARA obtained in this manner may be used in applications such as nutritional supplements for infants and health foods and medications for adults. ARA may be not greater than 80%, not greater than 70%, not greater than 60%, or not greater than 50% of the total fatty acid composition. The microbial oil obtained in the present invention contains DGLA in a proportion of not less than 2.5%, not less than 5%, or not less than 10% of the total fatty acid composition. Microbial oil with high DGLA obtained in this manner may be used in medicinal applications such as anti-inflammatory agents. DGLA may be not greater than 80%, not greater than 70%, not greater than 60%, or not greater than 50% of the total fatty acid composition. The microbial oil obtained in the present invention contains ETA in a proportion of not less than 0.35%, not less than 0.5%, not less than 0.75%, or not less than 1% of the total fatty acid composition. Microbial oil with high ETA obtained in this manner may be used in medicinal applications such as arthritis treatment. ETA may be not greater than 50%, not greater than 40%, not greater than 30%, or not greater than 20% of the total fatty acid composition. The microbial oil obtained in the present invention contains EPA in a proportion of not less than 4%, not less than 6%, not less than 8%, not less than 10%, or not less than 12% of the total fatty acid composition. Microbial oil with high EPA obtained in this manner may be used in nutritional supplement applications and medicinal applications. EPA may be not greater than 80%, not greater than 70%, not greater than 60%, or not greater than 50% of the total fatty acid composition. The microbial oil obtained in the present invention contains n-6 DPA in a proportion of not greater than 0.20%, not greater than 0.15%, not greater than 0.1%, or not greater than 0.05% of the total fatty acid composition. The microbial oil with low n-6 DPA obtained in this manner does not tend to hinder the functions of other fatty acids. Furthermore, it is advantageous in cases where removal of n-6 DPA by refinement is desired. n-6 DPA may be not less than 0.001%, not less than 0.005%, or not less than 0.01% of the total fatty acid composition. The microbial oil obtained in the present invention contains DHA in a proportion of not greater than 0.50%, not greater than 0.3%, not greater than 0.2%, or not greater than 0.1% of the total fatty acid composition. The microbial oil with low DHA obtained in this manner does not tend to hinder the functions of other fatty acids. Furthermore, it is advantageous in cases where removal of DHA by refinement is desired. DHA may be not less than 0.005%, not less than 0.01%, or not less than 0.05% of the total fatty acid composition. The microbial oil obtained in the present invention contains a total of DHA and n-6 DPA in a proportion of not greater than 0.7%, not greater than 0.8%, not greater than 0.9%, or not greater than 1.0% of the total fatty acid composition. The microbial oil with low DHA and n-6 DPA obtained in this manner does not tend to hinder the functions of other fatty acids and is stable against oxidation. Furthermore, it is advantageous in cases where removal of DHA and n-6 DPA by refinement is desired. The total of DHA and n-6 DPA may be not less than 0.05%, not less than 0.1%, or not less than 0.5% of the total fatty acid composition. The desired concentrations of each of these fatty acids may be combined as desired, limited to a total of 100%.
(120) In another aspect, the microbial oil obtained in the present invention is that which satisfies any of the following conditions. In the microbial oil obtained in the present invention, the value of LA/DHA by GC area is not less than 0.6, not less than 0.7, not less than 0.8, or not less than 0.9, and not greater than 10, not greater than 9, not greater than 8, not greater than 7, or not greater than 6. The microbial oil with a high LA/DHA value obtained in this manner is stable against oxidation, and the functions of LA do not tend to be hindered by DHA. In the microbial oil obtained in the present invention, the value of GLA/DHA by GC area is not less than 0.35, not less than 0.4, not less than 0.5, not less than 0.6, or not less than 0.7, and not greater than 10, not greater than 9, not greater than 8, or not greater than 7. The microbial oil with a high GLA/DHA value obtained in this manner is stable against oxidation, and the functions of GLA do not tend to be hindered by DHA.
(121) In the microbial oil obtained in the present invention, the value of DGLA/DHA by GC area is not less than 0.35, not less than 0.4, not less than 0.5, not less than 0.6, or not less than 0.7, and not greater than 10, not greater than 9, not greater than 8, not greater than 7, or not greater than 6. Microbial oil with a high DGLA/DHA value obtained in this manner may be used in medications having an anti-inflammatory action. In the microbial oil obtained in the present invention, the value of ARA/DHA by GC area is not less than 0.7, not less than 0.8, not less than 0.9, or not less than 1.0, and not greater than 50, not greater than 45, not greater than 40, not greater than 35, or not greater than 30. Microbial oil with a high ARA/DHA value obtained in this manner may be used in modified milk for infants. The value of EPA/DHA by GC area is not less than 0.35, not less than 0.4, not less than 0.5, not less than 0.6, or not less than 0.7, and not greater than 50, not greater than 45, not greater than 40, not greater than 35, or not greater than 30. EPA used in typical medications and the like are mainly esters containing DHA, but the microbial oil with a high EPA/DHA value obtained in this manner contains EPA with a high degree of purity, and can be used in health foods, medications, and the like.
(122) The desired ratios of each of these fatty acids may be combined as desired. In the microbial oil obtained in the present invention, the value of LA/EPA by GC area is not less than 0.06, not less than 0.07, not less than 0.08, or not less than 0.09, and not greater than 0.12, not greater than 0.1, not greater than 0.08, or not greater than 0.06. Microbial oil with a low LA/EPA value obtained in this manner may be used in infusion fluids with a low anti-inflammatory action and the like. In the microbial oil obtained in the present invention, the value of GLA/EPA by GC area is not less than 0.04 or not less than 0.45, and not greater than 0.12, not greater than 0.1, or not greater than 0.8. Microbial oil with a low GLA/EPA value obtained in this manner may be used in infusion fluids with a low anti-inflammatory action and the like. In the microbial oil obtained in the present invention, the value of DTA/EPA by GC area is not less than 0.01, not less than 0.02, not less than 0.03, not less than 0.04, or not less than 0.05, and not greater than 0.4, not greater than 0.35, or not greater than 0.3. The microbial oil with a low DTA/EPA value obtained in this manner is useful for separating high-purity EPA since DTA and EPA are close to each other in GC. The desired ratios of each of these fatty acids may be combined as desired.
(123) In the microbial oil obtained in the present invention, the value of DTA/ARA by GC area is not less than 0.01, not less than 0.03, not less than 0.05, not less than 0.07, or not less than 0.1, and not greater than 0.45, not greater than 0.4, not greater than 0.35, or not greater than 0.3. Microbial oil with a low DTA/ARA value obtained in this manner may be used in formulated milk for infants. In the microbial oil obtained in the present invention, the value of DTA/DGLA by GC area is not less than 0.01, not less than 0.05, not less than 0.1, not less than 0.15, or not less than 0.2, and not greater than 1.45, not greater than 1.4, not greater than 1.3, not greater than 1.2, or not greater than 1.1. Microbial oil with a low DTA/DGLA value obtained in this manner may be used in medications having an anti-inflammatory action and the like. In the microbial oil obtained in the present invention, the value of LA/n-6 DPA by GC area is not less than 0.4, not less than 0.5, not less than 0.6, not less than 0.7, or not less than 0.8, and not greater than 20, not greater than 18, not greater than 16, not greater than 14, or not greater than 12. Microbial oil with a high LA/n-6 DPA value obtained in this manner may be used in edible oils. In the microbial oil obtained in the present invention, the value of GLA/n-6 DPA by GC area is not less than 0.2, not less than 0.4, not less than 0.6, or not less than 0.8, and not greater than 10, not greater than 8, not greater than 6, or not greater than 4. Microbial oil with a high GLA/n-6 DPA value obtained in this manner may be used in health foods and supplements. In the microbial oil obtained in the present invention, the value of DGLA/n-6 DPA by GC area is not less than 0.35, not less than 0.5, not less than 0.75, or not less than 1.0, and not greater than 30, not greater than 27, not greater than 25, not greater than 22, or not greater than 20. Microbial oil with a high DGLA/n-6 DPA value obtained in this manner may be used in medications having an anti-inflammatory action. In the microbial oil obtained in the present invention, the value of ARA/n-6 DPA by GC area is not less than 0.7, not less than 1.0, not less than 2.0, or not less than 3.0, and not greater than 60, not greater than 50, not greater than 40, or not greater than 30. Microbial oil with a high LA/n-6 DPA value obtained in this manner may be used in formulated milk for infants. In the microbial oil obtained in the present invention, the value of EPA/n-6 DPA by GC area is not less than 0.4, not less than 0.6, not less than 0.8, not less than 1, not less than 2, or not less than 5, and not greater than 70, not greater than 60, not greater than 50, not greater than 40, or not greater than 30. Microbial oil with a high EPA/n-6 DPA value obtained in this manner may be used in health foods, supplements, and the like. The desired ratios of each of these fatty acids may be combined as desired.
(124) In the microbial oil obtained in the present invention, the value of DGLA/LA by GC area is not less than 1.4, not less than 2, or not less than 3, and not greater than 10, not greater than 9, not greater than 8, or not greater than 7. The microbial oil obtained in this manner may be used in foods and supplements having an anti-inflammatory action. In the microbial oil obtained in the present invention, the value of ARA/LA by GC area is not less than 5.1, not less than 7, not less than 9, or not less than 11, and not greater than 20, not greater than 17, not greater than 15, or not greater than 12. Microbial oil with a high ARA/LA value obtained in this manner may be used in animal feed and formulated milk for infants. In the microbial oil obtained in the present invention, the value of EPA/LA by GC area is not less than 5.5, not less than 7, not less than 9, not less than 11, or not less than 13, and not greater than 30, not greater than 25, not greater than 22, or not greater than 20. Microbial oil with a high EPA/LA value obtained in this manner may be used in medications and health foods. In the microbial oil obtained in the present invention, the value of DTA/LA by GC area is not less than 0.01, not less than 0.05, not less than 0.07, or not less than 0.1, and not greater than 0.4, not greater than 0.35, not greater than 0.33, not greater than 0.3, or not greater than 0.28. Microbial oil with a low DTA/LA value obtained in this manner may be used in animal feed and foods. The desired ratios of each of these fatty acids may be combined as desired.
(125) In the microbial oil obtained in the present invention, the value of DGLA/GLA by GC area is not less than 4.5, not less than 5, not less than 6, or not less than 7, and not greater than 20, not greater than 17, not greater than 15, or not greater than 12. Microbial oil with a high DGLA/GLA value obtained in this manner may be used in medications having an anti-inflammatory action and the like. In the microbial oil obtained in the present invention, the value of ARA/GLA by GC area is not less than 9, not less than 10, not less than 12, not less than 13, or not less than 14, and not greater than 30, not greater than 28, not greater than 26, not greater than 24, or not greater than 22. Microbial oil with a high ARA/GLA value obtained in this manner may be used in formulated milk for infants. The desired ratios of each of these fatty acids may be combined as desired.
(126) In the microbial oil obtained in the present invention, the value of n-6 DPA/DTA by GC area is not less than 0.001, not less than 0.01, or not less than 0.02, and not greater than 1.5, not greater than 1.4, not greater than 1.3, not greater than 1.2, or not greater than 1.1. The microbial oil obtained in this manner may be used in foods that prevent arteriosclerosis and the like. In the microbial oil obtained in the present invention, the value of DHA/n-3 DPA by GC area is not less than 0.001, not less than 0.01, or not less than 0.02, and not greater than 4, not greater than 4.5, not greater than 4, or not greater than 3.5. The microbial oil obtained in this manner may be used in animal feed or health foods. In the microbial oil obtained in the present invention, the value of C20 PUFA/C22 PUFA by GC area is not less than 0.5, not less than 0.7, not less than 1, or not less than 1.2, and not greater than 50, not greater than 45, not greater than 40, or not greater than 35. Microbial oil with a high C20 PUFA/C22 PUFA value obtained in this manner may be used in health foods and supplements. In the microbial oil obtained in the present invention, the value of n-6 PUFA/n-3 PUFA by GC area is not less than 1.8, not less than 2, not less than 2.5, or not less than 3, and not greater than 100, not greater than 80, not greater than 70, not greater than 60, or not greater than 50. Microbial oil with a high n-6 PUFA/n-3 PUFA value obtained in this manner may be used in edible oils and animal feed. The desired ratios of each of these fatty acids may be combined as desired.
(127) The desired ratios of each of these fatty acids may be combined as desired. The desired concentrations of each of these fatty acids may be combined as desired, limited to a total of 100%.
(128) The unsaturated fatty acids of the present invention also include various medications, foods, animal feeds, and industrial products, and the fields of use thereof are not particularly limited. The foods containing the unsaturated fatty acid-containing oils and fats of the present invention also include health foods such as supplements and food additives and the like. Examples of the industrial products include animal feed for organisms other than humans, films, biodegradable plastics, functional fibers, lubricating oils, and detergents.
(129) Next, the present invention will be specifically described based on examples. Furthermore, in the present specification, the features of each invention described in embodiments related to each aspect of the invention may be combined as desired to form new embodiments, and it is to be understood that such new embodiments may be included in each of the aspects of the present invention.
Example 1
(130) [Labyrinthulids and Culturing Method/Storage Method Thereof]
(131) (1) Strains Used in the Present Invention
(132) Parietichytrium sp. SEK358 (FERM BP-11405), Parietichytrium sarkarianum SEK364 (FERM BP-11298), and Parietichytrium sp. SEK571 (FERM BP-11406) were shared from the Department of Engineering at Konan University. Thraustochytrium aureum ATCC 34304 was shared from ATCC.
(133) (2) Culture Medium Composition
(134) i. Agar Plate Culture Medium Composition
(135) PDA Agar Plate Culture Medium
(136) 0.78% (w/v) of potato dextrose agar medium (available from Nissui Pharmaceutical Co., Ltd.), 1.75% (w/v) of Sealife (available from Marintec Co., Ltd.), and 1.21% (w/v) of agar powder (available from Nacalai Tesque, Inc.) were mixed and then sterilized by autoclave for 20 min at 121 C. After sufficient cooling, ampicillin sodium salt (available from Nacalai Tesque, Inc.) was added so as to result in a final concentration of 100 g/mL. This was dispensed into a Petri dish and left to stand at a level location to solidify.
(137) ii. Liquid Culture Medium Composition
(138) Gy Liquid Culture Medium
(139) 3.18% (w/v) of glucose (available from Nacalai Tesque, Inc.), 1.06% (w/v) of dry yeast extract (available from Nacalai Tesque, Inc.), and 1.75% (w/v) of Sealife (available from Marintec Co., Ltd.) were mixed and then sterilized by autoclave for 20 min at 121 C. Ampicillin sodium salt (available from Nacalai Tesque, Inc.) was then added so as to result in a final concentration of 100 g/mL.
(140) Pd Liquid Culture Medium
(141) 0.48% (w/v) of potato dextrose (available from Difco Laboratories Inc.) and 1.75% (w/v) of Sealife (available from Marintec Co., Ltd.) were mixed and then sterilized by autoclave for 20 min at 121 C. Ampicillin sodium salt (available from Nacalai Tesque, Inc.) was then added so as to result in a final concentration of 100 g/mL.
(142) (3) Culturing Method
(143) i. Agar Plate Culturing
(144) Labyrinthulea cells were inoculated using a platinum loop or a spreader and then static cultured at 25 C., thereby causing emergence of colonies. Subculturing was performed by extracting colonies using a platinum loop and suspending them in sterilized physiological saline solution, and then spreading this suspension using a platinum loop or a spreader. Furthermore, as necessary, it was transformed to a liquid culture by inoculating cells in a liquid culture medium on a flat plate.
(145) ii. Liquid Culturing
(146) Labyrinthulea cells were inoculated, and suspension culturing was performed with stirring at 150 rpm at 25 C. using an Erlenmeyer flask or a test tube. Subculturing was performed by adding a culture solution in which growth was confirmed from the logarithmic growth phase to the stationary phase, in a volume ratio of 1/200 to 1/10 to a fresh GY or PD liquid culture medium. Furthermore, as necessary, it was transformed to an agar plate culture by spreading the cell culture solution on a PDA agar plate culture medium.
(147) (4) Preservation/Storage Method of Labyrinthulids
(148) In addition to subculturing, cryopreservation was performed by producing glycerol stock. Specifically, glycerol (available from Nacalai Tesque, Inc.) was added to a cell suspension that used a GY liquid culture medium from the logarithmic growth phase to the stationary phase, so as to result in a final concentration of 15% (v/v), and this was stored in a deep freezer at 80 C.
Example 2
(149) [Measurement of Fatty Acid Composition of Lipids Produced by C20 Elongase Gene Disruption and Transformation Strain of Parietichytrium sarkarianum SEK364]
[Example 2-1]: Subcloning of SV40 Terminator Sequence
(150) An SV40 terminator sequence was amplified with PrimeSTAR HS DNA Polymerase (available from Takara Bio Inc.) using a pcDNA 3.1 myc-His vector (available from Invitrogen Corp.) as a template. The PCR primers used were as shown below. RHO58 was set on the SV40 terminator sequence, and includes BglII and BamHI linker sequences. RHO52 was set on the SV40 terminator sequence, and includes a BglII sequence. [RHO58: 34mer: 5-CAG ATC TGG ATC CGC GAA ATG ACC GAC CAA GCG A-3 (SEQ ID NO: 1), RHO52: 24mer: 5-ACG CAA TTA ATG TGA GAT CTA GCT-3 (SEQ ID NO: 2)]. After amplification under the following conditions, it was cloned in pGEM-T Easy Vector (available from Promega Corporation). [PCR cycles: 98 C. 2 min/98 C. 30 sec, 60 C. 30 sec, 72 C. 1 min, 30 cycles/72 C. 1 min]. After amplification with E. coli, the sequence was confirmed using a Dye Terminator Cycle Sequencing Kit (available from Beckman Coulter Inc.). This was named pRH27.
(151) The plasmid (pRH27) containing the subcloned SV40 terminator sequence (342 bp, SEQ ID NO: 3) is illustrated in
[Example 2-2]: Production of Artificially Synthesized Neomycin Resistance Gene Cassette
(152) Thraustochytrium aureum ATCC 34304 strain was cultured in a GY culture medium, and cells of the latter logarithmic growth phase were centrifuged for 5 min at 4 C. at 3500g to form pellets, and the pellets were frozen with liquid nitrogen and then crushed. After phenol extraction of the crushed cell liquid, ethanol precipitation was performed and the precipitate was dissolved in a TE solution. The nucleic acids dissolved in the TE solution were treated with RNase for 30 min at 37 C., and after further phenol extraction, ethanol precipitation was performed and the precipitate was dissolved in a TE solution. A260/280 was measured and the DNA concentration was calculated.
(153) Using this as a template, an ubiquitin promoter sequence (619 bp, SEQ ID NO: 4) was amplified with PrimeSTAR HS DNA Polymerase with GC Buffer (available from Takara Bio Inc.). The PCR primers used were as shown below. RHO53 was set on the ubiquitin promoter sequence, and includes a BglII linker sequence. TKO1 includes the ubiquitin promoter sequence and an artificially synthesized neomycin resistance gene sequence. [RHO53: 36mer: 5-CCC AGA TCT GCC GCA GCG CCT GGT GCA CCC GCC GGG-3 (SEQ ID NO: 5), TKO1: 58mer: 5-CGT GAA GGC CGT CCT GTT CAA TCA TGT TGG CTA GTG TTG CTT AGG TCG CTT GCT GCT G-3 (SEQ ID NO: 6)]. [PCR cycles: 98 C. 2 min/98 C. 10 sec, 68 1 min, 30 cycles/68 C. 1 min].
(154) Using the artificially synthesized neomycin resistance gene sequence as a template, an artificially synthesized neomycin resistance gene sequence (826 bp, SEQ ID NO: 7) was amplified with PrimeSTAR HS DNA Polymerase with GC Buffer (available from Takara Bio Inc.). The PCR primers used were as shown below. TK02 includes the ubiquitin promoter sequence and the artificially synthesized neomycin resistance gene sequence. RHO57 includes the artificially synthesized neomycin resistance gene sequence and has a BglII linker sequence. [TK02: 54mer: 5-AGC GAC CTA AGC AAC ACT AGC CAA CAT GAT TGA ACA GGA CGG CCT TCA CGC TGG-3 (SEQ ID NO: 8), RHO57: 26mer: 5-CAG ATC TCA AAA GAA CTC GTC CAG GA-3 (SEQ ID NO: 9)][PCR cycles: 98 C. 2 min/98 C. 10 sec, 68 1 min, 30 cycles/68 C. 1 min].
(155) Using SEQ ID NO: 4 and SEQ ID NO: 7 as templates, fusion PCR was performed using RHO53 (SEQ ID NO: 5) and RHO57 (SEQ ID NO: 9) according to the method described in Non-patent Document 9. Amplification was performed using LA Taq Hot Start Version (available from Takara Bio Inc.) as the enzyme with PCR cycles under conditions below: 94 C. 2 min/94 C. 20 sec, 55 C. 30 sec, 68 C. 1 min, 30 cycles/68 C. 1 min (1 C./10 sec from 55 C. to 68 C.), and then the amplified product was digested with BglII. (
(156) The Thraustochytrium aureum ATCC 34304-derived ubiquitin promoter-artificially synthesized neomycin resistance gene sequence (1395 bp, SEQ ID NO: 10) fused as described above was digested with BglII, and the resultant was bound to the BamHI site of pRH27 described in Example 2-1. After amplification of the produced plasmid with E. coli, the sequence was confirmed using a Dye Terminator Cycle Sequencing Kit (available from Beckman Coulter Inc.). This was named pRH31.
(157) The produced artificially synthesized neomycin resistance gene cassette (pRH31) is illustrated in
[Example 2-3]: Production of Hygromycin Resistance Gene Cassette
(158) Using Thraustochytrium aureum ATCC 34304 genome DNA as a template, a ubiquitin promoter sequence (617 bp, SEQ ID NO: 11) was amplified with PrimeSTAR HS DNA Polymerase with GC Buffer (available from Takara Bio Inc.). The PCR primers used were as shown below. RHO53 was set on the ubiquitin promoter sequence, and includes a BglII linker sequence. KS08 includes the ubiquitin promoter sequence and a hygromycin resistance gene sequence. [RHO53: 36mer: 5-CCC AGA TCT GCC GCA GCG CCT GGT GCA CCC GCC GGG-3 (described in Example 2-2, SEQ ID NO: 5), KS08: 58mer: 5-TCG CGG TGA GTT CAG GCT TTT TCA TGT TGG CTA GTG TTG CTT AGG TCG CTT GCT GCT G-3 (SEQ ID NO: 12)][PCR cycles: 98 C. 2 min/98 C. 30 sec, 68 2 min, 30 cycles/68 C. 2 min]
(159) Using pcDNA 3.1/Hygro (available from Invitrogen Corp.) as a template, a hygromycin resistance gene (1058 bp, SEQ ID NO: 13) was amplified with PrimeSTAR HS DNA Polymerase with GC Buffer (available from Takara Bio Inc.). The PCR primers used were as shown below. KS07 includes the ubiquitin promoter sequence and the hygromycin resistance gene sequence. RHO56 includes the hygromycin resistance gene sequence and has a BglII linker sequence. [KS07: 56mer: 5-AGC GAC CTA AGC AAC ACT AGC CAA CAT GAA AAA GCC TGA ACT CAC CGC GAC GTC TG-3 (SEQ ID NO: 14), RHO56: 36mer: 5-CAG ATC TCT ATT CCT TTG CCC TCG GAC GAG TGC TGG-3 (SEQ ID NO: 15)]. [PCR cycles: 98 C. 2 min/98 C. 30 sec, 68 2 min, 30 cycles/68 C. 2 min]
(160) Using SEQ ID NO: 11 and SEQ ID NO: 13 as templates, fusion PCR was performed using RHO53 (described in Example 2-2, SEQ ID NO: 5) and RHO56 (SEQ ID NO: 15) according to the method described in Non-patent Document 9. Amplification was performed using LA Taq Hot Start Version (available from Takara Bio Inc.) as the enzyme under the following conditions, and then the amplified product was digested with BglII. [PCR cycles: 94 C. 2 min/94 C. 20 sec, 55 C. 30 sec, 68 C. 1 min, 30 cycles/68 C. 1 min (1 C./10 sec from 55 C. to 68 C.)](
(161) The Thraustochytrium aureum ATCC 34304-derived ubiquitin promoter -pcDNA 3.1/Hygro (available from Invitrogen Corp.)-derived hygromycin resistance gene (1625 bp, SEQ ID NO: 16) fused as described above was digested with BglII, and the resultant was bound to the BamHI site of pRH27 described in Example 2-1,
(162) The produced hygromycin resistance gene cassette (pRH32) is illustrated in
[Example 2-4]: Cloning of Genus Parietichytrium C20 Elongase Gene
(163) Genome DNA of Parietichytrium sarkarianum SEK364 was extracted by the method described in Example 2-2, and the genome was read.
(164) With the region conserved in the C20 elongase gene as a target, a forward oligonucleotide (PsTaELO2 F1; 5-CCT TCG GCG CTC CTC TTA TGT ATG T-3) (SEQ ID NO: 17) and a reverse oligonucleotide (PsTaELO2 R2; 5-CAA TGC AAG AGG CGA ACT GGG AGA G-3) (SEQ ID NO: 18) were synthesized. Next, using the Parietichytrium sarkarianum SEK364 genome DNA prepared by the method described in Example 2-2 as a template, PCR was performed using the oligonucleotides PsTaELO2 F1 and PsTaELO2 R2 using LA Taq Hot Start Version (available from Takara Bio Inc.). [PCR cycles: 98 C. 1 min/98 C. 10 sec, 60 C. 30 sec, 72 C. 1 min, 30 cycles/72 C. 7 min/4 C.]. The obtained specific amplification product underwent gel purification, and when the base sequence thereof was analyzed by direct sequencing, it exhibited significant homology to a known C20 elongase gene sequence. This shows that it was a partial sequence of the C20 elongase gene derived from Parietichytrium sarkarianum SEK364.
(165) Then, the C20 elongase gene derived from Parietichytrium sarkarianum SEK364 was cloned by 3- and 5-RACE in the same manner as Comparative Example 1-2 to be described later. First, forward oligonucleotide primers (PsRACE F1; 5-TGG GGC TCT GGA ACC GCT GCT TAC G-3) (SEQ ID NO: 19) and (PsRACE F2; 5-CTT CCA GCT CTC CCA GTT CGC CTC T-3) (SEQ ID NO: 20), and reverse oligonucleotide primers (PsRACE R1; 5-CGG GTT GTT GAT GTT GAG CGA GGT G-3) (SEQ ID NO: 21) and (PsRACE R2; 5-CCC ACG CCA TCC ACG AGC ACA CCA C-3) (SEQ ID NO: 22) were designed. Next, using a cDNA library produced by SMART RACE cDNA Amplification Kit (trade name; available from Clontech Laboratories, Inc.) as a template, 3- and 5-RACE were performed using a synthetic adapter-specific oligonucleotide and the above oligonucleotide PsRACE F1 or PsRACE R1. [PCR cycles: 94 C. 30 sec 5 cycles/94 C. 30 sec, 70 C. 30 sec, 72 C. 3 min, 5 cycles/94 C. 30 sec, 68 C. 30 sec, 72 C. 3 min, 25 cycles/4 C.]. Then, using the two obtained RACE products as templates, nested PCR was performed using a synthetic adapter-specific oligonucleotide and the above oligonucleotide PsRACE F2 or PsRACE R2. [PCR cycles: 94 C. 1 min/94 C. 30 sec, 68 C. 30 sec, 72 C. 3 min, 25 cycles/72 C. 10 min/4 C.]. The obtained specific amplification product underwent gel purification, and when the base sequence thereof was analyzed after TA cloning using pGEM-Easy Vector (available from Promega Corporation), it was confirmed to be the C20 elongase gene derived from Parietichytrium sarkarianum SEK364.
(166) Additionally, using the genus Parietichytrium genome DNA extracted by the method described in Example 2-2 as a template, a sequence containing a C20 elongase gene sequence (957 bp, SEQ ID NO: 23) was amplified with LA Taq Hot Start Version (available from Takara Bio Inc.). The PCR primers used were as shown below. RHO153 includes a start codon, and has a BamHI site as a linker sequence. RHO154 includes a stop codon, and has a BamHI site as a linker sequence. [RHO153: 32mer: 5-CCC GGA TCC ATG GCA GCT CGC GTG GAG AAA CA-3 (SEQ ID NO: 24), RHO154: 33mer: 5-CCC GGA TCC TTA CTG AGC CTT CTT GGA GGT CTC-3 (SEQ ID NO: 25)]. [PCR cycles: 98 C. 2 min/98 C. 10 sec, 68 1 min, 30 cycles/68 C. 2 min].
(167) The obtained DNA fragment was cloned in pGEM-T Easy Vector, and after amplification with E. coli, the sequence was confirmed using a Dye Terminator Cycle Sequencing Kit (available from Beckman Coulter Inc.).
(168) The genus Parietichytrium C20 elongase gene (936 bp, SEQ ID NO: 26) was cloned. This was named pRH80 (
[Example 2-5]: Production of Base Plasmid for Production of Genus Parietichytrium C20 Elongase Gene Targeting Vector
(169) A primer set that was set up in the reverse direction so as to insert a BglII site into the core portion of the C20 elongase gene sequence was prepared using pRH80 (
(170)
[Example 2-6]: Production of Targeting Vectors (Artificially Synthesized Neomycin Gene and Hygromycin Resistance Gene)
(171) pRH31 (
(172) pRH32 (
(173) The two produced targeting vectors (pRH85 and 86) are illustrated in
[Example 2-7]: C20 Elongase Gene Targeting Vector Transfer
(174) Using the two targeting vectors produced in Example 2-6 as templates, the genes were amplified with PrimeSTAR Max DNA Polymerase (available from Takara Bio Inc.) using RHO153 (described in Example 2-4, SEQ ID NO: 24) and RHO154 (described in Example 2-4, SEQ ID NO: 25) as primers. [PCR cycles: 98 C. 2 min/98 C. 30 sec, 68 2 min, 30 cycles/68 C. 2 min]. After phenol chloroform extraction and chloroform extraction, the DNA underwent ethanol precipitation, and the precipitate was dissolved in 0.1TE. A260/280 was measured and the DNA concentration was calculated. The transfer fragment obtained when pRH85 (
(175) The Parietichytrium sarkarianum SEK364 strain was cultured for 4 days in a GY culture medium, and cells in the logarithmic growth phase were used for gene transfer. To cells corresponding to OD600=1 to 1.5, 0.625 g of DNA fragment was transformed by the gene gun method (microcarrier: 0.6 micron gold particles, target distance: 6 cm, chamber vacuum: 26 mmHg, rupture disk: 1550 psi). After a recovery time of 24 hr, the transgenic cells were spread on a PDA agar plate culture medium (containing 2 mg/mL of G418 or containing 2 mg/mL of hygromycin). As a result, from 10 to 20 cells of drug resistant strain per shot were obtained.
[Example 2-8]: Identification of C20 Elongase Gene Targeting Homologous Recombinant
(176) Genome DNA of the Parietichytrium sarkarianum SEK364 strain, a C20 elongase gene hetero homologous recombinant, and a C20 elongase gene homo homologous recombinant (gene disruption strain) were extracted by the method described in Example 2-2, and then A260/280 was measured and the DNA concentration was calculated. Using the genome DNA as templates, PCR for genome structure confirmation was performed using LA Taq Hot Start Version (available from Takara Bio Inc.). The positions of the primers used, the combinations used in amplification, and the expected sizes of the amplification products are illustrated in
(177) A C20 elongase gene disruption strain in which there is no amplification in the wild-type allele (Wt allele) and there is amplification in the artificially synthesized neomycin resistance gene allele (NeoR allele) and the hygromycin resistance gene allele (HygR allele) was obtained (
Example 2-9: Change in Fatty Acid Composition by C20 Elongase Gene Disruption
(178) The Parietichytrium sarkarianum SEK364 wild-type strain and the gene disruption strain thereof (C20 elongase gene disruption strain, C20 /) were cultured in a GY culture medium. The cells of the latter phase of the logarithmic growth phase were centrifuged for 10 min at 4 C. at 3000 rpm to form pellets, and the obtained pellets were suspended in 0.9% NaCl and washed. Then, the resultant was centrifuged for 10 min at 4 C. at 3000 rpm, and the pellets were suspended in sterilized water and washed. The resultant was further centrifuged for 10 min at 3000 rpm, the supernatant was removed and the precipitate was freeze-dried.
(179) To the freeze-dried cells, 2 mL of methanolic KOH (7.5% KOH in 95% methanol) was added, and after vortexing, the cells were crushed by ultrasound (80 C., 30 min). Then, 500 L of sterilized water was added and vortexing was performed, and then 2 mL of n-hexane was added and vortexing was performed. The resultant was then centrifuged for 10 min at 3000 rpm, and the top layer was discarded. Another 2 mL of n-hexane was added and vortexing was performed. The resultant was centrifuged for 10 min at 3000 rpm, and the top layer was discarded. One mL of 6 N HCl was added to the remaining bottom layer and vortexing was performed, and then 2 mL of n-hexane was added and vortexing was performed. The resultant was then centrifuged for 10 min at 3000 rpm, and the top layer was collected. Another 2 mL of n-hexane was added and vortexing was performed. The resultant was centrifuged for 10 min at 3000 rpm, and the top layer was collected. The collected top layer was concentrated and dried with nitrogen gas. Two mL of 3 N methanolic HCl was added to the concentrated and dried sample, and the resultant was incubated overnight at 80 C.
(180) The sample was cooled to room temperature, and 1 mL of 0.9% NaCl was added. Then, 2 mL of n-hexane was added and vortexing was performed. The resultant was centrifuged for 10 min at 3000 rpm, and the top layer was collected. Another 2 mL of n-hexane was added and vortexing was performed. The resultant was centrifuged for 10 min at 3000 rpm, and the top layer was collected. A small amount of anhydrous sodium sulfate was added to the collected top layer and then vortexing was performed. The resultant was centrifuged for 10 min at 3000 rpm, and the top layer was collected. The collected top layer was concentrated and dried with nitrogen gas. The concentrated and dried sample was dissolved in 0.5 mL of n-hexane, and 1 L of the resultant was subjected to GC analysis. In GC analysis, measurement was performed using a gas chromatograph GC-2014 (available from Shimadzu Corporation) under the following conditions. Column: HR-SS-10 (30 m0.25 mm; available from Shinwa Chemical Industries Ltd.); column temperature: 150 C..fwdarw.(5 C./min).fwdarw.220 C. (10 min); carrier gas: He (1.3 mL/min).
(181) As a result, when the C20 elongase gene was disrupted in Parietichytrium sarkarianum SEK364, fatty acids having not less than 22 carbon chains decreased while fatty acids having 20 carbon chains increased (
(182) In these results, arachidonic acid increased approximately 10-fold, EPA approximately 8-fold, and DGLA approximately 16-fold, while DPA decreased to approximately and DHA to approximately .
(183) By selecting the labyrinthulid Parietichytrium sarkarianum SEK364 having no PUFA-PKS pathway in this manner, a strain that accumulates PUFAs other than DHA and n-6 DPA can be produced without PUFA-PKS pathway gene disruption. This strain may also be used as a strain that produces EPA and/or ARA, and further disruption or transforming elongase or desaturase genes can create strains that produce desired PUFAs.
Example 3
(184) [Measurement of Fatty Acid Composition of Lipids Produced by 4 Desaturase Gene Disruption and Transformation Strain of Parietichytrium sarkarianum SEK364]
[Example 3-1]: Cloning of Genus Parietichytrium 4 Desaturase Gene
(185) Genome DNA of Parietichytrium sp. SEK571 was extracted by the method described in Example 2-2. Using the extracted genome DNA as a template, a sequence containing the 4 desaturase gene sequence (5003 bp, SEQ ID NO: 39) was amplified with LA Taq Hot Start Version (available from Takara Bio Inc.). The PCR primers used were as shown below. [RHO241: 23mer: 5-GTT TGA GGA GCG AGG CAT TTC TT-3 (SEQ ID NO: 40), RHO242: 23mer: 5-AGT GCT CGT ACA ATG ACT GGC GT-3 (SEQ ID NO: 41)].
(186) The obtained DNA fragment was cloned in pGEM-T Easy Vector, and after amplification with E. coli, the sequence was confirmed using a Dye Terminator Cycle Sequencing Kit (available from Beckman Coulter Inc.). This was named pRH112 (SEQ ID NO: 42).
(187) The plasmid (pRH112) containing the genus of Parietichytrium 4 desaturase gene sequence (1542 bp, SEQ ID NO: 43) is illustrated in
[Example 3-2]: Production of Plasmid Serving as Base for Production of 4 Desaturase Gene Targeting Vector
(188) Using pRH112 (
(189) The produced plasmid (pRH117) serving as a base for production of a 4 desaturase gene targeting vector is illustrated in
[Example 3-3]: Production of 4 Desaturase Gene Targeting Vector
(190) pRH31 (
(191) The produced 4 desaturase gene targeting vector (pRH126) is illustrated in
[Example 3-4]: Transfer of 4 Desaturase Gene Targeting Vector to Parietichytrium sarkarianum SEK364
(192) Using the targeting vector pRH126 (
(193) The Parietichytrium sarkarianum SEK364 strain was cultured for 1 to 2 days in a GY culture medium, and cells in the logarithmic growth phase were used for gene transfer. To cells corresponding to OD600=1 to 2, 0.625 g of DNA fragment was transformed by the gene gun method (microcarrier: 0.6 micron gold particles, target distance: 6 cm, chamber vacuum: 26 mmHg, rupture disk: 1550 psi). After a recovery time of 24 hr, the transgenic cells were spread on a PDA agar plate culture medium containing 1 mg/mL of G418. As a result, from 0 to 2 cells of drug resistant strain per shot were obtained.
[Example 3-5]: Identification of 4 Desaturase Gene Targeting Homologous Recombinant
(194) Genome DNA of the Parietichytrium sarkarianum SEK364 strain and the 4 desaturase gene disruption strain were extracted by the method described in Example 2-2, and then A260/280 was measured and the DNA concentration was calculated. Using the genome DNA as templates, PCR for genome structure confirmation was performed using PrimeSTAR GXL DNA Polymerase (available from Takara Bio Inc.). The positions of the primers used, the combinations used in amplification, and the expected sizes of the amplification products are illustrated in
(195) As a result, a 4 desaturase gene disruption strain in which there is no amplification derived from the wild-type allele (Wt allele) and there is amplification derived from the 4 desaturase gene KO allele (NeoR allele) was obtained (
Example 3-6: Change in Fatty Acid Composition by 4 Desaturase Gene Disruption
(196) The Parietichytrium sarkarianum SEK364 wild-type strain and the 4 desaturase gene disruption strain thereof were cultured according to the method described in Example 2-9, and after freeze drying, the fatty acids were methyl-esterified and analyzed using GC. In culturing, the GY liquid culture medium described in Example 1 supplemented with 0.1% of a vitamin solution (vitamin B.sub.1 200 mg, vitamin B.sub.2 1 mg, and vitamin B.sub.12 1 mg are dissolved in 100 mL of distilled water) and 0.2% of a trace element solution (EDTA disodium salt 30.0 g, FeCl.sub.3.Math.6H.sub.2O 1.45 g, H.sub.2BO.sub.3 34.2 g, MnCl.sub.2.Math.4H.sub.2O 4.3 g, ZnCl.sub.2 1.335 g, CoCl.sub.2.Math.6H.sub.2O 0.13 g, NiSO.sub.4.Math.6H.sub.2O 0.26 g, CuSO.sub.4 5H.sub.2O 0.01 g, and NaMoO.sub.4.Math.2H.sub.2O 0.025 g are dissolved in 1 L of distilled water) was used. In GC analysis, measurement was performed using a gas chromatograph GC-2014 (available from Shimadzu Corporation) under the following conditions. Column: HR-SS-10 (30 m0.25 mm; available from Shinwa Chemical Industries Ltd.); column temperature: 150 C..fwdarw.(2 C./min).fwdarw.220 C. (10 min); carrier gas: He (1.3 mL/min).
(197) The analysis results chart is shown in
(198) These results show that when the 4 desaturase gene is disrupted in the Parietichytrium sarkarianum SEK364 strain, DHA and DPA n-6 cannot be substantially biosynthesized, and conversely, DPA n-3 and DTA, which are substrates thereof, increase.
(199) By selecting the labyrinthulid Parietichytrium sarkarianum SEK364 having no PUFA-PKS pathway in this manner, a strain that accumulates PUFAs other than DHA and DPA n-6 can be produced without PUFA-PKS pathway gene disruption. This strain may also be used as a strain that produces n-3 DPA and/or DTA, and further disruption or transforming elongase or desaturase genes can create strains that produce desired PUFAs.
Example 4
(200) [Measurement of Fatty Acid Composition of Lipids Produced by C20 Elongase Gene Disruption and Transformation Strain of Parietichytrium sp. SEK358]
[Example 4-1]: Transfer of C20 Elongase Gene Targeting Vector to Parietichytrium sp. SEK358 Strain
(201) Using the targeting vector produced with pRH85 (
(202) The Parietichytrium sp. SEK358 strain was cultured for 3 days in a GY culture medium, and cells in the logarithmic growth phase were used for gene transfer. To cells corresponding to OD600=1 to 1.5, 0.625 g of DNA fragment was transformed by the gene gun method (microcarrier: 0.6 micron gold particles, target distance: 6 cm, chamber vacuum: 26 mmHg, rupture disk: 900 psi). After a recovery time of 24 hr, the transgenic cells were spread on a PDA agar plate culture medium containing 0.5 mg/mL of G418. As a result, from 10 to 30 cells of drug resistant strain per shot were obtained.
[Example 4-2]: Identification of C20 Elongase Gene Targeting Homologous Recombinant
(203) Genome DNA of the Parietichytrium sp. SEK358 strain and the C20 elongase gene disruption strain were extracted by the method described in Example 2-2, and then A260/280 was measured and the DNA concentration was calculated. Using the genome DNA as templates, PCR for genome structure confirmation was performed using Mighty Amp DNA Polymerase (available from Takara Bio Inc.). The positions of the primers used, the combinations used in amplification, and the expected sizes of the amplification products are illustrated in
(204) RHO184 (described in Example 2-8, SEQ ID NO: 37) was set upstream of C20 elongase; RHO185 (described in Example 2-8, SEQ ID NO: 38) was set downstream; RHO142 (described in Example 2-8, SEQ ID NO: 35) and RHO143 (described in Example 2-8, SEQ ID NO: 36) were set on the artificially synthesized neomycin resistance gene. [PCR cycles: 98 C. 2 min/98 C. 10 sec, 68 2 min, 30 cycles/68 C. 7 min].
(205) A C20 elongase gene disruption strain in which there is no amplification in the wild-type allele (Wt allele) and there is amplification in the artificially synthesized neomycin resistance gene allele (NeoR allele) was obtained (
[Example 4-3]: Change in Fatty Acid Composition by C20 Elongase Gene Disruption
(206) The Parietichytrium sp. SEK358 wild-type strain and the gene disruption strain thereof (C20 elongase gene disruption strain, C20 KO) were cultured according to the method described in Example 2-9, and after freeze drying, the fatty acids were methyl-esterified and analyzed using GC. In GC analysis, measurement was performed using a gas chromatograph GC-2014 (available from Shimadzu Corporation) under the following conditions. Column: HR-SS-10 (30 m0.25 mm; available from Shinwa Chemical Industries Ltd.); column temperature: 150 C..fwdarw.(5 C./min).fwdarw.220 C. (10 min); carrier gas: He (1.3 mL/min). The changes in the fatty acid composition are shown in
(207)
(208) As a result, when the C20 elongase gene was disrupted in the Parietichytrium sp. SEK358 strain, fatty acids having not less than 22 carbon chains decreased while fatty acids having 20 carbon chains increased. Specifically, arachidonic acid increased approximately 7-fold and EPA increased approximately 11-fold, while DPA decreased to approximately 1/15 and DHA decreased to approximately .
(209) By selecting the labyrinthulid Parietichytrium sp. SEK358 having no PUFA-PKS pathway in this manner, a strain that accumulates PUFAs other than DHA and DPA n-6 can be produced without PUFA-PKS pathway gene disruption. This strain may also be used as a strain that produces EPA and/or ARA, and further disruption or transforming elongase or desaturase genes can create strains that produce desired PUFAs.
Example 5
(210) [Measurement of Fatty Acid Composition of Lipids Produced by 4 Desaturase Gene Disruption and Transformation Strain of Parietichytrium sp. SEK358]
[Example 5-1]: Transfer of 4 Desaturase Gene Targeting Vector to Parietichytrium sp. SEK358 Strain
(211) Using the targeting vector produced with pRH126 (
(212) The Parietichytrium sp. SEK358 strain was cultured for 1 to 2 days in a GY culture medium, and cells in the logarithmic growth phase were used in gene transfer. To cells corresponding to OD600=1 to 2, 0.625 g of DNA fragment was transformed by the gene gun method (microcarrier: 0.6 micron gold particles, target distance: 6 cm, chamber vacuum: 26 mmHg, rupture disk: 1550 psi). After a recovery time of 24 hr, the transgenic cells were spread on a PDA agar plate culture medium containing 1 mg/mL of G418. As a result, from 0 to 2 cells of drug resistant strain per shot were obtained.
[Example 5-2]: Identification of 4 Desaturase Gene Targeting Homologous Recombinant
(213) Genome DNA from the Parietichytrium sp. SEK358 strain and the 4 desaturase gene disruption strain were extracted by the method described in Example 2-2, and then A260/280 was measured and the DNA concentration was calculated. Using the genome DNA as templates, PCR for genome structure confirmation was performed using PrimeSTAR GXL DNA Polymerase (available from Takara Bio Inc.). The positions of the primers used, the combinations used in amplification, and the expected sizes of the amplification products are illustrated in
(214) As a result, a 4 desaturase gene disruption strain in which there is no amplification derived from the wild-type allele (Wt allele) and there is amplification derived from the 4 desaturase gene KO allele (NeoR allele) was obtained (
[Example 5-3]: Change in Fatty Acid Composition by 4 Desaturase Gene Disruption
(215) The Parietichytrium sp. SEK358 wild-type strain and the 4 desaturase gene disruption strain thereof (SEK358 delta4 des. KO mutant strain) were cultured according to the method described in Example 2-9, and after freeze drying, the fatty acids were methyl-esterified and analyzed using GC. In culturing, the GY liquid culture medium described in Example 1 supplemented with 0.1% of a vitamin solution (vitamin B.sub.1 200 mg, vitamin B.sub.2 1 mg, and vitamin B.sub.12 1 mg are dissolved in 100 mL of distilled water) and 0.2% of a trace element solution (EDTA disodium salt 30.0 g, FeCl.sub.3 6H.sub.2O 1.45 g, H.sub.2BO.sub.3 34.2 g, MnCl.sub.2.Math.4H.sub.2O 4.3 g, ZnCl.sub.2 1.335 g, CoCl.sub.2.Math.6H.sub.2O 0.13 g, NiSO.sub.4 6H.sub.2O 0.26 g, CuSO.sub.4.Math.5H.sub.2O 0.01 g, and NaMoO.sub.4.Math.2H.sub.2O 0.025 g are dissolved in 1 L of distilled water) was used. In GC analysis, measurement was performed using a gas chromatograph GC-2014 (available from Shimadzu Corporation) under the following conditions. Column: HR-SS-10 (30 m0.25 mm; available from Shinwa Chemical Industries Ltd.); column temperature: 150 C..fwdarw.(2 C./min).fwdarw.220 C. (10 min); carrier gas: He (1.3 mL/min).
(216) The analysis results chart is shown in
(217) The results showed that when the 4 desaturase gene was disrupted in the Parietichytrium sp. SEK358 strain, DHA and DPA n-6 cannot be substantially biosynthesized, and conversely, n-3 DPA and DTA, which are substrates thereof, increase.
(218) By selecting the labyrinthulid Parietichytrium sp. SEK358 having no PUFA-PKS pathway in this manner, a strain that accumulates PUFAs other than DHA and n-6 DPAcan be produced without PUFA-PKS pathway gene disruption. This strain may also be used as a strain that produces n-3 DPA and/or DTA, and further disruption or transforming elongase or desaturase genes can create strains that produce desired PUFAs.
Example 6
(219) [Measurement of Fatty Acid Composition of Lipids Produced by C20 Elongase Gene Disruption and Transformation Strain of Parietichytrium sp. SEK571]
[Example 6-1]: Transfer of C20 Elongase Gene Targeting Vector to Parietichytrium sp. SEK571 Strain
(220) Using the targeting vector produced with pRH85 (
(221) The Parietichytrium sp. SEK571 strain was cultured for 3 days in a GY culture medium, and cells in the logarithmic growth phase were used in gene transfer. To cells corresponding to OD600=1 to 1.5, 0.625 g of DNA fragment was transformed by the gene gun method (microcarrier: 0.6 micron gold particles, target distance: 6 cm, chamber vacuum: 26 mmHg, rupture disk: 1550 psi). After a recovery time of 24 hr, the transgenic cells were spread on a PDA agar plate culture medium containing 0.5 mg/mL of G418. As a result, from 5 to 15 cells of drug resistant strain per shot were obtained.
[Example 6-2]: Identification of C20 Elongase Gene Targeting Homologous Recombinant
(222) Genome DNA of the Parietichytrium sp. SEK571 strain and the C20 elongase gene disruption strain were extracted by the method described in Example 2-2, and then A260/280 was measured and the DNA concentration was calculated. Using the genome DNA as templates, PCR for genome structure confirmation was performed using Mighty Amp DNA Polymerase (available from Takara Bio Inc.). The positions of the primers used, the combinations used in amplification, and the expected sizes of the amplification products are illustrated in
(223) RHO184 (described in Example 2-8, SEQ ID NO: 37) was set upstream of C20 elongase; RHO185 (described in Example 2-8, SEQ ID NO: 38) was set downstream; RHO142 (described in Example 2-8, SEQ ID NO: 35) and RHO143 (described in Example 2-8, SEQ ID NO: 36) were set on the artificially synthesized neomycin resistance gene. [PCR cycles: 98 C. 2 min/98 C. 10 sec, 68 2 min, 30 cycles/68 C. 7 min].
(224) A C20 elongase gene disruption strain in which there is no amplification in the wild-type allele (Wt allele) and there is amplification in the artificially synthesized neomycin resistance gene allele (NeoR allele) was obtained (
[Example 6-3]: Change in Fatty Acid Composition by C20 Elongase Gene Disruption
(225) The Parietichytrium sp. SEK571 strain and the gene disruption strain thereof (C20 elongase gene disruption strain, C20 KO) were cultured according to the method described in Example 2-9, and after freeze drying, the fatty acids were methyl-esterified and analyzed using GC. In GC analysis, measurement was performed using a gas chromatograph GC-2014 (available from Shimadzu Corporation) under the following conditions. Column: HR-SS-10 (30 m0.25 mm; available from Shinwa Chemical Industries Ltd.); column temperature: 150 C..fwdarw.(5 C./min).fwdarw.220 C. (10 min); carrier gas: He (1.3 mL/min).
(226) The changes in the fatty acid composition are shown in
(227)
(228) As a result, when the C20 elongase gene was disrupted in the Parietichytrium sp. SEK571 strain, fatty acids having not less than 22 carbon chains decreased while fatty acids having 20 carbon chains increased. Specifically, arachidonic acid increased approximately 4-fold and EPA increased approximately 8-fold, while DPA decreased to approximately 1/12 and DHA decreased to approximately 1/12.
(229) The results show that Parietichytrium sp. SEK571 has very weak or no PUFA production activity via the PUFA-PKS pathway, and by selecting the labyrinthulid Parietichytrium sp. SEK571, a strain that accumulates PUFAs other than DHA and n-6 DPA can be produced without PUFA-PKS pathway gene disruption. This strain may also be used as a strain that produces EPA and/or ARA, and further disruption or transforming elongase or desaturase genes can create strains that produce desired PUFAs.
Comparative Example 1
(230) [Measurement of Fatty Acid Composition of Lipids Produced by C20 Elongase Gene Disruption and Transformation Strain of Thraustochytrium aureum ATCC 34304]
[Comparative Example 1-1]: Extraction of Total RNA Derived from T. Aureum ATCC 34304, and mRNA Purification
(231) A T. aureum ATCC 34304 culture solution on the third day of culturing using a GY liquid culture medium was centrifuged for 15 min at 3500g, and the cells were collected. The obtained cells were washed by suspending in a sterilized physiological saline solution and then centrifuging again, and were then rapidly frozen with liquid nitrogen, and then ground into powder form in a mortar. Total RNA was extracted from the obtained crushed cell solution using Sepasol-RNA I Super (available from Nacalai Tesque, Inc.). Then, mRNA was purified from the total RNA according to manufacturer's instructions using Oligotex-dT30<Super> mRNA Purification Kit (trade name; available from Takara Bio Inc.). The obtained total RNA and mRNA were dissolved in an appropriate amount of TE, and then subjected to electrophoresis using formalin-modified gel (1% agarose/MOPS buffer). The result showed that total RNA extraction was successful, that mRNA was purified from the total RNA, and that the RNA was not decomposed by RNase. Furthermore, to proactively avoid RNA decomposition, rubber gloves, a mask, and the like were donned through the experimental operation, and the instruments used were completely RNase-free or the RNase used was inactivated by treatment with diethylpyrocarbonate (available from Nacalai Tesque, Inc.). Furthermore, when decomposing RNA, a solution obtained by adding the recombinant RNase inhibitor RNaseOUT (trade name; available from Invitrogen Corp.) to sterilized MilliQ water treated with diethylpyrocarbonate was used.
[Comparative Example 1-2]: Isolation of T. Aureum ATCC 34304-Derived Elongase Gene by RACE
(232) Using a histidine box (His box) in which the elongase gene was conserved to a high degree as a target, forward (elo-F; 5-TTY YTN CAY GTN TAY CAY CAY-3) (SEQ ID NO: 53) and reverse (elo-R; 5-GCR TGR TGR TAN ACR TGN ARR AA-3) (SEQ ID NO: 54) degenerate oligonucleotides were synthesized. The oligonucleotides were synthesized using a DNA synthesizer (available from Applied Biosystems Corp.). Next, 3- and 5-RACE cDNA libraries in which synthetic adapters were appended to the 3 and 5 terminals were produced according to manufacturer's instructions using SMART RACE cDNA Amplification Kit (trade name; available from Clontech Laboratories, Inc.). Using these as templates, 3- and 5-RACE were performed using the synthetic adapter-specific oligonucleotides and the above degenerate oligonucleotides elo-F and elo-R. [PCR cycles: 94 C. 1 min/94 C. 30 sec, 60 C. 30 sec, 72 C. 3 min, 30 cycles/72 C. 10 min/4 C.]. As a result, bands of specifically amplified 3- and 5-RACE products were confirmed (
(233) As a result, two respective sequences of 190 bp and 210 bp named elo1 (SEQ ID NO: 55) and elo2 (SEQ ID NO: 56) were successfully identified in the 3-RACE product, and one 200 bp sequence named elo3 (SEQ ID NO: 57) was successfully identified in the 5-RACE product. The fact that these elo1, elo2, and elo3 sequences exhibited significant homology to various elongase gene sequences shows that these sequences are partial sequences of elongase genes derived from T. aureum ATCC 34304. Additionally, respective oligonucleotide primers were again designed for elo1, elo2, and elo3, and acquisition of cDNA sequences was attempted by RACE. The produced oligonucleotide primers are shown below. elo1 forward oligonucleotide primer (elo1-F1; 5-TAT GAT CGC CAA GTA CGC CCC-3) (SEQ ID NO: 58) and reverse oligonucleotide primer (elo1-R1; 5-GAA CTG CGT CAT CTG CAG CGA-3) (SEQ ID NO: 59), elo2 forward oligonucleotide primer (elo2-F1; 5-TCT CGC CCT CGA CCA CCA AC-3) (SEQ ID NO: 60) and reverse oligonucleotide primer (elo2-R1: 5-CGG TGA CCG AGT TGA GGT AGC C-3) (SEQ ID NO: 61), elo3 forward oligonucleotide primer (elo3-F1; 5-CAA CCC TTT CGG CCT CAA CAA G-3) (SEQ ID NO: 62) and reverse oligonucleotide primer (elo3-R1; 5-TTC TTG AGG ATC ATC ATG AAC GTG TC-3) (SEQ ID NO: 63).
(234) Using the produced forward and reverse oligonucleotide primers, RACE and base sequence analysis of the amplified products were performed by the same methods as described above. As a result, for elo1, specifically amplified 3- and 5-RACE products were obtained, and since the duplicate portions thereof matched completely, they were proved to be an 1139 bp elo1 cDNA sequence (SEQ ID NO: 64). Similarly, for elo3, specifically amplified 3- and 5-RACE products were obtained, and since the duplicate portions thereof matched completely, they were proved to be a 1261 bp elo3 cDNA sequence (SEQ ID NO: 65).
(235) As a result of sequence analysis, it was found that elo1 is composed of an 825 bp translation sequence (SEQ ID NO: 67) that encodes 275 amino acid residues (SEQ ID NO: 66), and as a result of a BLAST search, it was found not only that elo1 exhibited significant homology to various elongase genes, but also that elo1 completely matches a known presumed A5 elongase gene sequence derived from T. aureum (NCBI accession no. CS486301). On the other hand, elo3 was estimated to constituted of a 951 bp translation region (SEQ ID NO: 69) that encodes 317 amino acid residues (SEQ ID NO: 68), and as a result of a BLAST search, elo3 was found to exhibit significant homology to various elongase genes, and thus was confirmed to be a presumed elongase gene derived from T. aureum ATCC 34304. Furthermore, a His box in which the elongase gene was conserved to a high degree was found within the presumed amino acid sequences of the two genes. From the above results, the elo1 and elo3 gene were considered to be presumed elongase genes derived from T. aureum ATCC 34304 and were designated as TaELO1 and TaELO2, respectively.
[Comparative Example 1-3]: Expression of TaELO1 and TaELO2 with Brewer's Yeast Saccharomyces cerevisiae as Host, and Analysis of Fatty Acid Composition of Transgenic Strains
(236) Respective expression vectors were constructed in order to cause expression of TaELO1 and TaELO2 using brewer's yeast S. cerevisiae as a host. An outline thereof is given below. A pair of oligonucleotide primers (E1 HindIII; 5-ATA AGC TTA AAA TGT CTA GCA ACA TGA GCG CGT GGG GC-3) (SEQ ID NO: 70) and (E1 XbaI; 5-TGT CTA GAA CGC GCG GAC GGT CGC GAA A-3) (SEQ ID NO: 71) were produced based on the sequence of the TaELO1 translation region. E1 HindIII is a forward oligonucleotide primer and has a restriction enzyme HindIII site (AAGCTT) at the 5 terminal. Furthermore, the sequence near the start codon of TaELO1 has been modified in reference to the yeast consensus sequence ((A/Y) A (A/U) A AUG UCU; underlined portion is start codon) (Non-patent Document 12). E1 XbaI is a reverse oligonucleotide primer, and has an XbaI site (TCTAGA) at the 5 terminal.
(237) Similarly, a pair of oligonucleotide primers (E2 HindIII; 5-TAAAGC TTA AAA TGT CTA CGC GCA CCT CGA AGA GCG CTC C-3) (SEQ ID NO: 72) and (E2 XbaI; 5-CAT CTA GAC TCG GAC TTG GTG GGG GCG CTT G-3) (SEQ ID NO: 73) were produced based on the sequence of the TaELO2 translation region. E2 HindIII is a forward oligonucleotide primer and has a restriction enzyme HindIII site at the 5 terminal. Furthermore, the sequence near the start codon of TaELO2 has been modified in reference to the yeast consensus sequence. E2 XbaI is a reverse oligonucleotide primer, and has an XbaI site at the 5 terminal.
(238) With the 5-RACE cDNA library described in Comparative Example 1-2 as a template, PCR was performed using the above two oligonucleotide primer pairs. A 949 bp TaELO1 translation region (SEQ ID NO: 74) and a 967 bp TaELO2 translation region (SEQ ID NO: 75), in which the vicinity of the start codon was modified to the consensus sequence and having the restriction enzyme HindII at the 5 terminal and the restriction enzyme XbaI site at the 3 terminal, were amplified. Furthermore, to avoid elongation mistakes, PrimeSTAR DNA Polymerase (trade name; available from Takara Bio Inc.) having high correction activity was used. [PCR cycles: 98 C. 2 min/98 C. 5 sec, 60 C. 5 sec, 72 C. 1.5 min, 30 cycles/72 C. 7 min/4 C.].
(239) Next, the amplified PCR products were separated with 1% agarose gel, and then DNA fragments were cut and extracted from the agarose gel. Additionally, after treatment with restriction enzymes HindIII and XbaI, the DNG fragments were again purified using agarose gel, and a cyclized vector was constructed by ligation using DNA Ligation Kit Mighty Mix (available from Takara Bio Inc.) to a brewer's yeast expression vector pYES2/CT (available from Invitrogen Corp.) which was made into a straight chain by treatment with restriction enzymes HindIII and XbaI. Furthermore, by analyzing the base sequence, it was confirmed that mutations due to PCR elongation mistakes had not been introduced into the sequences of the TaELO1 and TaELO2 translation regions transformed into pYES2/CT. From the above result, a TaELO1 expression vector pYEELOT and a TaELO2 expression vector pYEELO2 were successfully constructed.
(240) Transformants in which the two constructed expression vectors and pYES2/CT had been transformed into brewer's yeast S. cerevisiae by the lithium acetate method were selected according to the methods described in Non-patent Document 13 and Non-patent Document 14. Next, the obtained transformants (pYEELOT transgenic strain, pYEELO2 transgenic strain, and mock transgenic strain) were cultured according to the method of Qiu et al. (Non-patent Document 15), and cell-derived fatty acid extraction and methyl-esterification were performed. However, culturing was carried out after adding 0.02 mM each of the following acids in respective final concentrations: -linolenic acid (ALA, C18:39, 12, 15) and linoleic acid (LA, C18:29, 12) as 9 elongase substrates; stearidonic acid (STA, C18:46, 9, 12, 15) and -linolenic acid (GLA, C18:36, 9, 12) as 6 elongase substrates; eicosapentaenoic acid (EPA, C20:55, 8, 11, 14, 17) and arachidonic acid (AA, C20:45, 8, 11, 14) as 5 elongase substrates. Then, gas chromatography (GC) analysis of the methyl-esterified fatty acids was performed according to the method of Abe et al. (Non-patent Document 16). In GC analysis, measurement was performed using a gas chromatograph GC-2014 (available from Shimadzu Corporation) under the following conditions. Column: HR-SS-10 (30 m0.25 mm; available from Shinwa Chemical Industries Ltd.); column temperature: 150 C..fwdarw.(5 C./min).fwdarw.220 C. (10 min); carrier gas: He (1.3 mL/min).
(241) As a result, the pYEELO1 transgenic strain exhibited 6 elongase activity, by which stearidonic acid (STA) is converted to eicosatetraenoic acid (ETA, 20:48, 11, 14, 17) and -linolenic acid (GLA) is converted to dihomo--linolenic acid (DGLA, C20:38, 11, 14), which was not seen in the host (mock transgenic strain). On the other hand, the pYEELO1 transgenic strain exhibited 9 elongase activity, by which -linolenic acid (ALA) is converted to eicosatrienoic acid (ETrA, C20:311, 14, 17) and linoleic acid (LA) is converted to eicosadienoic acid (EDA, C20:311, 14), as well as 5 elongase (C20 elongase) activity, by which eicosapentaenoic acid (EPA) is converted to 3 docosapentaenoic acid (o3 DPA, C22:57, 10, 13, 16, 19) and arachidonic acid (ARA) is converted to docosatetraenoic acid (DTA, C22: 47, 10, 13, 16) (Table 1).
(242) Furthermore, the pYEELO2 transgenic strain exhibited 5 elongase (C20 elongase) activity by which EPA is converted to 3 DPA (C22: 57, 10, 13, 16, 19) and ARA is converted to DTA, which was not seen in the host. On the other hand, the pYEELO2 transgenic strain exhibited slight 6 elongase activity, by which STA is converted to ETA and GLA is converted to DGLA (Table 1). The above result shows that TaELO1 is 6/9/5 elongase, and TaELO2 is 5/6 elongase.
(243) TABLE-US-00001 TABLE 1 mock TaELO1 TaELO2 mock TaELO1 TaELO2 LA supplemented (0.2 mM) ALA supplemented (0.2 mM) LA 30.5 23.5 36.3 ALA 49.1 25.8 47.1 EDA 0.2 8.9 0.2 ETrA 0.2 17.9 0.3 Conversion 27.4 Conversion 41 efficiency efficiency (%) (%) GLA supplemented (0.2 mM) STA supplemented (0.2 mM) GLA 44.0 7.6 43.6 STA 46.2 8.3 40.5 DGLA 0.2 29.0 0.8 ETA 0.3 28.1 1.7 Conversion 79.3 1.9 Conversion 77.2 4.0 efficiency efficiency (%) (%) ARA supplemented (0.2 mM) EPA supplemented (0.2 mM) ARA 30.9 23.2 8.9 EPA 42.0 31.2 13.1 ADA 5.8 13.6 DPA 0.1 10.6 24.5 Conversion 20.1 60.3 Conversion 25.3 65.1 efficiency efficiency (%) (%) Conversion efficiency (%) = 100 product (area)/substrate (area) + product (area) (n = 1)
[Comparative Example 1-4]: Acquisition of TaELO2 ORF Upstream and Downstream Regions by PCR Genome Walking
(244) In the targeting vector for TaELO2 disruption, the regions upstream and downstream of TaELO2 ORF serving as homologous recombination sites were acquired by PCR genome walking. An overview is given below.
(245) Cells of the T. aureum ATCC 34304 strain on the third day of culturing in a GY liquid culture medium were rapidly frozen with liquid nitrogen, and then ground into powder form in a mortar. After genome DNA was extracted according to the method described in Non-patent Document 17, and was dissolved in an appropriate quantity of TE. The quantity and purity of the genome DNA were tested by O.D. 260 and O.D. 280 measurement. Next, a genome DNA library was constructed, wherein a cassette sequence having restriction enzyme sites was appended to genome DNA cut with various restriction enzymes according to the manufacturer's protocol using TaKaRa LA PCR (trade name) in vitro Cloning Kit (available from Takara Bio Inc.). Then, using the produced genome DNA library as a template, nested PCR was performed according to the manufacturer's protocol using forward oligonucleotide primers E2 XbaI (described in Comparative Example 1-3, SEQ ID NO: 73) produced based on the sequence of TaELO2 and elo3-F1 (described in Comparative Example 1-2, SEQ ID NO: 62), or the reverse oligonucleotide primers E2 HindIII (described in Comparative Example 1-3, SEQ ID NO: 72) and elo3-R1 (described in Comparative Example 1-2, SEQ ID NO: 63), together with oligonucleotide primers complementary to the sequences of cassettes included in the kit. As a result, an 1122 bp TaELO2 ORF upstream sequence (SEQ ID NO: 76) and a 1204 bp TaELO2 ORF downstream sequence (SEQ ID NO: 77) were successfully acquired.
[Comparative Example 1-5]: Construction of TaELO2 Targeting Vector with Neor as Selection Marker
(246) A DNA fragment in which TaELO2 ORF upstream sequence/artificially synthesized Neor/TaELO2 ORF downstream sequence were ligated and produced by fusion PCR. The oligonucleotide primers used were as shown below.
(247) TABLE-US-00002 KOProFSmaI (SEQIDNO:78) (31mer:5-CTCCCGGGTGGACCTAGCGCGTGTGTC ACCT-3) (SEQIDNO:79) ProR(25mer:5-GGTCGCGTTTACAAAGCAGCGCAG C-3) (SEQIDNO:80) SNeoF(52mer:5-GCTGCGCTGCTTTGTAAACGCGAC CATGATTGAACAGGACGGCCTTCACGCT-3) (SEQIDNO:81) SNeoR(52mer:5-TCGGGAGCCAGCCGGAAACAGGTT CAAAAGAACTCGTCCAGGAGGCGGTAGA-3) (SEQIDNO:82) TermF(23mer:5-ACCTGTTTCCGGCTGGCTCCC GA-3) (SEQIDNO:83) KOTermRSmaI(27mer:5-ATCCCGGGGCCGAGAACG GGGTCGCCC-3)
(248) Of these oligonucleotide primers, KO Pro F SmaI/Pro R were used in amplification of the TaELO2 ORF upstream sequence using the T. aureum ATCC 34304 genome DNA described in Comparative Example 1-4 as a template, SNeo F/SNeo R were used in amplification of artificially synthesized Neor using artificially synthesized Neor as a template, and Term F/KO Term R SmaI were used in amplification of the TaELO2 ORF downstream sequence using the T. aureum ATCC 34304 genome DNA described in Comparative Example 1-4 as a template. As PCR conditions, denaturation was performed at 98 C. for 10 sec, and annealing and the elongation reaction were performed while adjusting as appropriate according to Tm of the primers and the lengths of the amplification products.
(249) As a result, a 2696 bp (SEQ ID NO: 84) TaELO2 ORF upstream sequence/artificially synthesized Neor/TaELO2 ORF downstream sequence was successfully ligated. The result of TA cloning of this sequence using pGEM-T Easy Vector (available from Promega Corporation) was used as a disruption vector, and was named pTKONeor.
[Comparative Example 1-6]: Transfer of TKONeor into T. Aureum ATCC 34304
(250) Using, as a template, pTKONeor, which is the TaELO2 targeting vector with the artificially synthesized Neor as a selection marker produced in Comparative Example 1-5, TaELO2 ORF upstream sequence/artificially synthesized Neor/TaELO2 ORF downstream sequence was amplified using a pair of oligonucleotide primers KO Pro F SmaI (Comparative Example 1-5, SEQ ID NO: 78)/KO Term R SmaI (Comparative Example 1-5, SEQ ID NO: 83) and using PrimeSTAR (trade name) HS DNA Polymerase (available from Takara Bio Inc.). [PCR cycles: 98 C. 2 min/98 C. 10 sec, 68 C. 3 min, 30 cycles/68 C. 10 min/4 C.]. After electrophoresis using 1% agarose gel, the DNA fragments were extracted, and after ethanol precipitation, the extracted DNA were dissolved in an appropriate quantity of TE. The quantity and purity of the DNA fragments were tested by O.D. 260 and O.D. 280 measurement. The obtained DNA fragment is called TKONeor hereinafter.
(251) Next, the introduction of DNA was performed by the gene gun method. Specifically, the T. aureum ATCC 34304 strain was cultured at 25 C. at 150 rpm using a GY liquid culture medium, and cells of the middle to latter logarithmic growth phase were centrifuged for 10 min at 4 C. at 3500g, and the supernatant was removed. Then, the obtained cells were resuspended in a GY liquid culture medium so as to result in 100 times the concentration of the original culture solution. 20 L of this cell suspension was thinly spread uniformly and dried in a diameter of approximately 3 cm on PDA agar plate culture medium 5 cm in diameter containing 1 mg/mL of G418 (available from Nacalai Tesque, Inc.). Using a PDS-1000/He System (available from Bio-Rad Laboratories, Inc.), implantation was performed on under the conditions of target distance: 6 cm, vacuum: 26 inches Hg, microcarrier size: 0.6 m, rupture disk (implantation pressure): 1100 psi. After that, 100 L of PD liquid culture medium was added drop-wise to the PDA agar plate culture medium, and the cells were spread out again and static culturing was performed. As a result, transformants conferred with G418 resistance were obtained with efficiency of 4.710.sup.1 cfu/g DNA.
[Comparative Example 1-7]: PCR Using Genome DNA of Transformant in which TKONeor was Transformed as a Template
(252) Seven colonies of transformants were extracted with a toothpick, and were then inoculated in a GY liquid culture medium containing 0.5 mg/mL of G418 (available from Nacalai Tesque, Inc.). After subculturing multiple times, genome DNA was extracted from the cells by the method described in Comparative Example 1-4, and after ethanol precipitation, the extracted genome DNA was dissolved in an appropriate amount of TE. The quantity and purity of the extracted genome DNA were tested by O.D. 260 and O.D. 280 measurement. Then, with the obtained genome DNA of the obtained transformant and the wild-type as templates, PCR was performed using various oligonucleotide primer pairs. The used oligonucleotide primer pairs were as follows: (1) Neor detectionSneo F (described in Comparative Example 1-5, SEQ ID NO: 80) and SNeo R (described in Comparative Example 1-5, SEQ ID NO: 81); (2) KO confirmation 1KO Pro F SmaI (described in Comparative Example 1-5, SEQ ID NO: 78) and KO Term R SmaI (described in Comparative Example 1-5, SEQ ID NO: 83); (3) KO confirmation 2E2 KO ProF EcoRV (30mer: 5-GGA TAT CCC CCG CGA GGC GAT GGC TGC TCC-3) (SEQ ID NO: 85) and SNeo R (described in Comparative Example 1-5, SEQ ID NO: 81); (4) KO confirmation 3Sneo F (described in Comparative Example 1-5, SEQ ID NO: 80) and E2 KO Term R EcoRV (30mer: 5-TGA TAT CGG GCC GCG CCC TGG GCC GTA GAT-3) (SEQ ID NO: 86); (5) TaELO2 amplificationE2 HindIII (described in Comparative Example 1-3, SEQ ID NO: 72) and E2 XbaI (described in Comparative Example 1-3, SEQ ID NO: 73) (
(253) As a result, it was confirmed that six of the seven analyzed clones were transformants by random integration, but in one clone, TaELO2 ORF was substituted for Neor by homologous recombination (
[Comparative Example 1-8]: Confirmation of TaELO2 Copy Number by Southern Blotting
(254) The following experiment was conducted in accordance with the method described in DIG Manual [Japanese Edition]8th, Roche Applied Science (Non-patent Document 18). Specifically, wild-type genome DNA was cut with various restriction enzymes and then subjected to electrophoresis using 2.5 g of 0.7% SeaKem (trade name) GTG (trade name) agarose (available from Takara Bio Inc.) per lane. This was transformed to a nylon membrane (Hybond (trade name)-N+, available from GE Healthcare Inc.), and hybridized at 48 C. for 16 hr with a DIG labeled probe produced using PCR DIG Probe Synthesis Kit (available from Roche Applied Science, Inc.). The pair of oligonucleotide primers used in producing the DIG labeled probe were TaELO2 det F (25mer: 5-GTA CGT GCT CGG TGT GAT GCT GCT C-3) (SEQ ID NO: 87) and TaELO2 det R (24mer: 5-GCG GCG TCC GAA CAG GTA GAG CAT-3) (SEQ ID NO: 88). [PCR cycles: 98 C. 2 min/98 C. 30 sec, 65 C. 30 sec, 72 C. 1 min, 30 cycles/72 C. 7 min/4 C.]. The hybridized probes were detected using the color development method (NBT/BCIP solution).
(255) The results demonstrated that TaELO2 is a single copy gene from the fact that single bands were detected in all lanes treated with the various restriction enzymes (
[Comparative Example 1-9]: Evaluation by Southern Blotting of Transformant in which TKONeor was Transformed
(256) Southern blotting was performed by the method described in Comparative Example 1-8. Specifically, southern blotting was performed using the color development method (NBT/BCIP solution) relative to genome DNA of the transformant and a wild-type strain digested with EcoRV and PstI, using a DIG labeled probe amplified using the pair of oligonucleotide primers uprobe F (35mer: 5-ATC CGC GTA TAT ATC CGT AAA CAA CGG AAC ATT CT-3) (SEQ ID NO: 89) and uprobe R (26mer: 5-CTT CGG GTG GAT CAG CGA GCG ACA GC-3) (SEQ ID NO: 90). [PCR cycles: 98 C. 2 min/98 C. 30 sec, 65 C. 30 sec, 72 C. 1 min, 30 cycles/72 C. 7 min/4 C.]. In this case, in the wild-type allele, a DNA fragment of approximately 1.2 kbp was detected, but in the mutant allele in which TaELO2 ORF was substituted for Neor by homologous recombination, a DNA fragment of approximately 2.5 kbp was detected (
(257) The result of analysis shows that T. aureum ATCC 34304 is at least diploid, since the wild-type allele band was also detected at the same time as the mutant allele.
[Comparative Example 1-10]: Construction of TaELO2 Targeting Vector with Hygr as Selection Marker
(258) To disruption the remaining wild-type allele, a TaELO2 targeting vector with Hygr as a selection marker was constructed.
(259) First, a ubiquitin promoter sequence derived from T. aureum ATCC 34304 and Hygr were ligated by fusion PCR. The oligonucleotide primers used were as shown below.
(260) TABLE-US-00003 ubi-600pF (SEQIDNO:91) (27mer:5-GCCGCAGCGCCTGGTGCACCCGCCGGG-3) ubi-hygroR (SEQIDNO:92) (59mer:5-TCGCGGGTGAGTTCAGGCTTTTTCATGT TGGCTAGTGTTGCTTAGGTCGCTTGCTGCTG-3) ubi-hygroF (SEQIDNO:93) (57mer:5-AGCGACCTAAGCAACACTAGGCCAACAT GAAAAAGCCTGAACTCACCGCGACGTCTG-3) hygroR (SEQIDNO:94) (29mer:5-CTATTCCTTTGCCCTCGGACGAGTGCT GG-3)
(261) Of these oligonucleotide primers, ubi-600p F/ubi-hygro R were used in amplification of the T. aureum ATCC 34304-derived ubiquitin promoter sequence using the T. aureum ATCC 34304 genome DNA described in Comparative Example 1-4 as a template. Ubi-hygro F/hygro R were used in amplification of artificially synthesized Hygr using pcDNA 3.1 Zeo (available from Invitrogen Corp.) as a template. As PCR conditions, denaturation was performed at 98 C. for 10 sec, and annealing and the elongation reaction were performed while adjusting as appropriate according to Tm of the primers and the lengths of the amplification products.
(262) As a result, 1636 bp (SEQ ID NO: 95) of T. aureum ATCC 34304-derived ubiquitin promoter sequence/Hygr was successfully ligated. The result of TA cloning of this sequence using pGEM-T Easy Vector (available from Promega Corporation) was named pTub600Hygr.
(263) Then, using pTub600Hygr as a template, PCR was performed using a pair of oligonucleotide primers ubi-600p F NheI (33mer: 5-GTG CTA GCC GCA GCG CCT GGT GCA CCC GCC GGG-3) (SEQ ID NO: 96) and hygro R XbaI (37mer: 5-GTT CTA GAC TAT TCC TTT GCC CTC GGA CGA GTG CTG G-3) (SEQ ID NO: 97) and using PrimeSTAR HS DNA Polymerase (available from Takara Bio Inc.). [PCR cycles: 98 C. 2 min/98 C. 10 sec, 68 C. 3 min, 30 cycles/68 C. 10 min/4 C.]. As a result, a T. aureum ATCC 34304-derived ubiquitin promoter sequence/Hygr DNA fragment with NheI appended at the 5 terminal and an XbaI site appended at the 3 terminal was prepared. Furthermore, using pTKONeor described in Comparative Example 1-5 as a template, PCR was performed using a pair of oligonucleotide primers KO vec F XbaI (37mer: 5-GTT CTA GAC CTG TTT CCG GCT GGC TCC CGA GCC ATG C-3) (SEQ ID NO: 98) and KO vec R NheI (40mer: 5-GTG CTA GCG GTC GCG TTT ACA AAG CAG CGC AGC AAC AGA A-3) (SEQ ID NO: 99) and using PrimeSTAR HS DNA Polymerase (available from Takara Bio Inc.). [PCR cycles: 98 C. 2 min/98 C. 10 sec, 68 C. 3 min, 30 cycles/68 C. 10 min/4 C. ]. As a result, a linear vector in which Neor of pTKONeor described in Comparative Example 1-5 was removed and having NheI appended at the 3 terminal and an XbaI site appended at the 5 terminal was prepared. After the two DNA fragments were digested with NheI and XbaI, the DNA fragments were purified using agarose gel, and cyclic vectors were constructed using Ligation Convenience Kit (available from Nippon Gene Co., Ltd.).
(264) The constructed TaELO2 targeting vector having Hygr as a selection marker includes pGEM-T Easy Vector (available from Promega Corporation) as a basic framework, and as an insertion sequence, had a 3537 bp (SEQ ID NO: 100) TaELO2 ORF upstream sequence/T. aureum ATCC 34304-derived ubiquitin promoter sequence/Hygr/TaELO2 ORF downstream sequence. This was named pTKOub600Hygr.
[Comparative Example 1-11]: Evaluation of Transformant by PCR Using KOub600Hygr Retransfer and Genome DNA as Templates, Southern Blotting, and RT-PCR
(265) Using, as a template, pTKOub600Hygr (described in Comparative Example 1-10), which is the constructed TaELO2 targeting vector with Hygr as a selection marker, TaELO2 ORF upstream sequence/T. aureum ATCC 34304-derived ubiquitin promoter sequence/Hygr/TaELO2 ORF downstream sequence was amplified using a pair of oligonucleotide primers KO Pro F SmaI (Comparative Example 1-5, SEQ ID NO: 78)/KO Term R SmaI (Comparative Example 1-5, SEQ ID NO: 83) and using PrimeSTAR HS DNA Polymerase (available from Takara Bio Inc.). [PCR cycles: 98 C. 2 min/98 C. 10 sec, 68 C. 3.5 min, 30 cycles/68 C. 10 min/4 C.]. The obtained DNA fragment was named KOub600Hygr. This was transformed into the transformant obtained in Comparative Example 1-7 by the same technique, and after static culturing for 24 hr on PDA agar plate culture medium containing 1 mg/mL of G418 (available from Nacalai Tesque, Inc.), the cells were collected. The static culturing was continued on PDA agar plate culture medium containing 1 mg/mL of G418 (available from Nacalai Tesque, Inc.) and 2 mg/mL of hygromycin B (available from Wako Pure Chemical Industries, Ltd.) to obtain numerous transformants (transfer efficiency: 1.0210.sup.3 cfu/g DNA).
(266) Among them, 50 clones were extracted, and after subculturing multiple times in a GY liquid culture medium containing 1 mg/mL of G418 (available from Nacalai Tesque, Inc.) and 2 mg/mL of hygromycin B (available from Wako Pure Chemical Industries, Ltd.), genome DNA was extracted by the same technique as described in Comparative Example 1-4, and after ethanol precipitation, the extracted genome DNA was dissolved in an appropriate quantity of TE. The quantity and purity of the extracted genome DNA were tested by OD260 and OD280 measurement. Then, with the obtained transformant and wild-type genome DNA as templates, PCR was performed using various oligonucleotide primer pairs. [PCR cycles: 98 C. 2 min/98 C. 10 sec, 68 C. 1 min, 30 cycles/68 C. 10 min/4 C.]. The used oligonucleotide primer pairs were as follows: (1) TaELO2 ORF detectionSneo F (described in Comparative Example 1-5, SEQ ID NO: 80) and SNeo R (described in Comparative Example 1-5, SEQ ID NO: 81); (2) KO confirmationE2 KO Pro F EcoRV (described in Comparative Example 1-7, SEQ ID NO: 85) and ubi-hygro R (described in Comparative Example 1-10, SEQ ID NO: 92) (
(267) The results showed that of the 50 analyzed clones, 14 clones were transformants which caused homologous recombination in the form of substituting TaELO2 ORF (
(268) Then, southern blotting was performed using the technique described in Comparative Example 1-9. Specifically, southern blotting was performed by the color development method (NBT/BCIP solution) relative to genome DNA of the transformant and a wild-type strain digested with EcoRV and PstI, using a DIG labeled probe prepared using the pair of oligonucleotide primers uprobe F (SEQ ID NO: 89) and uprobe R (SEQ ID NO: 90). In this case, in the wild-type allele, a DNA fragment of approximately 1.2 kbp was detected; in the mutant allele in which TaELO2 ORF was substituted for Neor by homologous recombination, a DNA fragment of approximately 2.5 kbp was detected; in the mutant allele in which TaELO2 ORF was substituted for Hygr, a DNA fragment of approximately 1.9 kbp was detected (
(269) As a result of analysis, a band of the wild-type allele of approximately 2.5 kbp was disappeared, and instead, a band of the mutant allele of approximately 1.9 kbp in which TaELO2 ORF was substituted for Hygr was detected (
(270) Similarly, a DIG labeled probe that detects TaELO2 was prepared by PCR using the pair of oligonucleotide primers TaELO2 probe F (30mer: 5-ATG GCG ACG CGC ACC TCG AAG AGC GCT CCG-3) (SEQ ID NO: 101) and TaELO2 probe R (30mer: 5-AGG ATC ATC ATG AAC GTG TCG CTC CAG TCG-3) (SEQ ID NO: 102). [PCR cycles: 98 C. 2 min/98 C. 30 sec, 65 C. 30 sec, 72 C. 1 min, 30 cycles/72 C. 7 min/4 C.]. Southern blotting was performed by the color development method (NBT/BCIP solution) relative to genome DNA of transformants (clones 1, 8, 9, 10) and a wild-type strain digested with EcoRV. In this case, TaELO2 was detected as a DNA fragment of approximately 2.5 kbp (
(271) The result of analysis showed that TaELO2 was detected in the wild-type strain (
(272) Furthermore, to verify TaELO2 disruption at an mRNA level, TaELO2 mRNA was detected by RT-PCR. From the cells of the transformant (clones 1, 8, 9, 10) and the wild-type strain on the third day of culturing using a GY liquid culture medium, total RNA was extracted using Sepasol-RNA I Super (available from Nacalai Tesque, Inc.) in the same manner as Comparative Example 1-1. Then, 50 g of total RNA cleaned up using RNeasy Mini Kit (available from QIAGEN N.V.) according to the manufacturer's protocol was treated for 1 hr at 37 C. using 50 U of Recombinant DNase I (available from Takara Bio Inc.), and contaminated genome DNA was decomposed and removed. Then, using the obtained total RNA as a template, a single-strand cDNA library was prepared according to manufacturer's instructions using oligo (dT) primer (available from Novagen Corp.) and PrimeScript Reverse Transcriptase (available from Takara Bio Inc.). Additionally, using the obtained single-strand cDNA library as a template, TaELO2 ORF was amplified using a pair of oligonucleotide primers E2 HindIII (described in Comparative Example 1-3, SEQ ID NO: 72) and E2 XbaI (described in Comparative Example 1-3, SEQ ID NO: 73) and using LA Taq Hot Start Version (available from Takara Bio Inc.). [PCR cycles: 98 C. 2 min/98 C. 10 sec, 68 C. 1 min, 30 cycles/68 C. 10 min/4 C.].
(273) The result showed that TaELO2 mRNA was detected in the wild-type strain (
(274) The above results showed that a TaELO2 deletion homozygote in which TaELO2 had been completely disrupted was successfully obtained. The above results demonstrate that T. aureum ATCC 34304 is diploid.
[Comparative Example 1-12]: Comparison of Fatty Acid Compositions of Wild-Type Strain and TaELO2 Deletion Homozygote
(275) The fatty acid compositions of the TaELO2 deletion homozygote obtained in Comparative Example 1-11 and the wild-type strain were compared by GC analysis of the methyl-esterified fatty acids. Specifically, the cells of the wild-type strain and the TaELO2 deletion homozygote after 5 days of culturing in a GY liquid culture medium were collected. The fungus body-derived fatty acids were extracted and methyl-esterified by the method described in Comparative Example 1-3, and GC analysis was performed. In GC analysis, measurement was performed using a gas chromatograph GC-2014 (available from Shimadzu Corporation) under the following conditions. Column: HR-SS-10 (30 m0.25 mm; available from Shinwa Chemical Industries Ltd.); column temperature: 150 C..fwdarw.(5 C./min).fwdarw.220 C. (10 min); carrier gas: He (1.3 mL/min).
(276) As a result, the quantity of EPA serving as a substrate of TaELO2 increased up to approximately 2-fold in the TaELO2 deletion homozygote (TaELO2 KO) compared to the wild-type strain (Wild type), and a decrease in the amount of the downstream metabolite DHA was observed (
(277) As described above, it was confirmed that due to C20 elongase gene disruption in T. aureum ATCC 34304, similar to genus Parietichytrium labyrinthulids, the quantity of the C20 elongase substrate EPA increased compared to the wild-type strain, and conversely, the downstream metabolite DHA and the like decreased. However, unlike the genus Parietichytrium labyrinthulids, the proportion of DHA did not really decrease in T. aureum ATCC 34304 even when the C20 elongase gene was disrupted. Specifically, the proportion of DHA in the wild-type strain was 54.38%, whereas the proportion of DHA was 48.77%, which is only slightly less in the C20 elongase gene KO strain. A similar trend was seen for n-6 DPA as well.
(278) As described in Comparative Example 1-2, in T. aureum ATCC 34304, TaELO1 is present in addition to TaELO2, which was disrupted this time. In Comparative Example 1-3, it was shown that both have A5 elongase activity (C20 elongase activity). However, it was also clear that the A5 elongase activity of TaELO1 is considerably lower than the A5 elongase activity of TaELO2, and the reason that DHA and n-6 DPA did not really decrease in the TaELO2 deletion homozygote (TaELO2 KO) is difficult to explain by the A5 elongase activity (=C20 elongase activity) of TaELO1. This suggests the possibility that in Thraustochytrium aureum ATCC 34304, DHA and n-6 DPA are produced via another biosynthesis pathway in addition to the elongase-desaturase pathway.
(279) When such a labyrinthulid is selected, unlike Examples 2, 4, and 6, it is not possible to create a strain which accumulates PUFAs other than DHA and n-6 DPA even by disruption the C20 elongase gene. Therefore, creating such a strain requires disruption of a gene associated with a DHA and n-6 DPA biosynthesis pathway other than the elongase-desaturase pathway.
Comparative Example 2
(280) [Measurement of Fatty Acid Composition of Lipids Produced by PUFA-PKS Gene Disruption and Transformation Strain of Thraustochytrium aureum ATCC 34304]
[Comparative Example 2-1]: PUFA-PKS Pathway Associated Gene: OrfA Upstream Sequence Cloning
(281) After genome DNA was extracted from Thraustochytrium aureum ATCC 34304 by the method described in Example 2-2, A260/280 was measured and the DNA concentration was calculated. Using this extracted genome DNA, a genome cassette library was produced using LA PCR (trade name) in vitro Cloning Kit (available from Takara Bio Inc.). A PCR lower primer [RHO20: 23mer: 5-CGA TGA AAG GTC ACA GAA GAG TC-3 (SEQ ID NO: 103)] was set on the PUFA-PKS pathway associated gene: OrfA described in Patent Document 4, and DNA was amplified by combining with the cassette primers contained in the above kit. [1st PCR cycles: 98 C. 2 min/98 C. 30 sec, 56 C. 30 sec, 72 C. 4 min, 30 cycles/72 C. 5 min]. Then, the 1st PCR amplification product was diluted 100-fold, and the DNA was amplified by combining the PCR lower primer [RHO20] and the nested primers contained in the above kit. [2nd PCR cycles: 98 C. 2 min/98 C. 30 sec, 56 C. 30 sec, 72 C. 4 min, 30 cycles/72 C. 5 min]. The obtained DNA fragment was cloned in pGEM-T Easy Vector, and after amplification with E. coli, the sequence was confirmed using a Dye Terminator Cycle Sequencing Kit (available from Beckman Coulter Inc.).
(282) A DNA fragment of 3377 bp (SEQ ID NO: 105) containing 3181 bp (SEQ ID NO: 104) upstream of OrfA was cloned. It became clear that the OrfA upstream DNA sequence information was a total of 3181 bp.
[Comparative Example 2-2]: PUFA-PKS Pathway Associated Gene: OrfA Downstream Sequence Cloning
(283) The genome cassette library produced in Comparative Example 2-1 was used as a template. A PCR upper primer [RHO21: 21mer: 5-CAG GGC GAG CGA GTG TGG TTC-3 (SEQ ID NO: 106)] was set on the PUFA-PKS pathway associated gene: OrfA described in Patent Document 4, and DNA was amplified by the method described in Comparative Example 2-1. The obtained DNA fragment was cloned in pGEM-T Easy Vector, and after amplification with E. coli, the sequence was confirmed using a Dye Terminator Cycle Sequencing Kit (available from Beckman Coulter Inc.). A DNA fragment of 1204 bp (SEQ ID NO: 108) containing 1160 bp (SEQ ID NO: 107) downstream of OrfA was cloned.
(284) A PCR upper primer [RHO28: 20mer: 5-TGA TGC CGA TGC TAC AAA AG-3 (SEQ ID NO: 109)] was again produced on SEQ ID NO: 94, and DNA was amplified by the method described in Comparative Example 1-2. The obtained DNA fragment was cloned in pGEM-T Easy Vector, and after amplification with E. coli, the sequence was confirmed using a Dye Terminator Cycle Sequencing Kit (available from Beckman Coulter Inc.).
(285) Furthermore, a 1488 bp DNA fragment (SEQ ID NO: 110) containing the downstream sequence was cloned. It became clear that the OrfA downstream DNA sequence information is a total of 2551 bp (SEQ ID NO: 111).
[Comparative Example 2-3]: Production of PUFA-PKS Pathway Associated Gene: OrfA Targeting Vector
(286) Using Thraustochytrium aureum ATCC 34304 genome DNA as a template, an 18S rDNA sequence (1835 bp, SEQ ID NO: 112) was amplified with PrimeSTAR HS DNA Polymerase (available from Takara Bio Inc.). The PCR primers used were as shown below. TMO30 was set on the 18S rDNA sequence. TMO31 includes the 18S rDNA sequence and the EF1 promoter sequence. [TMO30: 30mer: 5-CGAATA TTC CTG GTT GAT CCT GCC AGT AGT-3 (SEQ ID NO: 113), TMO31: 46mer: 5-GTAACG GCT TTT TTT GAA TTG CAG GTT CAC TAC GCT TGT TAG AAA C-3 (SEQ ID NO: 114)]. [PCR cycles: 98 C. 10 sec/98 C. 10 sec, 58 C. 30 sec, 72 C. 2 min, 30 cycles/72 C. 2 min].
(287) Furthermore, using Thraustochytrium aureum ATCC 34304 genome DNA as a template, an EF1 promoter sequence (661 bp, SEQ ID NO: 115) was amplified with PrimeSTAR HS DNA Polymerase (available from Takara Bio Inc.). The PCR primers used were as shown below. TMO32 includes the 18S rDNA sequence and the EF1 promoter sequence. TMO33 includes the EF1 promoter sequence and an artificially synthesized neomycin resistance gene sequence. [TMO32: 46mer: 5-GGT TTC CGT AGT GAA CCT GCAATT CAA AAA AAG CCG TTA CTC ACA T-3 (SEQ ID NO: 116), TMO33: 46mer: 5-GCG TGA AGG CCG TCC TGT TCA ATC ATC TAG CCT TCC TTT GCC GCT G-3 (SEQ ID NO: 117)]. [PCR cycles: 98 C. 10 sec/98 C. 10 sec, 58 C. 30 sec, 72 C. 1 min, 30 cycles/72 C. 1 min].
(288) Using the artificially synthesized neomycin resistance gene sequence as a template, an artificially synthesized neomycin resistance gene sequence (835 bp, SEQ ID NO: 118) was amplified with PrimeSTAR HS DNA Polymerase (available from Takara Bio Inc.). The PCR primers used were as shown below. TMO34 includes the EF1 promoter sequence and the artificially synthesized neomycin resistance gene sequence. TMO35 includes the artificially synthesized neomycin resistance gene sequence and the EF1 terminator sequence. [TMO34: 45mer: 5-CAT CGG CAA AGG AAG GCT AGA TGA TTG AAC AGG ACG GCC TTC ACG-3 (SEQ ID NO: 119), TMO35: 46mer: 5-GCG CAT AGC CGG CGC GGA TCT CAA AAG AAC TCG TCC AGG AGG CGG T-3 (SEQ ID NO: 120)]. [PCR cycles: 98 C. 10 sec/98 C. 10 sec, 58 C. 30 sec, 72 C. 1 min, 30 cycles/72 C. 1 min].
(289) Using Thraustochytrium aureum ATCC 34304 genome DNA as a template, an EF1 terminator sequence (1249 bp, SEQ ID NO: 121) was amplified with PrimeSTAR HS DNA Polymerase (available from Takara Bio Inc.). The PCR primers used were as shown below. TMO36 includes the artificially synthesized neomycin resistance gene sequence and the EF1 terminator sequence. TMO37 was set within the EF1 terminator. [TMO36: 46mer: 5-TCC TGG ACG AGT TCT TTT GAG ATC CGC GCC GGC TAT GCG CCC GTG C-3 (SEQ ID NO: 122), TMO37: 30mer: 5-CAC TGC AGC GAA AGA CGG GCC GTA AGG ACG-3 (SEQ ID NO: 123)]. [PCR cycles: 98 C. 10 sec/98 C. 10 sec, 58 C. 30 sec, 72 C. 2 min, 30 cycles/72 C. 2 min].
(290) Using SEQ ID NOS: 112, 115, 118, and 121 as templates, fusion PCR was performed according to the method described in Non-patent Document 9. LA Taq Hot Start Version (available from Takara Bio Inc.) was used for the enzymes. In the first amplification, the set of TMO30 (SEQ ID NO: 113) and TMO33 (SEQ ID NO: 117) and the set of TMO34 (SEQ ID NO: 119) and TMO37 (SEQ ID NO: 123) were used. In the second amplification, the set of TMO30 (SEQ ID NO: 113) and TMO37 (SEQ ID NO: 123) was used. As conditions of the PCR reaction, denaturation was performed at 98 C. for 10 sec, and annealing and the elongation reaction were performed while adjusting as appropriate according to Tm of the primers and the lengths of the amplification fragments (
(291) The DNA fragment ligated in this manner (
(292) Using Thraustochytrium aureum ATCC 34304 genome DNA as a template, the PCR primers were set in the upstream sequence clarified in Comparative Example 2-1 (SEQ ID NO: 104) and the PUFA-PKS pathway associated gene: OrfA described in Patent Document 4, and DNA was amplified with PrimeSTAR HS DNA Polymerase with GC Buffer (available from Takara Bio Inc.). A 1218 bp DNA fragment (SEQ ID NO: 125) was obtained by this amplification. This was used as the 5 homologous region of the targeting vector. The PCR primers used are as shown below. As a linker sequence, an EcoRI site or a HindIII site was appended to each. [RHO33: 32mer: 5-CCC GAA TTC GGA CGA TGA CTG ACT GAC TGA TT-3 (SEQ ID NO: 126), RHO34: 28mer: 5-CCC AAG CTT GTC TGC CTC GGC TCT TGG T-3 (SEQ ID NO: 127)]. [PCR cycles: 98 C. 2 min/98 C. 30 sec, 57 C. 30 sec, 72 C. 1 min, 30 cycles/72 C. 3 min].
(293) Using Thraustochytrium aureum ATCC 34304 genome DNA as a template, the PCR primers were set in the downstream sequence clarified in Comparative Example 2-2 (SEQ ID NO: 111), and DNA was amplified with PrimeSTAR HS DNA Polymerase with GC Buffer (available from Takara Bio Inc.). A 1000 bp DNA fragment (SEQ ID NO: 128) was obtained by this amplification. This was used as the 3 homologous region of the targeting vector. The PCR primers used were as shown below. An NcoI site as a linker sequence was appended to each. [RHO29: 28mer: 5-CCC CCA TGG TGT TGC TGT GGG ATT GGT C-3 (SEQ ID NO: 129), RHO30: 30mer: 5-CCC CCA TGG CTC GGT TAC ATC TCT GAG GAA-3 (SEQ ID NO: 130)]. [PCR cycles: 98 C. 2 min/98 C. 30 sec, 57 C. 30 sec, 72 C. 1 min, 30 cycles/72 C. 3 min].
(294) The amplified upstream sequence was ligated to the EcoRI site and the HindIII site in pRH5 illustrated in
(295) The targeting vector (pRH21) obtained using the produced artificially synthesized neomycin resistance gene is illustrated in
[Comparative Example 2-4]: Production of PUFA-PKS Pathway Associated Gene: OrfA Targeting Vector (Hygromycin Resistance Gene)
(296) Using pRH32 (
(297) The amplified fragment was ligated to the HindIII and SphI sites of pRH21 (
(298) Using Thraustochytrium aureum ATCC 34304 genome DNA as a template, the DNA was amplified with PrimeSTAR HS DNA Polymerase with GC Buffer (available from Takara Bio Inc.) using the produced PCR primers in the downstream sequence (SEQ ID NO: 111) clarified in Comparative Example 2-2. A 1000 bp DNA fragment (SEQ ID NO: 134) was obtained by this amplification. This was used as the 3 homologous region of the targeting vector. The PCR primers used were as shown below. A SalI site as a linker sequence was also appended. [RHO61: 29mer: 5-CCC GTC GAC GTG TTG CTG TGG GAT TGG TC-3 (SEQ ID NO: 135), RHO62: 29mer: 5-CCC GTC GAC TCG GTT ACA TCT CTG AGG AA-3 (SEQ ID NO: 136)]. [PCR cycles: 98 C. 2 min/98 C. 30 sec, 57 C. 30 sec, 72 C. 1 min, 30 cycles/72 C. 3 min].
(299) The amplified downstream sequence was ligated to the SalI site of pRH30 (
[Comparative Example 2-5]: PUFA-PKS Pathway Associated Gene: OrfA Targeting Vector Transfer
(300) Using the targeting vectors produced in Comparative Examples 2-3 and 2-4 as templates, the genes were amplified with PrimeSTAR Max DNA Polymerase (available from Takara Bio Inc.) using RHO30 (described in Comparative Example 2-3, SEQ ID NO: 130) and RHO33 (described in Comparative Example 2-3, SEQ ID NO: 126) as primers. [PCR cycles: 98 C. 2 min/98 C. 30 sec, 60 C. 30 sec, 72 C. 1 min, 30 cycles/72 C. 3 min]. After phenol chloroform extraction and chloroform extraction, the DNA underwent ethanol precipitation, and the precipitate was dissolved in 0.1TE. A260/280 was measured and the DNA concentration was calculated. The transfer fragment obtained when pRH21 (
(301) The Thraustochytrium aureum ATCC 34304 strain was cultured for 4 days in a GY culture medium, and cells in the logarithmic growth phase were used in gene transfer. To cells corresponding to OD600=1 to 1.5, 0.625 g of DNA fragment was transformed by the gene gun method (microcarrier: 0.6 micron gold particles, target distance: 6 cm, chamber vacuum: 26 mmHg, rupture disk: 1100 psi). After a recovery time of 4 to 6 hr, the transgenic cells were spread on a PDA agar plate culture medium (containing 2 mg/mL of G418 or containing 2 mg/mL of hygromycin). As a result, from 100 to 200 cells of drug resistant strain per shot were obtained.
[Comparative Example 2-6]: Identification of PUFA-PKS Pathway Associated Gene: OrfA Gene Targeting Homologous Recombinant
(302) After genome DNA was extracted from Thraustochytrium aureum ATCC 34304 and a hetero homologous recombinant and homo homologous recombinant (PKS pathway associated gene disruption strain) by the method described in Example 2-2, A260/280 was measured and the DNA concentration was calculated.
(303) After the genome DNA was cut with a restriction enzyme, the obtained genome DNA underwent electrophoresis in approximately 2 to 3 g per well of 0.7% SeaKem GTG agarose gel (available from Takara Bio Inc.). This was transformed to a nylon membrane, and hybridized at 54 C. for 16 hr with a probe produced using DIG System (available from Roche Applied Science, Inc.). The primers used in probe production were as follows. 5 side [RHO37: 22mer: 5-GAA GCG TCC CGT AGA TGT GGT C-3 (SEQ ID NO: 139), RHO38: 21mer: 5-GCC CGA GAG GTC AAA GTA CGC-3 (SEQ ID NO: 140)]; 3 side [RHO39: 20mer: 5-GCG AGC CCA GGT CCA CTT GC-3 (SEQ ID NO: 141), RHO40: 22mer: 5-CAG CCC GAT GAA AAA CTT GGT C-3 (SEQ ID NO: 142)]. [PCR cycles: 98 C. 2 min/98 C. 30 sec, 60 C. 30 sec, 72 C. 2 min, 30 cycles/72 C. 3 min]. The positions of the restriction enzymes and the probes used are illustrated in
(304) In analysis of both the 5 side and the 3 side, bands were observed at the expected sizes when the drug resistance genes caused homologous recombination (
Comparative Example 2-7
(305) Thraustochytrium aureum ATCC 34304 and the gene disruption strain were cultured according to the method described in Example 2-9, and after freeze drying, the fatty acids were methyl-esterified and analyzed using GC.
(306) The changes in the fatty acid composition are shown in
(307) As a result, when the PUFA-PKS pathway associated gene: OrfA was disrupted in Thraustochytrium aureum, DPA (C22:5n-6) exhibited an increasing trend and DHA (C22:6n-3) exhibited a decreasing trend.
(308) It is known that in the genus Schizochytrium and genus Aurantiochytrium, exogenous PUFAs become necessary when a PUFA-PKS pathway gene is disrupted, and breeding is not possible unless exogenous PUFAs are supplied (Non-patent Document 4). Unlike these organisms, however, Thraustochytrium aureum ATCC 34304 can be cultured without supplementing the culture medium with exogenous PUFAs when a PUFA-PKS pathway associated gene is disrupted. Furthermore, disruption of a PUFA-PKS pathway associated gene, decreased DHA only to approximately and slightly increased DPA (C22:5n-6) compared to the wild-type strain.
(309) The above results suggest the possibility that DHA and n-6 DPA are produced via another biosynthesis pathway in addition to the PUFA-PKS pathway in Thraustochytrium aureum ATCC 34304. The reason that Thraustochytrium aureum ATCC 34304 can be cultured without supplementing the culture medium with exogenous PUFAs is surmised to be that endogenous PUFAs are supplied via a biosynthesis pathway other than the PUFA-PKS pathway.
Comparative Example 3
(310) [Measurement of Fatty Acid Composition of Lipids Produced by PUFA-PKS Gene and C20 Elongase Gene Disruption and Transformation Strain of Thraustochytrium aureum ATCC 34304]
[Comparative Example 3-1]: Cloning of Upstream Sequence of Thraustochytrium aureum C20 Elongase Gene
(311) The genome cassette library produced in Comparative Example 2-1 was used as a template. A PCR lower primer [RHO71: 22mer: 5-GGG AGC GCA GGG AAA ACG GTC T-3 (SEQ ID NO: 143)] was produced on the C20 elongase gene upstream sequence (SEQ ID NO: 76) described in Comparative Example 1-4, and the gene was amplified by combining with the cassette primers contained in the kit described in Comparative Example 2-1. [1st PCR cycles: 98 C. 2 min/98 C. 30 sec, 56 C. 30 sec, 72 C. 4 min, 30 cycles/72 C. 5 min]. Then, the 1st PCR amplification product was diluted 100-fold, and the gene was amplified by combining a PCR lower primer [RHO72: 20mer: 5-CCA GCC CAC GTC GTC GGA GC-3 (SEQ ID NO: 144)] and the nested primers contained in the kit described in Comparative Example 2-1. [2nd PCR cycles: 98 C. 2 min/98 C. 30 sec, 56 C. 30 sec, 72 C. 4 min, 30 cycles/72 C. 5 min]. The obtained DNA fragment was cloned in pGEM-T Easy Vector, and after amplification with E. coli, the sequence was confirmed using a Dye Terminator Cycle Sequencing Kit (available from Beckman Coulter Inc.).
(312) A 2297 bp DNA fragment (SEQ ID NO: 145) containing the 3277 bp to 981 bp region upstream of the C20 elongase gene was cloned.
[Comparative Example 3-2]: Cloning of Downstream Sequence of C20 Elongase Gene
(313) The genome cassette library produced in Comparative Example 2-1 was used as a template. A PCR upper primer [RHO87: 23mer: 5-GCC GCT CAT GCC CAC GCT CAA AC-3 (SEQ ID NO: 146)] was produced on the C20 elongase gene downstream sequence (SEQ ID NO: 77) described in Comparative Example 1-4, and the gene was amplified by combining with the cassette primers contained in the kit described in Comparative Example 2-1. [1st PCR cycles: 98 C. 2 min/98 C. 30 sec, 56 C. 30 sec, 72 C. 4 min, 30 cycles/72 C. 5 min]. Then, the 1st PCR amplification product was diluted 100-fold, and the gene was amplified by combining a PCR lower primer [RHO73: 23mer: 5-CTT TCG GCT GCC AGG AAT CTA CG-3 (SEQ ID NO: 147)] and the nested primers contained in the kit described in Comparative Example 2-1. [2nd PCR cycles: 98 C. 2 min/98 C. 30 sec, 56 C. 30 sec, 72 C. 4 min, 30 cycles/72 C. 5 min]. The obtained DNA fragment was cloned in pGEM-T Easy Vector, and after amplification with E. coli, the sequence was confirmed using a Dye Terminator Cycle Sequencing Kit (available from Beckman Coulter Inc.).
(314) A 2189 bp DNA fragment (SEQ ID NO: 148) containing the 1106 bp to 3294 bp region downstream of the C20 elongase gene was cloned.
[Comparative Example 3-3]: Production of Blasticidin Resistance Gene Cassette
(315) Using genome DNA from Thraustochytrium aureum ATCC 34304 as a template, an ubiquitin promoter sequence (618 bp, SEQ ID NO: 149) was amplified with PrimeSTAR HS DNA Polymerase with GC Buffer (available from Takara Bio Inc.). The PCR primers used were as shown below. RHO53 was set on the ubiquitin promoter sequence, and includes a BglII linker sequence (Example 2-2, SEQ ID NO: 5). RHO48 includes the ubiquitin promoter sequence and a blasticidin resistance gene sequence. [RHO48: 58mer: 5-CTT CTT GAG ACA AAG GCT TGG CCA TGT TGG CTA GTG TTG CTT AGG TCG CTT GCT GCT G-3) (SEQ ID NO: 150)]. [PCR cycles: 98 C. 2 min/98 C. 10 sec, 68 C. 1 min, 30 cycles/68 C. 1 min].
(316) Using pTracer-CMV/Bsd/lacZ (available from Invitrogen Corp.) as a template, a blasticidin resistance gene (432 bp, SEQ ID NO: 151) was amplified with PrimeSTAR HS DNA Polymerase with GC Buffer. The PCR primers used were as shown below. RHO47 includes the ubiquitin promoter sequence and the blasticidin resistance gene sequence. RHO49 includes the blasticidin resistance gene sequence and has a BglII linker sequence. [RHO47: 54mer: 5-AGC GAC CTA AGC AAC ACT AGC CAA CAT GGC CAA GCC TTT GTC TCA AGA AGA ATC-3 (SEQ ID NO: 152), RHO49: 38mer: 5-CCC AGA TCT TAG CCC TCC CAC ACA TAA CCA GAG GGC AG-3 (SEQ ID NO: 153)]. [PCR cycles: 98 C. 2 min/98 C. 10 sec, 68 C. 1 min, 30 cycles/68 C. 1 min].
(317) Using SEQ ID NOS: 149 and 151 as templates, fusion PCR was performed using RHO53 (described in Example 2-2, SEQ ID NO: 5) and RHO49 (SEQ ID NO: 153) according to the method described in Non-patent Document 9. Amplification was performed using LA Taq Hot Start Version (available from Takara Bio Inc.) as the enzyme under the following conditions, and then the amplified product was digested with BglII. [PCR cycles: 94 C. 2 min/94 C. 20 sec, 55 C. 30 sec, 68 C. 1 min, 30 cycles/68 C. 1 min (1 C./10 sec from 55 C. to 68 C.)]. (
(318) The Thraustochytrium aureum ATCC 34304-derived ubiquitin promoter -pTracer-CMV/Bsd/lacZ-derived blasticidin resistance gene sequence (1000 bp, SEQ ID NO: 154) fused as described above was digested with BglII, and the resultant was bound to the BamHI site of pRH27 (
(319) The produced blasticidin resistance gene cassette (pRH38) is illustrated in
[Comparative Example 3-4]: Production of GFP Fusion Zeocin Resistance Gene Cassette
(320) Using genome DNA from Thraustochytrium aureum ATCC 34304 as a template, a ubiquitin promoter sequence (812 bp, SEQ ID NO: 155) was amplified with PrimeSTAR HS DNA Polymerase with GC Buffer (available from Takara Bio Inc.). The PCR primers used were as shown below. TMO38 was set on the ubiquitin promoter sequence. TMO39 includes the ubiquitin promoter sequence and an enhanced GFP gene sequence. [TMO38: 29mer: 5-TCG GTA CCC GTT AGA ACG CGT AAT ACG AC-3 (SEQ ID NO: 156), TMO39: 41mer: 5-TCC TCG CCC TTG CTC ACC ATG TTG GCT AGT GTT GCT TAG GT-3 (SEQ ID NO: 157)]. [PCR cycles: 98 C. 10 sec/98 C. 10 sec, 58 C. 30 sec, 72 C. 1 min, 30 cycles/72 C. 1 min].
(321) Using an enhanced GFP gene sequence (available from Clontech Laboratories, Inc.) as a template, the enhanced GFP gene sequence (748 bp, SEQ ID NO: 158) was amplified with PrimeSTAR HS DNA Polymerase (available from Takara Bio Inc.). The PCR primers used were as shown below. TMO40 includes the ubiquitin promoter sequence and the enhanced GFP gene sequence. RHO91 includes the enhanced GFP sequence and a zeocin resistance gene sequence. [TMO40: 41mer: 5-ACC TAA GCA ACA CTA GCC AAC ATG GTG AGC AAG GGC GAG GA-3 (SEQ ID NO: 159), RHO91: 58mer: 5-GAACGGCAC TGGTCAACTTGGCGTCCATGC CGAGAGTGATCC CGG CGG CGG TCA CGA A-3 (SEQ ID NO: 160)]. [PCR cycles: 98 C. 10 sec/98 C. 10 sec, 58 C. 30 sec, 72 C. 2 min, 30 cycles/72 C. 2 min].
(322) Using SEQ ID NOS: 156 and 158 as templates, fusion PCR was performed by LA Taq Hot Start Version (available from Takara Bio Inc.) according to the method described in Non-patent Document 9. TMO38 (SEQ ID NO: 156) and RHO91 (SEQ ID NO: 160) were used as primers, and the conditions were as follows: PCR cycles: 94 C. 2 min/94 C. 20 sec, 55 C. 30 sec, 68 C. 2 min, 30 cycles/68 C. 2 min (1 C./10 sec from 55 C. to 68 C.) (
(323) Using SEQ ID NO: 161 as a template, the ubiquitin promoter sequenceenhanced GFP gene sequence (1319 bp, SEQ ID NO: 162) was amplified with PrimeSTAR HS DNA Polymerase (available from Takara Bio Inc.). The primers used were as follows. RHO53 (Example 2-2, SEQ ID NO: 5) contains the ubiquitin promoter sequence and has a BglII site. RHO91 (SEQ ID NO: 160) includes the enhanced GFP sequence and a zeocin resistance gene sequence. [PCR cycles: 98 C. 2 min/98 C. 10 sec, 68 C. 2 min, 30 cycles/68 C. 2 min].
(324) Using pcDNA 3.1 Zeo(+) as a template, a zeocin resistance gene sequence (408 bp, SEQ ID NO: 163) was amplified with PrimeSTAR HS DNA Polymerase (available from Takara Bio Inc.). RHO92 includes the enhanced GFP sequence and a zeocin resistance gene sequence. RHO64 contains the zeocin resistance gene sequence and has a BglII site. [RHO92: 54mer: 5-CGC CGC CGG GAT CAC TCT CGG CAT GGA CGC CAA GTT GAC CAG TGC CGT TCC GGT-3 (SEQ ID NO: 164), RHO64: 38mer: 5-CCC AGA TCT CAG TCC TGC TCC TCG GCC ACG AAG TGC AC-3 (SEQ ID NO: 165)]. [PCR cycles: 98 C. 2 min/98 C. 10 sec, 68 C. 1 min, 30 cycles/68 C. 1 min].
(325) Using SEQ ID NOS: 162 and 163 as templates, fusion PCR was performed by LA Taq Hot Start Version (available from Takara Bio Inc.) according to the method described in Non-patent Document 9. RHO53 (Example 2-2, SEQ ID NO: 5) and RHO64 (SEQ ID NO: 165) were used as primers, and the conditions were as follows: PCR cycles: 94 C. 2 min/94 C. 20 sec, 68 C. 2 min, 30 cycles/68 C. 2 min (1 C./10 sec from 55 C. to 68 C.) (
(326) The Thraustochytrium aureum ATCC 34304-derived ubiquitin promoter enhanced GFP genepcDNA 3.1 Zeo(+)-derived zeocin resistance gene (
(327) The produced GFP fusion zeocin resistance gene cassette (pRH51) is illustrated in
[Comparative Example 3-5]: Production of Plasmid Serving as Base for Production of C20 Elongase Gene Targeting Vector
(328) Using Thraustochytrium aureum ATCC 34304 genome DNA as a template, a C20 elongase gene and its surrounding sequence were amplified with PCR by PrimeSTAR HS DNA Polymerase (available from Takara Bio Inc.) (2884 bp, SEQ ID NO: 167). The PCR primers used were as follows. Both primers contained an EcoI linker sequence. KS09 was set in the C20 elongase gene upstream (SEQ ID NO: 76), and KSO10 was set in the C20 elongase gene downstream (SEQ ID NO: 77). [KSO9: 50mer: 5-CCC GAA TTC ACT AGT GAT TCT CCC GGG TGG ACC TAG CGC GTG TGT CAC CT-3 (SEQ ID NO: 168), KSO10: 40mer: 5-CCC GAA TTC GAT TAT CCC GGG GCC GAG AAC GGG GTC GCC C-3 (SEQ ID NO: 169)]. [PCR cycles: 98 C. 2 min/98 C. 10 sec, 68 C. 3.5 min, 30 cycles/68 C. 10 min]. PrimeSTAR HS DNA Polymerase (available from Takara Bio Inc.) was used for the enzymes, and after amplification, the amplified products were digested with EcoRI, and then cloned at the vector EcoRI site of pBlueScript (SK) (available from Stratagene Corp.). After amplification with E. coli, the sequence was confirmed using a Dye Terminator Cycle Sequencing Kit (available from Beckman Coulter Inc.) (
(329) A primer set that was set up in the reverse direction with the objective of deleting a portion of the C20 elongase gene sequence and inserting a BglII site (1939 bp, SEQ ID NO: 170) was prepared using the plasmid illustrated in
(330) The produced plasmid (pRH40) serving as a base for production of a C20 elongase gene targeting vector is illustrated in
[Comparative Example 3-6]: Production of Targeting Vectors (Blasticidin Resistance Gene and GFP Fusion Zeocin Resistance Gene)
(331) pRH38 (
(332) pRH51 (
(333) The two produced targeting vectors (pRH43 and 54) are illustrated in
[Comparative Example 3-7]: Transfer of C20 Elongase Gene Targeting Vectors into Thraustochytrium aureum OrfA Disruption Strain
(334) Using the two targeting vectors produced in Comparative Example 3-6 as templates, the genes were amplified with PrimeSTAR Max DNA Polymerase (available from Takara Bio Inc.) using KSO11 and KS012 as primers. KSO11 was set upstream of the Thraustochytrium aureum C20 elongase gene, and KS012 was set downstream of the Thraustochytrium aureum C20 elongase gene. [KSO11: 31mer: 5-CTC CCG GGT GGA CCT AGC GCG TGT GTC ACC T-3 (SEQ ID NO: 173), KSO12: 27mer: 5-ATC CCG GGG CCG AGA ACG CCC TCG CCC-3 (SEQ ID NO: 174)]. [PCR cycles: 98 C. 2 min/98 C. 30 sec, 68 C. 2 min, 30 cycles/68 C. 2 min]. After phenol chloroform extraction and chloroform extraction, the DNA underwent ethanol precipitation, and the precipitate was dissolved in 0.1TE. A260/280 was measured and the DNA concentration was calculated. The transfer fragment obtained when pRH43 (
(335) The PUFA-PKS pathway associated gene: OrfA gene disruption strain described in Comparative Example 2 was cultured for 4 days in a GY culture medium, and cells in the logarithmic growth phase were used in gene transfer. To cells corresponding to OD600=1 to 1.5, 0.625 g of DNA fragment was transformed by the gene gun method (microcarrier: 0.6 micron gold particles, target distance: 6 cm, chamber vacuum: 26 mmHg, rupture disk: 1100 psi). After a recovery time of 4 to 6 hr, the transgenic cells were spread on a PDA agar plate culture medium (containing 2 mg/mL of G418 or containing 2 mg/mL of hygromycin). As a result, from 100 to 200 cells of drug resistant strain per shot were obtained.
[Comparative Example 3-8]: Identification of C20 Elongase Gene Targeting Homologous Recombinant
(336) After genome DNA was extracted from the C20 elongase gene disruption strain in the Thraustochytrium aureum OrfA disruption strain and Thraustochytrium aureum by the method described in Example 2-2, A260/A280 was measured and the DNA concentration was calculated.
(337) After the genome DNA was cut with a restriction enzyme, and underwent electrophoresis in approximately 2 to 3 g per well of 0.7% SeaKem GTG agarose gel (available from Takara Bio Inc.). This was transformed to a nylon membrane, and hybridized for at 51 C. 16 hr with a probe produced using DIG System (available from Roche Applied Science, Inc.). The primers used in probe production were as follows. 5 side [RHO94: 21mer: 5-ACG TCC GCT TCAAAC ACC TCG-3 (SEQ ID NO: 177), RHO95: 24mer: 5-TCG GAA CAA CTG GAA CAA CTAAAG-3 (SEQ ID NO: 178)]; 3 side [RHO96: 22mer: 5-ATG TCG CTC TCC TTC TTC TCA G-3 (SEQ ID NO: 179), RHO97: 21mer: 5-TCG GCT CCT GGAAAG TGC TCT-3 (SEQ ID NO: 180)]. [PCR cycles: 98 C. 2 min/98 C. 30 sec, 58 C. 30 sec, 72 C. 1 min, 30 cycles/72 C. 3 min]. The positions of the restriction enzymes and the probes used are illustrated in
(338) In analysis of both the 5 side and the 3 side, bands were observed at the expected sizes when the drug resistance genes caused homologous recombination (
[Comparative Example 3-9]: Change in Fatty Acid Composition by C20 Elongase Gene Disruption in Thraustochytrium aureum OrfA Disruption Strain
(339) Thraustochytrium aureum ATCC 34304 and the gene disruption strain were cultured according to the method described in Example 2-9, and after freeze drying, the fatty acids were methyl-esterified and analyzed using GC. In GC analysis, measurement was performed using a gas chromatograph GC-2014 (available from Shimadzu Corporation) under the following conditions. Column: HR-SS-10 (30 m0.25 mm; available from Shinwa Chemical Industries Ltd.); column temperature: 150 C..fwdarw.(5 C./min).fwdarw.220 C. (10 min); carrier gas: He (1.3 mL/min).
(340) The changes in the fatty acid composition are shown in
(341) As a result, when the C20 elongase gene was disrupted in the Thraustochytrium aureum OrfA disruption strain, C20:4n-6 (ARA) increased approximately 8-fold, C20:5n-3 (EPA) increased approximately 4-fold, and C22:6n-3 (DHA) decreased to approximately .
(342) Thus, it was demonstrated that in order to create a strain in which the produced quantity of DHA and DPA n-6 are markedly reduced from Thraustochytrium aureum ATCC 34304, which has both an endogenous elongase-desaturase pathway and an endogenous PUFA-PKS pathway, both a gene of an enzyme constituting the elongase-desaturase pathway (for example, the C20 elongase gene) and a PUFA-PKS pathway associated gene need to be disrupted.
Comparative Example 4
(343) [Measurement of Fatty Acid Composition of Lipids Produced by PUFA-PKS Gene and 4 Desaturase Gene Disruption and Transformation Strain of Thraustochytrium aureum ATCC 34304]
[Comparative Example 4-1]: Cloning Sequence of 1071 bp Upstream of 4 Desaturase Gene to 1500 bp within 4 Desaturase Gene of Thraustochytrium aureum ATCC 34304 Strain
(344) Genome DNA of the Thraustochytrium aureum ATCC 34304 strain extracted by the method described in Example 2-2 was read, and a gene sequence having high homology to known 4 desaturase was searched for. Two PCR primers were designed based on the search results. TMO3 is a sequence located at 1071 to 1049 bp upstream of the 4 desaturase gene of the Thraustochytrium aureum ATCC 34304 strain, and TMO4 is a sequence within the protein coding region located at 1477 to 1500 bp counting from the start codon. [TMO3: 23mer: 5-GGC GGA GCG AAG TGT GAA AGT TA-3 (SEQ ID NO: 181), TMO4: 24mer: 5-GCG ACA GCA TCT TGA AAT AGG CAG-3 (SEQ ID NO: 182)]. Using genome DNA of the Thraustochytrium aureum ATCC 34304 strain as a primer, the sequence of 1071 bp upstream of the 4 desaturase gene to 1500 bp within the 4 desaturase gene (2571 bp, SEQ ID NO: 183) of Thraustochytrium aureum ATCC 34304 strain was amplified using these two primers. The amplification conditions were as follows. [PCR cycles: 98 C. 2 min/98 C. 20 sec, 60 C. 30 sec, 72 C. 3 min, 30 cycles/72 C. 8 min]. The obtained DNA fragment was cloned in pGEM-T Easy Vector, and after amplification with E. coli, the sequence was confirmed using a Dye Terminator Cycle Sequencing Kit (available from Beckman Coulter Inc.). This was named pTM1 (
[Comparative Example 4-2]: Production of Plasmid Serving as Base for Production of 4 Desaturase Gene Targeting Vector
(345) Using pTM1 (
(346) The produced plasmid (pTM2) serving as a base for production of a 4 desaturase gene targeting vector is illustrated in
[Comparative Example 4-3]: Production of Targeting Vectors (Blasticidin Resistance Gene and GFP Fusion Zeocin Resistance Gene)
(347) pRH38 (
(348) pRH51 (
(349) The two produced targeting vectors (pTM6 and 8) are illustrated in
[Comparative Example 4-4]: Transfer of 4 Desaturase Gene Targeting Vectors into Thraustochytrium aureum OrfA Disruption Strain
(350) Using the two targeting vectors produced in Comparative Example 4-3 as templates, the genes were amplified with PrimeSTAR Max DNA Polymerase (available from Takara Bio Inc.) using TMO3 (described in Comparative Example 4-1, SEQ ID NO: 181) and TMO4 (described in Comparative Example 4-1, SEQ ID NO: 182) as primers. [PCR cycles: 98 C. 3 min/98 C. 10 sec, 55 C. 5 sec, 72 C. 4 min, 30 cycles/72 C. 3 min]. After phenol chloroform extraction and chloroform extraction, the DNA underwent ethanol precipitation, and the precipitate was dissolved in 0.1TE. A260/280 was measured and the DNA concentration was calculated. The transfer fragment obtained when pTM6 (
(351) The PUFA-PKS pathway associated gene: OrfA gene disruption strain described in Comparative Example 2 was cultured for 4 days in a GY culture medium, and cells in the logarithmic growth phase were used in gene transfer. To cells corresponding to OD600=1 to 1.5, 0.625 g of DNA fragment was transformed by the gene gun method (microcarrier: 0.6 micron gold particles, target distance: 6 cm, chamber vacuum: 26 mmHg, rupture disk: 1100 psi). After a recovery time of 4 to 6 hr, the transgenic cells were spread on a PDA agar plate culture medium (containing 20 mg/mL of zeocin or containing 0.2 mg/mL of blasticidin). As a result, from 100 to 200 cells of drug resistant strain per shot were obtained.
[Comparative Example 4-5]: Identification of 4 Desaturase Gene Targeting Homologous Recombinant
(352) After genome DNA was extracted from the 4 desaturase gene disruption strain in the Thraustochytrium aureum OrfA disruption strain and Thraustochytrium aureum by the method described in Example 2-2, A260/A280 was measured and the DNA concentration was calculated. Using the genome DNA as templates, PCR for genome structure confirmation was performed using Mighty Amp DNA Polymerase (available from Takara Bio Inc.). The positions of the primers used, the combinations used in amplification, and the expected sizes of the amplification products are illustrated in
[Comparative Example 4-6]: Change in Fatty Acid Composition by 4 Desaturase Gene Disruption in Thraustochytrium aureum OrfA Disruption Strain
(353) Thraustochytrium aureum ATCC 34304 and the gene disruption strain were cultured according to the method described in Example 2-9, and after freeze drying, the fatty acids were methyl-esterified and analyzed using GC. In GC analysis, measurement was performed using a gas chromatograph GC-2014 (available from Shimadzu Corporation) under the following conditions. Column: HR-SS-10 (30 m0.25 mm; available from Shinwa Chemical Industries Ltd.); column temperature: 150 C..fwdarw.(5 C./min).fwdarw.220 C. (10 min); carrier gas: He (1.3 mL/min).
(354) The changes in the fatty acid composition are shown in
(355) As a result, when the 4 desaturase gene is disrupted in the Thraustochytrium aureum OrfA disruption strain, C22:5n-6 (DPA) and C22:6n-3 (DHA) are not substantially biosynthesized, and the 4 desaturase substrates C22:4n-6 (DTA) and C22:5n-3 (DPA) are accumulated.
(356) Thus, it was demonstrated that in order to create a strain that cannot substantially biosynthesize DHA and n-6 DPA from Thraustochytrium aureum ATCC 34304, which has both an endogenous elongase-desaturase pathway and an endogenous PUFA-PKS pathway, both a gene of an enzyme constituting the elongase-desaturase pathway (for example, the 4 desaturase gene) and a PUFA-PKS pathway associated gene needs to be disrupted.
(357) By using the microbial oil obtained in this manner, it is possible to obtain microbial oil having a fatty acid composition in which the composition ratios of PUFAs other than DHA and n-6 DPA are increased. It is possible to produce any PUFAs by modifying the genes of a microorganism that produces a large amount of DHA. Furthermore, by producing microbial oil that contains particularly little DHA and n-6 DPA, it is possible to produce microbial oil that requires little refinement. Additionally, by transforming elongase and desaturase into a microorganism in this manner, it is possible to obtain a microorganism that produces microbial oil.
INDUSTRIAL APPLICABILITY
(358) A new pattern of biosynthesis pathway of polyunsaturated fatty acids (PUFAs) was discovered in microorganisms called labyrinthulids. Because it is possible to provide labyrinthulea that produce PUFAs via only the elongase-desaturase pathway, it is anticipated that PUFAs will be mass produced using only the elongase-desaturase pathway.