Baculovirus vector and use thereof in preparation of recombinant adeno-associated virus (rAAV) in insect cell
12571001 ยท 2026-03-10
Assignee
Inventors
- He XIAO (Wuhan, CN)
- Xiaobin HE (Wuhan, CN)
- Gang HUANG (Wuhan, CN)
- Ying HU (Wuhan, CN)
- Xing PAN (Wuhan, CN)
- Mengdie WANG (Wuhan, CN)
- Liang DU (Wuhan, CN)
Cpc classification
C12N7/00
CHEMISTRY; METALLURGY
C12N2710/14021
CHEMISTRY; METALLURGY
C12N2750/14152
CHEMISTRY; METALLURGY
C12N2750/14143
CHEMISTRY; METALLURGY
C12N2710/14052
CHEMISTRY; METALLURGY
C12N2710/14043
CHEMISTRY; METALLURGY
C12N5/0601
CHEMISTRY; METALLURGY
International classification
C12N15/86
CHEMISTRY; METALLURGY
C12N15/864
CHEMISTRY; METALLURGY
Abstract
A baculovirus vector and a use thereof in the preparation of a recombinant adeno-associated virus (rAAV) in an insect cell are provided. The baculovirus vector includes an exogenous gene expression cassette and a stable sequence. The stable sequence is located at a site 5 kb or less from the exogenous gene expression cassette, and the stable sequence is a conserved noncoding element (CNE) sequence or a nucleocapsid assembly-essential element (NAE) sequence. When an insect cell is infected with a recombinant baculovirus (rBV) constructed in this way, after multiple continuous passages, production levels of the rBV and the rAAV still remain relatively stable.
Claims
1. A recombinant baculovirus (rBV) shuttle vector for preparing a rBV, comprising an exogenous gene expression cassette and a stable sequence, wherein the stable sequence is a conserved noncoding element (CNE) sequence or a nucleocapsid assembly-essential element (NAE) sequence; the exogenous gene expression cassette is at least one of a cap gene expression cassette of an adeno-associated virus (AAV), a rep gene expression cassette of the AAV, and an AAV inverted terminal repeat (ITR) core expression element operably linked to a heterologous coding sequence; and the stable sequence is located at a site 5 kb or less from at least one of a start and a stop end of the cap gene expression cassette, a start and a stop end of the rep gene expression cassette, and two ends of the AAV ITR core expression element operably linked to the heterologous coding sequence.
2. The rBV shuttle vector according to claim 1, wherein the exogenous gene expression cassette is the AAV ITR core expression element operably linked to the heterologous coding sequence and the cap gene expression cassette.
3. The rBV shuttle vector according to claim 1, wherein the rBV shuttle vector is obtained by inserting the exogenous gene expression cassette and the stable sequence into a parental baculovirus shuttle vector at a transposon insertion site through rBV transfer vector-mediated Tn7 transposition, and when the stable sequence is a CNE sequence, the native CNE sequence or when the stable sequence is a NAE sequence, the native NAE sequence is absent in the parental baculovirus shuttle vector.
4. A method of preparing a rBV comprising a step of infecting the rBV shuttle vector according to claim 1 into an insect cell.
5. The method according to claim 4, wherein the exogenous gene expression cassette of the baculovirus shuttle vector is the AAV ITR core expression element operably linked to the heterologous coding sequence and the cap gene expression cassette.
6. The method according to claim 4, wherein the rBV shuttle vector is obtained by inserting the exogenous gene expression cassette and the stable sequence into a parental baculovirus shuttle vector at a transposon insertion site through rBV transfer vector-mediated Tn7 transposition, and when the stable sequence is a CNE sequence, the native CNE sequence or when the stable sequence is a NAE sequence, the native NAE sequence is absent in the parental baculovirus shuttle vector.
7. An insect cell comprising the rBV shuttle vector according to claim 1.
8. A method for in vitro production of rBV, comprising: cultivating the insect cell according to claim 7 to obtain the rBV.
9. The insect cell according to claim 7, wherein the exogenous gene expression cassette of the rBV shuttle vector is the AAV ITR core expression element operably linked to the heterologous coding sequence and the cap gene expression cassette.
10. The insect cell according to claim 7, wherein the rBV shuttle vector is obtained by inserting the exogenous gene expression cassette and the stable sequence into a parental baculovirus shuttle vector at a transposon insertion site through rBV transfer vector-mediated Tn7 transposition, and when the stable sequence is a CNE sequence, the native CNE sequence or when the stable sequence is a NAE sequence, the native NAE sequence is absent in the parental baculovirus shuttle vector.
11. The baculovirus shuttle vector according to claim 1, wherein the CNE sequence is the amino acid sequence of SEQ ID NO: 5; and the NAE sequence is the amino acid sequence of SEQ ID NO: 7.
12. A rBV shuttle vector for preparing a recombinant adeno-associated virus (rAAV), comprising an exogenous gene expression cassette and a stable sequence, wherein the stable sequence is a CNE sequence or a NAE sequence; the exogenous gene expression cassette is a cap gene expression cassette of an adeno-associated virus (AAV) and a rep gene expression cassette of the AAV; and the stable sequence is located between the cap gene expression cassette and the rep gene expression cassette, and the cap gene expression cassette and the rep gene expression cassette are in opposite directions, and starting ends of the cap gene expression cassette and the rep gene expression cassette are arranged oppositely and face towards the stable sequence; or the exogenous gene expression cassette is an AAV inverted terminal repeat (ITR) core expression element operably linked to a heterologous coding sequence functional gene; and the stable sequence is located at a site 5 kb or less from the two ends of the AAV ITR core expression element operably linked to the heterologous coding sequence.
13. The rBV shuttle vector according to claim 12, wherein the rAAV is obtained by inserting the exogenous gene expression cassette and the stable sequence into a parental baculovirus shuttle vector at a transposon insertion site through rBV transfer vector-mediated Tn7 transposition, and when the stable sequence is a CNE sequence, the native CNE sequence or when the stable sequence is a NAE sequence, the native NAE sequence is absent in the parental baculovirus shuttle vector.
14. A method of preparing a rAAV comprising a step of infecting the baculovirus shuttle vector according to claim 12 into an insect cell.
15. An insect cell comprising the rBV shuttle vector according to claim 12.
16. A method for in vitro production of rAAV, comprising: cultivating the insect cell according to claim 15 to obtain the rAAV.
17. The baculovirus shuttle vector according to claim 12, wherein the CNE sequence is the amino acid sequence of SEQ ID NO: 5; and the NAE sequence is the amino acid sequence of SEQ ID NO: 7.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1)
(2)
(3)
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
(18)
(19)
(20)
(21)
(22)
DETAILED DESCRIPTION OF THE EMBODIMENTS
(23) In order to make the objectives, technical solutions, and advantages of the present disclosure clear, the present disclosure is further described in detail below with reference to the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are merely intended to explain the present disclosure, rather than to limit the present disclosure.
(24) Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the technical field of the present disclosure. The terms used in the specification of the present disclosure herein are merely for the purpose of describing specific embodiments, and are not intended to limit the present disclosure. The term and/or used herein includes any and all combinations of one or more of the associated listed items.
(25) In addition, the terms such as first and second are used only for the purpose of description and should not be construed as indicating or implying the relative importance, or implicitly indicating the quantity of indicated technical features. Therefore, features defined by first and second may explicitly or implicitly include at least one of the features. In the descriptions about the present disclosure, a plurality of means at least two, such as two or three, unless otherwise clearly and specifically limited. In the description of the present disclosure, several means at least one, such as one or two, unless otherwise clearly and specifically defined.
(26) As used herein, an expression cassette refers to a nucleic acid construct carrying a coding sequence and a regulatory sequence that can be operably linked when introduced into a host cell, where the coding sequence and the regulatory sequence lead to the transcription and/or translation of RNA or a polypeptide. It should be understood that the expression cassette includes a promoter allowing the initiation of transcription, an open reading frame of a target gene, and a transcription terminator. Generally, a promoter sequence is located upstream of a target gene, and a distance between the promoter sequence and the target gene is compatible with the expression control.
(27) Cis-acting elements refer to specific DNA sequences linked to structural genes in series, and are binding sites for transcription factors. The cis-acting elements can regulate the accurate initiation of gene transcription and the transcription efficiency by binding to transcription factors. The cis-acting elements include promoters, enhancers, regulatory sequences, inducible elements, etc. The cis-acting elements can participate in the regulation of gene expression, but do not code any protein themselves and merely provide one action site.
(28) AAV is a single-stranded DNA virus that has a simple genome structure with an overall length of about 4.7 kb. A genome of AAV includes a rep gene expression cassette, a cap gene expression cassette, and an AAV inverted terminal repeat (ITR) at two ends of the genome, which are the three elements necessary to package AAV A Cap gene encodes a structural VP capsid protein including three overlapping open reading frames that encode the three subunits of VP1, VP2, and VP3, respectively. A Rep gene encodes the four overlapping multifunctional proteins of Rep78, Rep68, Rep52, and Rep40, which are involved in the replication and integration of AAV. ITR is a palindromic structure of 125 nucleotides at two ends of a genome. ITR can form a self-complementary inverted T-shaped hairpin structure. ITR is a cis-acting element required for the initiation of DNA replication and the package of a recombinant AAV genome to generate infectious virions. As a defective virus, AAV cannot replicate independently in the absence of a helper virus. Therefore, AAV can only be integrated into a chromosome of a host cell in a targeted manner, and is in a latent state. In the presence of a helper virus, the increased expression of the rep gene can rescue an AAV genome integrated in a chromosome of a host cell for mass replication to produce AAV DNA, and a single-stranded rAAV genome can be packaged into infectious virions under an action of a VP capsid protein.
(29) It has been found that conserved non-protein-coding elements (CNEs) are present in all sequenced genomes of alphabaculoviruses, and have a highly-homologous sequence of 154 bp to 157 bp. It has been reported that an at-rich CNE sequence located in an ac152 region of a genome of an Autographa californica multiple nucleopolyhedro-virus (AcMNPV) may be a cis-acting element essential for virion production.
(30) NAE sequences have been first discovered as essential elements for nucleocapsid assembly in alphabaculoviruses. NAE sequences play an essential role in the nucleocapsid assembly. The natural NAE sequences are mapped to an ac83 gene and homologous genes thereof in alphabaculoviruses, and are located at the proximal end (CN106566829A). ac83 is a core gene associated with the baculovirus nucleocapsid assembly. ac83 has an overall length of 2,544 bp and a predicted molecular weight of 96.2 kDa, and can encode 847 amino acids. The knockout of ac83 does not affect the replication of a virus genome, but can completely block the virus nucleocapsid assembly, and accordingly, a large number of hollow capsid precursors can be observed in nuclei under an electron microscope.
(31) Positions of the natural CNE and NAE sequences in baculovirus genomes are conserved to some extent. There is currently no literature reporting that these two sequences can be used in baculovirus systems to improve the stability of AAV production, which is verified by the present disclosure.
(32) The present disclosure provides a baculovirus vector, including an exogenous gene expression cassette and a stable sequence. The stable sequence is located at a site 5 kb or less from the exogenous gene expression cassette, and the stable sequence is a CNE sequence or an NAE sequence.
(33) The exogenous gene expression cassette involved in the present disclosure may be either an element essential for producing rAAV or a coding sequence for expressing a foreign protein. For example, the foreign protein includes, but is not limited to, a reporter protein or a therapeutic gene product. When the exogenous gene expression cassette is the element essential for producing rAAV, the exogenous gene expression cassette can specifically be at least one of a cap gene expression cassette of AAV, a rep gene expression cassette of AAV, and an AAV ITR core expression element carrying a heterologous functional gene, and the stable sequence is located at a site 5 kb or less from at least one of start and stop ends of the cap gene expression cassette, start and stop ends of the rep gene expression cassette, and two ends of the AAV ITR core expression element carrying the heterologous functional gene.
(34) The AAV ITR core expression element carrying the heterologous functional gene is the heterologous functional gene and an AAV ITR located at two ends of the heterologous functional gene. The heterologous functional gene may be at least one nucleotide sequence encoding a gene of interest (GOI). The GOI may be a therapeutic gene product. Specifically, the GOI can be a polypeptide, an RNA molecule (siRNA), or another gene product, for example, including, but not limited to, a lipoprotein lipase, an apolipoprotein, a cytokine, an interleukin, or an interferon. The GOI can also be a reporter protein for assessing the transformation and expression of a vector, for example, including, but not limited to, a fluorescent protein (green fluorescent protein (GFP) and red fluorescent protein (RFP)), a chloramphenicol acetyltransferase, -galactosidase, -glucuronidase, renilla luciferase, firefly luciferase, or alkaline phosphatase.
(35) In the present disclosure, in order to improve the stability of AAV production of a baculovirus system in an insect cell, a stable sequence, namely, a CNE sequence or an NAE sequence, is constructed at a site near the three essential elements for the package of AAV. Specifically, a positional relationship between the stable sequence and the three elements can be presented in various forms: (1) The exogenous gene expression cassette is a cap gene expression cassette of AAV, and the stable sequence is located at a site 5 kb or less from a start end and/or a stop end of the cap gene expression cassette. (2) The exogenous gene expression cassette is a rep gene expression cassette of AAV, and the stable sequence is located at a site 5 kb or less from a start end and/or a stop end of the rep gene expression cassette. (3) The exogenous gene expression cassette is an AAV ITR core expression element carrying a heterologous functional gene (namely, ITR-GOI), and the stable sequence is located at a site 5 kb or less from one end and/or the other end of the ITR-GOI. (4) The exogenous gene expression cassette is a cap gene expression cassette of AAV and a rep gene expression cassette of AAV, and the stable sequence is located at a site 5 kb or less from at least one of start and stop ends of the cap gene expression cassette and start and stop ends of the rep gene expression cassette. (5) The exogenous gene expression cassette is a cap gene expression cassette of AAV and an AAV ITR core expression element carrying a heterologous functional gene, and the stable sequence is located at a site 5 kb or less from at least one of start and stop ends of the cap gene expression cassette and two ends of the ITR-GOI. (6) The exogenous gene expression cassette is a rep gene expression cassette of AAV and an AAV ITR core expression element carrying a heterologous functional gene, and the stable sequence is located at a site 5 kb or less from at least one of start and stop ends of the rep gene expression cassette and two ends of the ITR-GOI. (7) The exogenous gene expression cassette is a cap gene expression cassette of AAV, a rep gene expression cassette of AAV, and an AAV ITR core expression element carrying a heterologous functional gene, and the stable sequence is located at a site 5 kb or less from at least one of start and stop ends of the cap gene expression cassette, start and stop ends of the rep gene expression cassette, and two ends of the ITR-GOI.
(36) As a preferred embodiment, the exogenous gene expression cassette is a cap gene expression cassette and a rep gene expression cassette of AAV, and the stable sequence is located at a site 5 kb or less from at least one of start and stop ends of the cap gene expression cassette and start and stop ends of the rep gene expression cassette.
(37) It should be noted that the present disclosure does not limit the specific positions and directions of the cap gene expression cassette and the rep gene expression cassette. The cap gene expression cassette, the rep gene expression cassette, and the stable sequence can be arranged in the following six modes: 1. The cap gene expression cassette, the rep gene expression cassette, and the stable sequence are arranged sequentially from 5 terminus to 3 terminus. 2. The rep gene expression cassette, the cap gene expression cassette, and the stable sequence are arranged sequentially from 5 terminus to 3 terminus. 3. The cap gene expression cassette, the stable sequence, and the rep gene expression cassette are arranged sequentially from 5 terminus to 3 terminus. 4. The rep gene expression cassette, the stable sequence, and the cap gene expression cassette are arranged sequentially from 5 terminus to 3 terminus. 5. The stable sequence, the cap gene expression cassette, and the rep gene expression cassette are arranged sequentially from 5 terminus to 3 terminus. 6. The stable sequence, the rep gene expression cassette, and the cap gene expression cassette are arranged sequentially from 5 terminus to 3 terminus. The cap gene expression cassette and the rep gene expression cassette can be in a same direction or in opposite directions. The cap gene expression cassette can be arranged on the baculovirus vector in a sequence either from 5 terminus to 3 terminus or from 3 terminus to 5 terminus. Similarly, the rep gene expression cassette can be arranged on the baculovirus vector in a sequence either from 5 terminus to 3 terminus or from 3 terminus to 5 terminus.
(38) In addition, a distance of the stable sequence from the cap gene expression cassette and/or the rep gene expression cassette can be about 0.5 kb, about 1 kb, about 1.5 kb, about 2 kb, about 2.5 kb, about 3 kb, about 3.5 kb, about 4 kb, about 4.5 kb, or about 5 kb. The distance of the stable sequence from the cap gene expression cassette and/or the rep gene expression cassette can be a distance of the stable sequence from a start end or a stop end of the gene. In some embodiments, the CNE sequence may be a CNE sequence identical to a CNE sequence of wild-type AcMNPV, or a CNE sequence derived from another baculovirus, or an artificial CNE sequence that has a sequence identity of at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or more with the CNE sequence of wild-type AcMNPV. Similarly, the NAE sequence may be an NAE sequence identical to an NAE sequence of wild-type AcMNPV, or an NAE sequence derived from another baculovirus, or an artificial NAE sequence that has a sequence identity of at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or more with the NAE sequence of wild-type AcMNPV
(39) As a preferred embodiment, the stable sequence is located between the cap gene expression cassette and the rep gene expression cassette. Specifically, the baculovirus vector includes the cap gene expression cassette, the CNE sequence, and the rep gene expression cassette sequentially from 5 to 3, or the baculovirus vector includes the cap gene expression cassette, the NAE sequence, and the rep gene expression cassette sequentially from 5 to 3, or the baculovirus vector includes the rep gene expression cassette, the CNE sequence, and the cap gene expression cassette sequentially from 5 to 3, or the baculovirus vector includes the rep gene expression cassette, the NAE sequence, and the cap gene expression cassette sequentially from 5 to 3. Further preferably, two ends of the stable sequence are close to a start end of the cap gene expression cassette and a start end of the rep gene expression cassette, respectively. That is, the cap gene expression cassette and the rep gene expression cassette are in opposite directions, and starting ends of the cap gene expression cassette and the rep gene expression cassette are arranged oppositely and face towards the stable sequence.
(40) As a preferred embodiment, a cap gene and a rep gene can be regulated by the baculovirus very late gene-expression strong promoters p10 and polh, respectively, or the cap gene is regulated by the polh promoter and the rep gene is regulated by the p10 promoter.
(41) The rep gene expression cassette of the present disclosure at least encodes Rep78 and Rep52 proteins or Rep68 and Rep40 proteins. The rep gene expression cassette can include two overlapping open reading frames linked by a same regulatory sequence, and can include two expression cassettes, where the two expression cassettes have a respective regulatory sequence and express a protein. In some embodiments, the baculovirus vector may include the two independent gene expression cassettes of rep78 and rep52, and the expressions of the two gene expression cassettes are initiated by two promoters, respectively. For example, the stable sequence is located between the rep78 and rep52 gene expression cassettes. Preferably, two ends of the stable sequence are close to a start end of the rep78 gene expression cassette and a start end of the rep52 gene expression cassette, respectively. A promoter to initiate the expression of the rep78 gene expression cassette can be a baculovirus early promoter, such as a lE1 promoter, and a promoter to initiate the expression of the rep52 gene expression cassette can be a baculovirus very late promoter, such as a p10 promoter or a polh promoter.
(42) The baculovirus vector provided by the present disclosure can be a baculovirus, a baculovirus transfer vector, or a baculovirus shuttle vector (which is also known as a baculovirus plasmid and referred to as bacmid). The baculovirus transfer vector involved in the present disclosure usually includes a strong promoter and terminal elements Tn7L and Tn7R of a transposon Tn7, such as, but not limited to, a pFastBac vector. When a baculovirus vector including an exogenous gene expression cassette and a stable sequence is a first rBV transfer vector, the exogenous gene expression cassette and the stable sequence are located between terminal elements Tn7L and Tn7R of a transposon Tn7 of the first rBV transfer vector. The exogenous gene expression cassette and the stable sequence are together inserted into a first baculovirus shuttle vector at a transposon insertion site through first rBV transfer vector-mediated Tn7 transposition to obtain a first rBV shuttle vector carrying the exogenous gene expression cassette and the stable sequence. It should be noted that, when the stable sequence is a CNE sequence, the CNE sequence is deleted in a baculovirus genome carried by the corresponding first baculovirus shuttle vector, and when the stable sequence is an NAE sequence, the NAE sequence is deleted in a baculovirus genome carried by the corresponding first baculovirus shuttle vector. There is another method to prepare the rBV shuttle vector carrying the exogenous gene expression cassette and the stable sequence: a transfer vector with the exogenous gene expression cassette cloned and a second baculovirus shuttle vector carrying a complete baculovirus genome (including the normal CNE and NAE sequences) are subjected to Red homologous recombination, such that the exogenous gene expression cassette is inserted into the second baculovirus shuttle vector at a site near the CNE sequence or the NAE sequence to obtain a second rBV shuttle vector carrying the exogenous gene expression cassette and the stable sequence.
(43) The baculovirus vector provided by the present disclosure can be used for preparing rBV and/or rAAV in an insect cell. Compared with insect cells carrying vectors without the CNE or NAE sequence, an insect cell carrying the baculovirus vector of the present disclosure can stably maintain the production of high-titer rAAV even after continuous passages.
(44) The present disclosure also provides an insect cell carrying the above-described baculovirus vector, such as, but not limited to, a Sf9 cell from Spodoptera frugiperda, a Tni Pro cell from Trichoplusia ni, or an E4a cell from Estima acrea that carries the baculovirus vector, and preferably the Sf9 cell carrying the baculovirus vector.
(45) The present disclosure also provides a method for in vitro growth or production of rBV, including: providing an insect cell culture including the above-described insect cell, and cultivating the insect cell. The insect cell is produced by infecting an insect cell with any one of the rBVs carrying the exogenous gene expression cassette and the stable sequence described above or by transfecting an insect cell with any one of the recombinant bacmids carrying the exogenous gene expression cassette and the stable sequence described above.
(46) The present disclosure also provides a method for in vitro growth or production of rAAV, including: providing an insect cell culture including the insect cell described above, and cultivating the insect cell. The insect cell is produced by infecting an insect cell with one or more rBVs carrying the exogenous gene expression cassette and the stable sequence described above or by transfecting an insect cell with one or more recombinant bacmids carrying the exogenous gene expression cassette and the stable sequence described above. The CNE sequence or the NAE sequence is located at a site 5 kb or less from at least one of a start end of the cap gene expression cassette, a stop end of the cap gene expression cassette, a start end of the rep gene expression cassette, and a stop end of the rep gene expression cassette. The insect cell can be repeatedly passaged for multiple generations with little or no loss of AAV production, such as at least 3 generations, at least 4 generations, at least 5 generations, at least 6 generations, at least 7 generations, at least 8 generations, at least 9 generations, and at least 10 generations.
(47) It should be noted that the insect cell for growth or production of rBV or rAAV can include: the following three bacmids: a recombinant bacmid carrying the cap gene expression cassette of AAV, a recombinant bacmid carrying the rep gene expression cassette of AAV, and a recombinant bacmid carrying the ITR-GOI; or the following two bacmids: a recombinant bacmid carrying both the cap and rep gene expression cassettes of AAV, and a recombinant bacmid carrying the ITR-GOI; or the following two bacmids: a recombinant bacmid carrying only the rep gene expression cassette of AAV, and a recombinant bacmid carrying both the cap gene expression cassette of AAV and the ITR-GOI; or the following one bacmid: a recombinant bacmid carrying the cap and rep gene expression cassettes of AAV and the ITR-GOI after integration. The stable sequence (the CNE or NAE sequence) is located near at least one of the cap gene expression cassette of AAV, the rep gene expression cassette of AAV, and the AAV ITR core expression element with the heterologous functional gene.
(48) In an embodiment, rAAV is produced by a two-baculovirus system, and a main process is as follows: The rep and cap genes of AAV, in combination with the CNE sequence (or the NAE sequence) nearby, are integrated into a baculovirus genome through transfer vector-mediated Tn7 recombination, the ITR core expression element with the heterologous functional gene is integrated into another baculovirus genome through transfer vector-mediated Tn7 recombination, and then a host cell is co-infected with resulting two rBVs (BEVs) to produce the rAAV.
(49) The above technical solutions will be described in detail below in conjunction with specific examples.
Example 1 Construction of a CNE Sequence-Deleted Bacmid CNE-Bac and an NAE Sequence-Deleted Bacmid NAE-Bac
(50) Red recombination is an efficient recombinant method at a bacterial level, and can be used in Escherichia coli (DH10Bac) to rapidly modify an rBV genome. The Red recombination refers to homologous recombination of a linear DNA fragment carrying a homologous arm introduced into a cell with a specific target sequence of a genome using a X bacteriophage Red recombinase (including the three proteins of Exo, Beta, and Gam) to allow the substitution of a target gene (Doublet et al., 2008, J Microbiol Methods, 75 (2): 359-361).
(51) A first homologous recombination expression cassette (SEQ ID NO: 1) of a targeting CNE sequence was first constructed. As shown in
(52) Similarly, a second homologous recombination expression cassette (SEQ ID NO: 2) of a targeting NAE sequence was first constructed. As shown in
Example 2 Construction of Recombinant Transfer Vectors pFastBac-Rep-Cap9, pFastBac-Rep-CNE-Cap9, pFastBac-ITR, and pFastBac-ITR-CNE that Include or do not Include a CNE Sequence
(53) A recombinant transfer vector carrying Cap and Rep expression cassettes of AAV was constructed. A Cap gene sequence of AAV9 and a Rep gene sequence of AAV2 were first amplified from an AAV genome through polymerase chain reaction (PCR), and then the Cap gene sequence (SEQ ID NO: 3) and the Rep gene sequence (SEQ ID NO: 4) were inserted into a pFastBac vector through enzyme digestion and enzyme ligation to obtain a recombinant transfer vector pFastBac-Rep-Cap9, as shown in
(54) A recombinant transfer vector carrying a CNE sequence and Cap and Rep expression cassettes of AAV was constructed. A CNE sequence (SEQ ID NO: 5) was first amplified from a baculovirus genome through PCR and then inserted into the pFastBac-Rep-Cap9 vector through enzyme digestion and enzyme ligation to obtain a recombinant transfer vector pFastBac-Rep-CNE-Cap9, as shown in
(55) A recombinant transfer vector carrying an ITR core element (ITR-GOI) was constructed. A nucleotide sequence of the ITR-GOI was shown in SEQ ID NO: 6. In this example, GOI in the ITR core element adopted an RFP mcherry gene expression cassette, that is, the expression of mcherry was controlled by a miniEf1a promoter, which was convenient for the detection of an activity of rAAV. The ITR and the RFP expression cassette were constructed on a transfer vector pFastBac to obtain a recombinant transfer vector pFastBac-ITR, as shown in
(56) A transfer vector carrying a CNE sequence and ITR-GOI was constructed. A CNE sequence was first amplified from a baculovirus genome through PCR and then inserted into the pFastBac-ITR vector through enzyme digestion and enzyme ligation to obtain a recombinant transfer vector pFastBac-ITR-CNE, as shown in
Example 3 Construction of Recombinant Transfer Vectors pFastBac-Rep-NAE-Cap9 and pFastBac-ITR-NAE that Include an NAE Sequence
(57) A recombinant transfer vector carrying an NAE sequence and Cap and Rep expression cassettes of AAV was constructed. An NAE sequence (SEQ ID NO: 7) was first amplified from a baculovirus genome through PCR and then inserted into the pFastBac-Rep-Cap9 vector constructed in Example 2 to obtain a recombinant transfer vector pFastBac-Rep-NAE-Cap9, as shown in
(58) A transfer vector carrying an NAE sequence and ITR-GOI was constructed. An NAE sequence was first amplified from a baculovirus genome through PCR and then inserted into the pFastBac-ITR vector constructed in Example 2 through enzyme digestion and enzyme ligation to obtain a recombinant transfer vector pFastBac-ITR-NAE, as shown in
Example 4 Construction of a Recombinant Bacmid with or without a CNE Sequence
(59) The recombinant transfer vectors pFastBac-Rep-Cap9 and pFastBac-ITR obtained in Example 2 were transformed into a DH10Bac strain carrying a bacmid. The DH10Bac strain also included a helper plasmid (pMON7124 (13.2 kb), which had tetracycline resistance and could encode a transposase). Once the transfer vectors were transformed into the DH10Bac strain, Tn7 transposition occurred, and Rep-Cap9 and ITR sequences were cut off from the transfer vectors and inserted into the bacmid at a Tn7 site to produce recombinant bacmids Bac-Tn7-Rep-Cap9 and Bac-Tn7-ITR. A transposase required for the transposition was provided by the expression of the helper plasmid.
(60) Similarly, the recombinant transfer vectors pFastBac-Rep-CNE-Cap9 and pFastBac-ITR-CNE obtained in Example 2 were transformed into a DH10Bac strain carrying a bacmid CNE-Bac, and Tn7 transposition occurred to produce recombinant bacmids CNE-Bac-Tn7-Rep-CNE-Cap9 and CNE-Bac-Tn7-ITR-CNE.
Example 5 Construction of a Recombinant Bacmid with an NAE Sequence
(61) With reference to Example 4, the recombinant transfer vectors pFastBac-Rep-NAE-Cap9 and pFastBac-ITR-NAE obtained in Example 3 were transformed into a DH10Bac strain carrying a bacmid NAE-Bac, and Tn7 transposition occurred to produce recombinant bacmids NAE-Bac-Tn7-Rep-NAE-Cap9 and NAE-Bac-Tn7-ITR-NAE.
Example 6 Production of rBV with the Recombinant Bacmids Obtained in Examples 4 and 5 and Verification of Stability of the rBV with the CNE or NAE Sequence During Passages
(62) In order to further analyze the stability of the rBV with the CNE or NAE sequence during passages, titers of rBV and rAAV were detected by the quantitative polymerase chain reaction (Q-PCR) method in this example and the following examples. The Q-PCR method was cited from the patent CN108699567A.
(63) Preparation of rBVs: DNA was extracted from the recombinant bacmids constructed in Examples 4 and 5 and then transfected into Sf9 insect cells to prepare rBVs and rAAVs. BEVs were successfully produced in the transfected Sf9 insect cells, and the further infection of BEVs replicating and proliferating in large quantities led to an obvious cytopathic effect (CPE) of Sf9 cells. A culture supernatant of Sf9 cells undergoing CPE was collected, which included a large amount of BEV and was the 0th generation of BEV (BEV-P0). Sf9 cells carrying a large amount of rAAV were collected. Sf9 cells cultivated in a suspended state were infected with the prepared BEV-P0 at a multiplicity of infection (MOI=1). 72 h after the infection, a cell viability decreased to 50% or less, and a resulting cell culture was centrifuged at 1,000 g for 5 min to obtain a culture supernatant and a cell pellet. The culture supernatant was denoted as the 1st generation BEV (BEV-P1), and the cell pellet was denoted as BEV-P0-packed rAAV
(64) The rBV prepared in this example was continuously passaged with a same MOI and then used to infect Sf9 cells to obtain P3, P4, P5 . . . P10 BEVs, and the stability of the rBV during passages was tested. Titers of all generations of BEV were determined by Q-PCR, and the titers were expressed in a unit of VG/mL (VG, virus genomes). A total titer of baculoviruses was determined with a pair of Q-PCR primers (Q-GP64-F: AACTTGGACATTACCCCGCC, as shown in SEQ ID NO: 8 and Q-GP64-R: CCGTTGTACGCATACGCCTG, as shown in SEQ ID NO: 9) corresponding to the gp64 gene (present in all rBVs of the present disclosure). A titer of a baculovirus carrying the rep gene expression cassette and the cap gene expression cassette was determined with a pair of Q-PCR primers (Q-Rep-F: GAACAAGGTGGTGGACGAGT, as shown in SEQ ID NO: 10 and Q-Rep-R: ATTCAAACAGGCGCTTAAAT, as shown in SEQ ID NO: 11) corresponding to the rep gene. A titer of a baculovirus carrying ITR-GOI was determined with a pair of Q-PCR primers (Q-Tn7-F: TCGTATTAGCTTACGACGCTACA, as shown in SEQ ID NO: 12 and Q-Tn7-R: TAGTTGGGAACTGGGAGGGG, as shown in SEQ ID NO: 13) corresponding to the Tn7 sequence. The stability of an exogenous fragment (namely, the rep/cap gene expression cassette and ITR-GOI element) in BEV during passages was evaluated through ratios of Tn7/GP64 and REP/GP64. If the ratios remain stable, it indicates that the stability of the rep/cap gene expression cassette and ITR-GOI element during passages is prominent. If the ratios decrease significantly with the increase of passages, it indicates that the stability of the inserted exogenous fragment is poor. Throughout a passage process, a total BEV titer, namely, a Q-PCR titer of GP64, was used to calculate an MOI for passage.
(65) Experimental results of titers of the 3rd to 10th generations of rBVs with and without the CNE or NAE sequence are shown in
(66) The above experimental data shows that, when an rBV vector does not include the CNE or NAE sequence, a titer of the specific rBV decreases rapidly with the increase of passages. A titer of the specific rBV of the p10 generation is less than 10% of a total rBV titer (
Example 7 Detection of rAAV Yields of Different Generations of rBV Carrying the Rep Gene Expression Cassette and the Cap Gene Expression Cassette of AAV
(67) Another aspect of assessing the stability of rBV during passages was to detect a packaging rate and a supernatant titer of rAAV. Titers of all generations of rAAV were determined by Q-PCR, and the titers were expressed in a unit of VG/L (VG, virus genomes). The rAAV titer was detected with a pair of primers targeting the ITR sequence (Q-ITR-F: GGAACCCCTAGTGATGGAGTT, as shown in SEQ ID NO: 14 and Q-ITR-R: CGGCCTCAGTGAGCGA, as shown in SEQ ID NO: 15) or a pair of primers targeting the WPRE sequence (Q-WPRE-F: CCGTTGTCAGGCAACGTG, as shown in SEQ ID NO: 16 and Q-WPRE-R: AGCTGACAGGTGGTGGCAAT, as shown in SEQ ID NO: 17). In this example, the 3rd to 10th generations of rBV carrying the CNE sequence (CNE-Bac-Tn7-Rep-CNE-Cap9), rBV carrying the NAE sequence (NAE-Bac-Tn7-Rep-NAE-Cap9), and rBV carrying the ITR-GOI element (Bac-Tn7-ITR) were used to co-infect Sf9 cells to produce AAV vectors, and the 3rd to 10th generations of rBV without the CNE or NAE sequence (Bac-Tn7-Rep-Cap9) and rBV carrying the ITR-GOI element (Bac-Tn7-ITR) were used to co-infect Sf9 cells to produce AAV vectors. 3 d after viral infection, a cell pellet was collected, and an AAV yield was determined.
(68) Experimental results are shown in
Example 8 Detection of Protein Expression Levels of Different Generations of rBV Carrying the Rep Gene Expression Cassette and the Cap Gene Expression Cassette of AAV
(69) In this example, expression levels of a Rep protein and a Cap protein were analyzed by Western Blot.
(70)
(71) It is easy for those skilled in the art to understand that the above-mentioned contents are merely the preferred examples of the present disclosure, and are not intended to limit the present disclosure. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present disclosure should fall within the protection scope of the present disclosure.