Multifunctional microfluidic device for capturing target cells and analyzing genomic DNA isolated from the target cells while under flow conditions
12569849 ยท 2026-03-10
Assignee
Inventors
Cpc classification
B01L2300/0864
PERFORMING OPERATIONS; TRANSPORTING
B01L2400/086
PERFORMING OPERATIONS; TRANSPORTING
B01L2400/0487
PERFORMING OPERATIONS; TRANSPORTING
B01L3/502753
PERFORMING OPERATIONS; TRANSPORTING
B01L2200/0663
PERFORMING OPERATIONS; TRANSPORTING
B01L2300/0816
PERFORMING OPERATIONS; TRANSPORTING
B01L3/502761
PERFORMING OPERATIONS; TRANSPORTING
International classification
Abstract
The present invention relates to, inter alia, a microfluidic device for capturing target cells and analyzing genomic DNA isolated from the target cells while under flow conditions. The microfluidic device includes a cell microchannel and a nucleic acid microchannel that intersect in an orthogonal manner, thereby forming a cell capture intersection region. The microfluidic device also includes a cell capture array and a nucleic acid entanglement array. The cell capture array includes a plurality of cell capturing micropillars and is located in the cell capture intersection region. The nucleic acid entanglement array includes a plurality of nucleic acid entanglement micropillars that function to physically entangle and maintain thereon genomic DNA isolated from the one or more target cell, and is located in a portion of the nucleic acid microchannel that is adjacent to and downstream of the cell capture intersection region. Methods of using the microfluidic device are also disclosed.
Claims
1. A method of amplifying nucleic acids, the method comprising: flowing a sample through a cell channel within a microfluidic device to a cell capture array disposed at an intersection of the cell channel and a nucleic acid channel within the microfluidic device to immobilize a cell from the sample on a plurality of structures of the cell capture array while flowing a remainder of the sample downstream of the cell capture array in the cell channel; lysing the cell to release nucleic acids from the cell and flow the nucleic acids from the cell capture array to an entanglement array within the nucleic acid channel to capture the nucleic acids within the microfluidic device on the entanglement array, wherein the entanglement array comprises a plurality of nucleic acid entanglement micropillars configured and arranged in a manner effective to physically entangle and maintain thereon genomic DNA isolated from the cell; flowing amplification reagents into the nucleic acid channel; and copying the captured nucleic acids within the microfluidic device while the nucleic acids are captured and maintained on the plurality of nucleic acid entanglement micropillars under flow at the entanglement array using the amplification reagents.
2. The method of claim 1, wherein the nucleic acids include genomic DNA (gDNA), the method further comprising eluting the gDNA from the nucleic acid channel.
3. The method of claim 1, wherein the cell is a target cell, and the remainder of the sample includes a mixture of non-target cells.
4. The method of claim 3, further comprising immobilizing the target cell with a capture ligand specific to a cell type of the target cell.
5. The method of claim 1, wherein the amplification reagents comprise one or more primers and a polymerase.
6. The method of claim 1, further comprising extracting amplification products from an outlet of the nucleic acid channel.
7. The device of claim 1, wherein the plurality of structures are functionalized with antibodies or aptamers.
8. The method of claim 5, wherein copying the nucleic acids at the entanglement array comprises a multiple displacement amplification (MDA) process.
9. The method of claim 8, wherein the polymerase is 29 and the one or more primers are selected from one or more of SEQ ID NOS: 4-123.
10. The method of claim 1, wherein the cell capture array and the entanglement array are separated, and flowing the nucleic acids from the cell capture array to the entanglement array comprises moving the nucleic acids from the cell capture array to the entanglement array.
11. The method of claim 1, wherein the cell capture array has attached thereto cell-capture ligands that bind to cells of a specific cell type.
12. The method of claim 11, wherein the cells of the specific cell type are cancer cells.
13. The method of claim 12, wherein the cell-capture ligands comprise aptamers.
14. The method of claim 13, wherein the nucleic acids include genomic DNA (gDNA), the method further comprising collecting amplification products from an outlet of the nucleic acid channel.
15. The method of claim 14, wherein the gDNA remains entangled at the entanglement array during flow of the amplification reagents through the nucleic acid channel.
16. The method of claim 11, wherein the copying step includes amplifying one or more individual genes of interest while the gDNA is maintained under flow conditions.
17. The method of claim 16, further comprising amplifying the individual genes of interest consecutively.
18. The method of claim 17, further comprising collecting amplification products separately.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1) For the purpose of illustrating aspects of the present invention, there are depicted in the drawings certain embodiments of the invention. However, the invention is not limited to the precise arrangements and instrumentalities of the embodiments depicted in the drawings. Further, as provided, like reference numerals contained in the drawings are meant to identify similar or identical elements.
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
DETAILED DESCRIPTION OF THE INVENTION
(14) The present invention relates to, inter alia, a combination of microfluidic and aptamer technologies suitable for use in studying, analyzing, detecting, and treating various conditions and diseases.
(15) More particularly, in one aspect, the present invention relates to a microfluidic device for aptamer-based cancer cell capture and genetic mutation detection, and the use of the microfluidic device for various applications.
(16) In one aspect, the present invention provides a microfluidic device comprising: a cell microchannel and a nucleic acid microchannel that intersect to form a cell capture intersection region; a cell capture array comprising a plurality of cell capturing micropillars configured and arranged in a manner effective to capture one or more target cell when flowed through the cell microchannel, said cell capture array being located in the cell capture intersection region; and a nucleic acid entanglement array comprising a plurality of nucleic acid entanglement micropillars configured and arranged in a manner effective to physically entangle and maintain thereon genomic DNA isolated from the one or more target cell, said nucleic acid entanglement array being located in a portion of the nucleic acid microchannel that is adjacent to and downstream of the cell capture intersection region. The microfluidic device is multi-functional in that it is effective for capturing said one or more target cell, isolating said genomic DNA from the one or more target cell, and analyzing said genomic DNA in a self-contained manner.
(17) In one embodiment of the microfluidic device of the present invention, the cell capture array comprises one or more aptamer and/or another cell capture component specific to the one or more target cell.
(18) In another embodiment, the one or more aptamer and/or another cell capture component is concentrated in the cell capture intersection region, thereby enabling capture of the one or more target cell.
(19) In another embodiment, the nucleic acid entanglement array is effective to entangle and maintain the isolated genomic DNA for single amplification and/or multiple, consecutive amplifications of one or more nucleic acid sequence of interest contained on the isolated genomic DNA.
(20) In certain embodiments, the one or more nucleic acid sequence of interest is a cancer gene. In other embodiments, the one or more target cell is a cancer cell.
(21) In one embodiment, the microfluidic device of the present invention further comprises a first flow rate means for managing rate of flow of fluid through the cell microchannel and a second flow rate means for managing rate of flow of fluid through the nucleic acid microchannel.
(22) In another embodiment, the first flow rate means comprises external valves at the nucleic acid microchannel inlet and outlet and the second flow rate means comprises external valves at the cell microchannel inlet and outlet.
(23) In one embodiment, the external valves are selected from the group consisting of two-way valves and four-way valves.
(24) In another embodiment, the microfluidic device of the present invention further comprises a temperature controller for managing temperature of fluid and other contents contained within the cell microchannel and/or nucleic acid microchannel.
(25) In one embodiment, the cell microchannel and the nucleic acid microchannel have a height ranging from between about 20 m and about 40 m.
(26) In one embodiment, the cell microchannel and the nucleic acid microchannel have a height of about 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 m.
(27) In one embodiment, the cell microchannel and the nucleic acid microchannel have a height of about 25 m.
(28) In one embodiment, the cell channel has a width ranging from between about 500 m and about 1500 m.
(29) In one embodiment, the cell channel has a width of about 500, 510, 520, 530, 540, 550, 560, 570, 580, 590, 600, 600, 610, 620, 630, 640, 650, 660, 670, 680, 690, 700, 710, 720, 730, 740, 750, 760, 770, 780, 790, 800, 810, 820, 830, 840, 850, 860, 870, 880, 890, 900, 910, 920, 930, 940, 950, 960, 970, 980, 990, or 1000 m.
(30) In one embodiment, the cell channel has a width of about 1000 m.
(31) In one embodiment, the nucleic acid channel has a width ranging from between about 200 m and about 1500 m.
(32) In one embodiment, the nucleic acid channel has a width selected from the group consisting of about 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, 300, 310, 320, 330, 340, 350, 360, 370, 380, 390, 400, 410, 420, 430, 440, 450, 460, 470, 480, 490, 500, 510, 520, 530, 540, 550, 560, 570, 580, 590, 600, 600, 610, 620, 630, 640, 650, 660, 670, 680, 690, 700, 710, 720, 730, 740, 750, 760, 770, 780, 790, 800, 810, 820, 830, 840, 850, 860, 870, 880, 890, 900, 910, 920, 930, 940, 950, 960, 970, 980, 990, 1000, 1010, 1020, 1030, 1040, 1050, 1060, 1070, 1080, 1090, 1100, 1120, 1130, 1140, 1150, 1160, 1170, 1180, 1190, 1200, 1210, 1220, 1230, 1240, 1250, 1260, 1270, 1280, 1290, 1300, 1310, 1320, 1330, 1340, 1350, 1360, 1370, 1380, 1390, 1400, 1410, 1420, 1430, 1440, 1450, 1460, 1470, 1480, 1490, or 1500 m.
(33) In one embodiment, the nucleic acid channel has a width selected from the group consisting of about 250 m, 500 m, and 1000 m.
(34) In one embodiment, the cell capturing micropillars have a diameter ranging from between about 40 m and about 60 m.
(35) In one embodiment, the cell capturing micropillars have a diameter of about 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, or 60 m.
(36) In one embodiment, the cell capturing micropillars have a diameter of about 50 m.
(37) In one embodiment, the cell capture array is ordered in a patterned array that is rotated by about 4 to maximize contact between the one or more target cell and microchannel surface.
(38) In one embodiment, the nucleic acid entanglement micropillars have a diameter ranging from between about 2 m and about 10 m.
(39) In one embodiment, the nucleic acid entanglement micropillars have a diameter of about 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, 9.0, 9.5, or 10 m.
(40) In one embodiment, the nucleic acid entanglement micropillars have a cross-sectional dimension of about 4 m4 m, wherein said nucleic acid entanglement micropillars are spaced in a gradient that begins with the micropillars being about 10 m apart and ending with the micropillars being about 7 m apart.
(41) In another aspect, the present invention provides a method of isolating and maintaining genomic DNA of one or more target cell from a sample under flow for further analysis thereof. This method involves the steps of: providing a microfluidic device as described herein; introducing a sample comprising one or more target cell into the cell microchannel at a flow rate effective to transport the one or more target cell to the cell capture array so as to capture the one or more target cell in the cell capturing micropillars by specific binding; lysing the one or more target cell by introducing lysing reagents through the nucleic acid microchannel at a flow rate effective to release genomic DNA from the one or more target cell without shearing the genomic DNA; and maintaining fluid flow within the nucleic acid microchannel at a flow rate effective to cause the released genomic DNA to become physically entangled and maintained within the nucleic acid entanglement array for further analysis thereof.
(42) In one embodiment, the one or more target cell is captured in the cell capture array due to specific contact with an aptamer or other capture component present in the cell capture array.
(43) In one embodiment, the one or more target cell is introduced into the cell microchannel and thereafter captured within the cell capture array under a flow rate ranging from between about 0.1 L/minute and about 20 L/minute.
(44) In one embodiment, the one or more target cell is introduced into the cell microchannel and thereafter captured within the cell capture array under a flow rate of about 0.1, 0.5, 1.0, 1.5, 2.0, 2.5, 3.0, 3.5, 4.0, 4.5, 5.0, 5.5, 6.0, 6.5, 7.0, 7.5, 8.0, 8.5, 9.0, 9.5, 10, 10.5, 11, 11.5, 12, 12.5, 13, 13.5, 14, 14.5, 15, 15.5, 16, 16.5, 17, 17.5, 18, 18.5, 19, 19.5, or 20 L/minute.
(45) In one embodiment, the lysing reagents are introduced through the nucleic acid microchannel at a flow rate ranging from between about 0.1 L/minute and about 2 L/minute, thereby causing the release of the genomic DNA from the one or more target cell without shearing the genomic DNA.
(46) In one embodiment, the flow of fluid in the nucleic acid microchannel is maintained at a flow rate ranging from between about 0.05 L/minute and about 2 L/minute, thereby causing the released genomic DNA to become physically entangled and maintained within the nucleic acid entanglement array.
(47) In one embodiment, the one or more target cell is a cancer cell, although the present invention can be used for any type of cell of structure that contains DNA or genomic DNA.
(48) In another aspect, the present invention provides a method for conducting aptamer-based cancer cell capture and genomic DNA mutation analysis of genomic DNA isolated from one or more target cell. This method includes the steps of: performing the steps described herein of the method of isolating and maintaining genomic DNA of one or more target cell from a sample under flow; and conducting aptamer-based cancer cell capture and genomic DNA mutation analysis of the genomic DNA isolated from one or more target cell while in a flow environment within the microfluidic device.
(49) In another aspect, the present invention provides a method for amplifying individual genes of interest from the one or more target cell consecutively and collecting each amplification product separately. This method includes the steps of: performing the steps described herein of the method of isolating and maintaining genomic DNA of one or more target cell from a sample under flow; and amplifying individual genes of interest from the genomic DNA entangled and maintained under flow within the nucleic acid entanglement array of the microfluidic device consecutively and collecting each amplification product separately.
(50) In another aspect, the present invention provides a method for sequencing nucleic acids amplified from genomic DNA isolated from one or more target cell. This method includes the steps of: performing the steps described herein of the method of isolating and maintaining genomic DNA of one or more target cell from a sample under flow; and sequencing the genomic DNA entangled and maintained under flow within the nucleic acid entanglement array of the microfluidic device.
(51) In another aspect, the present invention provides a method for multiple displacement amplification (MDA) reactions of one or more nucleic acid sequence isolated from one or more target cell. This method includes the steps of: performing the steps described herein of the method of isolating and maintaining genomic DNA of one or more target cell from a sample under flow; and conducting multiple displacement amplification (MDA) reactions under flow using the genomic DNA entangled and maintained within the nucleic acid entanglement array of the microfluidic device.
(52) In one embodiment, the MDA reactions involve using the same genomic DNA template isolated by the nucleic acid entanglement micropillars of the microfluidic device.
(53)
(54)
(55)
(56) As illustrated in
(57) Aspects of the microfluidic device of the present invention and various methods of use thereof are further described below. Certain terms are used that are interchangeable with the terms provided herein above and in the claims. Such interchangeable terminology is readily apparent to those of ordinary skill in the art.
(58) In accordance with one embodiment, the present invention includes a microfluidic device capable of specifically capturing rare cancer cells and isolating their genomic DNA for on-chip amplification and subsequent genetic sequencing. The device is fabricated out of polydimethylsiloxane (PDMS) using a silicon mold. The PDMS is bonded to a glass substrate to form the microfluidic channels. The device contains two microchannels intersecting at right angles with a pillar array at the intersection functionalized with single stranded DNA aptamers that serve as specific capture ligands for cancer cells. The pillars are rotated 4 to increase the number of collisions cells undergo with the surface, thereby increasing the capture efficiency. In one of the channels downstream from the cell capture zone, there is a secondary micropillar array with smaller pillars spaced closely together that will isolate the genomic DNA from the lysed captured cells. This DNA will remain entangled in the micropillar array through multiple isothermal amplification reactions. The amplification product will be extracted from the outlet of the device, and the DNA will be sequenced to identify any genetic mutations.
(59) As noted above,
(60) Aptamers are single stranded nucleic acids that are analogous to antibodies in that they are ligands with specific binding affinity to their target, but with several advantages over antibodies. Aptamers are chemically synthesized with no batch-to-batch variability, much less expensive, more robust, and more easily functionalized. Here, a previously-selected aptamer with specific affinity to surface species present on several types of cancer cells that will capture the rare cancer cells and filter them from a complex sample can be used (see Van Simaeys D, Lpez-Coln D, Sefah K, Sutphen R, Jimenez E, Tan W (2010) Study of the molecular recognition of aptamers selected through ovarian cancer cell-SELEX. PLoS One 5:e13770. doi: 10.1371/journal.pone.0013770).
(61) To detect specific genetic mutations, these genes can be individually amplified in separate multiple displacement amplification (MDA) reactions using the same genomic DNA template isolated by the micropillars. Following each amplification, the product can be extracted from the device through the outlet. These samples can be sequenced using Sanger sequencing, which requires pure samples with a single DNA sequence, and this can be accomplished using our device capable of separate consecutive amplification reactions on the same genomic DNA. The sequencing results can be compared to the known wildtype genes, and any mutations can be identified. This information can then be passed onto clinicians to make informed recommendations for the most appropriate and effective treatment for each patient.
(62) In various other embodiments, the present invention provides a microfluidic device for capturing selected cells and efficiently separating genomic DNA from other cellular components.
(63) Further, although certain aspects of the present invention primarily relate to the processing and analysis of DNA extracted and immobilized in the device and treating the other cellular components, in other aspects, the present invention also relates to the use of a microfluidic device for separating the cellular components from the genomic DNA such as mitochondrial DNA or RNA.
(64) One advantage of the microfluidic device of the present invention is that it is an integrated device, as shown herein. The integrated device of the present invention obviates the need for transferring the sample form one device to another and therefore reduces the possibilities for contamination of the sample.
(65) The structures that are employed in the microfluidic device of the present invention for capturing the cells can be of many forms. For example, in certain embodiments, the structures can be coated with antibodies or aptamers and can include, without limitation, structures such as pillars, beads, flat surfaces, or patterned surfaces. Such methods for incorporating such features in microfluidics are known to those skilled in the art.
(66) In accordance with the present invention, the ability to capture the DNA by mechanical entanglement with pillared structures allows the application of sequential chemical treatments and washing steps by flowing different solutions past the immobilized DNA.
(67) The microfluidic device of the present invention can be constructed of various suitable materials. For example, in certain embodiments, the microfluidic device is constructed of transparent plastic. However, the microfluidic device of the present invention can alternatively be made of glass or other optically transparent materials to permit optical microscopic imaging of captured cells and DNA. This would permit histological evaluation of cells by a Pathologist to combine conventional imaging and analysis of cells to be combined with our molecular diagnostics.
(68) In certain embodiments, the microfluidic device of the present invention can include multiple stages of cell capture regions of different geometry and chemical coatings to capture different cell types or other biological entities such as cancer cells, shed cells from implanted tissue, parasites, pathogens, bacteria, viruses, and others.
(69) As described herein,
(70) The microfluidic device can be used to study various genes of interest, including, without limitation, genes of interest in cancer. For example, as shown in the examples section below, one such gene of interest is the TP53 gene. Additional examples of genes of interest in cancer include, without limitation, APC, BRCA1, BRCA2, CDK4, CMM1, HER2, MLH1, MSH2, p16, and Rb1. The microfluidic device of the present invention can be used to study these and other cancer genes, as well as other genes not associated with cancer.
(71) The microfluidic device of the present invention can be constructed so that it does not require internal valves to control the flow of fluid or other materials through the channels of the device. Thus, in accordance with the present invention, there are multiple ways to control the flow through the device. For example, external valves can be used to control the flow. Alternatively, tubing clamps or fluidic plugs can also be used to control the direction of flow in the microfluidic device of the present invention.
(72) The microfluidic device of the present invention can also use various types of cell capture components in addition to those specifically described herein. For example, antibodies or other recognition elements could be used in the same way as described herein with the same surface chemistry (e.g., biotinylated). Such cell capture alternatives would work and could be incorporated into the microfluidic device.
(73) The microfluidic device of the present invention can be used to incorporate various technologies relating to microfluidic arrays, microfluidic cell capture, aptamer-based cell capture, nucleic acid elongation and capture, and the like. Such compatible technologies described in the art can be found in various published U.S. patent applications, including, without limitation, the following (which are incorporated herein by reference in their entirety): US-2015/0291952, US-2015/0204859, US-2014/0121132, US-2014/0194313, and US-2015/0011425.
EXAMPLES
(74) The following examples are intended to illustrate particular embodiments of the present invention, but are by no means intended to limit the scope of the present invention.
Example 1
(75) Microfluidic Device for Aptamer-Based Cancer Cell Capture and Gene Mutation Detection
(76) Genetic mutations in cancer cells are not only fundamental to the disease, but can also have tremendous impact on the efficacy of treatment. Identification of specific key mutations in a timely and cost-effective way would allow clinicians to better prescribe the most effective treatment strategy. Here, we present a novel microfluidic device as a platform for specifically capturing cancer cells and isolating their genomic DNA (gDNA) for specific amplification and sequence analysis. To capture cancer cells within the device, nucleic acid aptamers that specifically bind to cancer cells are immobilized within a microchannel containing micropillars to increase capture efficiency. The captured cells are then lysed and the gDNA is isolated via physical entanglement within a secondary micropillar array. This type of isolation allows the gDNA to be retained within the channel, and enables multiple types of analysis to be performed on the same gDNA template. The amplified gene samples undergo sequencing, and the resulting sequence information is compared against the known wildtype gene to identify any mutations. Cervical and ovarian cancer cells have been tested for mutations in the TP53, PTEN, and BRCA2 genes using this technology. This approach offers a way to monitor multiple genetic mutations in the same small population of cells, which is beneficial given the wide diversity in cancer cells, and requires very few cells to be extracted from the patient sample. With this capability for genetic monitoring, precision medicine should be more accessible for the treatment of cancer.
Experimental
(77) Cell Culture and Buffers:
(78) HeLa, CAOV-3, Ect1/E6E7, and End1/E6E7 cells were purchased from American Type Cell Culture (ATCC). The HeLa and CAOV-3 cells were cultured in DMEM media (Life Technologies) supplemented with non-essential amino acids, 110 mg/L sodium pyruvate, 200 mM L-glutamine (Life Technologies), 1 Pen Strep (Life Technologies), 26.8 mM HEPES, betamercaptoethanol, and containing 10% fetal bovine serum. The Ect1/E6E7 and End1/E6E7 cells were cultured in keratinocyte-serum free media (Life Technologies) with 0.1 ng/mL human recombinant epidermal growth factor (Life Technologies), 0.05 mg/mL bovine pituitary extract (Life Technologies), and an additional 44.1 mg/L calcium chloride. Prior to use, the cells were trypsinized and resuspended in phosphate-buffered saline (PBS) binding buffer [1 Dulbecco's PBS with calcium chloride and magnesium chloride (Fisher Scientific) containing 4.5 g/L glucose, 5 mM MgCl.sub.2, and 0.1% Pluronic F-68 non-ionic surfactant (Sigma Aldrich)]. HeLa cells contained GFP-conjugated histones, and CAOV-3, Ect1/E6E7, and End1/E6E7 cells were stained with calcein-AM (Thermo Fisher Scientific) that allowed them to be observed using fluorescence microscopy.
(79) Device Fabrication:
(80) The devices used here were polydimethylsiloxane (PDMS) microchannels bonded to glass substrates. The devices consisted of two orthogonal microchannels that contained two micropillar arrays: a cell capture array at the intersection of the two microchannels and a gDNA isolation array downstream of the cell capture array (see
(81) Sylgard 184 (Dow Corning) PDMS base resin was mixed in a 10:1 ratio with curing agent, and degassed in a vacuum oven at room temperature. The PDMS was poured onto the master mold and baked at 140 C. for 1 hour. The PDMS was allowed to cool to room temperature, and it was carefully peeled off of the mold. Inlet and outlet holes were created using a 1 mm biopsy punch (Sklar Instruments). To complete the formation of the channels, the patterned PDMS and a microscope slide were treated with oxygen plasma for 5 min, and then bonded together. An external 4-way L-type valve (IDEX Health and Science) was used at the DNA channel inlet and external 2-way valves were used at the cell channel inlet and both outlets to control the flow between the perpendicular channels.
(82) Surface Chemistry:
(83) DNA aptamers that were used to capture cancer cells were immobilized onto the surface of the microchannels via a streptavidin-biotin conjugation. The channels were initially primed and cleaned with 100% ethanol and ultrapure water. A 1PBS solution was pumped through the channels at 50 L/min for 9 min. A 1 mg/mL solution of streptavidin (Life Technologies) in PBS was prepared, and 120 L were pumped through the cell channel (see
(84) Cell Capture, Lysis, and gDNA Isolation:
(85) Cells suspended in PBS binding buffer were pumped through the cell channel (see
(86) Primers and Specific Gene Amplification from gDNA:
(87) To amplify a specific gene from gDNA isothermally, MDA was used with specific primers targeting a fragment of the TP53, PTEN, or BRCA2 gene. Table 1 contains the 40 short primers used for these amplifications. Initially, the isolated gDNA was chemically denatured using Buffer DLB from the Repli-g Mini Kit (Qiagen) prepared according to the manufacturer's instructions. This solution was pumped through the DNA channel at 1 L/min for 25 min. The gDNA was then neutralized using the Stop Solution from the Repli-g Mini Kit with the addition of 12 pmol of each MDA primer. This solution was pumped at 1 L/min for 45 min. An MDA reaction solution was prepared from the Repli-g Mitochondrial DNA Kit according to the manufacturer's instructions, and 15-30 pmol of each MDA primer was added to the reaction solution. The microchannel device was placed on a hotplate set to 33 C., and 50 L of MDA reaction solution was pumped through at 0.05 L/min to perform the MDA reaction for approximately 16 hours. The eluent was collected in an Eppendorf tube. For consecutive rounds of on-chip MDA gene amplification from the same gDNA, the gDNA was denatured again, neutralized, and the MDA reaction was performed as described above, but using different primers.
(88) For benchtop control experiments, gDNA from HeLa and CAOV-3 cells was extracted using the Blood and Cell Culture DNA Mini Kit (Qiagen). Buffer D1 and Buffer N1 from the Repli-g Mini Kit (Qiagen) were prepared, and 15 ng of extracted gDNA were denatured and neutralized according to the manufacturer's instructions. An MDA reaction master mix was prepared using the buffer and DNA polymerase from the Repli-g Mitochondrial DNA Kit (Qiagen) and various concentrations of specific MDA primers (Table 1), and this solution was added to the denatured and neutralized gDNA. This reaction was incubated at 33 C. for 16 hours.
(89) TABLE-US-00001 TABLE1 AmplificationPrimerSequences MDAPrimersfortheTP53,PTEN,andBRCA2Genes PrimerName Sequence PrimerName Sequence TP53MDAFOR#1 TTGTGCCCTG TP53MDAREV#1 GCCATGGCGC (SEQIDNO:4) (SEQIDNO:5) TP53MDAFOR#2 CAGTTGCTTT TP53MDAREV#2 GCTGTGACTG (SEQIDNO:6) (SEQIDNO:7) TP53MDAFOR#3 GTTTCTTTGC TP53MDAREV#3 CCTCACAACC (SEQIDNO:8) (SEQIDNO:9) TP53MDAFOR#4 GGAGGTGCTT TP53MDAREV#4 CGCTCATGGT (SEQIDNO:10) (SEQIDNO:11) TP53MDAFOR#5 TAGCTCGCTA TP53MDAREV#5 CACCATCGCT (SEQIDNO:12) (SEQIDNO:13) TP53MDAFOR#6 GTGTAGACGC TP53MDAREV#6 TCTCTCCAGC (SEQIDNO:14) (SEQIDNO:15) TP53MDAFOR#7 CCTATCTCAA TP53MDAREV#7 CTGGGCAACC (SEQIDNO:16) (SEQIDNO:17) TP53MDAFOR#8 CCTGAGTGAC TP53MDAREV#8 GAATCAGAGG (SEQIDNO:18) (SEQIDNO:19) TP53MDAFOR#9 ATCACACCAC TP53MDAREV#9 ACCTAAGAGC (SEQIDNO:20) (SEQIDNO:21) TP53MDAFOR#10 GGAGGCTGCA TP53MDAREV#10 AGATGCTGAG (SEQIDNO:22) (SEQIDNO:23) TP53MDAFOR#11 ATCACTTGAG TP53MDAREV#11 TCCACACGCA (SEQIDNO:24) (SEQIDNO:25) TP53MDAFOR#12 TAGGAGGCTG TP53MDAREV#12 TGTTTCTGTC (SEQIDNO:26) (SEQIDNO:27) TP53MDAFOR#13 CACCTATAGT TP53MDAREV#13 CACCACACTA (SEQIDNO:28) (SEQIDNO:29) TP53MDAFOR#14 TAGCCAGGCA TP53MDAREV#14 TCAGGCGGCT (SEQIDNO:30) (SEQIDNO:31) TP53MDAFOR#15 ACCTCGTCTC TP53MDAREV#15 CCCCAGTTGC (SEQIDNO:32) (SEQIDNO:33) TP53MDAFOR#16 AGCCTGGGTA TP53MDAREV#16 TTAACCCCTC (SEQIDNO:34) (SEQIDNO:35) TP53MDAFOR#17 GAGCCCAGGA TP53MDAREV#17 AGGGCCACTG (SEQIDNO:36) (SEQIDNO:37) TP53MDAFOR#18 CCAAGGCAGG TP53MDAREV#18 CCCCCCTACT (SEQIDNO:38) (SEQIDNO:39) TP53MDAFOR#19 TCCCAGCACT TP53MDAREV#19 TAGGGAGGTC (SEQIDNO:40) (SEQIDNO:41) TP53MDAFOR#20 TTGGTGGCTC TP53MDAREV#20 TTGCACATCT (SEQIDNO:42) (SEQIDNO:43) PTENMDAFOR#1 GTCCAGAGCC PTENMDAREV#1 GCAGCCGCAG (SEQIDNO:44) (SEQIDNO:45) PTENMDAFOR#2 AGCCGCCGCA PTENMDAREV#2 GAACGTGGGA (SEQIDNO:46) (SEQIDNO:47) PTENMDAFOR#3 AGTCGCTGCA PTENMDAREV#3 TTCGCATCCG (SEQIDNO:48) (SEQIDNO:49) PTENMDAFOR#4 TGCTGAGGAG PTENMDAREV#4 CTGACCAGGG (SEQIDNO:50) (SEQIDNO:51) PTENMDAFOR#5 GCCGCTGCCA PTENMDAREV#5 CACACCCTAG (SEQIDNO:52) (SEQIDNO:53) PTENMDAFOR#6 CTTCTCCCCA PTENMDAREV#6 GCAACCAGGC (SEQIDNO:54) (SEQIDNO:55) PTENMDAFOR#7 CCGTTCGGAG PTENMDAREV#7 CAATCGGTGG (SEQIDNO:56) (SEQIDNO:57) PTENMDAFOR#8 GAGGCCGCCG PTENMDAREV#8 GGAAGAGACC (SEQIDNO:58) (SEQIDNO:59) PTENMDAFOR#9 CCCCCGTGGC PTENMDAREV#9 CCGAGCTCGC (SEQIDNO:60) (SEQIDNO:61) PTENMDAFOR#10 CCCGTCCGCC PTENMDAREV#10 GCTCAACCTC (SEQIDNO:62) (SEQIDNO:63) PTENMDAFOR#11 CCCGGGCCGG PTENMDAREV#11 GGGCCTAAGC (SEQIDNO:64) (SEQIDNO:65) PTENMDAFOR#12 GGCGGCGGCA PTENMDAREV#12 CGTGCAACAC (SEQIDNO:66) (SEQIDNO:67) PTENMDAFOR#13 GCCTCCAACA PTENMDAREV#13 GCAACTCAGG (SEQIDNO:68) (SEQIDNO:69) PTENMDAFOR#14 CGCCGGAGAG PTENMDAREV#14 GCCCTCAATG (SEQIDNO:70) (SEQIDNO:71) PTENMDAFOR#15 GTCGCCTGTC PTENMDAREV#15 CCCCATAGGG (SEQIDNO:72) (SEQIDNO:73) PTENMDAFOR#16 GCTCCAGGGA PTENMDAREV#16 CTGGGATCAG (SEQIDNO:74) (SEQIDNO:75) PTENMDAFOR#17 CGGCGGCCGC PTENMDAREV#17 CTGGCATCAC (SEQIDNO:76) (SEQIDNO:77) PTENMDAFOR#18 GGGAGAAGCG PTENMDAREV#18 CGGTGAGCAG (SEQIDNO:78) (SEQIDNO:79) PTENMDAFOR#19 CACCTCCCGC PTENMDAREV#19 TCAGAGGACC (SEQIDNO:80) (SEQIDNO:81) PTENMDAFOR#20 AGGCGCGGCG PTENMDAREV#20 CCCCTCTTGC (SEQIDNO:82) (SEQIDNO:83) BRCA2MDAFOR#1 CCTCAGTCAC BRCA2MDAREV#1 GACGTACTGG (SEQIDNO:84) (SEQIDNO:85) BRCA2MDAFOR#2 TCCAGCGCTT BRCA2MDAREV#2 CCACTAGACG (SEQIDNO:86) (SEQIDNO:87) BRCA2MDAFOR#3 GATGGGACTG BRCA2MDAREV#3 AGGGGCCAGT (SEQIDNO:88) (SEQIDNO:89) BRCA2MDAFOR#4 CCCATCCTCA BRCA2MDAREV#4 GGGGGTCCTA (SEQIDNO:90) (SEQIDNO:91) BRCA2MDAFOR#5 TGGACAGCAC BRCA2MDAREV#5 CACCACGCCC (SEQIDNO:92) (SEQIDNO:93) BRCA2MDAFOR#6 GGCTAGTGGC BRCA2MDAREV#6 AAGTGCTGGG (SEQIDNO:94) (SEQIDNO:95) BRCA2MDAFOR#7 ACTAGCCACG BRCA2MDAREV#7 TCCGCCCACC (SEQIDNO:96) (SEQIDNO:97) BRCA2MDAFOR#8 CTGGTTAGCG BRCA2MDAREV#8 ACTTCTGGCC (SEQIDNO:98) (SEQIDNO:99) BRCA2MDAFOR#9 CTCTGTCCCC BRCA2MDAREV#9 GTTGGCCAGG (SEQIDNO:100) (SEQIDNO:101) BRCA2MDAFOR#10 GCGGCGTTGG BRCA2MDAREV#10 CACGCAGCAC (SEQIDNO:102) (SEQIDNO:103) BRCA2MDAFOR#11 TGCTGATGGG BRCA2MDAREV#11 GTAGCTGGGA (SEQIDNO:104) (SEQIDNO:105) BRCA2MDAFOR#12 AAGCCCCTGG BRCA2MDAREV#12 CTCCTGCCTC (SEQIDNO:106) (SEQIDNO:107) BRCA2MDAFOR#13 GGGCACGCTG BRCA2MDAREV#13 CCTCCAGGGT (SEQIDNO:108) (SEQIDNO:109) BRCA2MDAFOR#14 AGATGACGCC BRCA2MDAREV#14 CTTGGCTCAC (SEQIDNO:110) (SEQIDNO:111) BRCA2MDAFOR#15 CTTCCCTCCC BRCA2MDAREV#15 TGGCCCAGGC (SEQIDNO:112) (SEQIDNO:113) BRCA2MDAFOR#16 CCTTCAGCTC BRCA2MDAREV#16 CAACGTGAGG (SEQIDNO:114) (SEQIDNO:115) BRCA2MDAFOR#17 GGCCCGGCCT BRCA2MDAREV#17 GCGACATGGG (SEQIDNO:116) (SEQIDNO:117) BRCA2MDAFOR#18 CTGGGTCTCC BRCA2MDAREV#18 TCCATGGTGG (SEQIDNO:118) (SEQIDNO:119) BRCA2MDAFOR#19 CGAGCCCCGC BRCA2MDAREV#19 CCAGTGGCTC (SEQIDNO:120) (SEQIDNO:121) BRCA2MDAFOR#20 GCCCGAAGGC BRCA2MDAREV#20 TGCTGCAAGG (SEQIDNO:122) (SEQIDNO:123) PCRPrimers PrimerName Sequence TP53PCRFOR ACTTTCAACTCTGTCTCCTTCCTCTTCCTA (SEQIDNO:124) TP53PCRREV GGACGCGGGTGCCG (SEQIDNO:125) PTENPCRFOR AAGCGGCGGCAGAGCG (SEQIDNO:126) PTENPCRREV TCTGGGAGCCTGTGGCTGAAG (SEQIDNO:127) BRCA2PCRFOR ATGCATCCCTGTGTAAGTGCATTTTGG (SEQIDNO:128) BRCA2PCRREV GCGTGTCTTAAAAATTTCAAAAAATGTTGGCCTCT (SEQIDNO:129)
Gene Sequencing:
(90) The MDA product was verified by running the product on a 1% agarose gel, and staining the gel with SYBR Gold (Thermo Fisher Scientific). Since the product was around 10 kilobases (kb), a smaller product must be made to enable sequencing. Thus, a PCR amplification was performed using 10-60% of the MDA product. The PCR product was verified and purified using 8-10% polyacrylamide gel electrophoresis (PAGE) stained with ethidium bromide or SYBR Gold. To purify the PCR product for sequencing, the 130-nt band was cut from the gel, crushed, suspended in 3 M NaAc pH 6.2, and incubated at 37 C. with mixing overnight. The gel pieces were removed from the sample, the sample underwent phenol-chloroform extraction and ethanol precipitation, and the DNA was resuspended in DEPC water. This purified PCR product was sequenced via Sanger Sequencing, and the sequence was compared to the known wildtype gene.
Results and Discussion
(91) Microchannel Design:
(92) The assay presented here involves two main steps, cancer cell capture using aptamers and genomic DNA analysis. The ability to perform these two step easily all within one device would significantly reduce contamination and sample loss, which is important when developing an assay for rare cells. Therefore, the device was designed to have two intersecting orthogonal microchannels: the cell channel where cancer cells are captured, and the DNA channel where the gDNA from the captured cells is isolated (
(93) To control the flow within the device, valves were needed at the inlets and outlets. An external 4-way L-type valve was used at the DNA channel inlet to not only control flow, but also eliminate most of the dead volume caused by the length of tubing needed to reach the syringe pump while the device is either observed under a microscope or is incubated using a hotplate. This is necessary because high initial flowrates cannot be used after the gDNA is isolated on the micropillar array, as there is a risk of losing some of the entangled gDNA under the high flow conditions. External 2-way shutoff valves were used at each of the outlets as well as the cell channel inlet to control the fluid flow. These types of valves were used because they do not disturb the fluid within the channels, whereas controlling the flow using tubing clamps causes significant flow during the clamping process, which can disturb the captured cells. This device design and setup enables this assay to be performed easily by the user.
(94) HeLa and CAOV-3 Cell Capture and Genomic DNA Isolation:
(95) The target cells were suspended in PBS binding buffer and pumped through the device with aptamers immobilized on the surface of the cell capture region containing a pillar array. The cell capture was most efficient at a flowrate of 5 L/min when the cells were freshly trypsinized and the channel depth was 25 m. Several flowrates were tested ranging from 20 L/min down to 0.1 L/min. At high flowrates (>10 L/min), the linear velocity of the cells was very high and the cells did not bind to the aptamers on the surface easily. At low flowrates (<5 L/min), the cells did bind to the aptamers, but the throughput was very low and there was increased non-specific adhesion of the cells to the device. Cells used from frozen stocks did not bind as readily, likely due to different surface compositions caused by the shock of a freeze/thaw cycle. With channels deeper than 25 m, the cell capture took longer, since fewer collisions with the channel surface were likely occurring. To demonstrate using aptamers to specifically capture cancer cells within the microchannels, HeLa and CAOV-3 cancer cells were tested with and without aptamers immobilized on the surface, and Ect1/E6E7 and End1/E6E7 non-cancerous cells were tested with aptamers immobilized on the surface.
(96) After successfully capturing cancer cells within the cell capture region, the cells were lysed through the DNA channel. The cell contents flowed through the DNA micropillar array, and the gDNA was isolated on the pillars via physical entanglement. To verify that the gDNA was isolated and retained within the micropillar array, the gDNA was stained with YOYO-1 dye, and the results are shown in
(97) Specific Isothermal Amplification of Genes from gDNA:
(98) With the gDNA isolated and retained within the micropillar array, several types of genetic analyses can be performed. Here, we demonstrated the amplification of specific genes to determine their nucleotide sequence and discover any genetic mutations. MDA, an isothermal amplification technique, was used to reduce the complexity and cost of the device and enable straightforward device operation, since thermocycling is not necessary. MDA uses many short primers and a strand-displacing DNA polymerase (29) to make numerous copies of the template DNA isothermally. Whereas MDA is commonly used as a method for whole genome amplification,.sup.23-26 in this work we use MDA to amplify a specific gene from gDNA. To our knowledge, this is the first demonstration of using MDA to amplify a specific gene from gDNA. Forty 10-nt primers (20 forward and 20 reverse primers) were designed around regions of the TP53, PTEN, and BRCA2 genes, which are commonly mutated genes in cervical and ovarian cancer..sup.27,30 This modified MDA technique for amplifying these genes from gDNA was initially verified in benchtop experiments using purified HeLa and CAOV-3 gDNA.
(99) The isolated gDNA from HeLa and CAOV-3 cells was first chemically denatured to create single stranded DNA (ssDNA). The DNA was then neutralized prior to the MDA reaction. Since the gDNA is entangled in the micropillar array, upon denaturation the two complimentary strands likely cannot diffuse and migrate away from each other as readily as they can in a bulk solution, so it is possible that some may rehybridize upon neutralization. This would prevent the MDA reaction from occurring efficiently. To reduce the likelihood of this occurring, the neutralization buffer was spiked with the MDA primers allowing the primers to bind to the ssDNA before it rehybridizes. The MDA reaction solution containing additional primers and the DNA polymerase was pumped through the device and the amplification product was collected. The MDA product from HeLa and CAOV-3 cell gDNA was analyzed on an agarose gel, and
(100) Sequencing of the TP53 Gene Fragment:
(101) The purified TP53 gene fragments from HeLa and CAOV-3 cells were sequenced via Sanger sequencing. This sequencing technique was chosen because it is fast, inexpensive, and can perform longer reads than other techniques. It also requires the sample to be pure, as only one read is performed. The wildtype sequence for TP53 was obtained from the International Agency for Research on Cancer, and the known mutation in the TP53 gene in CAOV-3 cells was obtained from the mutation data for this cell line from ATCC. CAOV-3 cells contain a homozygous single-nucleotide polymorphism (SNP), and this SNP (c.406C>T) is a nonsense mutation resulting in a truncated p53 protein.
CONCLUSIONS
(102) We have developed a device and technique for capturing cancer cells using aptamers, and isolating their gDNA for genetic analysis. The device was designed to enable both the cell capture and gDNA isolation to occur within a single device to significantly reduce contamination and sample loss. Preventing sample loss is particularly important, since most cells of interest, such as circulating tumor cells, are rare and are generally found in low numbers. The device was also designed to isolate the gDNA via physical entanglement within a micropillar array. This isolation technique allows the gDNA to be chemically available for downstream reactions. It also enables the gDNA to be retained within the microchannel even under flow, which enables multiple types of analyses to be performed on the same template gDNA.
(103) We demonstrated on-chip isothermal amplification of a specific gene and subsequent sequencing of this gene to determine any genetic mutations. We successfully detected a point mutation in the TP53 gene in CAOV-3 cells. Specifically, we developed a method using MDA to amplify a specific gene from whole gDNA. This technique allows for long strands of DNA to be produced that can cover an entire large gene up to 10 kb. Here, we used PCR to produce pure samples of smaller gene fragments that could be sequenced using Sanger sequencing, but other sequencing methods can be used where pure samples are not necessary as multiple reads are taken.
(104) An assay like this can be extremely impactful when it comes to cancer diagnosis and treatment. If the mutations present in a specific patient's cancer cells can be identified, clinicians will be able to use this information to better diagnose the patient and better determine the most effective treatment options. This would truly enable precision medicine when it comes to cancer treatment, which is necessary to effectively treat patients considering the substantial diversity observed in cancer.
(105) While we have described the application of our device primarily in terms of isolating and genetically analyzing cancer cells. The same device and approach can be applied to other improvements in bioanalytical applications. For example, the rapid identification of antibiotic resistant bacteria is of great importance for determining appropriate treatment in a timely manner. Our device could be employed to select by aptamer binding a particular type of bacteria from body fluid or a swab sample and with even a single or a few cells rapid genetic analysis could determine the strain of the bacteria and its antibiotic resistance. This would be much more rapid than culturing cells to determine the effective antibiotic treatment. Another example would be for forensic analysis where human cells could be isolated from a complex sample and even a few cells genetically analyzed to identify the genetic fingerprint of the individual from whom the cells originate. There are numerous other examples to which our device and approach could be applied such as environmental monitoring for invasive organisms, analyzing drinking water safety or detecting rejections of human medical transplants where the rapid isolation of selected cell types and identification of specific genetic traits would be valuable.
(106) Supplementary information is shown in
Example 2
Various Embodiments of a Microfluidic Device for Aptamer-Based Cancer Cell Capture and Gene Mutation Detection
(107) The microfluidic device of the present invention can be used for aptamer-based cell capture for various uses. This example illustrates one protocol for preparing one embodiment of a microfluidic device of the present invention. As shown, this example describes a protocol of the preparation process, starting with the PDMS device fabrication and continuing through to the on-chip specific multiple displacement amplification (MDA) reaction.
Surface Chemistry for HeLa Cell Capture in Microfluidic Devices
(108) A. Fabrication of PDMS Devices
(109) For each wafer, mix 50 g of PDMS base and 5 g of curing agent thoroughly Degass the mixture completely in the vacuum oven Make an Al foil boat around the wafer and pour the PDMS onto the wafer Pop any bubbles that formed during the pouring process Put the samples in the oven at cure at 140 C for >1 h
Bonding the Devices: Once cured, SLOWLY and carefully peel the PDMS off of the wafer to prevent the pillars from ripping off Cut out the devices individually to fit on a microscope slide and punch inlet and outlet holes using a 1-mm biopsy punch Wash the PDMS thoroughly with soap and tap water and then DI water Rinse the PDMS and a microscope slide thoroughly with 100% ethanol and DI water Dry the PDMS and slide with nitrogen and place immediately into the plasma cleaner Draw a vacuum on the plasma cleaner for about a minute and then turn the plasma on high Adjust the door valve so that the plasma is a pink color (a blueish plasma means there is not enough oxygen) Plasma treat for 10 min Immediately take out the PDMS and slide and bond them, but do not push too hard as the channels can collapse Cover the inlet and outlet holes with tape to prevent debris from entering the device
B. Cleaning the Device
(110) To avoid having to clean with acid and base, use a device that has been bonded within 48 hours.
(111) With a device bonded within the last 48 hours, Connect tubing to all inlets and outlets, and connect valves to all inlets and outlets The valves at the inlets should have a third connection that allows dead volume to be pumped out into waste Fill 2 1-mL syringes for each device with ethanol and connect them to both inlet valves With the valves set to flow out to waste, pump 100 L of ethanol through at 100 L/min to flush out any bubbles Set the valves to flow into the device and then flow 900 L through both inlets at 30 L/min Fill a 1-mL syringe with ultrapure water With the valves set to flow out to waste, pump 100 L of water through the cell channel inlet valve at 100 L/min to flush out any bubbles Set the valve to flow into the device and then flow 1 mL of water through the cell channel at 50 L/min Repeat this for the DNA channel Fill a 1-mL syringe with filter-sterilized 1PBS With the valves set to flow out to waste, pump 100 L of PBS through the cell channel inlet valve at 100 L/min to flush out any bubbles Set the valve to flow into the device and then flow 450 L of water through the cell channel at 50 L/min Repeat this for the DNA channel
C. Surface Chemistry for Immobilizing Aptamers Fill a 1-mL syringe with 200 L of 1 mg/mL streptavidin With the valves set to flow out to waste, pump 60 L of streptavidin through the cell channel inlet valve at 80 L/min to flush out any bubbles (stop flowing once bubbles are flushed out and the fluid stream can be seen in the waste tubing past the valve) Set the valve to flow into the device and then flow 90 L of streptavidin through the cell channel inlet at 3 L/min, and then incubate for 10-15 mins Fill a 1-mL syringe with a blocking solution of 1% BSA, 1% Pluronic F-68, and 1% polyvinylpyrrolidone (PVP) K15 in PBS binding buffer (1DPBS with Mg and Ca, 4.5 g/L glucose, and 5 mM MgCl.sub.2) With the valves set to flow out to waste, pump 80 L of blocking solution through the cell channel inlet valve at 80 L/min to flush out any bubbles Set the valve to flow into the device and then flow 500 L of blocking solution through the cell channel inlet at 4 L/min Repeat for the DNA channel Prepare an aptamer solution by combining 3 L of 1 mM biotinylated DOV4 aptamer with 297 L of PBS binding buffer Incubate this aptamer solution at 75 C. for 5 mins then allow to cool to RT Fill a 1-mL syringe with this solution With the valves set to flow out to waste, pump 60 L of aptamer solution through the DNA channel inlet valve at 80 L/min to flush out any bubbles (stop flowing once bubbles are flushed out and the fluid stream can be seen in the waste tubing past the valve) Set the valve to flow into the device and then flow 180 L of aptamer solution through the DNA channel inlet at 3 L/min
D. Preparing the HeLa Cells
From Culture: Passage the cells as usual, but resuspend one pellet with 3 mL PBS binding buffer containing no DMSO This can be used directly
From Frozen: Thaw quickly an aliquot of cells in a 37 C. waterbath and transfer the cells to a falcon tube. Add 9 mL of PBS binding buffer and spin down the solution at 100g for 5 mins Take out supernatant and resuspend in 3 mL of PBS binding buffer Repeat this washing 3 times to remove all of the DMSO Resuspend the cells in 1 mL of PBS binding buffer and use directly in the device
E. Capturing and Lysing HeLa Cells Fill a 1-mL syringe with HeLa cell suspension With the valves set to flow out to waste, pump 80 L of cell suspension through the cell channel inlet valve at 10 L/min to flush out any bubbles Set the valve to flow into the device and then flow cells at 1 L/min and monitor capture using a fluorescence microscope (the HeLa cells have green fluorescent protein on their histones that enables them to fluoresce) Once cells are captured, close the cell channel valves Fill a 1-mL syringe with 2004 of 6M guanidinium thiocyanate in ultrapure water (this is the lysis solution) With the valves set to flow out to waste, pump 80 L of the solution through the DNA channel inlet valve at 80 L/min to flush out any bubbles Set the valve to flow into the device and then flow solution at 1 L/min and monitor lysis using a fluorescence microscope (look for disappearance of fluorescent whole cells)
F. Performing Specific MDA Reaction Flush out the lysis solution with 1 TE: Fill a 1-mL syringe with 200 L of 1 TE With the valves set to flow out to waste, pump 80 L of the solution through the DNA channel inlet valve at 80 L/min to flush out any bubbles Set the valve to flow into the device and then flow 60 L of solution at 1 L/min Use the REPLI-g Mitochondrial DNA kit to provide the buffer and enzymes for the MDA reaction Prepare the D1 denaturing buffer: 54 L Reconstituted Buffer DLB 192 L ultrapure Water Fill a 1-mL syringe with D1 solution With the valves set to flow out to waste, pump 80 L of the solution through the DNA channel inlet valve at 80 L/min to flush out any bubbles Set the valve to flow into the device and then flow 25 L of solution at 1 L/min Prepare the N1 Neutralizing Buffer 36 L Stop Solution 24 L MDA primer mix for the gene of interest 180 L ultrapure water Fill a 1-mL syringe with N1 solution With the valves set to flow out to waste, pump 80 L of the solution through the DNA channel inlet valve at 80 L/min to flush out any bubbles Set the valve to flow into the device and then flow 45 L of solution at 1 L/min Setup the device on a hotplate set to 3 C. Setup a humidity chamber around the device to prevent evaporation Prepare the MDA master mix 75 L ultrapure water 24 L MDA primer mix 121.5 L REPLI-g reaction buffer 4.5 L DNA polymerase Fill a 1-mL syringe with MDA reaction mix With the valves set to flow out to waste, pump the solution through the DNA channel inlet valve at 80 L/min to flush out any bubbles, and stop flowing once bubbles are flushed out and the fluid stream can be seen in the waste tubing past the valve Set the valve to flow into the device and then flow 50 uL of solution at 0.05 uL/min and collect eluent in an Eppendorf tube
REFERENCES
(112) Citation of a reference herein shall not be construed as an admission that such reference is prior art to the present invention. All references cited herein are hereby incorporated by reference in their entirety. Below is a listing of various references cited herein by Reference (Ref.) number: 1 K. Vermeulen, D. R. Van Bockstaele and Z. N. Berneman, Cell Proli 2003, 36, 131-149. 2 B. Vogelstein and K. W. Kinzler, Nat. Med., 2004, 10, 789-799. 3 L. Coin, M. Marshall, T. Down, T. Hubbard, R. Wooster, N. Rahman and M. R. Stratton, Nat. Rev. Cancer, 2004, 4, 177-183. 4 P. C. Nowell, Science, 1976, 194, 23-28. 5 C. G. Mullighan, S. Goorha, I. Radtke, C. B. Miller, E. Coustan-Smith, J. D. Dalton, K. Girtman, S. Mathew, J. Ma, S. B. Pounds, X. Su, C.-H. Pui, M. V Relling, W. E. Evans, S. A. Shurtleff and J. R. Downing, Nature, 2007, 446, 758-64. 6 A. Didelot, D. Le Cone, A. Luscan, A. Cazes, K. Pallier, J. F. Emile, P. Laurent-Puig and H. Blons, Exp. Mol. Pathol., 2012, 92, 275-280. 7 M. N. Nikiforova, A. I. Wald, S. Roy, M. B. Durso and Y. E. Nikiforov, J. Clin. Endocrinol. Metab., 2013, 98, 1852-1860. 8 G. Ellison, G. Zhu, A. Moulis, S. Dearden, G. Speake and R. McCormack, J. Clin. Pathol., 2013, 66, 79-89. 9 P. N. Gray, C. L. M. Dunlop and A. M. Elliott, Cancers, 2015, 7, 1313-1332. 10 D. T. Cheng, T. N. Mitchell, A. Zehir, R. H. Shah, R. Benayed, A. Syed, R. Chandramohan, Z. Y. Liu, H. H. Won, S. N. Scott, A. Rose Brannon, C. O'Reilly, J. Sadowska, J. Casanova, A. Yannes, J. F. Hechtman, J. Yao, W. Song, D. S. Ross, A. Oultache, S. Dogan, L. Borsu, M. Hameed, K. Nafa, M. E. Arcila, M. Ladanyi and M. F. Berger, J. Mol. Diagnostics, 2015, 17, 251-264. 11 Y. Wan, Y. L. Liu, P. B. Allen, W. Asghar, M. A. I. Mahmood, J. F. Tan, H. Duhon, Y. T. Kim, A. D. Ellington and S. M. Iqbal, Lab Chip, 2012, 12, 4693-4701. 12 J. A. Phillips, Y. Xu, Z. Xia, Z. H. Fan and W. Tan, Anal. Chem., 2009, 81, 1033-1039. 13 F. Zheng, Y. Cheng, J. Wang, J. Lu, B. Zhang, Y. Zhao and Z. Gu, Adv. Mater., 2014, 26, 7333-7338. 14 Y. Xu, J. A. Phillips, J. Yan, Q. Li, Z. H. Fan and W. Tan, Anal. Chem., 2009, 81, 7436-7442. 15 W. Sheng, T. Chen, R. Kamath, X. Xiong, W. Tan and Z. H. Fan, Anal Chem, 2012, 84, 4199-4206. 16 Q. Shen, L. Xu, L. Zhao, D. Wu, Y. Fan, Y. Zhou, W. H. Ouyang, X. Xu, Z. Zhang, M. Song, T. Lee, M. A. Garcia, B. Xiong, S. Hou, H. R. Tseng and X. Fang, Adv. Mater., 2013, 25, 2368-2373. 17 J. J. Benitez, J. Topolancik, H. C. Tian, C. B. Wallin, D. R. Latulippe, K. Szeto, P. J. Murphy, B. R. Cipriany, S. L. Levy, P. D. Soloway and H. G. Craighead, Lab Chip, 2012, 12, 4848. 18 D. Van Simaeys, D. Lopez-Colon, K. Sefah, R. Sutphen, E. Jimenez and W. Tan, PLoS One, 2010, 5, e13770. 19 J. P. Gleghorn, E. D. Pratt, D. Denning, H. Liu, N. H. Bander, S. T. Tagawa, D. M. Nanus, P. A. Giannakakou and B. J. Kirby, Lab Chip, 2010, 10, 27-29. 20 1 R. Pinard, A. de Winter, G. J. Sarkis, M. B. Gerstein, K. R. Tartaro, R. N. Plant, M. Egholm, J. M. Rothberg and J. H. Leamon, BMC Genomics, 2006, 7, 216. 21 C.-Z. Zhang, V. A. Adalsteinsson, J. Francis, H. Cornils, J. Jung, C. Maire, K. L. Ligon, M. Meyerson and J. C. Love, Nat. Commun., 2015, 6, 1-10. 22 J. Sabina and J. H. Leamon, in Whole Genome Amplifcation, ed. T. Kroneis, Springer, New York, 2015, vol. 1347, pp. 15-41. 23 F. B. Dean, S. Hosono, L. Fang, X. Wu, A. F. Faruqi, P. Bray-Ward, Z. Sun, Q. Zong, Y. Du, J. Du, M. Driscoll, W. Song, S. F. Kingsmore, M. Egholm and R. S. Lasken, Proc. Natl. Acad. Sci. U.S.A., 2002, 99, 5261-6. 24 C. Spits, C. Le Caignec, M. De Rycke, L. Van Haute, A. Van Steirteghem, I. Liebaers and K. Sermon, Nat. Protoc., 2006, 1, 1965-1970. 25 J. G. Paez, M. Lin, R. Beroukhim, J. C. Lee, X. Zhao, D. J. Richter, S. Gabriel, P. Herman, H. Sasaki, D. Altshuler, C. Li, M. Meyerson and W. R. Sellers, Nucleic Acids Res., 2004, 32, e71. 26 S. H. L. Mandey, M. S. Schneiders, J. . Koster and H. R. Waterham, Hum. Mutat., 2006, 27, 796-802. 27 M. Hollstein, K. Rice, M. S. Greenblatt, T. Soussi, R. Fuchs, T. Sorlie, E. Hovig, B. Smith-Sorensen, R. Montesano and C. C. Harris, Nucleic Acids Res., 1994, 22, 3551-5. 28 S. J. Foster and B. J. Monahan, Fungal Genet. Biol., 2005, 42, 367-375. 29 O. Alsmadi, F. Alkayal, D. Monies and B. F. Meyer, BMC Res. Notes, 2009, 2, 48. 30 R. Kurman and I. Shih, Int. J. Gynecol. Pathol., 2008, 27, 151-160.
(113) Although the present invention has been described for the purpose of illustration, it is understood that such detail is solely for that purpose and variations can be made by those skilled in the art without departing from the spirit and scope of the invention which is defined by the following claims.