Promoter and use thereof
12570989 ยท 2026-03-10
Assignee
Inventors
- Gaoxu Xue (Suzhou, CN)
- Tianming Qi (Suzhou, CN)
- Aihua Feng (Suzhou, CN)
- Zhengli Xie (Suzhou, CN)
- Yankai Jia (Suzhou, CN)
- Xin Wu (Suzhou, CN)
- Zhongping Sun (Suzhou, CN)
- Guojuan Liao (Suzhou, CN)
Cpc classification
C12N9/2471
CHEMISTRY; METALLURGY
C12N2800/22
CHEMISTRY; METALLURGY
C12N15/70
CHEMISTRY; METALLURGY
C12N15/72
CHEMISTRY; METALLURGY
C12Y302/01023
CHEMISTRY; METALLURGY
International classification
C12N15/66
CHEMISTRY; METALLURGY
C12N15/70
CHEMISTRY; METALLURGY
C12N15/72
CHEMISTRY; METALLURGY
Abstract
An improved promoter and a use thereof. An improvement is to mutate a nucleic acid sequence between 35 region and 10 region in a promoter region into recognition sites for an endonuclease. The improvement is used for overcoming the problem that a transcription or translation product of foreign genes under a strong promoter might be toxic to a host and cannot be cloned and avoiding the phenomena of false positives and false negatives during blue-white screening.
Claims
1. A -galactosidase promoter, consisting of a 35 region, a 10 region, and a mutated nucleic acid sequence between the 35 region and the 10 region, wherein: the mutated nucleic acid sequence comprises at least one recognition site for an endonuclease, each recognition site for an endonuclease selected from the group consisting of EcoRV, AleI, BamHI, XhoI, and PmlI; the 35 region has a nucleic acid sequence of 5-TTTACA-3; a 5 end of the mutated nucleic acid sequence is linked to a 3 end of the 35 region; a 3 end of the mutated nucleic acid sequence is linked to a 5 end of the 10 region; and the mutated nucleic acid sequence is 16 to 18 base pairs in length.
2. The promoter of claim 1, wherein the mutated nucleic acid sequence between the 35 region and the 10 region of the promoter is SEQ ID NO: 4.
3. A vector, comprising the promoter of claim 1 and a reporter gene regulated by the promoter.
4. The vector of claim 3, wherein insertion of a foreign DNA at the recognition site for the endonuclease significantly reduces activity of the promoter.
5. The vector of claim 3, wherein the vector is a cloning vector or an expression vector.
6. An isolated host cell, comprising the vector of claim 3.
7. The host cell of claim 6, wherein the host cell is Escherichia coli.
8. The host cell of claim 7, wherein a C-terminal -fragment of a -galactosidase of the Escherichia coli is encoded.
9. A method of preparing the vector of claim 3, comprising the following steps: (1) performing PCR with a set of primers for mutating a nucleic acid sequence between the 35 region and the 10 region of a -galactosidase promoter in a promoter region of a -galactosidase to comprise at least one recognition site for an endonuclease, and using an original vector comprising an original -galactosidase promoter and a reporter gene regulated by the original -galactosidase promoter as a template for PCR amplification, to obtain a PCR amplification product with the promoter of claim 1; and (2) cyclizing the PCR amplification product obtained using the primers in step (1) by recombination to obtain a vector.
10. The method of claim 9, wherein nucleic acid sequences of the set of primers in step (1) are SEQ ID NO: 17 and SEQ ID NO: 18.
11. A kit, comprising either a vector comprising the promoter of claim 1 or an isolated host cell comprising the vector.
12. The method of claim 9, wherein before step (1), the method further comprises performing codon optimization on the reporter gene.
13. The method of claim 9, wherein the reporter gene is a lacZ gene whose nucleic acid sequence is SEQ ID NO: 39.
14. The vector of claim 3, wherein the reporter gene is a lacZ gene whose nucleic acid sequence is SEQ ID NO: 39.
15. The method of claim 9, wherein the reporter gene is a lacZ gene encoding an N-terminal -fragment of the -galactosidase.
16. The promoter of claim 1, wherein the 10 region has a nucleic acid sequence of 5-TATGTT-3.
17. The vector of claim 4, wherein the foreign DNA is at least 24 base pairs in length.
18. A method of using the vector of claim 3, comprising the following steps: (1) linearizing the vector by digesting the at least one recognition site for the endonuclease in the mutated nucleic acid sequence between the 35 region and the 10 region of the promoter to obtain a linearized vector; and (2) ligating a foreign DNA into the linearized vector of step (1), thereby obtaining a vector comprising a foreign DNA inserted into the mutated nucleic acid sequence between the 35 region and the 10 region of the promoter.
19. The method of claim 18, wherein the linearizing in step (1) is performed through endonuclease digestion and PCR amplification.
20. The method of claim 18, wherein digesting is performed with an appropriate endonuclease selected from the group consisting of EcoRV, AleI, BamHI, XhoI, and PmlI.
Description
BRIEF DESCRIPTION OF DRAWINGS
(1)
(2)
(3)
DETAILED DESCRIPTION
(4) To further elaborate on the technical means adopted and the effects achieved in the present application, the technical solutions of the present application are further described below through specific embodiments, but the present application is not limited to the scope of the embodiments.
(5) The present application adopts conventional techniques and methods in the fields of genetic engineering and molecular biology, and general reference literature provides definitions and methods known to those skilled in the art. However, those skilled in the art may adopt other conventional methods, experimental schemes and reagents in the art on the basis of the technical solutions described in the present application without being limited by specific embodiments of the present application.
(6) Experiments without specific techniques or conditions noted in the examples are conducted according to techniques or conditions described in the literature in the art or a product specification. The reagents or instruments used without manufacturers are conventional products commercially available through proper channels.
Explanation of Terms
(7) LacZ gene: a gene widely used in gene expression regulation researches. An encoded -galactosidase (-gal) is a tetramer composed of 4 subunits and can catalyze a hydrolysis of lactose. The -gal is relatively stable, appears blue when stained with X-Gal as a substrate, and is easy to detect and observe. Many advantages of the LacZ gene make it a commonly-used marker gene in genetic engineering experiments such as screening of transformed strains and -galactosidase color test method, that is, blue-white screening.
(8) LacZ gene: an N-terminal -fragment for encoding the -galactosidase (lacZ). The -galactosidase with enzymatic activity may be formed through -complementation and cleave a colorless compound, X-gal (5-bromo-4-chloro-3-indole--D-galactoside), into galactose and a dark blue substance, 5-bromo-4-indigo.
(9) Endonuclease: an enzyme that can hydrolyze a phosphodiester bond inside a molecular chain to generate oligonucleotides among nucleic acid hydrolases.
(10) PCR technology: a polymerase chain reaction, in which DNA is denatured in vitro at a high temperature of 95 C. to be single-stranded, a primer combines with a single strand at a low temperature (generally about 60 C.) based on a principle of complementary base pairing, the temperature is adjusted to an optimal reaction temperature of a DNA polymerase (about 72 C.) at which the DNA polymerase synthesizes a complementary strand along a direction from phosphate to five-carbon sugar (5-3). A PCR instrument based on polymerases is in fact a temperature control device and can control the temperature well between a denaturation temperature, a renaturation temperature and an extension temperature.
(11) Materials:
(12) Kanamycin-resistant pUC57 plasmid Genewiz Inc. Suzhou pCK plasmid Genewiz Inc. Suzhou Chloramphenicol-resistant pCC1TM plasmid EPICENTRE Top10F competent cell Invitrogen Restriction enzymes: EcoRV, AleI, BamHI, XhoI NEB T4 DNA ligase NEB lambdaDNA NEB Gibson Assembly Master Mix kit NEB Primer synthesis Genewiz Inc. Suzhou
Example 1: Codon Optimization of a lacZ Gene
(13) The codon optimization of the lacZ gene includes a step described below.
(14) The codon optimization was conducted on the lacZ gene (SEQ ID NO: 39) in a pUC57 plasmid using codon optimization software (developed by Genewiz Inc. Suzhou), where the optimized lacZ gene was synthesized by Genewiz Inc. Suzhou. A nucleotide sequence is shown by SEQ ID NO: 39, specifically:
(15) TABLE-US-00005 thelacZgene(SEQIDNO.39): ATGACCATGCTCGAGCCAAGCTTGCATGCAGGCCTCTGCAGTCG ACGGGCCCGGGATCCGATATCTAGATGCATTCGCGAGGTACCGA GCTCGAATTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAA AACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCC TTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCC CTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGGCGCCTGATG CGGTATTTTCTCCTTACGCATCTGTGCGGTATTTCACACCGCAT ATGGTGCACTCTCAGTACAATCTGCTCTGATGCCGCATAG; theoptimizedlacZgene(SEQIDNO.40): ATGACCATGCTGGAACCGAGCCTGCATGCAGGTCTGTGCAGCCG TCGTGCACGCGATCCGATTAGCCGCTGCATTCGCGAAGTGCCGA GCAGCAATAGCCTGGCCGTGGTGCTGCAGCGTCGCGATTGGGAA AATCCGGGTGTGACCCAGCTGAATCGCCTGGCAGCACATCCGCC GTTTGCCAGCTGGCGTAATAGCGAAGAAGCACGCACCGATCGTC CGAGCCAGCAGCTGCGTAGCCTGAATGGCGAATGGCGCCTGATG CGCTATTTTCTGCTGACCCATCTGTGCGGCATTAGCCATCGCAT TTGGTGCACCCTGAGCACCATTTGCAGCGATGCCGCCTAA.
Example 2 Construction of a High-Copy Cloning Vector
(16) A method for constructing the high-copy cloning vector includes specific steps described below.
(17) (I) The lacZ gene of pUC57 (kanamycin resistance) was replaced with the optimized lacZ gene in Example 1, specifically including steps described below.
(18) (1) The kanamycin-resistant pUC57 plasmid was used as a template and SEQ ID NOs: 41-42 were used as primers for PCR amplification. Specific sequences are as follows:
(19) TABLE-US-00006 SEQIDNO.41(forwardprimer): ATGCAGGCTCGGTTCCAGCATGGTCATAGCTGTTTCCTGTGTGA AATTGTTATCC; SEQIDNO.42(reverseprimer): AGCACCATTTGCAGCGATGCCGCCTAATTAAGCCAGCCCCGACA CCCGCCAACAC.
(20) A PCR system is shown in Table 1.
(21) TABLE-US-00007 TABLE 1 Template About 50 ng, 0.5 L Forward primer 10 pM, 0.5 L Reverse primer 10 pM, 0.5 L dNTP 5 mM each, 0.5 L 5 PCR buffer 10 L pfu DNA polymerase 5 U/L 0.5 L H.sub.2O 37.5 L
(22) One group uses water as a sample for negative control.
(23) Reaction conditions are listed in Table 2.
(24) TABLE-US-00008 TABLE 2 Amplification program Reaction Program Number of Cycles 95 C. 4 min 1 94 C. 30 s 25 58 C. 30 s 72 C. 2 min 72 C. 5 min 1 4 C. 1
(25) (2) A PCR solution obtained in step (1) was subjected to 1% agarose gel electrophoresis, and gel was cut, recovered and purified to obtain a PCR amplification product.
(26) (3) The Gibson Assembly Master Mix kit was used for ligating a PCR purified product obtained in step (2) and the codon-optimized lacZ gene obtained in Example 1. A ligation system is shown in Table 3.
(27) TABLE-US-00009 TABLE 3 PCR amplification product About 200 ng, 5 L lacZ gene About 120 ng, 5 L Gibson Assembly Master Mix 10 L Sterilized and deionized H.sub.2O 0 L
(28) A ligation condition was a ligation reaction of 1 h at 50 C.
(29) (4) A ligation product obtained in step (3) was transformed into Top10F competent cells which were finally coated with a kanamycin-resistant LB plate containing IPTG and X-gal and cultivated overnight at 37 C. A blue single clone was picked and subjected to Sanger sequencing on the next day, and a plasmid with a correct sequence was reserved and named pUC57-lacZ.
(30) (II) A sequence, 5-CTTTATGCTTCCGGCTCG-3 (SEQ ID NO: 2), between 35 region and 10 region in a promoter region of the -galactosidase of the pUC57-lacZ plasmid was mutated into a sequence recognizable by the endonuclease, which specifically includes steps described below.
(31) (1) The pUC57-lacZ plasmid successfully constructed in step (I) was used as a template, and primers F1-EcoRV, R1-EcoRV, F2-EcoRV, R2-EcoRV, F3-EcoRV, R3-EcoRV, F4-EcoRV, R4-EcoRV, F5-EcoRV, R5-EcoRV, F6-AleI, R6-AleI, F7-BamHI-XhoI and R7-BamHI-XhoI (SEQ ID NO: 15-SEQ ID NO: 28) were used as primers for the PCR amplification. Specific sequences are listed in Table 4.
(32) TABLE-US-00010 TABLE4 NO. Sequence SEQID CCGGAAGCGATATCTGTAAAG NO.15 CCTGGGGTGCCTAATGAGTG (F1- EcoRV) SEQID CCCCAGGCTTTACAGATATCGCTT NO.16 CCGGCTCGTATGTTGTGTGGAATT (R1- EcoRV) SEQID GAGCCGGAGATATCAAGTGTAAAG NO.17 CCTGGGGTGCCTAATGAG (F2- EcoRV) SEQID CAGGCTTTACACTTGATATCTCCGG NO.18 CTCGTATGTTGTGTGGAATTGTG (R2- EcoRV) SEQID TACGAGCCGATATCATAAAGTGTAAA NO.19 GCCTGGGGTGCCTAAT (F3- EcoRV) SEQID GCTTTACACTTTATGATATCGGCTCG NO.20 TATGTTGTGTGGAATTGTGAGC (R3- EcoRV) SEQID ACATACGAGATATCAGCATAAAGTGT NO21 AAAGCCTGGGGTGCCT (F4- EcoRV) SEQID TTACACTTTATGCTGATATCTCGTATG NO.22 TTGTGTGGAATTGTGAGCGGA (R4- EcoRV) SEQID ACAACATAGATATCGGAAGCATAAAGT NO.23 GTAAAGCCTGGGGTG (F5- EcoRV) SEQID CACTTTATGCTTCCGATATCTATGTTG NO.24 TGTGGAATTGTGAGCGGATAA (R5- EcoRV) SEQID AACATACGAGCACGAAGGTGAAAGTGT NO.25 AAAGCCTGGGGTGCCTAATGA (F6- AleI) SEQID TACACTTTCACCTTCGTGCTCGTATGT NO.26 TGTGTGGAATTGTGAGCGG (R6- AleI) SEQID CATAGGATCCGATATCCTCGAGTGTA NO.27 AAGCCTGGGGTGCCTAATGAGTGA (F7- BamHI -XhoI) SEQID TACACTCGAGGATATCGGATCCTATGT NO.28 TGTGTGGAATTGTGAGCGGATAA (R7- BamHI-XhoI)
(33) A specific PCR system is shown in Table 1, and reaction conditions are listed in Table 2.
(34) (2) A PCR solution obtained in step (1) was subjected to 1% agarose gel electrophoresis, and gel was cut, recovered and purified to obtain a PCR amplification product. The Gibson Assembly Master Mix kit was used for a ligation reaction. A ligation system is shown in Table 5.
(35) TABLE-US-00011 TABLE 5 PCR amplification product About 300 ng, 10 L Gibson Assembly Master Mix 10 L Sterilized and deionized H.sub.2O 0 L
(36) A ligation condition was a ligation reaction of 1 h at 50 C.
(37) (3) Each ligation product obtained in step (2) was transformed into Top10F competent cells which were finally coated with a kanamycin-resistant LB plate containing IPTG and X-gal and cultivated overnight at 37 C. A blue single clone was picked and subjected to Sanger sequencing on the next day, and a plasmid with a correct sequence was reserved and separately named pUC57-lacZ-Mu-1 (5-CTTTATGCTTCCGGCTCG-3 (SEQ ID NO: 2) was mutated into 5-GATATCGCTTCCGGCTCG-3 (SEQ ID NO: 3), and the plasmid was constructed with primers F1-EcoRV+R1-EcoRV), pUC57-lacZ-Mu-2 (5-CTTTATGCTTCCGGCTCG-3 (SEQ ID NO: 2) was mutated into 5-CTTGATATCTCCGGCTCG-3 (SEQ ID NO: 4), and the plasmid was constructed with primers F2-EcoRV+R2-EcoRV), pUC57-lacZ-Mu-3 (5-CTTTATGCTTCCGGCTCG-3 (SEQ ID NO: 2) was mutated into 5-CTTTATGATATCGGCTCG-3 (SEQ ID NO: 5), and the plasmid was constructed with primers F3-EcoRV+R3-EcoRV), pUC57-lacZ-Mu-4 (5-CTTTATGCTTCCGGCTCG-3 (SEQ ID NO: 2) was mutated into 5-CTTTATGCTGATATCTCG-3 (SEQ ID NO: 6), and the plasmid was constructed with primers F4-EcoRV+R4-EcoRV), pUC57-lacZ-Mu-5 (5-CTTTATGCTTCCGGCTCG-3 (SEQ ID NO: 2) was mutated into 5-CTTTATGCTTCCGATATC-3 (SEQ ID NO: 7), and the plasmid was constructed with primers F5-EcoRV+R5-EcoRV), pUC57-lacZ-Mu-6 (5-CTTTATGCTTCCGGCTCG-3 (SEQ ID NO: 2) was mutated into 5-CTTTCACCTTCGTGCTCG-3 (SEQ ID NO: 8), and the plasmid was constructed with primers F6-AleI+R6-AleI), and pUC57-lacZ-Mu-7 (5-CTTTATGCTTCCGGCTCG-3 (SEQ ID NO: 2) was mutated into 5-CTCGAGGATATCGGATCC-3 (SEQ ID NO: 9), and the plasmid was constructed with primers F7-BamHI-XhoI+R7-BamHI-XhoI).
(38) (III) Vector Cloning Experiments
(39) (1) The correct plasmids pUC57-lacZ-Mu-1, pUC57-lacZ-Mu-2, pUC57-lacZ-Mu-3, pUC57-lacZ-Mu-4, pUC57-lacZ-Mu-5 constructed in step (II) were digested with a restriction enzyme EcoRV, pUC57-lacZ-Mu-6 was digested with a restriction enzyme AleI, and pUC57-lacZ-Mu-7 was digested with restriction enzymes BamHI and XhoI. Digestion products were subjected to 1% agarose gel electrophoresis, and gel was cut, recovered and purified.
(40) (2) Reversely complementary primers of 24 bp and 48 bp were synthesized and annealed to form double-stranded DNA. Nucleotide sequences of the reversely complementary primers of 24 bp and 48 bp are shown by SEQ ID NO: 43-SEQ ID NO: 46, specifically:
(41) TABLE-US-00012 SEQIDNO.43: TTCATACAGCAGGCTATGTTTAGG; SEQIDNO.44: CCTAAACATAGCCTGCTGTATGAA; SEQIDNO.45: TAAGCCGATACTGTATTTTTTATCCATAGCTGTTTCCTGTGTGAAATT; SEQIDNO.46: AATTTCACACAGGAAACAGCTATGGATAAAAAATACAGTATCGGCTTA.
(42) (3) \ DNA was used as a template, and F-ADNA-200 bp+R-ADNA-200 bp were used as primers for the PCR amplification. Nucleotide sequences of the primers F-ADNA-200 bp and R-ADNA-200 bp are shown by SEQ ID NO: 47-SEQ ID NO: 48, specifically:
(43) TABLE-US-00013 SEQIDNO.47(F-DNA-200bp): AATGGTCAGGATCCGTTGAATGGGCGGATGCTAATTACTATCTCCCG; SEQIDNO.48(R-DNA-200bp): TGAAGAACCTCGAGTTATGCTCTATAAAGTAGGCATAAACACCCAGC.
(44) A PCR system is shown in Table 1, and a PCR amplification program is shown in Table 6.
(45) TABLE-US-00014 TABLE 6 Amplification program Reaction Program Number of Cycles 95 C. 4 min 1 94 C. 30 s 25 58 C. 30 s 72 C. 15 s 72 C. 3 min 1 4 C. 1
(46) (4) A PCR solution obtained in step (3) was subjected to 1% agarose gel electrophoresis, and gel was cut, recovered and purified to obtain a PCR amplification product. The purified PCR amplification product was digested with BamHI and XhoI. A digestion system is shown in Table 7.
(47) TABLE-US-00015 TABLE 7 PCR amplification product About 900 ng, 12 L BamHI 1 L XhoI 1 L 10 buffer 2 L Sterilized and deionized H.sub.2O 4 L
(48) A digestion condition was digestion of 1 h at 37 C., and the digestion product was recovered and purified using an Axygen purification kit.
(49) (5) Fragments of 24 bp and 48 bp formed after annealing in step (2) were ligated to the digested and purified vectors in step (1), pUC57-lacZ-Mu-1, pUC57-lacZ-Mu-2, pUC57-lacZ-Mu-3, pUC57-lacZ-Mu-4, pUC57-lacZ-Mu-5 and pUC57-lacZ-Mu-6 separately, and the purified digestion product in step (4) was ligated to the digested and purified vector in step (1), pUC57-lacZ-Mu-7. A ligation system is shown in Table 8.
(50) TABLE-US-00016 TABLE 8 Foreign DNA About 90 ng, 3 L Digested vector About 30 ng, 1 L 10 buffer 1 L T4 DNA ligase 1 L Sterilized and deionized H.sub.2O 4 L
(51) A ligation condition was a ligation reaction of 1 h at 22 C.
(52) (6) Each ligation product obtained in step (5) was transformed into Top10F competent cells which were finally coated with the kanamycin-resistant LB plate containing IPTG and X-gal and cultivated overnight at 37 C. 24 white single clones were picked on the plate of the cloned DNA fragment of about 200 bp (pUC57-lacZ-Mu-7 vector) for colony PCR identification on the next day. The PCR system is shown in Table 9.
(53) TABLE-US-00017 TABLE 9 PCR system Bacterium solution template 3 L F-DNA-200 bp 10 pM, 0.5 L R-DNA-200 bp 10 pM, 0.5 L dNTP 5 mM each, 0.5 L 10 Taq buffer 5 L Taq DNA polymerase 5 U/L, 0.5 L H.sub.2O 40 L
(54) A PCR amplification program is shown in Table 10.
(55) TABLE-US-00018 TABLE 10 Amplification program Reaction Program Number of Cycles 95 C. 6 min 1 94 C. 30 s 25 58 C. 30 s 72 C. 15 s 72 C. 3 min 1 4 C. 1
(56) A PCR identification result is shown in
(57) The result in
Example 3 Construction of Three Mutant Plasmids of pUC57-lacZ-Mu-2
(58) A method for constructing the pUC57-lacZ-Mu-2 plasmid includes steps described below.
(59) (1) The plasmid pUC57-lacZ-Mu-2 constructed in Example 2 was used as a template, and F1-del+R1-del, F2-del+R2-del and F3-del+R3-del were used as primers for PCR amplification. Nucleotide sequences of the primers F1-del, R1-del, F2-del, R2-del, F3-del and R3-del are shown by SEQ ID NO: 49-SEQ ID NO: 54, specifically:
(60) TABLE-US-00019 SEQIDNO.49(F1-del): ATACGAGCCGGAGAATCAAGTGTAAAGCCTGGGGTGCCTAAT; SEQIDNO.50(R1-del): GCTTTACACTTGATTCTCCGGCTCGTATGTTGTGTGGAATTG; SEQIDNO.51(F2-del): TACGAGCCGGAGATTCAAGTGTAAAGCCTGGGGTGCCTAATG; SEQIDNO.52(R2-del): GGCTTTACACTTGAATCTCCGGCTCGTATGTTGTGTGGAATTG; SEQIDNO.53(F3-del): ATACGAGCCGGAGATCAAGTGTAAAGCCTGGGGTGCCTAATG; SEQIDNO.54(R4-del): GGCTTTACACTTGATCTCCGGCTCGTATGTTGTGTGGAATTG.
(61) A PCR system is shown in Table 1 in Example 2, and a PCR amplification program is shown in Table 2 in Example 2.
(62) (2) A PCR solution obtained in step (1) was subjected to 1% agarose gel electrophoresis, and gel was cut, recovered and purified to obtain a PCR amplification product. The Gibson Assembly Master Mix (NEB) kit was used for a ligation reaction. A ligation system is shown in Table 5 in Example 2.
(63) A ligation condition was a ligation reaction of 1 h at 50 C.
(64) (3) Each ligation product obtained in step (2) was transformed into Top10F competent cells which were finally coated with a kanamycin-resistant LB plate containing IPTG and X-gal and cultivated overnight at 37 C. Blue single clones were picked and subjected to Sanger sequencing on the next day, and plasmids with correct sequences were reserved to obtain the three mutant plasmids of the pUC57-lacZ-Mu-2, which are named pUC57-lacZ-Mu-2A, pUC57-lacZ-Mu-2B and pUC57-lacZ-Mu-2C, separately.
(65) An EcoRV site of pUC57-lacZ-Mu-2A was mutated into GATTC, that is, the sequence was mutated from 5-CTTGATATCTCCGGCTCG-3 (SEQ ID NO: 59) to 5-CTTGATTCTCCGGCTCG-3 (SEQ ID NO: 60). An EcoRV site of pUC57-lacZ-Mu-2B was mutated into GAATC, that is, the sequence was mutated from 5-CTTGATATCTCCGGCTCG-3 (SEQ ID NO: 59) to 5-CTTGAATCTCCGGCTCG-3 (SEQ ID NO: 61). An EcoRV site of pUC57-lacZ-Mu-2C was mutated into GATC, that is, the sequence was mutated from 5-CTTGATATCTCCGGCTCG-3 (SEQ ID NO: 59) to 5-CTTGATCTCCGGCTCG-3 (SEQ ID NO: 62).
(66) (4) Correct plasmids pUC57-lacZ-Mu-2A, pUC57-lacZ-Mu-2B and pUC57-lacZ-Mu-2C in step (3) each were transformed into Top10F competent cells which were finally coated with the kanamycin-resistant LB plate containing IPTG and X-gal and cultivated overnight at 37 C. It was found on the next day that colonies on three plates were all blue. 5 single clones were selected from each plate and subjected to Sanger sequencing. Sequencing results show that all clones have correct sequences.
(67) Experimental results show that -galactosidase promoters of the three mutant plasmids of pUC57-lacZ-Mu-2 (pUC57-lacZ-Mu-2A, pUC57-lacZ-Mu-2B and pUC57-lacZ-Mu-2C) still have activity and can express lacZ and make colonies appear blue when induced by IPTG. Meanwhile, the experimental results show that the linearized pUC57-lacZ-Mu-2 vector after EcoRV digestion can still express lacZ and make colonies appear blue after the self-ligation of the linearized vector that lacks 1 base at one end of the site (pUC57-lacZ-Mu-2A and pUC57-lacZ-Mu-2B plasmids) or two ends of the site (pUC57-lacZ-Mu-2C plasmid), that is, the vector of the present application, after digested by the endonuclease, will not generate false positive clones due to the self-ligation for the lack of 1 base at one end or two ends of the site.
Example 4 Construction and Function Verification of a Low-Copy Cloning Vector
(68) A method for constructing the low-copy cloning vector includes specific steps described below.
(69) (I) The lacZ gene of pCK plasmid was replaced with the optimized lacZ gene in Example 1, specifically including steps described below.
(70) (1) The pCK plasmid was used as a template and SEQ ID NOs: 55-56 were used as primers for PCR amplification. Specific sequences are as follows:
(71) TABLE-US-00020 SEQIDNO.55(forward primer): ATGCAGGCTCGGTTCCAGCATGGTCATA GCTGTTTCCTGTGTGAAATTGTTATCC; SEQIDNO.56(reverse primer): AGCACCATTTGCAGCGATGCCGCCTAAT TAAGCCAGCCCCGAGTAGCTAGACAGG.
(72) A PCR system is shown in Table 1 in Example 2, and reaction conditions are shown in Table 2 in Example 2.
(73) (2) A PCR solution obtained in step (1) was subjected to 1% agarose gel electrophoresis, and gel was cut, recovered and purified to obtain a PCR amplification product.
(74) (3) The Gibson Assembly Master Mix kit was used for ligating a PCR purified product obtained in step (2) and the codon-optimized lacZ gene obtained in Example 1. A ligation system is shown in Table 3 in Example 2.
(75) A ligation condition was a ligation reaction of 1 h at 50 C.
(76) (4) A ligation product obtained in step (3) was transformed into Top10F competent cells which were finally coated with a kanamycin-resistant LB plate containing IPTG and X-gal and cultivated overnight at 37 C. A blue single clone was picked and subjected to Sanger sequencing on the next day, and a plasmid with a correct sequence was reserved and named pCK-lacZ.
(77) (II) A sequence, 5-CTTTATGCTTCCGGCTCG-3 (SEQ ID NO: 2), between 35 region and 10 region in a promoter region of the -galactosidase of the pCK-lacZ plasmid was mutated into a sequence recognizable by the endonuclease, which specifically includes steps described below.
(78) (1) The pCK-lacZ plasmid successfully constructed in step (I) was used as a template, and primers F1-EcoRV, R1-EcoRV, F2-EcoRV, R2-EcoRV, F3-EcoRV, R3-EcoRV, F4-EcoRV, R4-EcoRV, F5-EcoRV, R5-EcoRV, F6-AleI, R6-AleI, F7-BamHI-XhoI and R7-BamHI-XhoI (SEQ ID NO: 15-SEQ ID NO: 28) were used as primers for the PCR amplification. Specific sequences are listed in Table 4 in Example 2. A specific PCR system is shown in Table 1 in Example 2, and reaction conditions are shown in Table 2 in Example 2.
(79) (2) A PCR solution obtained in step (1) was subjected to 1% agarose gel electrophoresis, and gel was cut, recovered and purified to obtain a PCR amplification product. The Gibson Assembly Master Mix kit was used for a ligation reaction. A ligation system is shown in Table 5 in Example 2.
(80) A ligation condition was a ligation reaction of 1 h at 50 C.
(81) (3) Each ligation product obtained in step (2) was transformed into Top10F competent cells which were finally coated with the kanamycin-resistant LB plate containing IPTG and X-gal and cultivated overnight at 37 C. A blue single clone was picked and subjected to Sanger sequencing on the next day, and a plasmid with a correct sequence was reserved and separately named pCK-lacZ-Mu-1 (5-CTTTATGCTTCCGGCTCG-3 (SEQ ID NO: 2) was mutated into 5-GATATCGCTTCCGGCTCG-3 (SEQ ID NO: 3), and the plasmid was constructed with primers F1-EcoRV+R1-EcoRV), pCK-lacZ-Mu-2 (5-CTTTATGCTTCCGGCTCG-3 (SEQ ID NO: 2) was mutated into 5-CTTGATATCTCCGGCTCG-3 (SEQ ID NO: 4), and the plasmid was constructed with primers F2-EcoRV+R2-EcoRV), pCK-lacZ-Mu-3 (5-CTTTATGCTTCCGGCTCG-3 (SEQ ID NO: 2) was mutated into 5-CTTTATGATATCGGCTCG-3 (SEQ ID NO: 5), and the plasmid was constructed with primers F3-EcoRV+R3-EcoRV), pCK-lacZ-Mu-4 (5-CTTTATGCTTCCGGCTCG-3 (SEQ ID NO: 2) was mutated into 5-CTTTATGCTGATATCTCG-3 (SEQ ID NO: 6), and the plasmid was constructed with primers F4-EcoRV+R4-EcoRV), pCK-lacZ-Mu-5 (5-CTTTATGCTTCCGGCTCG-3 (SEQ ID NO: 2) was mutated into 5-CTTTATGCTTCCGATATC-3 (SEQ ID NO: 7), and the plasmid was constructed with primers F5-EcoRV+R5-EcoRV), pCK-lacZ-Mu-6 (5-CTTTATGCTTCCGGCTCG-3 (SEQ ID NO: 2) was mutated into 5-CTTTCACCTTCGTGCTCG-3 (SEQ ID NO: 8), and the plasmid was constructed with primers F6-AleI+R6-AleI), and pCK-lacZ-Mu-7 (5-CTTTATGCTTCCGGCTCG-3 (SEQ ID NO: 2) was mutated into 5-CTCGAGGATATCGGATCC-3 (SEQ ID NO: 9), and the plasmid was constructed with primers F7-BamHI-XhoI+R7-BamHI-XhoI).
(82) (III) Vector Cloning Experiments
(83) (1) The correct plasmids pCK-lacZ-Mu-1, pCK-lacZ-Mu-2, pCK-lacZ-Mu-3, pCK-lacZ-Mu-4 and pCK-lacZ-Mu-5 constructed in step (II) were digested with a restriction enzyme EcoRV, pCK-lacZ-Mu-6 was digested with a restriction enzyme AleI, and pCK-lacZ-Mu-7 was digested with restriction enzymes BamHI and XhoI. Digestion products were subjected to 1% agarose gel electrophoresis, and gel was cut, recovered and purified.
(84) (2) Reversely complementary primers of 24 bp and 48 bp were synthesized and annealed to form double-stranded DNA. Nucleotide sequences of the reversely complementary primers of 24 bp and 48 bp are shown by SEQ ID NO: 43-SEQ ID NO: 46 in Example 2.
(85) (3) \ DNA was used as a template, and F-ADNA-200 bp+R-ADNA-200 bp were used as primers for the PCR amplification. Nucleotide sequences of the primers F-ADNA-200 bp and R-ADNA-200 bp are shown by SEQ ID NO: 47-SEQ ID NO: 48 in Example 2.
(86) A PCR system is shown in Table 1 in Example 2, and a PCR amplification program is shown in Table 6 in Example 2.
(87) (4) A PCR solution obtained in step (3) was subjected to 1% agarose gel electrophoresis, and gel was cut, recovered and purified to obtain a PCR amplification product. The purified PCR amplification product was digested with BamHI and XhoI. A digestion system is shown in Table 7 in Example 2.
(88) A digestion condition was digestion of 1 h at 37 C., and the digestion product was recovered and purified using an Axygen purification kit.
(89) (5) Fragments of 24 bp and 48 bp formed after annealing in step (2) were ligated to the digested and purified vectors in step (1), pCK-lacZ-Mu-1, pCK-lacZ-Mu-2, pCK-lacZ-Mu-3, pCK-lacZ-Mu-4, pCK-lacZ-Mu-5 and pCK-lacZ-Mu-6, separately, and the purified digestion product in step (4) was ligated to the digested and purified vector in step (1), pCK-lacZ-Mu-7. A ligation system is shown in Table 8 in Example 2.
(90) A ligation condition was a ligation reaction of 1 h at 22 C.
(91) (6) Each ligation product obtained in step (5) was transformed into Top10F competent cells which were finally coated with the kanamycin-resistant LB plate containing IPTG and X-gal and cultivated overnight at 37 C. 12 white single clones were picked on the plate of the cloned DNA fragment of about 200 bp (pCK-lacZ-Mu-7 vector) for colony PCR identification on the next day. The PCR system is shown in Table 9.
(92) A PCR amplification program is shown in Table 10.
(93) A result in
Example 5 Construction and Function Verification of a Single-Copy Cloning Vector
(94) A method for constructing the single-copy cloning vector includes specific steps described below.
(95) (I) The lacZ gene of pCC1 plasmid was replaced with the optimized lacZ gene in Example 1, specifically including steps described below.
(96) (1) The pCC1 plasmid was used as a template and SEQ ID NOs: 57-58 were used as primers for PCR amplification. Specific sequences are as follows:
(97) TABLE-US-00021 SEQIDNO.57(forward primer): ATGCAGGCTCGGTTCCAGCATGGTCATAG CTGTTTCCTGTGTGAAATTGTTATCC; SEQIDNO.58(reverse primer): AGCACCATTTGCAGCGATGCCGCCTAATT AAGCCAGCCCCGACACCCGCCAACAC.
(98) A PCR system is shown in Table 1 in Example 2, and reaction conditions are shown in Table 11.
(99) TABLE-US-00022 TABLE 11 Amplification program Reaction Program Number of Cycles 95 C. 4 min 1 94 C. 30 s 25 58 C. 30 s 72 C. 5 min 72 C. 8 min 1 4 C. 1
(100) (2) A PCR solution obtained in step (1) was subjected to 1% agarose gel electrophoresis, and gel was cut, recovered and purified to obtain a PCR amplification product.
(101) (3) The Gibson Assembly Master Mix kit was used for ligating a PCR purified product obtained in step (3) and the codon-optimized lacZ gene obtained in Example 1. A ligation system is shown in Table 12 in Example 2.
(102) TABLE-US-00023 TABLE 12 PCR amplification product About 387 ng, 9 L lacZ gene About 100 ng, 1 L Gibson Assembly Master Mix 10 L Sterilized and deionized H.sub.2O 0 L
(103) A ligation condition was a ligation reaction of 1 h at 50 C.
(104) (4) A ligation product obtained in step (3) was transformed into Top10F competent cells which were finally coated with a chloramphenicol-resistant LB plate containing IPTG and X-gal and cultivated overnight at 37 C. A blue single clone was picked and subjected to Sanger sequencing on the next day, and a plasmid with a correct sequence was reserved and named pCC1-lacZ.
(105) (II) A sequence, 5-CTTTATGCTTCCGGCTCG-3 (SEQ ID NO: 2), between 35 region and 10 region in a promoter region of the -galactosidase of the pCC1-lacZ plasmid was mutated into a sequence recognizable by the endonuclease, which specifically includes steps described below.
(106) (1) The pCC1-lacZ plasmid successfully constructed in step (I) was used as a template, and primers F1-PmlI+R1-PmlI, F2-PmlI+R2-PmlI, F3-PmlI+R3-PmlI, F4-PmlI+R4-PmlI, F5-PmlI+R5-PmlI and F7-BamHI-XhoI+R7-BamHI-XhoI (SEQ ID NO: 29-SEQ ID NO: 38, SEQ ID NO: 27-SEQ ID NO: 28) were used as primers for the PCR amplification. Specific sequences are listed in Table 13.
(107) TABLE-US-00024 TABLE13 NO. Sequence SEQ CCGGAAGCCACGTGTGTAAAGC ID CTGGGGTGCCTAATGAGTG NO.29 (F1- Pm1I) SEQ CCCCAGGCTTTACACACGTGGCTT ID CCGGCTCGTATGTTGTGTGGAATT NO.30 (R1- Pm1I) SEQ GAGCCGGACACGTGAAGTGTA ID AAGCCTGGGGTGCCTAATGAG NO.31 (F2-Pm1I) SEQ CAGGCTTTACACTTCACGTGTCCG ID GCTCGTATGTTGTGTGGAATTGTG NO.32 (R2- Pm1I) SEQ TACGAGCCCACGTGATAAAGTGT ID AAAGCCTGGGGTGCCTAAT NO.33 (F3- Pm1I) SEQ GCTTTACACTTTATCACGTGGGCT ID CGTATGTTGTGTGGAATTGTGAGC NO.34 (R3- Pm1I) SEQ ACATACGACACGTGAGCATAA ID AGTGTAAAGCCTGGGGTGCCT NO.35 (F4- Pm1I) SEQ TTACACTTTATGCTCACGTGTCGT ID ATGTTGTGTGGAATTGTGAGCGGA NO.36 (R4- Pm1I) SEQ ACAACATACACGTGGGAAGCA ID TAAAGTGTAAAGCCTGGGGTG NO.37 (F5- Pm1I) SEQ CACTTTATGCTTCCCACGTGTATG ID TTGTGTGGAATTGTGAGCGGATAA NO.38 (R5- Pm1I) SEQ CATAGGATCCGATATCCTCGAGTGT ID AAAGCCTGGGGTGCCTAATGAGTGA NO.27 (F7- BamHI- XhoI) SEQ TACACTCGAGGATATCGGATCCTATG ID TTGTGTGGAATTGTGAGCGGATAA NO.28 (R7- BamHI- XhoI)
(108) A specific PCR system is shown in Table 1 in Example 2, and reaction conditions are shown in Table 11.
(109) (2) A PCR solution obtained in step (1) was subjected to 1% agarose gel electrophoresis, and gel was cut, recovered and purified to obtain a PCR amplification product. The Gibson Assembly Master Mix kit was used for a ligation reaction. A ligation system is shown in Table 14 in Example 2.
(110) TABLE-US-00025 TABLE 14 PCR amplification product About 490 ng, 10 L Gibson Assembly Master Mix 10 L Sterilized and deionized H.sub.2O 0 L
(111) A ligation condition was a ligation reaction of 1 h at 50 C.
(112) (3) Each ligation product obtained in step (2) was transformed into Top10F competent cells which were finally coated with the chloramphenicol-resistant LB plate containing IPTG and X-gal and cultivated overnight at 37 C. A blue single clone was picked and subjected to Sanger sequencing on the next day, and a plasmid with a correct sequence was reserved and separately named pCC1-lacZ-Mu-1 (5-CTTTATGCTTCCGGCTCG-3 (SEQ ID NO: 2) was mutated into 5-CACGTGGCTTCCGGCTCG-3 (SEQ ID NO: 10), and the plasmid was constructed with primers F1-PmlI+R1-PmlI), pCC1-lacZ-Mu-2 (5-CTTTATGCTTCCGGCTCG-3 (SEQ ID NO: 2) was mutated into 5-CTTCACGTGTCCGGCTCG-3 (SEQ ID NO: 11), and the plasmid was constructed with primers F2-PmlI+R2-PmlI), pCC1-lacZ-Mu-3 (5-CTTTATGCTTCCGGCTCG-3 (SEQ ID NO: 2) was mutated into 5-CTTTATCACGTGGGCTCG-3 (SEQ ID NO: 12), and the plasmid was constructed with primers F3-PmlI+R3-PmlI), pCC1-lacZ-Mu-4 (5-CTTTATGCTTCCGGCTCG-3 (SEQ ID NO: 2) was mutated into 5-CTTTATGCTCACGTGTCG-3 (SEQ ID NO: 13), and the plasmid was constructed with primers F4-PmlI+R4-PmlI), pCC1-lacZ-Mu-5 (5-CTTTATGCTTCCGGCTCG-3 (SEQ ID NO: 2) was mutated into 5-CTTTATGCTTCCCACGTG-3 (SEQ ID NO: 14), and the plasmid was constructed with primers F5-PmlI+R5-PmlI), and pCC1-lacZ-Mu-6 (5-CTTTATGCTTCCGGCTCG-3 (SEQ ID NO: 2) was mutated into 5-CTCGAGGATATCGGATCC-3 (SEQ ID NO: 9), and the plasmid was constructed with primers F7-BamHI-XhoI+R7-BamHI-XhoI).
(113) (III) Vector Cloning Experiments
(114) (1) The correct plasmids pCC1-lacZ-Mu-1, CC1-lacZ-Mu-2, pCC1-lacZ-Mu-3, pCC1-lacZ-Mu-4 and pCC1-lacZ-Mu-5 constructed in step (II) were digested with a restriction enzyme PmlI, and pCC1-lacZ-Mu-6 was digested with restriction enzymes BamHI and XhoI. Digestion products were subjected to 1% agarose gel electrophoresis, and gel was cut, recovered and purified.
(115) (2) Reversely complementary primers of 24 bp and 48 bp were synthesized and annealed to form double-stranded DNA. Nucleotide sequences of the reversely complementary primers of 24 bp and 48 bp are shown by SEQ ID NO: 43-SEQ ID NO: 46 in Example 2.
(116) (3) 2 DNA was used as a template, and F-ADNA-200 bp+R-ADNA-200 bp were used as primers for the PCR amplification. Nucleotide sequences of the primers F-ADNA-200 bp and R-ADNA-200 bp are shown by SEQ ID NO: 47-SEQ ID NO: 48 in Example 2.
(117) A PCR system is shown in Table 1, and a PCR amplification program is shown in Table 6.
(118) (4) A PCR solution obtained in step (3) was subjected to 1% agarose gel electrophoresis, and gel was cut, recovered and purified to obtain a PCR amplification product. The purified PCR amplification product was digested with BamHI and XhoI. A digestion system is shown in Table 7 in Example 2.
(119) A digestion condition was digestion of 1 h at 37 C., and the digestion product was recovered and purified using an Axygen purification kit.
(120) (5) Fragments of 24 bp and 48 bp formed after annealing in step (2) were ligated to the digested and purified vectors in step (1), pCC1-lacZ-Mu-1, pCC1-lacZ-Mu-2, pCC1-lacZ-Mu-3, pCC1-lacZ-Mu-4 and pCC1-lacZ-Mu-5, separately, and the purified digestion product in step (4) was ligated to the digested and purified vector in step (1), pCC1-lacZ-Mu-6. A ligation system is shown in Table 7 in Example 2.
(121) A ligation condition was a ligation reaction of 1 h at 22 C.
(122) (6) Each ligation product obtained in step (5) was transformed into Top10F competent cells which were finally coated with the chloramphenicol-resistant LB plate containing IPTG and X-gal and cultivated overnight at 37 C. 24 white single clones were picked on the plate of the cloned DNA fragment of about 200 bp (pCC1-lacZ-Mu-6 vector) for colony PCR identification on the next day. The PCR system is shown in Table 9.
(123) A PCR amplification program is shown in Table 10. A result is shown in
(124) An electrophoresis result in
(125) To conclude, in the present application, a sequence between 35 region and 10 region in a strong promoter region of the -galactosidase is mutated into sites that can be recognized and digested by the endonuclease, and during cloning, a vector is digested with an appropriate endonuclease or a linearized vector is prepared by a PCR method, and then the linearized vector is ligated to foreign genes, so that a strong promoter of the -galactosidase has significantly decreased activity due to the insertion of a foreign DNA fragment, an expression amount of the lacZ gene is significantly reduced, and a colony containing a recombinant plasmid is white. By use of the above-mentioned method, the present application overcomes the common problem that a strong promoter in a vector based on blue-white screening initiates the transcription or translation of foreign genes and a transcription or translation product might be toxic to a host and cannot be cloned, can avoid the deficiency that frameshift mutation of the lacZ gene due to a lack of 1-2 bp of the vector at digestion sites results in false positive clones, and can eliminate a false negative phenomenon that a plate is rich in blue spots due to a small fragment of foreign DNA and a reading frame of the lacZ gene which is unchanged by inserting the foreign DNA.
(126) The applicant has stated that although the detailed method of the present application is described through the examples described above, the present application is not limited to the detailed method described above, which means that implementation of the present application does not necessarily depend on the detailed method described above. It should be apparent to those skilled in the art that any improvements made to the present application, equivalent replacements of raw materials of the product of the present application, additions of adjuvant ingredients to the product of the present application, and selections of specific manners, etc., all fall within the protection scope and the disclosed scope of the present application.