Recombinant yeast strain having sterol productivity, preparation method therefor and use thereof

Abstract

The present invention relates to a recombinant yeast strain having sterol productivity, a preparation method therefor and a use thereof, and more specifically, to a recombinant yeast strain capable of producing cholesterol and cholesterol precursors in a high yield through the deletion of ERG5 and ERG6 genes and the introduction of DHCR24 and DHCR7 genes by codon-optimizing same in multiple or with a codon context method; and a production method therefor and a use thereof. In addition, disclosed are: a method for producing a recombinant yeast strain with increased production yields of cholesterol and cholesterol precursors by the additional introduction of gene tHMG1, ERG2, ERG3, ERG27, or UPC2-1 in the prepared recombinant yeast strain; and a use thereof.

Claims

1. A recombinant yeast strain having sterol productivity, into which ERG5 and ERG6 genes are deleted and codon-optimized DHCR24 and DHCR7 synthetic genes are introduced, wherein the codon-optimized DHCR24 synthetic gene consists of SEQ ID NO: 17 and is introduced into an ERG6 gene site and the codon-optimized DHCR7 synthetic gene consists of SEQ ID NO: 18 and is introduced into an ERG5 gene site; or the codon-optimized DHCR24 synthetic gene consists of SEQ ID NO: 17 and is introduced into an ERG5 gene site and the codon-optimized DHCR7 synthetic gene consists of SEQ ID NO: 18 and is introduced into an ERG6 gene site, wherein the sterol comprises one or more of a cholesterol precursor or cholesterol, and wherein the cholesterol precursor comprises one or more selected from the group consisting of squalene, oxidosqualene, zymosterol, and lathosterol.

2. The recombinant yeast strain of claim 1, wherein a tHMGJ gene is further introduced onto a host chromosome.

Description

DESCRIPTION OF DRAWINGS

(1) FIG. 1 shows the cholesterol biosynthesis pathway of a recombinant yeast strain according to one embodiment of the present invention.

(2) FIGS. 2A and 2B shows a process of preparing a recombinant yeast strain according to one embodiment of the present invention: FIG. 2A is a schematic diagram of preparing recombinant yeast strains #19 (erg5::D24/erg6::D7) and #S1 (erg6::D24/erg5::D7), and recombinant yeast strains into which multiple copies of DHCR24 are additionally integrated; and FIG. 2B is a schematic diagram of producing recombinant yeast strains by additional multiple DHCR24 and DHCR7 integration or overexpression, and additional introduction of ERG3, ERG2, ERG27-2 fusion and UPC2-1 into the recombinant yeast strains #19 (erg5::D24/erg6::D7) and #S1 (erg6::D24/erg5::D7).

(3) FIGS. 3A and 3B shows a process of producing a recombinant yeast strain according to one embodiment of the present invention: FIG. 3A is a schematic diagram of producing a recombinant yeast strain by introducing DHCR24 and multiple DHCR7 integration into a wild-type Saccharomyces cerevisiae strain, a recombinant yeast strain into which ERG3, ERG2, ERG27-2 fusion and UPC2-1are additionally introduced, and a recombinant yeast strain in which erg6 deletion and multiple DHCR24 integration are introduced; and FIG. 3B is a schematic diagram of producing recombinant yeast strains #cc19 (erg5::ccD24/erg6::ccD7) and #ccS1 (erg6::ccD24/erg5::ccD7) using DHCR24(cc) and DHCR7(cc) codon-optimized by a codon context method and recombinant yeast strains into which the multiple integration of tHMG1 from which the N-terminus partially removed is additionally introduced.

(4) FIGS. 4A to 4J shows vectors used in preparation of recombinant yeast strains according to one embodiment of the present invention.

(5) FIG. 5 shows the result of analyzing the production amounts of cholesterol and precursors thereof of recombinant yeast strains #19 (erg5::D24/erg6::D7) and #S1 (erg6::D24/erg5::D7) according to one embodiment of the present invention using HPLC-UV/Vis chromatograms (*: unknown peak, DD: dehydrodesmosterol), D: desmosterol, Z: zymosterol, C: cholesterol).

(6) FIG. 6 shows the result of analyzing the production amounts of cholesterol and precursors thereof of recombinant yeast strains .sub.NTSD24/#19 (NTS D24/erg5::D24/erg6::D7) and .sub.NTSD24/#S1 (.sub.NTSD24/erg6::D24/erg5::D7) according to one embodiment of the present invention using HPLC-UV/Vis chromatograms (DD: dehydrodesmosterol, D: desmosterol, Z: zymosterol, C: cholesterol).

(7) FIGS. 7A to 7C shows the results of comparative analysis of characteristics of recombinant yeast strains according to one embodiment of the present invention: FIG. 7A is the result (qPCR) of analyzing recombinant strain .sub.NTSD24D7/#19 (.sub.NTSD24D7/erg5::D24/erg6::D7) according to the number of integration cassettes; FIG. 7B is the result (HPLC-UV/Vis chromatogram) of analyzing the production amounts of cholesterol and precursors thereof of recombinant strains #19 and .sub.NTSD24D7/#19; and FIG. 7C is the result (HPLC-UV/Vis chromatogram) of analyzing the productivity of cholesterol and precursors thereof of recombinant strain .sub.2uD24D7/#S1 (DD: dehydrodesmosterol, D: desmosterol, Z: zymosterol, C: cholesterol).

(8) FIG. 8 shows the result of analyzing the production amounts of cholesterol and precursors thereof of recombinant yeast strains E3E2/.sub.NTSD24D7/#19, E3E27-2/.sub.NTSD24D7/#19 and UPC2-1/.sub.NTSD24D7/#19 according to one embodiment of the present invention using HPLC-UV/Vis chromatograms (DD: dehydrodesmosterol, D: desmosterol, Z: zymosterol, C: cholesterol).

(9) FIG. 9 shows newly constructed HPLC-CAD-based LC chromatograms, analyzing the production amounts of cholesterol and precursors thereof of recombinant yeast strains according to one embodiment of the present invention: FIG. 9(A) shows the LC chromatogram for three types of reference standards (1: zymosterol, 2: ergosterol, 3: cholesterol); FIG. 9(B) shows the LC chromatogram for four types of reference standards (4: 7-dehydrodesmosterol, 5: desmosterol, 6: 7-dehydrocholesterol, 7: lathosterol); FIG. 9(C) shows a wild-type strain (CEN.PK); and FIG. 9(D) shows recombinant strain #19 (erg5::D24/erg6::D7).

(10) FIGS. 10A to 10C shows the result of analyzing sterol profiles of ARE2-deleted strains prepared according to one embodiment of the present invention: FIG. 10A is the schematic diagram of preparation of a homologous recombination-based ARE2-deleted strain; FIG. 10B shows the chromatograms of total sterols (KOH/EtOH) and free sterols (Chloroform/MeOH) obtained by a different HPLC-UV/Vis-based sterol extraction method; and FIG. 10C shows the HPLC-UV/Vis-based total sterol chromatogram of recombinant strain are2/N-rsD24D7/#19. (DD: dehydrodesmosterol, D: desmosterol, Z: zymosterol, C: cholesterol).

(11) FIGS. 11A to 11C are the result of analyzing the relationship between the copy number and a sterol production amount of recombinant yeast strains prepared according to one embodiment of the present invention, and FIG. 11D is the result of HPLC-UV/Vis analysis showing the sterol profile of erg6::D7/UPC2-1/NTS D24D7 strain (*: unknown peak, DD: dehydrodesmosterol, D: desmosterol, Z: zymosterol, C: cholesterol).

(12) FIGS. 12A to 12C are the result of comparative analysis of characteristics of recombinant yeast strains according to one embodiment of the present invention: FIG. 12A shows a vector including a cassette used in the production of recombinant strain .sub.NTSD7/.sub.NTSD24/#S1; FIG. 12B shows an analysis result (qPCR analysis) according to the number of integration cassettes of recombinant strain .sub.NTSD7/.sub.NTSD24/#S1; and FIG. 12C shows the analysis result (HPLC-UV/Vis chromatogram) for the production amounts of cholesterol and precursors thereof of recombinant strain .sub.NTSD7/.sub.NTSD24/#S1.

(13) FIGS. 13A to 13E shows the result of comparative analysis of recombinant yeast strains according to one embodiment of the present invention: FIGS. 13A to 13D are vectors including a cassette used in the production of recombinant strains #cc19 and #ccS1; and FIG. 13E is the result of analyzing the production amounts of cholesterol and precursors thereof of recombinant strains #cc19 and #ccS1.

(14) FIGS. 14A to 14C shows the result of comparative analysis of the characteristics of recombinant yeast strains according to one embodiment of the present invention: FIG. 14A shows a vector including a multiple tHMG1 integration cassette used in the production of recombinant strains tHMG1/#cc19 and tHMG1/#ccS1; FIG. 4B shows the analysis result (qPCR) according to the number of multiple tHMG1 integration cassettes of recombinant strains tHMG1/#cc19 and tHMG1/#ccS1; and FIG. 4C shows the analysis result (HPLC-UV/Vis chromatogram) for the production amounts of cholesterol and precursors thereof of recombinant strains tHMG1/#cc19 and tHMG1/#ccS1.

MODES OF THE INVENTION

(15) Hereinafter, the present invention will be described in further detail with reference to exemplary embodiments. The objects, features and advantages of the present invention are easily understood through the following exemplary embodiments. The present invention is not limited to the exemplary embodiments to be described below, but may be embodied in other forms. The exemplary embodiments presented herein are provided such that the idea of the present invention can be fully conveyed to those of ordinary skill in the art to which the present invention belongs. Therefore, the present invention should not be limited by the following exemplary embodiments.

(16) This embodiment was carried out to prepare a recombinant yeast strain that produces cholesterol and precursors thereof of an animal cell, instead of ergosterol, which is a yeast-specific sterol. To this end, a recombinant yeast strain having a cholesterol biosynthesis pathway was prepared by blocking the final ergosterol biosynthesis step for traditional baking yeast Saccharomyces cerevisiae and introducing a cholesterol biosynthesis-related foreign gene (FIG. 1). As a specific strategy of this embodiment, recombinant Saccharomyces cerevisiae (S. cerevisiae) strains were prepared by disrupting C22 sterol desaturase gene ERG5 involved in the formation of a 22-carbone double bond, which is an ergosterol-specific structure, and delta(24)-sterol C-methyl transferase gene ERG6 involved in 24carbone methylation, and introducing 7-dehydrocholesterol reductase gene DHCR7 and 24-dehydrocholesterol reductase gene DHCR24, which are derived from animal cells required for cholesterol production, into yeast hosts in various forms (FIG. 2A). In addition, further, in order to more effectively convert an ergosterol biosynthesis pathway into a cholesterol precursor biosynthesis pathway, it was attempted to prepare recombinant strains into which delta(7)-sterol 5(6)-desaturase (ERG3), C8 sterol isomerase (ERG2) and 3-keto-steroid reductase (ERG27), and uptake control protein 2-1 (UPC2-1), which is a transcription factor for regulating an ergosterol biosynthesis pathway, are additionally introduced (FIG. 2B). As another method, cholesterol-producing strains were prepared by first integrating multiple copies of DHCR7 and DHCR24 genes into a wild-type strain background, additionally introducing ERG3, ERG2, ERG27, and UPC2-1, which is a transcription factor for regulating an ergosterol biosynthesis pathway, and disrupting ERG6 (FIG. 3A). Furthermore, to amplify a mevalonate biosynthesis pathway, which is a precursor biosynthesis pathway of an ergosterol biosynthesis pathway, multiple copies of a tHMG1 gene were additionally introduced onto a host chromosome (FIG. 3B).

(17) The ERG5, ERG6, DHCR7, DHCR24, ERG3, ERG2, ERG27, ARE2, ERG27-ERG2, UPC2-1 and tHMG1 may consist of sequences represented by SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16 and SEQ ID NO: 19, respectively.

(18) TABLE-US-00001 ERG27-ERG2fusiongenesequence (SEQIDNO:15,underlined:ERG2region) ttaaaactaaaacccccattccaaccaattacatgttcgat ccaaaaactttgaacgaaatatgtaactcggtgattagcaa acacaacgcagcagaaggtttatccactgaagacctgttac aggatgtcagagacgcacttgcctctcattacggggacgaa tacatcaacaggtacgtcaaagaagaatgggtcttcaacaa tgctggtggtgcgatgggccaaatgatcatcctacacgctt ccgtatccgagtacttaattctattcggaaccgctgttggt actgaagggcacacaggtgttcactttgctgacgactattt taccatcttacatggtacgcaaatcgcagcattgccatatg ccactgaagccgaagtttacactcctggtatgactcatcac ttgaagaagggatacgccaagcaatacagcatgccaggtgg ttcctttgcccttgaattggctcaaggctggattccatgta tgttgccattcgggtttttggacactttctccagtactctt gatttatacactctatatagaactgtctacctgactgccag ggacatgggtaagaacttgttgcaaaacaaaaagttctaa UPC2-1sequence(SEQIDNO:16,underlined capitalletters:G888Dpointmutation site(GGTtoGAT) attattaagagaagctgttttagaaatatctgagaataaca ccgatgcgctagttgccagcgccctgatactaatcatggac tcgttagcaaatgctagtggtaacggcactgtaggaaacca aagtttgaatagcatgtcaccaagcgcttggatctttcatg tcaaaggtgctgcaacaattttaaccgctgtgtggcctttg agtgaaagatctaaatttcataacattatatctgttgatct tagcgatttaggcgatgtcattaaccctgatgttggaacaa ttactgaattggtatgttttgatgaaagtattgccgatttg tatcctgtcggcttagattcgccatatttgataacactagc ttatttagataaattgcaccgtgaaaaaaaccagggtgatt ttattctgcgggtatttacatttccagcattgctagacaag acattcctggcattactgatgacaggtgatttaggtgcaat gagaattatgagatcatattataaactacttcgaggatttg ccacagaggtcaaggataaagtctggtttctcgaaggagtc acgcaggtgctgcctcaagatgttgacgaatacagtggagg tggtGATatgcatatgatgctagatttcctcggtggcggat taccatcgatgacaacaacaaatttctctgatttttcgtta

(19) Hereinafter, the present invention will be described in further detail with reference to specific examples.

EXAMPLES

(20) Materials

(21) Primers, expression vectors and yeast strains used in the examples are listed in Tables 1 to 3. The expression vectors constructed in the examples are listed in the diagram in FIG. 4, and media and reagents used are as follows. Synthetic Complete medium (SC medium): 0.67% yeast nitrogen base without amino acids) (BD, 291940), 2% glucose (JUNSEI, 64220S0650), and 0.77 g/L of a drop-out amino acid mixture supplemented with all required amino acids (CLONTECH, 630425) In-fusion cloning kit (TAKARA 121416) KOH (JUNSEI, 39040-0350/Sigma, P1767) Ethanol (MERCK, 1.00983.1011) Methanol (B&J, AH230-4) Heptane (SIGMA, 246654) Petroleum ether (B&J, 317-4) Pyrogallol (TCI, P0570) Acetone (SIGMA, 650501) Cosmosil C18-PAQ (4.6 mm*250 mm) column HPLC acetonitrile (FISHER, A998-4) HPLC water (FISHER, W5-4) Standard cholesterol precursor for HPLC Lanosterol (SIGMA, L5768) Ergosterol (SIGMA, 45480-10g-f) Zymosterol (AVANTI, 700068P) Desmosterol (SIGMA, D6513) Cholesterol (SIGMA, C8667) Lathosterol (SIGMA, C3652) 7-Dehydrodesmosterol (AVANTI, 700138P) 7-Dehydrocholesterol (SIGMA, 30800) Glucose Bio (Roche, 06343732001) Acetate V2 Bio (COWIE, 7395442001) Ethanol Bio (Roche, 8055645001)
Apparatus HPLC (Waters Separations Module 2695, Waters Dual Absorbance Detector
2487) PCR cycler (Eppendorf, AG 22331) Bead beater (BERTIN TECHNOLOGY, PrecellysR24) Water bath (TAITEC, SDN-B) Centrifuge (Eppendorf, 5424R) Rotational vacuum concentrator (CHRIST, RVC 2-25 CD plus) HPLC-CAD system (Thermo Scientific, Dionex Ultimate 3000-Corona Veo RS) Bioprocess analyzer (Roche, Cedex Bio)

(22) TABLE-US-00002 [TABLE1] Primersusedinthisexperiment Primer Sequence(5->3) erg5dNfw ACATGCATGCCGCTATTG AAGAGAGCTCATG (SEQIDNO:20) erg5dNrv GCGGCCGCGGGTCTAGAG GGGGATCCCCAGGATACT GAAGGCAGTAG (SEQIDNO:21) erg5dCfw GGATCCCCCTCTAGACCC GCGGCCGCCATGATTAC CTTCGCCGCTTTG (SEQIDNO:22) erg5dCrv CGACGCGTGCTGGCAGG GTGAGTATTTG (SEQIDNO:23) erg6dNfw ACGTGCATGCGCTGTTGC CGATAACTTCTTC (SEQIDNO:24) erg6dNrv GCGGCCGCGGGTCTAGAG GGCTCGAGGGGGGATCC CTCAATTCTGTTTCACT CATC (SEQIDNO:25) erg6dCfw GGATCCCCCCTCGAGCCC TCTAGACCCGCGGCCGCC CTCCCAAACTTCCCAAG (SEQIDNO:26) erg6dCrv CGACGCGTCTTGCCGCTG TAGACAATAG (SEQIDNO:27) DHCR7fw AACTGCAGATGATGGCCT CCGATAGAGTTAG (SEQIDNO:28) DHCR7rv GCGTCGACTTACTTGTC GTCATCGTCTTTGTAGT CAAAGATGTTTGGCAAT AATCTATAGG (SEQIDNO:29) DHCR24 AACTGCAGATGGACCCT fw TTGTTGTATTTGGG (SEQIDNO:30) DHCR24 GCGTCGACTTACGCATA rv GTCAGGAACATCGTATG GGTAGTGTCTGGCGGAT TTACAG (SEQIDNO:31) TEF1p CCGCTCGAGAGCTC fw ATAGCTTCAAAATGTT TC (SEQIDNO:32) TEF1prv GCTCTAGAGGGGAA ACTTAAAGAAATTC (SEQIDNO:33) GAL7tfw ACGCGTCGACTTGA ACGAAACTTGAACGGA G(SEQIDNO:34) GAL7trv GCTCTAGAGGGGAA ACTTAAAGAAATTC (SEQIDNO:35) ACT1pfw CGAAGTTATTAGGGCGGCCGC TTTGGACTCCACCAACGTC (SEQIDNO:36) ACT1prv ATCGGAGGCCATCATTGTTA ATTCAGTAAATTTTCGATCT TGGG (SEQIDNO:37) DHCR7 TGAATTAACAATGATGGCCT fw2 CCGATAGAGTTAG (SEQIDNO:38) DHCR7 CTTTAATTTGCGGCCTTACT rv2 TGTCGTCATCGTCTTTG (SEQIDNO:39) CYC1t GATGACGACAAGTAAGGCCG fw CAAATTAAAGCCTTC (SEQIDNO:40) CYC1trv ACCTCTGGCGCGGCCTCATG TAATTAGTTATGTCACGC (SEQIDNO:41) TDH3pfw CGCGGATCCGTAGAATCATT TTGAATAAAAAACACGC (SEQIDNO:42) TDH3prv ACTTCTAAGACCAAATCCATGA ATTCTGTTTATGTGTGTTTAT TCGAAAC (SEQIDNO:43) ERG3fw ACTTCTAAGACCAAATCCATGA ATTCTGTTTATGTGTGTTTT TCGAAAC (SEQIDNO:44) ERG3rv AGAAAAGTCTTATCAATCTCCG TCGACTCAGTTGTTCTTCTT GGTATTTG (SEQIDNO:45) TEF1tfw CAAATACCAAGAAGAACAACT GAGTCGACGGAGATTGATAA GACTTTTCT (SEQIDNO:46) TEF1t CCGCTCGAGGTAAAAAATAC rv GCCCGTAACGATG (SEQIDNO:47) TEF2p CCGCTCGAGTGCCATTAAAG fw GCGAATTTTTG (SEQIDNO:48) TEF2prv AAGGAGTGGGAAAAACTTCAT GCATGCGTTTAGTTAATTAT AGTTCGTTG (SEQIDNO:49) ERG2fw CAACGAACTATAATTAACTA AACGCATGCATGAAGTTTTT CCCACTCCTT (SEQIDNO:50) ERG2rv AGATTTAAAGTAAATTCACG CATGCTTAGAACTTTTTGT TTTGCAACAAG (SEQIDNO:51) TDH3tfw CTTGTTGCAAAACAAAAAGTTC TAAGCATGCGTGAATTTACT TTAAATCT (SEQIDNO:52) TDH3trv CCGCTCGAGTCTAGATATATGT TATCTTATCTTGG (SEQIDNO:53) ERG27-2 CGAACATGTAATTGGTTGGAAT fw1 GGGGGTTCTAGTTTCAACA ATTTG (SEQIDNO:54) ERG27-2 CTATAATTAACTAAACGCATG rv1 CATGAACAGGAAAGTAGCTA TCGTAAC (SEQIDNO:55) ERG27-2 AAGATTTAAAGTAAATTCACG fw2 CATGCTTAGAACTTTTTGTTT TGCAACAAGTTC (SEQIDNO:56) ERG27-2 GTTGAAACTAGAACCCCCATT rv2 CCAACCAATTACATGTTCGAT CC (SEQIDNO:57) ARE2dN ACATGCATGCCAAGTCGTA fw1 AACCTCGTCGG (SEQIDNO:58) ARE2dN GATATCGCGCTCGAGGTTCT rv1 CCAGTAGATCCTTCTTC (SEQIDNO:59) ARE2dN CTCGAGCGCGATATCGGACC fw2 AAGTGTCATGTGTACG (SEQIDNO:60) ARE2dN CCGACGCGTGGCAAATAGATT rv2 GGTTAAATCTGAAG (SEQIDNO:61) 101HISfw GCTATACGAAGTTATTAGGCCC GGGGATTGGCATTATCACATA ATGAATTATAC (SEQIDNO:62) 101HISrv CACCTTGAAACTACCTCTGGCG CGGCCGCTCGAGTTCAAGAGA AAAAAAAAGAAAAAGCAAAA AG(SEQIDNO:63) ccD7fw CTAATCTAAGTTTTCTAGCTG CAGATGATGGCCTCTGACAG AGTC (SEQIDNO:64) ccD7rv GTCACTCCGTTCAAGTCGACT TAGAAAATGTTTGGTAGCAA TCTGTAAG (SEQIDNO:65) ccD24fw CTAAGTTTTCTAACTGCAGA TGGACCCATTGCTATACTTA GGTG (SEQIDNO:66) ccD24rv CAAGTTTCGTTCAAGTCGACC TAATGTCTGGCAGATTTGCA AATCTTG (SEQIDNO:67) tHMG1-fw GGAATTCATGCCAGTTTTAA CCAATAA (SEQIDNO:68) tHMG1-rv GCGTCGACTTACGCATAGTC AGGAACATCGTATGGGTAG GATTTAATGCAGGTGACGG (SEQIDNO:69)

(23) TABLE-US-00003 TABLE 2 Plasmids used in this experiment Plasmid Description Reference pT-ERG5dNC pGEM-Teasy vector containing ERG5 N and C partial this study fragments pT-ERG6dNC pGEM-Teasy vector containing ERG6 N and C partial this study fragments pMKRQ-DrDHCR24 pMKRQ containing S. cerevisiae-codon optimized Daewoong zebrafish DHCR7 pMKRQ-DrDHCR7 pMKRQ containing S. cerevisiae-codon optimized Daewoong zebrafish DHCR24 pUG72 loxP-pKlURA3-KlURA3-tKlURA3-loxP Euroscarf pUG73 loxP-pKlLEU2-KlLEU2-tKlLEU2-loxP Euroscarf pT-DHCR24 pGEM-Teasy-pTEF1-DHCR24-GAL7t this study pT-DHCR7 pGEM-Teasy-pACT1-DHCR7-CYC1t this study pT-erg5::DHCR24-LEU 2 pGEM-Teasy-ERG5(N)-pTEF1-DHCR24-GAL 7t- this study KlLEU2-ERG5(C) pT-erg6::DHCR7-URA3 pGEM-Teasy-ERG6(N)-pACT1-DHCR7-CYC1 t- this study KlURA3-ERG6(C) pT-erg6::DHCR24-LEU 2 pGEM-Teasy-ERG6(N)-pTEF1-DHCR24-GAL 7t- this study KlLEU2-ERG6(C) pT-erg5::DHCR7-URA3 pGEM-Teasy-ERG5(N)-pACT1-DHCR7-CYC1 t- this study KlURA3-ERG5(C) pT-NTS-86TRP1 pGEM-Teasy-5NTS2-TRP1 with 86bp promoter-3NTS2 Moon et. al., 2016 pT-NTS-DHCR24-86TR P1 pT-NTS-86TRP1 containing the DHCR24 this study expression cassette pTEF1-DHCR24-GAL7t pT-NTS-DHCR24-DHC R7- pT-NTS-DHCR24-86TRP1 containing the this study 86TRP1 DHCR7 expression cassette pACT1-DHCR7-CYC1t Y2pH 2-based YEp351 derivative, containing the this study GAL10 promoter and GAL7 terminator and the HIS3 marker Y2pH-DHCR7-DHCR24 Y2pH containing pTEF1-DHCR24-GAL7t and pACT1- this study DHCR7-CYC1t Y2pH-ERG3-ERG2 Y2pH containing TDH3p-ERG3-TEF1t and TEF2p- this study ERG2-TDH3t Y2pH-ERG3-ERG27-2 Y2pH containing TDH3p-ERG3-TEF1t and TEF2p- this study ERG27-ERG2 fusion-TDH3t YCpH-Tp CEN-based pRE316 derivative containing the Application: TEF1 promoter, the GAL7 terminator and the 10-2017- HIS3 marker 0182422 YCpH-np-UPC2 YCpH derivative expressing UPC2-1 under the Application: control of its own promoter 10-2017- 0182422 pT-ARE2dNC-HIS pGEM-Teasy vector containing the ARE2 this study deletion cassette ARE2::HIS3 pT-NTS-101HIS3-DHC R7 pT-NTS-101HIS3 containing the DHCR7 this study expression cassette pACT1-DHCR7-CYC1t pMKRQ-sDrDHCRc7(cc) pMKRQ containing S. cerevisiae-codon context this study optimized DHCR7 gene from Danio rerio pMKRQ-sDrDHCRc24(cc) pMKRQ containing S. cerevisiae-codon context this study optimized DHCR24 gene from Danio rerio pT-ERG5dNC-ccDHCR 7 pGEM-Teasy-ERG5(N)-pACT1-ccDHCR7-CY C1t- this study ERG5(C) pT-ERG5dNC-ccDHCR 24 pGEM-Teasy-ERG5(N)-pTEF1-ccDHCR24-GA L7t- this study KlLEU2-ERG5(C) pT-ERG6dNC-ccDHCR 7 pGEM-Teasy-ERG6(N)-pACT1-ccDHCR7-CY C1t- this study ERG6(C) pT-ERG6dNC-ccDHCR 24 pGEM-Teasy-ERG6(N)-pTEF1-ccDHCR24-GA L7t- this study KlLEU2-ERG6(C) pT-erg6::ccDHCR7-UR A3 pGEM-Teasy-ERG6(N)-pACT1-ccDHCR7-CY C1t- this study KlURA3-ERG6(C) pT-erg6::ccDHCR24-LE U2 pGEM-Teasy-ERG6(N)-pTEF1-ccDHCR24-GA L7t- this study KlLEU2-ERG6(C) pT-erg5::ccDHCR-UR A3 pGEM-Teasy-ERG5(N)-pACT1-ccDHCR7-CYC1t- this study KlURA3-ERG5(C) pT-NTS-86TRP1-tHMG 1 pT-NTS-86TRP1 containing the N-truncated HMG1 this study expression cassette pTEF1-tHMG1-GAL7t

(24) TABLE-US-00004 TABLE 3 Yeast strains used in this experiment Strain Genotype Reference 1 CEN.PK (WT) MATa ura3-52 trp1-289 leu2-3,112 his3-D1 MAL2-8C Entian SUC2 and Kotter (2007) 2 erg5::D24 MATa ura3-52 trp1-289 leu2-3,112 his3-D1 MAL2-8C this study SUC2 erg5::KlLEU2-TEF1p-sDrDHCR24 3 erg6::D7 MATa ura3-52 trp1-289 leu2-3,112 his3-D1 MAL2-8C this study SUC2 erg6::KlURA3-TEF1p-sDrDHCR7 4 erg6::D24 MATa ura3-52 trp1-289 leu2-3,112 his3-D1 MAL2-8C this study SUC2 erg6::KlLEU2-TEF1p-sDrDHCR24 5 erg5::D7 MATa ura3-52 trp1-289 leu2-3,112 his3-D1 MAL2-8C this study SUC2 erg5::KlURA3-TEF1p-sDrDHCR7 6 erg5::D24/erg6::D 7 (#19) MATa ura3-52 trp1-289 leu2-3,112 his3-D1 MAL2-8C this study SUC2 erg5::KlLEU2-TEF1p-sDrDHCR24, erg6::KlURA3- TEF1p-sDrDHCR7 7 erg6::D24/erg5::D 7(#S1) MATa ura3-52 trp1-289 leu2-3,112 his3-D1 MAL2-8C this study SUC2 erg5::KlLEU2-TEF1p-sDrDHCR7, erg6::KlURA3- TEF1p-sDrDHCR24 8 .sub.NTSD24/erg5::D24/erg6:: MATa ura3-52 trp1-289 leu2-3,112 his3-D1 MAL2-8C this study D7(.sub.NTSD24/#19) SUC2 erg5::KlLEU2-TEF1p-sDrDHCR24, erg6::KlURA3- TEF1p-sDrDHCR7, NTS-DHCR24-TRP1 9 .sub.NTSD24/erg6::D24/erg5:: MATa ura3-52 trp1-289 leu2-3,112 his3-D1 MAL2-8C this study D7(.sub.NTSD24/#S1) SUC2 erg5::KlLEU2-TEF1p-sDrDHCR7, erg6::KlURA3- TEF1p-sDrDHCR24, NTS-DHCR24-TRP1 10 .sub.NTSD24D7/erg5::D24/ MATa ura3-52 trp1-289 leu2-3,112 his3-D1 MAL2-8C this study erg6::D7(.sub.NTSD24D7/#19) SUC2 erg5::KlLEU2-TEF1p-sDrDHCR24, erg6::KlURA3- TEF1p-sDrDHCR7, NTS-DHCR24-DHCR7-TRP1 11 .sub.2uD24D7/erg6::D24/erg5:: MATa ura3-52 trp1-289 leu2-3,112 his3-D1 MAL2-8C this study D7(.sub.2uD24 D7/#S1) SUC2 erg5::KlLEU2-TEF1p-sDrDHCR7, erg::KlURA3- TEF1p-sDrDHCR24/Y2pH-DH CR24-DHCR7 12 E3E2/.sub.NTSD24D7/erg5:: MATa ura3-52 trp1-289 leu2-3,112 his3-D1 MAL2-8C this study D24/erg6::D7 SUC2 erg::KlLEU2-TEF1p-sDrDHCR24, erg6::KlURA3- TEF1p-sDrDHCR7, NTS-DHCR24-DHCR7- TRP1/Y2pH-ERG3-ERG2 13 E3E27- MATa ura3-52 trp1-289 leu2-3,112 his3-D1 MAL2-8C this study 2/.sub.NTSD24D7/erg5:: SUC2 D24/erg6:: D7 erg5::KlLEU2-TEF1p-sDrDHCR24, erg6::KlURA3- TEF1p-sDrDHCR7, NTS-DHCR24-DHCR7- TRP1/Y2pH-ERG3-ERG27-2 14 UPC2- MATa ura3-52 trp1-289 leu2-3,112 his3-D1 MAL2-8C this study 1/.sub.NTSD24D7/erg5::D24/ SUC2 erg6::D7 erg5::KlLEU2-TEF1p-sDrDHCR24, erg6::KlURA3- TEF1p-sDrDHCR7, NTS-DHCR24-DHCR7- TRP1/Y2pH-ERG3-ERG2 15 .sub.NTSD24D7/WT MATa ura3-52 trp1-289 leu2-3,112 his3-D1 MAL2-8C this study SUC2 NTS-DHCR24-DHCR7-TRP1 16 E3E2/.sub.NTSD24D7/WT MATa ura3-52 trp1-289 leu2-3,112 his3-D1 MAL2-8C this study SUC2 NTS-DHCR24-DHCR7-TRP1/Y2pH-ERG3-ERG2 17 E3E27-2/.sub.NTSD24D7/ MATa ura3-52 trp1-289 leu2-3,112 his3-D1 this study WT MAL2-8C SUC2 NTS-DHCR24-DHCR7-TRP1/Y2pH-ERG3 ERG27ERG2 fusion 18 UPC2-1/.sub.NTSD24D7/ MATa ura3-52 trp1-289 leu2-3,112 his3-D1 MAL2-8C this study WT SUC2 NTS-DHCR24-DHCR7-TRP1/Y2pH-ERG3 ERG27ERG2 fusion 19 erg6::D7/UPC2-1/ MATa ura3-52 trp1-289 leu2-3,112 his3-D1 MAL2-8C this study .sub.NTSD24D7 SUC2 NTS-DHCR24-DHCR7-TRP1/Y2pH-ERG3- ERG27ERG2 fusion/erg6::KlURA3-TEF1p-sDrDHCR7 20 are2 MATa ura3-52 trp1-289 leu2-3,112 his3-D1 MAL2-8C this study SUC2 are2::HIS3 21 are2/.sub.NTSD24D7/ MATa ura3-52 trp1-289 leu2-3,112 his3-D1 MAL2-8C this study erg5::D24/erg6::D7 SUC2 erg5::KlLEU2-TEF1p-sDrDHCR24, erg6::KlURA3- TEF1p-sDrDHCR7, NTS-DHCR24-DHCR7-TRP1 are2::HIS3 22 .sub.NTSD7/.sub.NTSD24/#S1 MATa ura3-52 trp1-289 leu2-3,112 his3-D1 MAL2-8C this study SUC2 erg5:: KlLEU2 TEF1p-sDrDHCR7, erg::KlURA3- TEF1p-sDrDHCR24, NTS-DHC R24-TRP1/NTS- DHCR7-HIS3 23 erg5::ccD24 MATa ura3-52 trp1-289 leu2-3,112 his3-D1 MAL2-8C this study SUC2 erg5::KlLEU2-TEF1p-sDrDHCR24(cc) 24 erg6::ccD7 MATa ura3-52 trp1-289 leu2-3,112 his3-D1 MAL2-8C this study SUC2 erg6::KlURA3-TEF1p-sDrDHCR7(cc) 25 erg6::ccD24 MATa ura3-52 trp1-289 leu2-3,112 his3-D1 MAL2-8C this study SUC2 erg6::KlLEU2-TEF1p-sDrDHCR24(cc) 26 erg5::ccD7 MATa ura3-52 trp1-289 leu2-3,112 his3-D1 MAL2-8C this study SUC2 erg5::KlURA3-TEF1p-sDrDHCR7(cc) 27 erg5::ccD24/erg6::ccD7 MATa ura3-52 trp1-289 leu2-3,112 his3-D1 MAL2-8C (#cc19) SUC2 erg5::KlLEU2-TEF1p-sDrDHCR24 (cc), erg6::KlURA3-TEF1p-sDrDHCR7 (cc) 28 erg6::ccD24/erg5::ccD7 MATa ura3-52 trp1-289 leu2-3,112 his3-D1 MAL2-8C (#ccS1) SUC2 erg5::KlLEU2-TEF1p-sDrDHCR7(cc), erg6::KlURA3-TEF1p-sDrDHCR24(cc) 29 tHMG1/#cc19 MATa ura3-52 trp1-289 leu2-3,112 his3-D1 MAL2-8C this study SUC2 erg5::KlLEU2-TEF1p-sDrDHCR24(cc), erg6::KlURA3-TEF1p-sDrDHCR7(cc)/NTS-t HMG1- TRP1 30 tHMG1/#ccS1 MATa ura3-52 trp1-289 leu2-3,112 his3-D1 MAL2-8C this study SUC2 erg5::KlLEU2-TEF1p-sDrDHCR7(cc), erg6::KlURA3-TEF1p-sDrDHCR24(cc)/NTS-t HMG1- TRP1
Yeast Transformation (LiAc/PEG Method)

(25) To perform transformation using the prepared vectors or cassettes, a strain precultured in a YPD (2% (w/v) bacto-peptone, 1% (w/v) bacto-yeast extract, and 2% (w/v) D-glucose) liquid medium was grown in a 500 mL baffled flask to an initial OD.sub.600 of 0.2, and 50 mL of the medium was cultured in a rotary shaker at 30 C. and 180 rpm. After 6 to 7 hours, the cells were cultured until OD.sub.600 reached 1.0, and centrifuged at 4 C. and 4,000 rpm for 10 minutes. After removing a supernatant, 1 mL of a LiAc/TE buffer solution (0.01 M Tris-HCl, 1 mM EDTA, 0.1 M LiAc, pH 7.5) was added to the pellet, and the pellet was suspended by pipetting and then centrifuged at 13,000 rpm for 1 minute, thereby obtaining a pellet. The pellet was resuspended in 500 L of a LiAc/TE buffer solution, thereby preparing competent cells. The resulting cells were divided into five tubes at 100 L each, and 2 L of a recombinant vector or cassette, 10 L of salmon sperm DNA and 600 L of a PEG/LiAc buffer solution (50% polyethylene glycol), 0.01 M Tris-HCl, 1 mM EDTA, 0.1 M LiAc, pH 7.5) were mixed in each tube, followed by gentle pipetting 3 to 4 times. After the tube was left at 30 C. for 30 minutes, 70 L of DMSO was added and mixed by pipetting, followed by thermal treatment at 42 C. for 15 minutes. The tube was left on ice for 3 minutes, and centrifuged at 13,000 rpm for 1 minute, thereby obtaining a pellet, and the pellet was suspended with sterilized distilled water, and plated on a specific amino acid (LEU or TRP or HIS) or base (URA)-deleted SC synthesis-based selective medium SC-LEU, SC-URA, SC-LUE-URA-TRP or SC-LUE-URA-TRP-HIS (0.67% yeast nitrogen base without amino acids, 2% glucose, 0.77 g/L drop-out amino acid mixture supplemented without leucine, tryptophan, histidine, or uracil in combination) to culture the cells at 30 C. for 48 hours, thereby obtaining a transformant (Hill J et. al. 1991).

Example 1: Preparation of Sterol-Producing Strains Through ERG5 and ERG6 Deletion and Co-Insertion of DHCR24 and DHCR7

(26) First, for ERG5 and ERG6 deletion, two PCR fragments, such as N- and C-fragments at which homologous recombination would occur, were obtained using an erg5 dN fw, erg5 dN rv, erg5 dC fw, erg5 dC rv, erg6 dN fw, erg6 dN rv, erg6 dC fw or erg6 dC ry primer shown in Table 1, and then subjected to fusion PCR, thereby obtaining pT-ERG5dNC or pT-ERG6dNC. DNA fragments of DHCR7 and DHCR24 were recovered from pMKRQ-DrDHCR24 and pMKRQ-DrDHCR7 in which codon-optimized zebrafish-derived DHCR24 and DHCR7 genes were cloned by a codon adaptation index method for yeast through PCR, and ligated with 411 bp TEF1 promoter and 314 bp GALT terminator, which were obtained by PCR, thereby constructing vectors pT-DHCR24 and pT-DHCR7. Subsequently, TEF1p-DHCR7-GAL7t and TEF1p-DHCR24-GAL7t fragments obtained from these vectors were inserted into BamHI/XbaI sites in the N- and C-fragments of the vectors pT-ERG5dNC and pT-ERG6dNC, and K1URA3 and K1LEU2 were obtained from vectors pUG73 and pUG72 and inserted into NotI sites, thereby obtaining final vectors pT-erg5::DHCR24-LEU2, pT-erg6::DHCR7-URA3, pT-erg6::DHCR24-LEU2, and pT-erg5::DHCR7-URA3 (FIGS. 4A, 4B, 4C and 4D). The final vectors were treated with SphI/MluI to recover erg5::DHCR24-LEU2, erg6::DHCR7-URA3, erg6::DHCR24-LEU2 and erg5::DHCR7-URA3 cassettes and transformed into a CENPK strain by a LiAc/PEG method, and then transformants were selected from SC-LEU, SC-URA and SC-LEU-URA media, thereby preparing recombinant strains erg5::D24, erg6::D7, erg6::D24, erg5::D7, erg5::24/erg6::D7 and erg6::D24/erg5::D7 (FIG. 2, Step 1, and Table 3).

Example 2: Preparation of Multiple DHCR24 Integration Cassette and Selection of Recombinant Yeast

(27) For multiple integration of cholesterol biosynthetic genes, an NTS-DHCR24-86TRP1 cassette was constructed using the rDNA-NTS-based multiple integration cassette system (Moon et al., 2016) developed by the inventors. The NTS-DHCR24-86TRP1 cassette was recovered by treating pT-NTS-DHCR24-86TRP1, which was constructed by inserting TEF1p-DHCR24-GALt7 fragment derived from pT-erg6::DHCR24-LEU2 into pT-NTS-86TRP1 vector at a BamHI site (FIG. 4E), with SphI/NsiI, and then introduced into recombinant strains erg5::D24/erg6::D7 (#19, Accession No. KCTC 13889BP) and erg6::D24/erg5::D7 (#S1, Accession No. KCTC 13888BP), respectively. Transformants were selected from a SC-LEU-URA-TRP medium, thereby preparing recombinant strains NThD24/#19 or NTS D24/#S1 (FIG. 2, Step 2).

Example 3: Construction of Multiple DHCR24/DHCR7 Integration Cassette and Selection of Recombinant Yeast

(28) Vector pT-NTS-DHCR24-DHCR7-86TRP1 (FIG. 4F) having both of DCHR24 and DHCR7 expression cassettes was constructed by amplifying each of 837-bp ScACT1 promoter using ACT1p fw and ACT1p ry primers, 1458-bp DHCR7 gene using DHCR7 fw2 and DHCR7 rv2 primers, and 252-bp CYC1 terminator using CYClt fw and CYClt ry primers, making these amplified products a single fragment through fusion PCR, and inserting the fragment into the conventional vector pT-NTS-DHCR24-86TRP1 at a KpnI site. The constructed pT-NTS-DHCR24-DHCR7-86TRP1 was treated with SphI/NsiI to recover a NTS-DHCR24-DHCR7-86TRP1 cassette, transformed into recombinant strain erg5::D24/erg6::D7 (#19), and selected in a SC-LEU-URA-TRP medium, thereby manufacturing recombinant strain NTS D24D7/#19 (Accession No. KCTC 13884BP) (FIG. 2, Step 3, right panel).

(29) In addition, vector pT-NTS-86TRP1-DHCR7 was constructed by treating vector pT-NTS-86TRP1-DHCR24-DHCR7 with BamHI to remove DHCR24. Afterward, pT-NTS-101HIS3-DHCR7 was constructed by removing 86TRP1 by treating the vector pT-NTS-86TRP1-DHCR7 with SmaI/NotI and inserting HIS3 fragment having a 101-bp promoter obtained by PCR using primers 101HIS3 fw and 101HIS3 ry (FIG. 12A). After a pT-NTS-101HIS3-DHCR7 cassette was obtained by treatment with SpeI/XbaI, the cassette was transformed into NTS D24/#S1 strain by a LiAc/PEG method and selected from a SC-HIS medium, thereby obtaining .sub.NTSD7/.sub.NTSD24/#S1 strain (Accession No. KCTC 13885BP). To confirm the number of cassettes introduced onto the chromosome of the prepared .sub.NTSD7/.sub.NTSD24/#S1 strain, the number of the introduced copies was analyzed through qPCR performed on the corresponding strain. It was confirmed that approximately 4 DHCR7 genes and approximately 2 DHCR24 genes were introduced into the chromosome (FIG. 12B).

Example 4: Construction of Episomal Plasmid-Based DHCR24/DHCR7 Expression Vector

(30) Vector Y2pH-DHCR7-DHCR24 using two micro yeast episomal plasmids (FIG. 4G) was constructed by inserting DHCR24-DHCR7 obtained from pT-NTS-DHCR24-DHCR7-86TRP1 into vector Y2pH at a BamHI/XhoI site, transformed into recombinant strain erg6::D24/erg5::D7 (#S1) by a LiAc/PEG method, and then selected from a SC-LEU-URA-HIS medium, thereby obtaining recombinant strain 2u D24D7/#S1 (FIG. 2, Step 3, left panel).

Example 5: Preparation of ERG27-ERG2 Fusion Gene and ERG3-Overexpressing Strain

(31) For ERG2 and ERG3 expression, vector Y2pH-ERG3-ERG2 (FIG. 4F) was constructed by amplifying each of 714-bp ScTDH3 promoter using TDH3p fw and TDH3p ry primers, 1098-bp ScERG3 gene using ERG3 fw and ERG3 ry primers, and 367-bp ScTEF1 terminator using TEF1t fw and TEF1t ry primers, making the amplified products a single fragment through fusion PCR, and amplifying each of 836-bp ScTEF2 promoter using TEF2p fw and TEF2p ry primers, 666-bp ScERG2 gene using ERG2 fw and REF2 ry primers, and 484-bp ScTDH3 terminator using TDH3t fw and TDH3t ry primers, making the amplified products a single fragment through fusion PCR, and inserting the resulting PCR fragments into a conventional Y2pH vector at a BamHI/XhoI site.

(32) Y2pH-ERG3-ERG27-2 fusion vector (FIG. 4G) was constructed by inserting the ERG27 and ERG2, that obtained through fusion PCR using PCR product 1 using ERG27-2 fw1and ERG27-2 rv1 and PCR product 2 using ERG27-2 fw2 and ERG27-2 rv2, into Y2pH-ERG3-ERG2 vector at an SphI site instead of ERG2. The constructed Y2pH-ERG3-ERG2 and Y2pH-ERG3-ERG27-2 fusion vectors were transformed into NTS D24D7/#19 strain, and selected from a SC-LEU-URA-TRP-HIS medium, thereby preparing recombinant strains E3E2/.sub.NTSD24D7/#19 and E3E27-2/.sub.NTSD24D7/#19, respectively.

Example 6: Preparation of UPC2-1-Introduced Strain

(33) YCpH-np-UPC2 constructed by the inventors using 480-bp UPC2 promoter and yeast centromere plasmids (YCp) was transformed into .sub.2uD24D7/#19 strain, and selected from a SC-LEU-URA-TRP-HIS medium, thereby preparing recombinant strain UPC2-1/NTS D24D7/#19 (FIG. 2, Step 4, left panel).

Example 7: Preparation of erg6::D7/UPC2-1/.SUB.NTS.D24D7 Strain

(34) Recombinant strain .sub.NTSD24D7/WT was obtained by transforming the previously constructed NTS-DHCR24-DHCR7-86TRP1 cassette into a wild-type CEN.PK strain, and selecting the transformant from a SC-TRP medium. Afterward, the constructed Y2pH-ERG3-ERG2, Y2pH-ERG3-ERG27-2 and YCpH-np-UPC2 were introduced, thereby preparing E3E2/.sub.NTSD24D7/WT, E3E27-2/.sub.NTSD24D7/WT and UPC2-1/.sub.NTSD24D7/WT strains, respectively. Among these strains, the UPC2-1/.sub.NTSD24D7/WT strain was selected, and ERG6 gene was deleted using an erg6::DHCR7-URA3 cassette, thereby preparing erg6::D7/UPC2-1/.sub.NTSD24D7 strain (FIG. 3).

Example 8: Preparation of Strain from which ARE2, which is the Main Gene for Sterol Esterification, is Deleted

(35) For ARE2 deletion using homologous recombination, N- and C-fragments were obtained using ARE2 dN fw, ARE2 dN fw, ARE2 dC fw, and ARE2 dC fw primers through PCR, and then subjected to fusion PCR, thereby obtaining pT-ARE2dNC. Afterward, a final vector pT-ARE2dNC-HIS was obtained by inserting ScHIS3 at an XhoI/EcoRV site between the two fragments, an ARE2dNC-HIS cassette was obtained by SphI/MluI treatment, transformed into .sub.NTSD24D7/#19 strain by a LiAc/PEG method, and selected from a SC-LEU-URA-TRP-HIS medium, thereby preparing a recombinant strain are2/.sub.NTSD24D7/#19.

Example 9: Construction of ERG5/ERG6 Deletion and Co-Insertion of DHCR24/DHCR7 Using Codon-Optimized ccDHCR24 and ccDHCR7 by Codon Context Method and Selection of Recombinant Yeast

(36) The previously-constructed vectors pT-ERG5dNC-DrDHCR7, pT-ERG5dNC-DrDHCR24, pT-ERG6dNC-DrDHCR7 and pT-ERG6dNC-DrDHCR7 were treated with PstI/SalI to be prepared as backbones, and inserts obtained by treating ccDHCR24 and ccDHCR7 fragments obtained by PCR using primers ccD7 fw, ccD7 rv, ccD24 fw and ccD24 ry with KpnI/SalI were ligated to vectors pMKRQ-sDrDHCR7(cc) and pMKRQ-sDrDHCR24(cc) in which ccDHCR24 and ccDHCR7 genes were synthesized by a codon context method, thereby obtaining vectors pT-ERG5dNC-ccDHCR7, pT-ERG5dNC-ccDHCR24, pT-ERG6dNC-ccDHCR7 and pT-ERG6dNC-ccDHCR24. Subsequently, final vectors pT-erg5::ccDHCR24-LEU2, pT-erg6::ccDHCR7-URA3, pT-erg6::ccDHCR24-LEU2 and pT-erg5::ccDHCR7-URA3 were obtained by inserting K1URA3 and K1LEU2 derived from pUG73 and pUG72 vectors into NotI sites (FIG. 13A to 13D). The final vectors were treated with SphI/MluI to recover erg5::ccDHCR24-LEU2, erg6::ccDHCR7-URA3, erg6::ccDHCR24-LEU2 and erg5::ccDHCR7-URA3 cassettes, transformed into CEN.PK strain by a LiAc/PEG method, and selected from SC-LEU, SC-URA and SC-LEU-URA media, thereby preparing recombinant strains erg5::ccD24, erg6::ccD7, erg6::ccD24, erg5::ccD7, erg5::ccD24/erg6::ccD7 (=#cc19, Accession No. KCTC 13886BP), and erg6::ccD24/erg5::ccD7 (=#ccS1, Accession No. KCTC 13882BP) (Table 3).

Example 10: Improvement in Cholesterol Production Amount of Recombinant Strains #cc19 and #ccS1 by Multiple tHMG1 Integration

(37) Vector pT-NTS-86TRP1-tHMG1 enabling multiple integration was constructed by inserting HMG1 gene from which 552 N-terminal amino acids were deleted and amplified using primers tHMG1-fw and tHMG1-ry shown in Table 1 into an EcoRI/SalI site of pT-NTS-86TRP1 (FIG. 14A). An NTS-86TRP1-tHMG1 cassette was obtained by treating the constructed pT-NTS-86TRP1-tHMG1 vector with SpeI/NsiI, transformed into erg5::ccD24/erg6::ccD7 (=#cc19) and erg6::ccD24/erg5::ccD7 (=#ccS1) strains by a LiAc/PEG method, and selected from a SC-TRP medium, thereby constructing recombinant strains tHMG1/erg5::ccD24/erg6::ccD7 (=tHMG1/#cc19, Accession No. KCTC 13887BP) and tHMG1/erg6::ccD24/erg5::ccD7 (=tHMG1/#ccS1, Accession No. KCTC 13883BP) (Table 3). To confirm the number of cassettes introduced onto the chromosomes of the constructed strains tHMG1/#cc19 and tHMG1/#ccS1, the corresponding strains were analyzed to determine the number of introduced copies through qPCR, confirming that approximately 3 to 4 cassettes were introduced (FIG. 14B).

EXPERIMENTAL EXAMPLES

(38) Analysis of Insert Copy Number Using qPCR

(39) To confirm the copy number of target gene expression cassettes inserted into the prepared recombinant strain, chromosomal DNA was recovered and used as a template to perform qPCR.

(40) Analysis of Metabolic By-Products and Residual Carbon Sources

(41) After final culture, the residual amounts of metabolic by-products (e.g., ethanol or acetate) accumulated in a supernatant and glucose, which is a carbon source added in culture, were measured. A sample used in analysis was the final culture solution of the main culture, which was centrifuged (12,000 rpm, 10 min), followed by analyzing a supernatant. The analysis was performed using a kit (Roche/COWIE) for ethanol, acetate or glucose measurement of a bio process analyzer.

(42) HPLC-UV/Vis-Based Analysis for Cholesterol and Precursor Thereof

(43) For a HPLC assay, a Synthetic Complete medium [SC medium (0.67% yeast nitrogen base without amino acids, 2% glucose, 0.77 g/L drop-out amino acid mixture supplemented with all required amino acids)] was inoculated with 1 or 2 colonies of the strain to perform seed culture, and then the cells were grown in a SC or YPD medium to reach OD600 of 0.3 to 0.5 after initial inoculation. To extract total sterols, 10 mL of the sample obtained after 3- to 6-day culture (28 C., 220 rpm) was recovered, and then a 0.05 g/wet weight of pellet was suspended in 1 mL KOH/EtOH (3:2) (KOH final concentration: 4.5 M) mixed solution, cultured at 85 C. for 1 hour, and mixed with 0.5 mL heptane (Sigma) using a bead beater (6,000 rpm, 15 sec, repeat three times). The mixed sample was centrifuged (12,000 rpm, 10 min, 25 C.) to recover 0.5 mL of a heptane layer from a supernatant (12,000 rpm, 10 min, 25 C.) and dried, and then HPCL analysis was performed on a sample dissolved by adding 200 L of acetone. To extract free sterols, 0.5 mL of a chloroform:MeOH (2:1) mixture was added to a pellet, and mixed using a bead beater (6,000 rpm, 15 sec, repeat three times). The mixed sample was centrifuged (12,000 rpm, 10 min, 25 C.), an organic solvent layer was recovered and dried, 250 L hexane was added to the dry pellet to dissolve, followed by drying again. After complete drying, a HPLC assay was performed on the sample dissolved by adding 200 L acetone. In the HPLC assay, a column was Cosmosil C18-PAQ (4.6 mm*250 mm), a flow rate was 1 mL/min, an analysis solvent was 90% acetonitrile, and an analysis time was 50 min. Peaks corresponding to cholesterol and precursors thereof were analyzed at 203 nm using a UV/Vis detector.

(44) Analysis of Productivity of HPLC-CAD-Based Cholesterol and Precursor Thereof

(45) Cell culture for HPLC-CAD analysis to confirm the productivity of cholesterol and precursors thereof in the prepared strain was the same as described above in the HPLC-based analysis. For extraction of cholesterol and precursors thereof, 50 mL of a sample cultured for 3 to 6 days (28 C., 220 rpm) and resuspended in 20 mL of a resuspension solution (15% KOH (w/v), 0.125% pyrogallol (w/v), 71% MeOH (v/v)). The resulting product was reacted at 85 C. for 2 hours, cooled at room temperature, and mixed with 5 mL of petroleum ether by vortexing for 5 minutes. The mixed sample was centrifuged (3,000 g, 5 min), and a supernatant was recovered. The extraction process by adding petroleum ether was repeated twice, and by using 3 mL of petroleum ether, all of a supernatant was recovered. The recovered supernatant was dried using a rotational vacuum concentrator, and then HPLC-CAD analysis was performed on a sample dissolved by adding 1 mL of methanol to the dry sample. In HPLC-CAD analysis, a column was Capcellpak (C18, 4.6 mm250 mm, 5 m), a mobile phase was methanol, and a flow rate and conditions are as shown in Table below. Analysis time was 45 min.

(46) TABLE-US-00005 Time Flow % A % B (min) (mL/min) (50% methanol) (100% methanol) 0.0 0.5 10 90 10.0 0.5 0 100 40.0 0.5 0 100 40.1 0.5 10 90 45.0 0.5 10 90

(47) As a result of analyzing 7 types of reference standards (zymosterol, ergosterol, lathosterol, 7-dehydrocholesterol, 7-dehydrodesmosterol, desmosterol and cholesterol) by the analysis method described above (see FIG. 9), the HPLC peak retention time of ergosterol and desmosterol overlapped with 30.7 min and 30.4 min, respectively, but only ergosterol was produced in a wild-type yeast strain, and in a recombinant yeast strain prepared to produce cholesterol and precursors thereof, only desmosterol was produced. Therefore, final productivity analysis was performed through a corresponding analysis method.

Experimental Example 1: HPLC Assay on Sterol-Producing Strain Prepared by erg5, erg6 Deletion and DHCR24, DHCR7 Expression

(48) As a result of HPLC-UV/Vis analysis, a cholesterol peak was able to be found in the erg5::D24/erg6::D7 or, erg6::D24/erg5::D7 strain, the cholesterol productivity of the erg5::D24/erg6::D7 (#19) strain was 3.1 ppm, and the cholesterol production amount of the erg6::D24/erg5::D7 (#S1) strain was 7.5 ppm (Table 4). However, the content of a cholesterol precursor, such as zymosterol, dehydrodesmosterol or desmosterol was very high (FIG. 5).

Experimental Example 2: HLPC Assay on Sterol-Producing Strain Prepared by Multiple DHCR24 Integration

(49) As a result of the HPLC assay on a strain into which an NTS-DHCR24-86TRP1 cassette was additionally introduced using a rDNA-NTS-based multiple integration cassette system developed by the inventors to increase the production amount of cholesterol (a .sub.NTSD24/#19 recombinant strain), a peak of 7.4 ppm cholesterol production was found, which is approximately 2.4-fold higher than a #19 strain (FIG. 6, Table 4). In addition, in a .sub.NTSD24/#S1 recombinant strain, a peak of 11.5 ppm cholesterol production was found, which is approximately 1.5-fold higher than a #S1 strain (FIG. 6, Table 4).

Experimental Example 3: qPCR and HPLC Assay for Recombinant Strain Prepared by DHCR24, DHCR7 Multiple Integration

(50) As a qPCR result of analyzing the number of cassettes in a .sub.NTSD24D7/#19 recombinant strain obtained by multiple integration of an NTS-DHCR24-DHCR7-86TRP1 cassette having both cassettes expressing DHCR24 and DHCR7 genes, it was confirmed that strains having 3 or 4 cassettes were able to be obtained (FIG. 7A). As a result of HPLC analysis, in the .sub.NTSD24D7/erg5::D24/erg6::D7 (.sub.NTSD24D7/#19) recombinant strain, a peak of 9.0 ppm cholesterol production was able to be found, which is approximately 2.9-fold higher than an erg5::D24/erg6::D7(#19) strain (FIG. 7B). In addition, as a result of a HPLC assay, in a .sub.2uD24D7/#S1 recombinant strain, a peak of 11.1 ppm cholesterol production was also able to be found, which is approximately 1.5-fold higher than the #S1 strain (FIG. 7C, Table 4).

Experimental Example 4: HPLC Assay for Recombinant Strain Prepared through ERG27-ERG2 Fusion Gene, ERG3 and UPC2-1 Overexpression

(51) As a result of a HPLC assay for strains further expressing ERG27, ERG2 and ERG3 genes involved in cholesterol production from zymosterol to further increase cholesterol production efficiency of the prepared .sub.NTSD24D7/#19 recombinant strain, compared to the .sub.NTSD24D7/#19, it was confirmed that the difference in cholesterol production amount was not large in E3E2/.sub.NTSD24D7/#19, E3E27-2/.sub.NTSD24D7/#19, and UPC2-1/.sub.NTSD24D7/#19 recombinant strains (Table 4, FIG. 8). However, ERG3, ERG27-2 or UPC2-1-introduced recombinant strains showed significantly increased cholesterol precursor productivity.

Experimental Example 5: Analysis of Production Amounts of Cholesterol and Precursor Thereof in HPLC-CAD-Based Recombinant Strains

(52) The productivity of cholesterol and precursors thereof was analyzed by a HPLC-CAD-based analysis method, and a result thereof is shown in FIG. 9. Compared to a wild-type strain, it was confirmed that the recombinant strain #19 (erg5::D24/erg6::D7) produced 7-dehydrodesmosterol, zymosterol, desmosterol, 7-dehydrocholesterol and cholesterol in high yields.

(53) The production amounts of cholesterol and precursors thereof in the recombinant strain prepared by the method described above are summarized in Table 4.

(54) TABLE-US-00006 TABLE 4 HPLC-CAD-based comparative analysis of production amounts of cholesterol and precursor thereof in recombinant strains introduced culture Concentration (ppm) Strains gene (copy #) medium E Z L 7-dc 7-dm D C OD.sub.600 nm CEN.PK(WT) SC 5.5 6.7 2.2 0 0 0 0 12.7 #19 DHCR7(1), 0 10.5 0 1.9 23.4 4.5 3.1 8.3 (erg5::D24/erg6::D7) DHCR24(1) #S1 0 25.0 0 3.4 19.8 5.2 7.5 16.8 (erg6::D24/erg5::D7) .sub.NTSD7/#19 DHCR7(5), 0 7.3 0 0.5 17.6 10.6 3.8 7.9 DHCR24(1) .sub.NTSD7/#S1 DHCR7(4), 0 21.9 0 1.9 19.9 15.0 9.0 20.7 DHCR24(1) .sub.NTSD24/#19 DHCR7(1), 0 16.4 0 4.3 15.0 2.6 7.4 9.1 DHCR24(4) .sub.NTSD24/#S1 DHCR7(1), 0 22.2 0 2.5 13.2 6.3 11.5 19.1 DHCR24(4) .sub.NTSD24D7/#19 DHCR7(4), 0 14.1 0 1.9 16.4 6.3 9.0 9.3 DHCR24(4) .sub.2D24D7/#S1 DHCR7(~10), 0 17.8 0 2.1 11.2 5.8 11.1 9.5 DHCR24(~10) E3E2/.sub.NTSD24D7/#19 DHCR7(4), 0 8.4 0 1.9 17.0 7.0 11.5 7.2 DHCR24(4), ERG3(~10), ERG2(~10) E3E27-2/.sub.NTSD24D7/#19 DHCR7(4), 0 17.0 0 2.6 28.1 6.2 9.0 6.2 DHCR24(4), ERG3(~10), ERG27-ERG2 fusion(~10) UPC2-1/.sub.NTSD24D7/#19 DHCR7(4), 0 12.2 0 2.0 17.2 5.3 7.9 7.2 DHCR24(4), UPC2-1(1~2)

(55) (E: Ergosterol, Z: Zymosterol, 7-dc: 7-dehydrocholesterol, 7-dm: 7-dehydrodesmosterol, D: Desmosterol, C: Cholesterol)

(56) (Strains: CEN.PK (WT), #19, #S1, .sub.NTSD7/#19, .sub.NTSD7/#S1, .sub.NTSD24/#19, .sub.NTSD24/#S1, .sub.NTSD24D7/#19, .sub.2D24D7/#S1, E3E2/.sub.NTSD24D7/#19, E3E27-2/.sub.NTSD24D7/#19, UPC2-1/.sub.NTSD24D7/#19)

Experimental Example 6: HPLC-UV/Vis Assay for Recombinant Strain from which ARE2, which is a Main Gene for Sterol Esterification, was Deleted

(57) Among ARE1 and ARE2 genes (Hohmann H-P et. al. 2017) involved in esterification and lipid droplet storage to store surplus intracellular sterols in yeast cells, it was tried to delete ARE2, which plays a major role in aerobic growth, in the .sub.NTSD24D7/#19 strain using a gene disruption technique by homologous recombination (FIG. 10A). In the case of a sample prepared by an extraction method in which a free cholesterol form was maintained, it was observed that there was not significant change in cholesterol amount in the wild-type strain background, but a dehydrodesmosterol amount among the precursors was greatly reduced (FIG. 10B). This shows that, in the case of dehydrodesmosterol, it is mostly present in an esterified form, but cholesterol is mostly present in a free form. As a result of a HPLC assay for the prepared are2/NTS D24D7/#19 strain, there was no significant difference in cholesterol amount, and the amount of dehydrodesmosterol which was accumulated in a large quantity was slightly reduced. These results suggest that the most of the cholesterol produced in the .sub.NTSD24D7/#19 strain is in a free sterol form.

Experimental Example 7: Analysis of Sterol-Producing Recombinant Yeast S. Cerevisiae for Wild-Type Strain

(58) Among the previously attempted strategies, in a strategy in which a wild-type strain was first subjected to the multiple integration of NTS-DHCR24-DHCR7-86TRP1 cassettes and then ERG6 deletion as a method of increasing the number of inserted NTS-DHCR24-DHCR7-86TRP1 cassettes on the chromosome using a multiple integration cassette system, as a first step, the number of inserted cassettes in the prepared .sub.NTSD24D7/WT recombinant strain was analyzed by qPCR, thereby obtaining several candidate strains in which 4 to 10 cassettes were inserted (FIG. 11A). Afterward, in a HPLC-UV/Vis assay, an ergosterol peak was greatly reduced in a candidate group (.sub.NTSD24D7/WT #8) in which 7 cassettes were inserted, but the peak estimated as campesterol showed the highest value (FIG. 11B). Accordingly, in a subsequent experiment, E3E2/.sub.NTSD24D7/WT and E3E27-2/.sub.NTSD24D7/WT strains were prepared using the 7 cassette-inserted candidate group (.sub.NTSD24D7/WT #8), and as a result of HPLC-UV/Vis assay, there was no significant difference from the .sub.NTSD24D7/WT strain. Meanwhile, in the case of a UPC2-1/NTS D24D7/WT recombinant strain, due to overall activation of an ergosterol biosynthesis pathway, rather, ergosterol production increased (FIG. 11C). Subsequently, as a result of a HPLC-UV/Vis assay for the prepared erg6::D7/UPC2-1/.sub.NTSD24D7 strain, a cholesterol production amount was not better, compared to the .sub.NTSD24D7/erg5::D24/erg6::D7 (.sub.NTSD24D7/#19) recombinant strain, which showed the highest cholesterol production amount (FIG. 11D).

Experimental Example 8: Analysis of Amounts of Growth and by-Product Accumulation of Sterol-Producing Recombinant Strains #S1 and #19

(59) As a result of confirming the amount of metabolic by-product accumulation of the prepared strain, by-products such as ethanol and acetate were accumulated after the final culture in the #19 (erg5::D24/erg6::D7) strain, whereas there were a small quantity of acetate accumulation but no accumulation of a major metabolic by-product, ethanol, in the #S1 (erg6::D24/erg5::D7) strain, and therefore, the same pattern as the wild type was able to be confirmed. In addition, as a result of analysis of a cell growth amount, since the OD600 of the #19 (erg5::D24/erg6::D7) strain was approximately 14.8, it was confirmed that growth was inhibited compared to the OD600 of each of the wild-type strain (WT) and the #S1 (erg6::D24/erg5::D7) strain, which were approximately 46.5 and 57.3 (Table 5).

(60) TABLE-US-00007 TABLE 5 Comparative analysis of amounts of growth and by-product accumulation in recombinant strains #S1 and #19 By-product & Cell culture Residual C-source(mg/L) growth Strains medium Acetate Ethanol Glucose OD.sub.600 nm CEN.PK(WT) YPD 0 0 0 46.5 #19 385 7501 0 14.8 (erg5::D24/erg6::D7) #S1 8 0 0 57.3 (erg6::D24/erg5::D7)

Experimental Example 9: Analysis of Production Amounts of Cholesterol and Precursor Thereof in #S1-Derived Strain and DHCR Gene Codon-Optimized Strains in SC or YPD Medium

(61) As a result of the analysis of a cell production amount and a by-product accumulation amount, it is suggested that, compared to the #19 (erg5::D24/erg6::D7) strain, the #S1 (erg6::D24/erg5::D7) strain with high growth and less by-product accumulation is more suitable as an industrial strain. Accordingly, the cholesterol and precursor production amounts of the #S1-derived recombinant strains cultured in a SC or YPD medium were measured, and detailed comparative analysis was performed using a HPLC-CAD-based LC chromatogram (Table 6). In the culture in the YPD medium, compared to the culture in the SC medium, cell growth was high and a total cholesterol production amount was large. On the other hand, in the culture in the SC medium, it was able to be confirmed that the cholesterol production amount per cell was high.

(62) TABLE-US-00008 TABLE 6 Analysis of production amount of cholesterol and precursor thereof in #S1 (erg6::D24/erg5::D7)-derived recombinant strains in SC or YPD medium using HPLC-CAD-based HPLC chromatogram culture Concentration (ppm) Strains medium E Z L 7-dc 7-dm D C OD.sub.600 nm CEN.PK(WT) SC 5.1 10.2 1.8 1.8 0.0 0.0 0.0 17.0 #S1(erg6::D24/erg5::D7) 0 25.0 0 3.4 19.8 5.2 7.5 16.8 .sub.NTSD7/#S1 0 21.9 0 1.9 19.9 15.0 9.0 20.7 .sub.NTSD24/#S1 0 22.2 0 2.5 13.2 6.3 11.5 19.1 .sub.2D24D7/#S1 0 17.8 0 2.1 11.2 5.8 11.1 9.5 CEN.PK(WT) VPD 5.8 11.6 2.8 4.2 1.7 0 0 42.2 #S1(erg6::D24/erg5::D7) 0 30.7 1.6 1.5 19.7 13.3 9.4 59.0 .sub.NTSD7/#S1 0 26.7 1.2 0.8 19.5 22.4 9.0 62.1 .sub.NTSD24/#S1 0 33.0 2.5 3.4 15.0 8.4 15.0 64.5 .sub.2D24D7/#S1 0 29.3 0 2.5 22.3 15.3 12.9 18.7

(63) (E: Ergosterol, Z: Zymosterol, 7-dc: 7-dehydrocholesterol, 7-dm: 7-dehydrodesmosterol, D: Desmosterol, C: Cholesterol)

(64) (Strains: CEN.PK (WT), #S1, .sub.NTSD7/#S1, .sub.NTSD24/#S1, .sub.2D24D7/#S1)

(65) In addition, as a result of a HPLC assay for the .sub.NTSD7/.sub.NTSD24/#S1 recombinant strain, it was able to be confirmed that a 9.3 ppm cholesterol production peak was found, which is approximately 1.7-fold higher than the #S1 strain (FIG. 12C, Table 7). In addition, as a result of a HPLC assay for erg5::ccD24/erg6::ccD7(=#cc19) and erg6::ccD24/erg5::ccD7(=#ccS1), it was confirmed that 30.1 and 29.4 ppm of cholesterol and 6.1 and 6.0 ppm of zymosterol were produced, which shows that the cholesterol production amounts are approximately 5-fold or more increased, compared to the #S1 strain (FIG. 13E, Table 7).

(66) TABLE-US-00009 TABLE 7 Analysis of production amounts of cholesterol and precursor thereof in recombinant strains using HPLC-CAD-based HPLC chromatogram Culture Aver. Concentration (mg/L) Strains condition E Z L 7-dc 7-dm D C CEN.PK YPD, 21.4 7.0 2.0 0 0 0 0 #19 5 days 0 3.5 0 0 3.3 5.3 2.4 #S1 0 0 0.5 0.9 6.2 5.9 5.2 D7/D24/S1 0 27.2 0 0 1.9 11.4 9.3 #cc19 0 6.1 0 0 0 0 30.1 #ccS1 0 6.0 0 0 0 0 29.4 (7-dm: 7-dehydrodesmosterol, 7-dc: 7-dehydrocholesterol, Z: Zymosterol, D: Desmosterol, E: Ergosterol, L: Lathosterol, C: Cholesterol, D7/D24/S1: .sub.NTSD7/NTS D24/#S1)

(67) In addition, the result of the HPLC assay, compared to #cc19 and #ccS1 strains, tHMG1/#cc19, tHMG1/#ccS1 strains showed a pattern in which all of squalene, oxidosqualene, lanosterol and zymosterol are accumulated, and approximately 1.3 to 1.5-fold higher cholesterol production amounts when comparing HPLC chromatogram peak areas (FIG. 14C).