ESCHERICHIA COLI-BASED RECOMBINANT STRAIN, CONSTRUCTION METHOD THEREFOR AND USE THEREOF

Abstract

The present disclosure discloses an Escherichia coli-based genetically-modified recombinant strain, a construction method therefor and use thereof. A mutant gene obtained by subjecting a wild-type deoB gene (ORF sequence is shown in a sequence 3902352-3903575 in GenBank accession No. CP032667.1) and a wild-type rhtA gene promoter sequence PrhtA (shown in a sequence 850520-850871 in GenBank accession No. AP009048.1) of an E. coli K12 strain and a derivative strain thereof (such as MG1655 and W3110) to site-directed mutagenesis, and a recombinant strain obtained therefrom can be used for the production of L-threonine, and compared with an unmutated wild-type strain, the obtained strain can produce L-threonine with a higher concentration and has good strain stability, and also has lower production cost as an L-threonine production strain.

Claims

1. A nucleotide sequence, comprising a sequence selected from the group consisting of: i. a sequence formed by a mutation occurring at the 1049.sup.th base of a coding sequence of a wild-type deoB gene shown in SEQ ID NO: 1, and ii. a promoter nucleotide sequence formed by a mutation occurring at the −67.sup.th base at the upstream of a nucleotide sequence shown in SEQ ID NO: 13.

2. The nucleotide sequence according to claim 1, wherein, i. the mutation is that guanine (G) mutates to adenine (A) at the 1049.sup.th base in SEQ ID NO: 1, and preferably, the mutated nucleotide sequence is shown in SEQ ID NO: 2; or ii. the mutation is that adenine (A) mutates to guanine (G) at the −67.sup.th base in SEQ ID NO: 13, and preferably, the mutated nucleotide sequence is shown in SEQ ID NO: 14.

3. An expression cassette, comprising the promoter nucleotide sequence ii according to claim 1 and a coding nucleotide sequence of a rhtA gene, wherein, preferably, the coding nucleotide sequence of the rhtA gene comprises a nucleotide sequence shown in SEQ ID NO: 15.

4. A recombinant protein, comprising an amino acid sequence shown in SEQ ID NO: 4; wherein, preferably, the recombinant protein is encoded by the nucleotide sequence i according to claim 1.

5. A recombinant vector, comprising the nucleotide sequence according to claim 1.

6. The recombinant vector according to claim 5, wherein the recombinant vector is constructed by introducing the nucleotide sequence into a plasmid.

7. A recombinant strain, comprising the nucleotide sequence according to claim 1.

8. The recombinant strain according to claim 7, wherein the recombinant strain is formed by introducing the recombinant vector comprising the nucleotide sequence a host strain, wherein the host strain is selected from Escherichia coli; for example, the host strain is E. coli K12, a derivative strain thereof E. coli K12 (W3110), or an E. coli CGMCC 7.232 strain.

9. A construction method for the recombinant strain according to claim 7, comprising the following steps: (1) modifying the nucleotide sequence of the wild-type gene shown in SEQ ID NO: 1 or SEQ ID NO: 13 to obtain a mutated nucleotide sequence shown in SEQ ID NO: 2 or SEQ ID NO: 14; (2) ligating the mutated nucleotide sequence to a plasmid to construct a recombinant vector, preferably, the plasmid being a pKOV plasmid; and (3) introducing the recombinant vector into a host strain to obtain the recombinant strain.

10. A method of preparing L-threonine, comprising fermenting L-threonine in presence of the nucleotide sequence according to claim 1.

11. A method of preparing L-threonine, comprising fermenting L-threonine in presence of the expression cassette according to claim 3.

12. A method of preparing L-threonine, comprising fermenting L-threonine in presence of the recombinant protein according to claim 4.

13. A method of preparing L-threonine, comprising fermenting L-threonine in presence of the recombinant vector according to claim 5.

14. A method of preparing L-threonine, comprising fermenting L-threonine in presence of the recombinant strain according to claim 7.

Description

DETAILED DESCRIPTION

[0073] The above-mentioned and other features and advantages of the present disclosure are explained and illustrated in more detail in the following description of examples of the present disclosure. It should be understood that the following examples are intended to illustrate the technical solutions of the present disclosure, and are not intended to limit the protection scope of the present disclosure defined in the claims and equivalents thereof in any way.

[0074] Unless otherwise indicated, the materials and reagents herein are either commercially available or can be prepared by one skilled in the art in light of the prior art.

EXAMPLE 1

[0075] (1) Construction of Plasmid pKOV-deoB.sup.(G1049A) with deoB Gene Coding Region Having Site-Directed Mutation (G1049A) (equivalent to that cysteine is substituted with tyrosine at the 350.sup.th site (C350Y) in a protein-coding amino acid sequence SEQ ID NO: 3 , the substituted amino acid sequence being SEQ ID NO: 4)

[0076] Pentose phosphate mutase was encoded by a deoB gene, and in an E. coli K12 strain and a derivative strain thereof (such as MG1655), an ORF sequence of the wild-type deoB gene is shown in a sequence 3902352-3903575 in GenBank accession No. CP032667.1. Two pairs of primers for amplifying deoB were designed and synthesized according to the sequence, and a vector was constructed for a base G mutating to a base A at the 1049.sup.th site in a deoB gene coding region sequence (in SEQ ID NO: 1) of an original strain (to obtain a mutated nucleotide sequence SEQ ID NO: 2). The primers (synthesized by Shanghai Invitrogen Corporation) were designed as follows:

TABLE-US-00003 P1: (SEQ ID NO: 5) 5′ CGGGATCCATGGACGGCAACGCTGAAG 3′ (the underlined part is a restriction endonuclease cutting site BamH I); P2: (SEQ ID NO: 6) 5′ GATCGTAACCGTGGTCAG 3′; P3: (SEQ ID NO: 7) 5′ CTGACCACGGTTACGATC 3′; and P4: (SEQ ID NO: 8) 5′ AAGGAAAAAAGCGGCCGCGCTCGTGAGTGCGGATGT 3′ (the underlined part is a restriction endonuclease cutting site Not I).

[0077] The construction method was as follows: using primers P1/P2 and P3/P4 for PCR amplification by taking a a wild-type geneof E. coli K12 as a template to obtain two DNA fragments having a length of 836 bp and 890 bp and point mutation (deoB.sup.(G1049A)-Up and deoB.sup.(G1049A)-Down fragments). PCR system: 10×Ex Taq buffer 5 μL, dNTP mixture (2.5 mM each) 4 μL, MgCl.sub.2 (25 mM) 4 μL, primers (10 pm) 2 μL each, template 1 μL, Ex Taq (5 U/μL) 0.25 μL, total volume 50 μL, wherein the PCR amplification was performed as follows: pre-denaturing at 94 ° C. for 5 min, (denaturing at 94 ° C. for 30 s, annealing at 52 ° C. for 30 s, and extending at 72 ° C. for 90 s, for 30 cycles), and over-extension at 72 ° C. for 10 min. The two DNA fragments were separated and purified by agarose gel electrophoresis, and then the two purified DNA fragments were taken as templates, and P1 and P4 were taken as primers to perform overlap PCR to obtain a fragment (deoB.sup.(G1049A)-Up-Down) having a length of about 1726 bp. Overlap PCR system: 10×Ex Taq buffer 5 μL, dNTP mixture (2.5 mM each) 4 μL, MgCl.sub.2 (25 mM) 4 μL, primers (10 pm) 2 μL each, template 1 μL, Ex Taq (5 U/μL) 0.25 μL, total volume 50 μL, wherein the PCR amplification was performed as follows: pre-denaturing at 94 ° C. for 5 min, (denaturing at 94 ° C. for 30 s, annealing at 52 ° C. for 30 s, and extending at 72 ° C. for 90 s, for 30 cycles), and over-extension at 72 ° C. for 10 min. The deoB.sup.(G1049A)-Up-Down fragment was separated and purified by agarose gel electrophoresis, then the purified fragment and a pKOV plasmid (purchased from Addgene) were double digested with BamH I/Not I, and the digested deoB.sup.(G1049A)-Up-Down fragment and the digested pKOV plasmid were separated and purified by agarose gel electrophoresis followed by ligation to obtain a vector pKOV-deoB.sup.(G1049A). The vector pKOV-deoB.sup.(G1049A) was sent to a sequencing company for sequencing and identification, and the result is shown in SEQ ID NO: 11. The vector pKOV-deoB.sup.(G1049A) with the correct point mutation (deoB.sup.(G1049A)) was stored for later use.

(2) Construction of Engineered Strain with deoB.SUP.(G1049A) .Having Point Mutation

[0078] A wild-type deoB gene was reserved on chromosomes of a wild-type Escherichia coli strain E. coli K12 (W3110) and a high-yield L-threonine production strain E. coli CGMCC 7.232 (preserved in China General Microbiological Culture Collection Center). The constructed plasmid pKOV-deoB.sup.(G1049A) was transferred into E. coli K12 (W3110) and E. coli CGMCC 7.232, respectively, and through allele replacement, the base G mutated to the base A at the 1049.sup.th site of the deoB gene sequences in the chromosomes of the two strains as shown in SEQ ID NO: 1.

[0079] The specific process was as follows: transforming the plasmid pKOV-deoB.sup.(G1049A) into host bacterium competent cells through an electrotransformation process, and adding the cells into 0.5 mL of a SOC liquid culture medium; resuscitating the mixture in a shaker at 30 ° C. and 100 rpm for 2 h; coating an LB solid culture medium having a chloramphenicol content of 34 mg/mL with 100 μL of the culture solution, and culturing at 30 ° C. for 18 h; selecting grown monoclonal colonies, inoculating the colonies in 10 mL of an LB liquid culture medium, and culturing at 37 ° C. and at 200 rpm for 8 h; coating an LB solid culture medium having a chloramphenicol content of 34 mg/mL with 100 μL of the culture solution, and culturing at 42° C. for 12 h; selecting 1-5 single colonies, inoculating the colonies in 1 mL of an LB liquid medium, and culturing at 37° C. and 200 rpm for 4 h; coating an LB solid culture medium containing 10% of sucrose with 100 μL of the culture solution, and culturing at 30° C. for 24 h; selecting monoclonal colonies, and streaking the colonies on an LB solid culture medium having a chloramphenicol content of 34 mg/mL and an LB solid culture medium in a one-to-one correspondence manner; and selecting strains which grew on the LB solid culture medium and could not grow on the LB solid culture medium having the chloramphenicol content of 34 mg/mL for PCR amplification identification. The primers (synthesized by Shanghai Invitrogen Corporation) for use in PCR amplification were as follows:

TABLE-US-00004 P5: (SEQ ID NO: 9) 5′ TGACGCCACCATCAAAGAGA 3′; and P6: (SEQ ID NO: 10) 5′ GTCAACGCTCCGCCCAAAT 3′.

[0080] SSCP (Single-Strand Conformation Polymorphism) electrophoresis was performed on the PCR-amplified product; the amplified fragment of the plasmid pKOV-deoB.sup.(G1049A) was taken as a positive control, the amplified fragment of the wild-type Escherichia coli was taken as a negative control, and water was taken as a blank control. In SSCP electrophoresis, single-stranded oligonucleotide chains having the same length but different sequence arrangements formed different spatial structures in an ice bath and also had different mobilities during electrophoresis. Therefore, the fragment electrophoresis position was not consistent with that of negative control, and a strain having a fragment electrophoresis position consistent with that of positive control is the successfully allele-replaced strain. PCR amplification was performed on the target fragment by taking the successfully allele-replaced strain as a template and using primers P5 and P6, and then the target fragment was ligated to a pMD19-T vector for sequencing. Through sequence comparison of a sequencing result, the sequencing result is shown in SEQ ID NO: 12, and a recon formed by the base G mutating to the base A at the 1049.sup.th site in the deoB gene coding region sequence is the successfully modified strain. The recon derived from E. coli K12 (W3110) was named as YPThr09, and the recon derived from E. coli CGMCC 7.232 was named as YPThr10.

(3) Threonine Fermentation Experiment

[0081] The E. coli K12 (W3110) strain, the E. coli CGMCC 7.232 strain, and the mutant strains YPThr09 and YPThr10 were inoculated in 25 mL of a liquid culture medium described in Table 1, respectively, and cultured at 37 ° C. and 200 rpm for 12 h. Then, 1 mL of the resulting culture of each strain was inoculated in 25 mL of a liquid culture medium described in Table 1, and subjected to fermentation culture at 37 ° C. and 200 rpm for 36 h. The content of L-threonine was determined by HPLC, three replicates of each strain were taken, the average was calculated, and the results are shown in Table 2.

TABLE-US-00005 TABLE 1 Culture medium formula Component Formula g/L Glucose 40 Ammonium sulfate 12 Potassium dihydrogen phosphate 0.8 Magnesium sulfate heptahydrate 0.8 Ferrous sulfate heptahydrate 0.01 Manganese sulfate monohydrate 0.01 Yeast extract 1.5 Calcium carbonate 0.5 L-methionine 0.5 pH value adjusted with potassium hydroxide pH 7.0

TABLE-US-00006 TABLE 2 Threonine fermentation results Fermentation Mean Multiple of Strains volume (g/L) value (g/L) improvement E. coli K12 0.01 0.01 — (W3110) 0.02 0.00 YPThr09 3.3 3.3 330 3.2 3.3 E. coli CGMCC 16.6 16.6 — 7.232 16.5 16.8 YPThr10 19.3 19.4 16.9% 19.6 19.4

[0082] As can be seen from the results of Table 2, the substitution of cysteine at the 350.sup.th site of the amino acid sequence of the deoB gene with tyrosine contributes to the improvement of the yield of L-threonine for the original strain producing L-threonine with either high or low yield.

EXAMPLE 2

(1) Construction of Transformation Vector pKOV-PrhtA.SUP.(A(−67)G) .with rhtA Gene Promoter Having Site-Directed Mutation

[0083] Threonine and homoserine efflux proteins (RHTA enzymes) were encoded by rhtA genes, and in an E. coli K12 strain and a derivative strain thereof (e.g., W3110), a wild-type rhtA gene promoter sequence PrhtA was shown in a sequence 850520-850871 in GenBank accession No. AP009048.1.

[0084] According to this sequence, two pairs of primers for amplifying promoter PrhtA were designed and synthesized, and a vector was constructed for a base A mutating to a base G at the −67.sup.th site at the upstream of a base sequence (SEQ ID NO: 13) of the PrhtA promoter of an original strain (to obtain a nucleotide sequence SEQ ID NO: 14). The primers (synthesized by Shanghai Invitrogen Corporation) were designed as follows:

TABLE-US-00007 P1: (SEQ ID NO: 17) 5′ CGGGATCCTCGCTGGTGTCGTGTTTGTAGG 3′ (the underlined part is a restriction endonuclease cutting site BamH I); P2: (SEQ ID NO: 18) 5′ TATACCCAATGCTGGTCGAG 3′; P3: (SEQ ID NO: 19) 5′ CGACCAGCATTGGGTATATC 3′; and P4: (SEQ ID NO: 20) 5′ AAGGAAAAAAGCGGCCGCCGAAAATTAACGCTGCAATCAAC 3′ (the underlined part is a restriction endonuclease cutting site Not I).

[0085] The construction method was as follows: using primers P1/P2 and P3/P4 for PCR amplification by taking a genome of E. coli K12 as a template to obtain two DNA fragments having a length of 690 bp and 640 bp and point mutation (PrhtA.sup.(A(−67)G)-Up and PrhtA.sup.(A(−67)G)-Down fragments). PCR system: 10×Ex Taq buffer 5 μL, dNTP mixture (2.5 mM each) 4 μL, Mg.sup.2+(25 mM) 4 μL, primers (10 pM) 2 μL each, Ex Taq (5 U/μL) 0.25 μL, total volume 50 μL, wherein the PCR amplification was performed as follows: pre-denaturing at 94 ° C. for 5 min, (denaturing at 94 ° C. for 30 s, annealing at 52 ° C. for 30 s, and extending at 72 ° C. for 30 s, for 30 cycles), and over-extending at 72 ° C. for 10 min.

[0086] The two DNA fragments were separated and purified by agarose gel electrophoresis, and then the two purified DNA fragments were taken as templates, and P1 and P4 were taken as primers to perform overlap PCR to obtain a fragment (PrhtA.sup.(A(−67)G)-Up-Down) having a length of about 1310 bp.

[0087] PCR system: 10×Ex Taq buffer 5 μL, dNTP mixture (2.5 mM each) 4 μL, Mg.sup.2+(25 mM) 4 μL, primers (10 pM) 2 μL each, Ex Taq (5 U/μL) 0.25 μL, total volume 50 μL, wherein the overlap PCR was performed as follows: denaturing at 94 ° C. for 30 s, annealing at 52 ° C. for 30 s, and extending at 72 ° C. for 60 s (for 30 cycles).

[0088] The PrhtA.sup.(A(−67)G)-Up-Down fragment was separated and purified by agarose gel electrophoresis, then the purified fragment and a pKOV plasmid (purchased from Addgene) were double digested with BamH I/Not I, and the digested PrhtA.sup.(A(−67)G)-Up-Down fragment and the digested pKOV plasmid were separated and purified by agarose gel electrophoresis followed by ligation to obtain a vector pKOV-PrhtA.sup.(A(−67)G). The vector pKOV-PrhtA.sup.(A(−67)G) was sent to a sequencing company for sequencing and identification, and the vector pKOV-PrhtA.sup.(A(−67)G) with the correct point mutation (PrhtA.sup.(A(−67)G)) was stored for later use.

(2) Construction of Engineered Strain with PrhtA.SUP.(A(−67)G) .Having Point Mutation

[0089] A wild-type PrhtA promoter was reserved on chromosomes of a wild-type Escherichia coli strain E. coli K12 (W3110) and a high-yield L-threonine production strain E. coli CGMCC 7.232 (preserved in China General Microbiological Culture Collection Center). The constructed plasmid pKOV-PrhtA.sup.(A(−67)G) was transferred into E. coli K12 (W3110) and E. coli CGMCC 7.232, respectively, and through allele replacement, the base A mutated to the base G at the −67.sup.th site at the upstream of base sequences of the PrhtA promoters in the chromosomes of the two strains.

[0090] The specific process was as follows: transforming the plasmid pKOV-PrhtA.sup.(A(−67)G) into host bacterium competent cells through an electrotransformation process, and adding the cells into a 0.5 mL SOC liquid culture medium; resuscitating the mixture in a shaker at 30 ° C. and 100 rpm for 2 h; coating an LB solid culture medium having a chloramphenicol content of 34 μg/mL with 100 μL of the culture solution, and culturing at 30 ° C. for 18 h; selecting grown monoclonal colonies, inoculating the colonies in a 10 mL LB liquid culture medium, and culturing at 37 ° C. and at 200 rpm for 8 h; coating an LB solid culture medium having a chloramphenicol content of 34 μg/mL with 100 μL of the culture solution, and culturing at 42 ° C. for 12 h; selecting 1-5 single colonies, inoculating the colonies in 1 mL of an LB liquid medium, and culturing at 37 ° C. and 200 rpm for 4 h; coating an LB solid culture medium containing 10% of sucrose with 100 uL of the culture solution, and culturing at 30 ° C. for 24 h; selecting monoclonal colonies, and streaking the colonies on an LB solid culture medium having a chloramphenicol content of 34 μg/mL and an LB solid culture medium in a one-to-one correspondence manner; and selecting strains which grew on the LB solid culture medium and could not grow on the LB solid culture medium having the chloramphenicol content of 34 μg/mL for PCR amplification identification. The primers (synthesized by Shanghai Invitrogen Corporation) for use in PCR amplification were as follows:

TABLE-US-00008 P5: (SEQ ID NO: 21) 5′ ATACACCGCTATCCATCT 3′; and P6: (SEQ ID NO: 22) 5′ AACCAGGCATCCTTTCTC 3′.

[0091] PCR system: 10×Ex Taq buffer 5 μL, dNTP mixture (2.5 mM each) 4 μL, Mg.sup.2+(25 mM) 4 μL, primers (10 pM) 2 μL each, Ex Taq (5 U/μL) 0.25 μL, total volume 50 μL, wherein the PCR amplification was performed as follows: pre-denaturing at 94 ° C. for 5 min, (denaturing at 94 ° C. for 30 s, annealing at 52 ° C. for 30 s, and extending at 72 ° C. for 30 s, for 30 cycles), and over-detending at 72 ° C. for 10 min. SSCP (Single-Strand Conformation Polymorphism) electrophoresis was performed on the PCR-amplified product; the amplified fragment of the plasmid pKOV-PrhtA.sup.(A(−67)G) was taken as a positive control, the amplified fragment of the wild-type Escherichia coli was taken as a negative control, and water was taken as a blank control. In SSCP electrophoresis, single-stranded oligonucleotide chains having the same length but different sequence arrangements formed different spatial structures in an ice bath and also had different mobilities during electrophoresis. Therefore, the fragment electrophoresis position was not consistent with that of negative control, and a strain having a fragment electrophoresis position consistent with that of positive control is the successfully allele-replaced strain. PCR amplification was performed on the target fragment by taking the successfully allele-replaced strain as a template and using primers P5 and P6, and then the target fragment was ligated to a pMD19-T vector for sequencing. Through sequence comparison of a sequencing result, a recon formed by the base A mutating to the base G at the −67.sup.th site at the upstream of the base sequence of the PrhtA promoter is the successfully modified strain. The recon derived from E. coli K12 (W3110) was named as YPThr01, and the recon derived from E. coli CGMCC 7.232 was named as YPThr 02.

(3) Threonine Fermentation Experiment

[0092] The E. coli K12 (W3110) strain, the E. coli CGMCC 7.232 strain, and the mutant strains YPThr01 and YPThr02 were inoculated in 25 mL of a liquid culture medium described in Table 1, and cultured at 37 ° C. and 200 rpm for 12 h. Then, 1 mL of the resulting culture of each strain was inoculated in 25 mL of a liquid culture medium described in Table 1, and subjected to fermentation culture at 37 ° C. and 200 rpm for 36 h. The content of L-threonine was determined by HPLC, three replicates of each strain were taken, the average was calculated, and the results are shown in Table 2.

TABLE-US-00009 TABLE 1 Culture medium formula Component Formula g/L Glucose 40 Ammonium sulfate 12 Potassium dihydrogen phosphate 0.8 Magnesium sulfate heptahydrate 0.8 Ferrous sulfate heptahydrate 0.01 Manganese sulfate monohydrate 0.01 Yeast extract 1.5 Calcium carbonate 0.5 L-methionine 0.5 pH value adjusted with potassium hydroxide pH 7.0

TABLE-US-00010 TABLE 2 Threonine fermentation results Fermentation Mean Multiple of Strains volume (g/L) value (g/L) improvement E. coli K12 0.02 0.02 — (W3110) 0.02 0.03 YPThr01 1.8 1.8 90   1.9 1.7 E. coli CGMCC 16.1 16.2 — 7.232 16.2 16.2 YPThr02 18.3 18.0 11.1% 18.1 17.7

[0093] As can be seen from the results of Table 2, the mutation of the base A at the −67.sup.th site of the promoter sequence of the rhtA gene to the base G contributes to the improvement of the yield of L-threonine for the original strain producing L-threonine with either high or low yield.

[0094] The examples of the present disclosure have been described above. However, the present disclosure is not limited to the above examples. Any modification, equivalent, improvement and the like made without departing from the spirit and principle of the present disclosure shall fall within the protection scope of the present disclosure.