Gene engineering bacteria for producing L-arginine and construction method and application of gene engineering bacteria

12571013 ยท 2026-03-10

Assignee

Inventors

Cpc classification

International classification

Abstract

Disclosed are gene engineering bacteria for producing L-arginine and a construction method and an application of the gene engineering bacteria. According to the method, genes encoding a carbamoyl phosphate synthetase and a gene encoding an L-arginine biosynthesis pathway enzyme are integrated into Escherichia coli; the present invention has analyzed and reconstructed the arginine synthetic pathway and the metabolic flow related to arginine in the entire amino acid metabolic network in E. coli and finally obtained a genetically engineered bacterial strain which has a clear genetic background, carries no plasmids, undergoes no mutagenesis and is capable of stably and efficiently producing L-arginine.

Claims

1. A construction method of a genetically engineered bacterial strain, comprising the following steps: (1) integrating pyrAA and pyrAB genes into a genome of Escherichia coli used as a starting strain; (2) integrating at least one arginine biosynthesis pathway enzyme gene selected from the group consisting of argC, argJ, argB, argD, argF, argG, and argH genes; and integrating lysE gene encoding an arginine transporter; and (3) knocking out a gene encoding an arginine decarboxylase, a gene encoding an arginine succinyltransferase, and a gene encoding an acetylornithine deacetylase; wherein, the gene encoding an acetylornithine deacetylase includes at least one of speA and adiA genes; the gene encoding an arginine succinyltransferase is astA gene; and the gene encoding an acetylornithine deacetylase is the argE gene.

2. The construction method according to claim 1, wherein the construction method comprises the steps of: (1) knocking out the following three genes in E. coli: speA gene encoding an arginine decarboxylase, adiA gene encoding an arginine decarboxylase and astA gene encoding an arginine succinyltransferase; (2) knocking out argE gene encoding an acetylornithine deacetylase in E. coli, and optionally integrating gene argJ encoding a glutamate acetyltransferase into E. coli; (3) integrating the following arginine biosynthesis-related gene cluster: argC, argJ, argB, argD, argF, argG and argH; (4) integrating pyrAA and pyrAB genes encoding a carbamoyl phosphate synthetase; and (5) integrating lysE gene encoding an arginine transporter into the E. coli genome.

3. The construction method according to claim 1, comprising adopting CRISPR/Cas9-mediated gene editing technology to perform gene integration and knockout.

4. The construction method according to claim 1, comprising the steps of simultaneously transforming a pGRB plasmid and a recombinant fragment into electroporation-competent cells containing pREDCas9 and eliminating plasmids, to obtain a recombinant genetically engineered bacterial strain; the step of constructing the pGRB plasmid comprises: designing a target sequence, preparing a DNA fragment comprising the target sequence, and recombining the DNA fragment comprising the target sequence with a linearized vector fragment; in the construction method, the step of constructing a recombinant fragment comprises constructing a recombinant fragment for gene integration or for gene knockout; the step of constructing a recombinant fragment for gene integration comprises: using the genome of the starting strain as a template, designing primers for the upstream and downstream homologous arms according to the upstream and downstream sequences of the intended insertion site of the target gene, and designing primers according to the target genome to amplify the target gene fragment, and then performing overlap PCR to obtain the recombinant fragment; and the step of constructing a recombinant fragment for gene knockout comprises: using the upstream and downstream sequences of the gene to be knocked out as templates, designing primers for upstream and downstream homologous arms; respectively amplifying the upstream and downstream homologous arms by PCR, and then preparing the recombinant fragment by overlap PCR.

5. The construction method according to claim 1, wherein the pyrAA and pyrAB genes are derived from the genes encoding a carbamoyl phosphate synthetase in B. subtilis A260.

6. The construction method according to claim 1, wherein the Escherichia coli is E. coli W3110.

Description

DESCRIPTION OF THE DRAWINGS

(1) In FIGS. 1(a) and 1(b), panel 1(a) shows the pREDCas9 plasmid map and panel 1(b) shows the pGRB plasmid map.

(2) FIG. 2 shows the electropherogram of the construction and verification of the fragment for knocking out speA gene, wherein M: 1 kb DNA marker; lane 1: upstream homologous arm; lane 2: downstream homologous arm; lane 3: overlapping fragment; lane 4: original strain (control); lane 5: identified fragment from positive bacteria.

(3) FIG. 3 shows the electropherogram of the construction and verification of the fragment for knocking out adiA gene, wherein M: 1 kb DNA marker; lane 1: upstream homologous arm; lane 2: downstream homologous arm; lane 3: overlapping fragment; lane 4: original strain (control); lane 5: identified fragment from positive bacteria.

(4) FIG. 4 shows the electropherogram of the construction and verification of the fragment for knocking out astA gene, wherein M: 1 kb DNA marker; lane 1: upstream homologous arm; lane 2: downstream homologous arm; lane 3: overlapping fragment; lane 4: original strain (control); lane 5: identified fragment from positive bacteria.

(5) FIG. 5 shows the electropherogram of the construction and verification of the fragment for integrating argJ gene, wherein M: 1 kb DNA marker; lane 1: upstream homologous arm; lane 2: downstream homologous arm; lane 3: overlapping fragment; lane 4: original strain (control); lane 5: identified fragment from positive bacteria.

(6) FIG. 6 shows the electropherogram of the construction and verification of the fragment for integrating argC-arg), wherein M: 1 kb DNA marker; lane 1: upstream homologous arm; lane 2: argC-argJ fragment; lane 3: downstream homologous arm; lane 4: overlapping fragment; lane 5: original strain (control); lane 6: identified fragment from positive bacteria.

(7) FIG. 7 shows the electropherogram of the construction and verification of the fragment for integrating argB-argD-argF, wherein M: 1 kb DNA marker; lane 1: argB-argD-argF upstream fragment-argB-argD-argF gene fragment; lane 2: downstream homologous arm; lane 3: overlapping fragment; lane 4: original strain (control); lane 5: identified fragment from positive bacteria.

(8) FIG. 8 shows the electropherogram of the construction and verification of the fragment for integrating argG-argH, wherein M: 1 kb DNA marker; lane 1: upstream homologous arm; lane 2: argG-argH fragment; lane 3: downstream homologous arm; lane 4: overlapping fragment; lane 5: original strain (control); lane 6: identified fragment from positive bacteria.

(9) FIG. 9 shows the electropherogram of the construction and verification of the first fragment for integrating pyrAA-pyrAB, wherein M: 1 kb DNA marker; lane 1: upstream homologous arm; lane 2:1-pyrAA-pyrAB fragment; lane 3: downstream homologous arm; lane 4: overlapping fragment; lane 5: original strain (control); lane 6: identified fragment from positive bacteria.

(10) FIG. 10 shows the electropherogram of the construction and verification of the second fragment for integrating pyrAA-pyrAB, wherein M: 1 kb DNA marker; lane 1: pyrAA upstream fragment-pyrAA-pyrAB-downstream homologous arm; lane 2: downstream homologous arm; lane 3: overlapping fragment; lane 4: original strain (control); lane 5: identified fragment from positive bacteria.

(11) FIG. 11 shows the electropherogram of the construction and verification of the fragment for integrating lysE, wherein M: 1 kb DNA marker; lane 1: upstream homologous arm; lane 2: lysE fragment; lane 3: downstream homologous arm; lane 4: overlapping fragment; lane 5: original strain (control); lane 6: identified fragment from positive bacteria.

(12) FIG. 12 shows the fed-batch fermentation curve of the strain E. coli W3110 ARG10 in a 5 L fermenter.

DETAILED DESCRIPTION OF THE INVENTION

(13) The above and other characteristics and advantages of the present invention are explained and illustrated in more detail below by way of the description of the examples of the present invention. It should be understood that the following examples are meant to illustrate the technical solutions of the present invention, rather than to limit the protection scope of the present invention defined by the claims and their equivalent solutions.

(14) Unless otherwise specified, the materials and reagents herein are commercially available, or can be prepared by those skilled in the art according to the prior art.

Example 1: Construction of Genetically Engineered Bacterial Strain E. coli TRP 05

(15) 1. Gene Editing Method

(16) The gene editing method adopted in the present invention refers to literature Li Y, Lin Z, Huang C, et al. Metabolic engineering of Escherichia coli using CRISPR-Cas9 meditated genome editing. Metabolic engineering, 2015, 31:13-21. and the maps of the two plasmids used in this method are shown in FIGS. 1(a) and 1(b). Among them, the pREDCas9 vector carries an elimination system of the gRNA expression plasmid pGRB, a Red recombination system of phage and a Cas9 protein expression system, spectinomycin resistance (working concentration: 100 mg/L), cultured at 32 C.; the pGRB vector uses pUC18 as the backbone and contains a promoter J23100, a gRNA-Cas9 binding domain sequence and a terminator sequence, ampicillin resistance (working concentration: 100 mg/L), cultured at 37 C.

(17) The specific steps of this method:

(18) 1.1 Construction of pGRB Plasmid

(19) The purpose of constructing the plasmid pGRB is to transcribe the corresponding gRNA to form a complex with Cas9 protein, and recognize the target site of the target gene through base pairing and PAM to achieve the target DNA double-strand break. The pGRB plasmid was constructed by recombining a DNA fragment containing the target sequence with a linearized vector fragment.

(20) 1.1.1 Design of the Target Sequence

(21) CRISPR RGEN Tools was used to design the target sequence (PAM: 5-NGG-3).

(22) 1.1.2 Preparation of the DNA Fragment Containing Target Sequence

(23) The primer 5-linearized vector end sequence (15 bp)-restriction site-target sequence (without PAM sequence)-linearized vector end sequence (15 bp)-3 and its reverse complementary primer were designed, and a DNA fragment comprising the target sequence was prepared by annealing of a single-stranded DNA. Reaction conditions: pre-denaturation at 95 C. for 5 min; annealing at 30-50 C. for 1 min. The annealing system was as follows:

(24) TABLE-US-00001 TABLE 1 Annealing system Reaction system Volume (20 L) Primer (10 mol/L) 10 L Reverse complementary primer (10 mol/L) 10 L
1.1.3 Preparation of the Linearized Vector

(25) The linearization of the vector adopted the method of inverse PCR amplification.

(26) 1.1.4 Recombination Reaction

(27) The recombination system is shown in Table 2. The recombinases used were all enzymes of the ClonExpress II One Step Cloning Kit series. Recombination conditions: 37 C., 30 min.

(28) TABLE-US-00002 TABLE 2 Recombination system Reaction system Volume (10 L) 5 CE II Buffer 4 L Linearized clone vector 1 L Inserted fragment clone vector 1 L Exnase II 2 L ddH.sub.2O 12 L
1.1.5 Plasmid Transformation

(29) Ten L of the reaction solution were added to 100 mL of DH5 chemically competent cells and mixed gently. The resulting mixture was cooled in an ice bath for 20 min, heated shock at 42 C. for 45-90 s, cooled immediately in an ice bath for 2-3 min, added with 900 L of SOC, and recovered at 37 C. for 1 h. The mixture was centrifuged at 8,000 rpm for 2 min, part of the supernatant was discarded and the remaining 200 L of the supernatant was used to resuspend the cells. The cells were then spread onto a plate containing 100 mg/L ampicillin, and the plate was placed upside down and cultured at 37 C. overnight. After single colonies were grown on the plate, positive recombinants were identified by colony PCR and picked.

(30) 1.1.6 Identification of Clones

(31) The PCR-positive colonies were inoculated into LB medium containing 100 mg/L ampicillin for overnight culture, and the bacteria were preserved. The plasmids were extracted and identified by enzyme digestion.

(32) 1.2 Preparation of the Recombinant DNA Fragments

(33) The recombinant fragment for knockout consists of the upstream and downstream homologous arms of the gene to be knocked out (upstream homologous arm-downstream homologous arm); the recombinant fragment for integration consists of the upstream and downstream homologous arms of the integration site and the gene fragment to be integrated (upstream homologous arm-target gene-downstream homologous arm). Using the primer design software primer5, the upstream and downstream sequences of the gene to be knocked out or the site to be integrated were used as the template to design the primers for the upstream and downstream homologous arms (amplification product length: about 400-500 bp); the gene to be integrated was used as the template to design the primers for the amplification of the integrated gene. After amplifying the upstream and downstream homologous arms and the target gene fragment by PCR, respectively, the recombinant fragment was prepared by overlap PCR. The PCR system and method are shown in the following Table 3:

(34) TABLE-US-00003 TABLE 3 PCR amplification system Component Volume (50 L) DNA template 1 L Forward primer (10 mol/L) 1 L Reverse primer (10 mol/L) 1 L dNTP mixture (10 mmol/L) 4 L 5 Buffer 10 L HS enzyme (5 U/L) 0.5 L ddH.sub.2O 32.5 L

(35) The overlap PCR system is shown in the following Table 4:

(36) TABLE-US-00004 TABLE 4 Overlap PCR amplification system Component Volume (50 L) Template 2 L Forward primer for the upstream 1 L homologous arm (10 mol/L) Reverse primer for the downstream 1 L homologous arm (10 mol/L) dNTP mixture (10 mmol/L) 4 L 5 Buffer 10 L HS enzyme (5 U/L) 0.5 L ddH.sub.2O 31.5 L

(37) PCR reaction conditions (PrimeSTAR HS enzyme from Takara Bio): pre-denaturation at 95 C. for 5 min; 30 cycles of denaturation at 98 C. for 10 s, annealing at (Tm-3/5 C.) for 15s, extension at 72 C.; and a final extension at 72 C. for 10 min; hold at 4 C.

(38) 1.3 Transformation of Plasmids and the Recombinant DNA Fragment

(39) 1.3.1 Transformation of pREDCas9

(40) The pREDCas9 plasmid was electro-transformed into the electroporation-competent cells of W3110 by electro-transformation. The cells were recovered and cultured and then spread on a LB plate containing spectinomycin, and cultured at 32 C. overnight. Single colonies grown on the plate with the antibiotic were subjected to colony PCR with identification primers to screen positive recombinants.

(41) 1.3.2 Preparation of Electroporation-Competent Cells of the Target Strain Containing pREDCas9

(42) The strain was cultured at 32 C. until the culture reached an OD600 of from 0.1 to 0.2, and then IPTG was added (to a final concentration of 0.1 mM). The culture was continued until OD600 value reached from 0.6 to 0.7. The obtained cells were used for the preparation of competent cells. The purpose of adding IPTG is to induce the expression of the recombinase on the pREDCas9 plasmid. The medium and preparation process required for the preparation of the competent cells refer to conventional standard operations.

(43) 1.3.3 Transformation of pGRB and the Recombinant DNA Fragment

(44) The pGRB plasmid and the recombinant DNA fragment were simultaneously electro-transformed into the electroporation-competent cells containing pREDCas9. After electro-transformation, the cells were recovered and cultured and then spread on a LB plate containing ampicillin and spectinomycin, and cultured at 32 C. overnight. Colony PCR verification was performed by using the forward primer for the upstream homologous arm and the reverse primer for the downstream homologous arm, or by using specifically designed primers for identification, to screen positive recombinants and the recombinants were preserved.

(45) 1.4 Elimination of Plasmids

(46) 1.4.1 Elimination of Plasmid pGRB

(47) The positive recombinant was cultured overnight in LB medium containing 0.2% arabinose, and after appropriate dilutions, the culture was spread on a LB plate containing spectinomycin, and cultured at 32 C. overnight. The obtained recombinants were then inoculated into LB plates containing ampicillin and spectinomycin, respectively, and single colonies that did not grow on the plate containing ampicillin but grew on the plate containing spectinomycin were picked and preserved.

(48) 1.4.2 Elimination of Plasmid pREDCas9

(49) The positive recombinant was transferred to LB liquid medium without antibiotics, cultured overnight at 42 C., and after appropriate dilutions, the culture was spread on a LB plate without antibiotics and cultured at 37 C. overnight. The obtained recombinants were then inoculated into LB plates containing spectinomycin and without antibiotics, respectively, single colonies that did not grow on the plate with spectinomycin but grew on the LB plate without antibiotics were picked and preserved.

(50) 2. The primers used in the strain construction are shown in Table 5:

(51) TABLE-US-00005 TABLE5 Primersusedinthestrainconstruction Primer Sequence(5-3) UP-speA-S TTAACCTGTCTCACCGTTCTGG (SEQIDNO:1) UP-speA-A ACAAACCTGCCTCGAACTCTTCCGC TGACGAAGGCAAACC (SEQIDNO:2) DN-speA-S GGTTTGCCTTCGTCAGCGGAAGAGT TCGAGGCAGGTTTGT (SEQIDNO:3) DN-speA-A CATATACCAGATCGCCGCAGT (SEQIDNO:4) UP-adiA-S CGAGTTTCTCCATCAAGACACCT (SEQIDNO:5) UP-adiA-A CGCCCATAGAGAACAGGAACATGCG GGTTGGCACCATATA (SEQIDNO:6) DN-adiA-S TATATGGTGCCAAGCCGCATGTTCC TGTTCTCTATGGGCG (SEQIDNO:7) DN-adiA-S TATCGCCGAAGTTTTCACCAG (SEQIDNO:8) UP-astA-S GGCACTCATGGCACCACCT (SEQIDNO:9) UP-astA-A TGAGGGCATCCAGTTGTGCCTGCAT CAGCGCCGAGAC (SEQIDNO:10) DN-astA-S GTCTCGGCGCTGATGCAGGCACAAC TGGATGCCCTCA (SEQIDNO:11) DN-astA-A TGACCAGGGAAATTATACGGC (SEQIDNO:12) UP-argE-S GCCCGCTTCAAGAAACTGC (SEQIDNO:13) UP-argE-A AATTGTTATCCGCTCACAATTCCAC ACATTATACGAGCCGGATGATTAAT TGTCAAGGCGCTTATTGAAGGTGTG G (SEQIDNO:14) argj-S TCCGGCTGGTATAAGTGTGGAATTG TGAGCGGATAACAATTTCACACAGG AAACAGACGATGGCAGAAAAAGGCA TTACC (SEQIDNO:15) argj-A GTTGATGAGCCTGATTAATTGAGCG CCCTTTTCCCTGCTTGTTAG (SEQIDNO:16) DN-argE-S CTAACAAGCAGGGAAAAGGGCGCTC AATTAATCAGGCTCATCAAC (SEQIDNO:17) DN-argE-A CTGTATCCTTCACGTCGCATTG (SEQIDNO:18) UP-yghX-S GCGCAACGTAGAACAGGAATT (SEQIDNO:19) UP-yghX-A AATTGTTATCCGCTCACAATTCCAC ACATTATACGAGCCGGATGATTAAT TGTCAAGATTGAAGCGCCTTTACTA CTCC (SEQIDNO:20) argC-argJ-S TCCGGCTCGTATAATGTGTGGAATT GTGAGCGGATAACAATTTCACACAG GAAACAGACCATGATCATGCATAAC GTGTATGGTG (SEQIDNO:21) argC-argJ-A GCCCCAAGGGGTTATGCTAGCCTAC AAATTGAGTTATGTTC ATTTAAATATGATGTTGTTCAGTTA AGAGCTGTACGCGCAGTTGA (SEQIDNO:22) DN-yghX-S1 CTGAACAACATCATATTTAAATGAA CATAACTCAATTTGTAGGCTAGCAT AACCCCTTGGGGCGTCATAGTAATC CAGCAACTCTTCTG (SEQIDNO:23) DN-yghX-A GAGCAGGTATTTACGTGAACCG (SEQIDNO:24) UV-argB-argD- GTACGCAGCTTGTTCTGATATCG argF-S (SEQIDNO:25) UP-argB-argD- AGTTGCTGGATTACTATGACCCTAG argF-A AAGAAATCAACCAGCGCATCAGAAA GTCTCCTGTGCATTTACCTCGGCTG GTTGGC (SEQIDNO:26) DN-yghX-S2 ATGCACAGGAGACTTTCTGATGCGC TCGTTGATTTCTTCTAGCGTCATAG TAATCCAGCAACTCTCATAGTAATC CAGCAACTCTTGTG (SEQIDNO:27) UP-argG-argH-S GATATTTCCATCATCGCTCCTG (SEQIDNO:28) UP-argG-argH-A CTCGGGTTATACCTTACCTGCCTTA CCTCGGCTGGTTGGC (SEQIDNO:29) argG-argH-S GCCAACCAGCCGAGGTAAGGCAGGT AAGGTATAACCCGAG (SEQIDNO:30) argG-argH-A CACCGACAAACAACAGATAAAACGA AAGGCCCAGTCTTTCGACTGAGCCT TTCGTTTTATTTGTTATCGACGTAC CCCCGC (SEQIDNO:31) DN-yghX-S3 AAAGACTGGGCCTTTCGTTTTATCT GTTGTTTGTCGGTGAACGCTCTCCT GAGTAGGACAAATGTCATAGTAATC CAGCAACTCTTGTG (SEQIDNO:32) UP-yjiT-S AATAGTTGTTGCCGCCTGAGT (SEQIDNO:33) UP-yjiT-A AATTGTTATCCGCTCACAATTCCAC ACATTATACGAGCCGGATGATTAAT TGTCAAAAAACAGGCAGCAAAGTCC C (SEQIDNO:34) 1-PyrAA-pyrAB-S TCCGGCTCGTATAATGTGTGGAATT GTGAGCGGATAACAATTTCACACAG GAAACAGACCATGAAGAGACGATTA GTACTGGAAAAC (SEQIDNO:35) 1-PyrAA-pyrAB-A GCCCCAAGGGGTTATGCTAGCCTAC AAATTGAGTTATGTTCATTTAAATA TGATGTTGTTCAGAGAAGACATCGA TAGCGGAAAAT (SEQIDNO:36) DN-yjiT-S CTGAACAACATCATATTTAAATGAA CATAACTCAATTTGTAGGCTAGCAT AACCCCTTGGGGCAAGCACTACCTG TGAAGGGATGT (SEQIDNO:37) DN-yjiT-A CAGGGTTTCCACAGTCACAAT (SEQIDNO:38) 2-PyrAA-pyrAB-S ACCCGGTGACAGGAAAAACAT (SEQIDNO:39) 2-PyrAA-pyrAB-A CACCGACAAACAACAGATAAAACGA AAGGCCCAGTCTTTCGACTGAGCCT TTCGTTTTATTTGTCATATAGTGAC TGCCGCCTCC (SEQIDNO:40) DN-yjiT-S1 AAAGACTGGGCCTTTCGTTTTATCT GTTGTTTGTCGGTGAACGCTCTCCT GAGTAGGACAAATAAGCACTACCTG TGAAGGGATGT (SEQIDNO:41) UP-ilvG-S ACCGAGGAGCAGACAATGAATAA (SEQIDNO:42) UP-ilvG-A AATTGTTATCCGCTCACAATTCCAC ACATTATACGAGCCGGATGATTAAT TGTCAAGGTGATGGCAACAACAGGG A (SEQIDNO:43) lysE-S TCCGGCTCGTATAATGTGTGGAATT GTGAGCGGATAACAATTTCACACAG GAAACAGACCATGGAAATTTTCGTT ACGGGTC (SEQIDNO:44) lysE-A CACCGACAAACAACAGATAAAACGA AAGGCCCAGTCTTTCGACTGAGCCT TTCGTTTTATTTGTTAGCCCATCAG AATCAGTTTCAC (SEQIDNO:45) DN-ilvG-S AAAGACTGGGCCCTTTCGTTTTATC TGTTGTTTGTCGGTGAACGCTCTCC TGAGTAGGACAAATCTATCTACGCG CCGTTGTTGT (SEQIDNO:46) DN-ilvG-A GCGCTGGCTAACATGAGGAA (SEQIDNO:47) AGTCCTAGGTATAATACTAGTTGCG gRNA-speA-S TACTTACAATATTGCCGTTTTAGAG CTAGAA (SEQIDNO:48) gRNA-speA-A TTCTAGCTCTAAAACGGCAATATTG TAAGTACGCAACTAGTATTATACCT AGGACT (SEQIDNO:49) gRNA-adiA-S AGTCCTAGGTATAATACTAGTTATC GGGCCAATCTATCCGCGTTTTAGAG CTAGAA (SEQIDNO:50) gRNA-adiA-A TTCTAGCTCTAAAACGCGGATAGAT TGGCCCGATAACTAGTATTATACCT AGGACT (SEQIDNO:51) gRNA-astA-S AGTCCTAGGTATAATACTAGTTCTC TGCGGCACCGGGCAAAGTTTTAGAG CTAGAA (SEQIDNO:52) TTCTAGCTCTAAAACTTTGCCCGGT gRNA-astA-A GCCGCAGAGAACTAGTATTATACCT AGGACT (SEQIDNO:53) gRNA-argE-S AGTCCTAGGTATAATACTAGTTGCA GATTTAATCACTCTGCGTTTTAGAG CTAGAA (SEQIDNO:54) gRNA-argE-A TTCTAGCTCTAAAACGCAGAGTGAT TAAATCTGCAACTAGTATTATACCT AGGACT (SEQIDNO:55) AGTCCTAGGTATAATACTAGTGGTG gRNA-yghX-S CCTGACGACCATAAAAGTTTTAGAG CTAGAA (SEQIDNO:56) TTCTAGCTCTAAAACTTTTATGGTC gRNA-yghX-A GTCAGGCACCACTAGTATTATACCT AGGACT (SEQIDNO:57) gRNA-argBDF-S CTGAACAACATCATATTTAAATGAA CATAACTCAATTTGTAGGCTAGCAT AACCCCTTGGGGC (SEQIDNO:58) gRNA-argBDF-A GCCCCAAGGGGTTATGCTAGCCTAC AAATTGAGTTATGTTCATTTAAATA TGATGTTGTTCAGTTAAGAGCTGTA CGCGGAGTTGA (SEQIDNO:59) gRNA-argG- ATGCACAGGAGACTTTCTGATGCGC argH-S TGGTTTCATTTCTTCTAGGGTCATA GTAATCCAGCAACT (SEQIDNO:60) gRNA-argG- AGTTCCTGGATTACTATCACCCTAC argH-A AAGAAATCAACCAGCCCATCAGAAA GTCTCCTGTGCAT (SEQIDNO:61) gRNA-yjiT-S AGTCCTAGGTATAATACTAGTAGGG ATTATGAACGGCAATGGTTTTAGAG CTAGAA (SEQIDNO:62) gRNA-yjiT-A TTCTAGCTCTAAAACCATTGCCGTT CATAATCCCTACTAGTATTATACCT AGGACT (SEQIDNO:63) gRNA-pyrAA- CTGAACAACATCATATTTAAATGAA pyrAB-S CATAACTCAATTTGTAGGCTAGCAT AACCCCTTGGGGC (SEQIDNO:64) gRNA-pyrAA- GCCCCAAGGGGTTATGCTAGCCTAC pyrAB-A AAATTGAGTTATGTTCATTTAAATA TGATG1TGTTCAG (SEQIDNO:65) gRNA-ilvG-S AGTCCTAGGTATAATACTAGTGGAA GAGTTGCCGCGCATCAGTTTTAGAG CTAGAA (SEQIDNO:66) gRNA-ilvG-A TTCTAGCTCTAAAACTGATGCGCGG CAACTCTTCCACTAGTATTATACCT AGGACT (SEQIDNO:67)
3. Specific Process of Strain Construction
3.1 Knockout of the three genes, speA, adiA and astA
3.1.1 Knockout of speA gene

(52) Using E. coli W3110 (ATCC27325) genome as the template, PCR was performed with the primers for the upstream homologous arm (UP-speA-S, UP-speA-A) and the primers for the downstream homologous arm (DN-speA-S, DN-speA-A) designed according to the upstream and downstream sequences of its speA gene (NCBI-GeneID: 12933352) to amplify the upstream and downstream homologous arms of the speA gene. The overlap PCR method was applied to fuse the above fragments to obtain a fragment for knocking out speA gene (upstream homologous arm-downstream homologous arm). The DNA fragment obtained by annealing primers gRNA-speA-S and gRNA-speA-A was ligated with the plasmid pGRB to construct a recombinant plasmid pGRB-spe.A. E. coli W3110 competent cells were prepared, according to the methods described in sections 1.3 and 1.4. The plasmid pGRB-speA and the fragment for knocking out speA gene were electro-transformed into the competent cells at the same time, and finally a strain named E. coli W3110 ARG1 was obtained. The electropherogram of the construction of the fragment for knocking out speA gene and the PCR verification of the positive bacteria was shown in FIG. 2, wherein, the length of the upstream homologous arm should be 397 bp, the length of the downstream homologous arm should be 468 bp, and the full length of the overlapping fragment should be 865 bp, and for PCR verification, the length of the PCR amplified fragment of the positive bacteria should be 2752 bp, and the length of the PCR amplified fragment of the original bacteria should be 865 bp.

(53) 3.1.2 Knockout of adiA gene

(54) Using E. coli W3110 (ATCC27325) genome as the template, PCR was performed with the primers for the upstream homologous arm (UP-adiA-S, UP-adiA-A) and the primers for the downstream homologous arm (DN-adiA-S, DN-adiA-A) designed according to the upstream and downstream sequences of its adiA gene (NCBI-GeneID: 12934085) to amplify the upstream and downstream homologous arms of the adiA gene. The overlap PCR method was applied to fuse the above fragments to obtain a fragment for knocking out adiA gene (upstream homologous arm-downstream homologous arm). The DNA fragment obtained by annealing primers gRNA-adiA-S and gRNA-adiA-A was ligated with the plasmid pGRB to construct a recombinant plasmid pGRB-adiA. E. coli W3110 ARG1 competent cells were prepared, according to the methods described in sections 1.3 and 1.4. The plasmid pGRB-adiA and the fragment for knocking out adiA gene were electro-transformed into the competent cells at the same time, and finally a strain named E. coli W3110 ARG2 was obtained. The electropherogram of the construction of the fragment for knocking out adiA gene and the PCR verification of the positive bacteria was shown in FIG. 3, wherein, the length of the upstream homologous arm should be 806 bp, the length of the downstream homologous arm should be 402 bp, and the full length of the overlapping fragment should be 1208 bp, and for PCR verification, the length of the PCR amplified fragment of the positive bacteria should be 2124 bp, and the length of the PCR amplified fragment of the original bacteria should be 1208 bp.

(55) 3.1.3 Knockout of astA gene

(56) Using E. coli W3110 (ATCC27325) genome as the template, PCR was performed with the primers for the upstream homologous arm (UP-astA-S, UP-astA-A) and the primers for the downstream homologous arm (DN-astA-S, DN-astA-A) designed according to the upstream and downstream sequences of its adiA gene (NCBI-GeneID: 12933241) to amplify the upstream and downstream homologous arms of the astA gene. The overlap PCR method was applied to fuse the above fragments to obtain a fragment for knocking out astA gene (upstream homologous arm-downstream homologous arm). The DNA fragment obtained by annealing primers gRNA-astA-S and gRNA-astA-A was ligated with the plasmid pGRB to construct a recombinant plasmid pGRB-astA. E. coli W3110 ARG2 competent cells were prepared, according to the methods described in sections 1.3 and 1.4. The plasmid pGRB-astA and the fragment for knocking out astA gene were electro-transformed into the competent cells at the same time, and finally a strain named E. coli W3110 ARG3 was obtained. The electropherogram of the construction of the fragment for knocking out astA gene and the PCR verification of the positive bacteria was shown in FIG. 4, wherein, the length of the upstream homologous arm should be 443 bp, the length of the downstream homologous arm should be 523 bp, and the full length of the overlapping fragment should be 965 bp, and for PCR verification, the length of the PCR amplified fragment of the positive bacteria should be 1869 bp, and the length of the PCR amplified fragment of the original bacteria should be 965 bp.

(57) 3.2 Knockout the argE Gene in E. coli and Integration of the argJ Gene from Corynebacterium glutamicum at this Locus

(58) Using E. coli W3110 (ATCC27325) genome as the template, PCR was performed with the primers for the upstream homologous arm (UP-argE-S, UP-argE-A) and the primers for the downstream homologous arm (DN-argE-S, DN-argE-A) designed according to the upstream and downstream sequences of its argE gene (NCBI-GeneID: 12930574) to amplify the upstream and downstream homologous arms of the argE gene. Using Corynebacterium glutamicum (ATCC13032) genome as the template, PCR was performed with the primers (argJ-S, argJ-A) designed according to its argJ gene sequence (NCBI-GeneID: 1019371) to amplify the argJ fragment; promoter Pire was designed in the reverse primer for the upstream homologous arm and the forward primer for the argJ gene. The overlap PCR method was applied to fuse the above fragments to obtain a fragment for knocking out argE gene and integrating argJ gene (upstream homologous arm-P.sub.trc-argJ-downstream homologous arm). The DNA fragment obtained by annealing primers gRNA-argE-S and gRNA-argE-A was ligated with the plasmid pGRB to construct a recombinant plasmid pGRB-argE. E. coli W3110 ARG3 competent cells were prepared, according to the methods described in sections 1.3 and 1.4. The plasmid pGRB-argE and the fragment for knocking out argE gene and integrating arg/gene were electro-transformed into the competent cells at the same time, and finally a strain named E. coli W3110 ARG4 was obtained. The electropherogram of the construction of the fragment for integration and the PCR verification of the positive bacteria during the Pure-argJ fragment integration process was shown in FIG. 5, wherein, the length of the upstream homologous arm should be 510 bp, the length of the argJ gene should be 1206 bp, the length of the downstream homologous arm should be 668 bp, and the full length of the overlapping fragment should be 2458 bp, and for the PCR verification of the recombinants, the length of the amplified fragment of the positive recombinants should be 2458 bp, and the length of the amplified fragment of the original bacteria should be 2154 bp.

(59) 3.2 Integration of the Arginine Synthesis Operon from Corynebacterium glutamicum into the yghX Gene Locus in E. coli

(60) The arginine synthesis operator gene from Corynebacterium glutamicum (containing seven genes, argC, argJ, argB, argD, argF, argG and argH) were successively integrated into the yjhX gene locus in E. coli, and the transcription and expression of this foreign operon was initiated by a promoter Pure, and finally the strain named E. coli W3110 ARG7 was constructed.

(61) The integration of arginine synthesis operator gene from Corynebacterium glutamicum is divided into three stages.

(62) 3.2.1 Integration of Pre-argC-argJ

(63) Using E. coli W3110 (ATCC27325) genome as the template, PCR was performed with the primers for the upstream homologous arm (UP-yghXS, UP-yghX-A) and the primers for the downstream homologous arm (DN-yghX-S1, DN-yghX-A) designed according to the upstream and downstream sequences of its yghX gene to amplify the upstream and downstream homologous arms of the yghX gene. Using Corynebacterium glutamicum (ATCC13032) genome as the template, PCR was performed with the primers (argC-argJ-S, argC-argJ-A) designed according to its argC-argJ gene sequences (NCBI-GeneID: 1019370, 1019371) to amplify the argC-argJ fragment; promoter Pirc was designed in the reverse primer for the upstream homologous arm and the forward primer for the argC-argJ gene. The overlap PCR method was applied to fuse the above fragments to obtain a fragment for integrating argC-argJ genes (upstream homologous arm-P.sub.trc-argC-argJ-downstream homologous arm). The DNA fragment containing the target sequence was obtained by annealing primers gRNA-yghX-S and gRNA-yghX-A, and then ligated with the plasmid pGRB to construct a recombinant plasmid pGRB-yghX. E. coli W3110 ARG4 competent cells were prepared, according to the methods described in sections 1.3 and 1.4. The plasmid pGRB-yghX and the fragment for integrating argC-argJ genes were electro-transformed into the competent cells at the same time, and finally a strain named E. coli W3110 ARG5 was obtained. The electropherogram of the construction of the fragment for integration and the PCR verification of the positive bacteria during the Pic-argC-argJ fragment integration process was shown in FIG. 6, wherein, the length of the upstream homologous arm should be 602 bp, the length of the argC-argJ gene fragment should be 2324 bp, the length of the downstream homologous arm should be 561 bp, and the full length of the overlapping fragment should be 3650 bp, and the length of the amplified fragment by using the identification primers should be 1068 bp, and no bands should be amplified from the original bacteria.

(64) 3.2.2 Integration of argB-argD-argF

(65) Using Corynebacterium glutamicum (ATCC13032) genome as the template, PCR was performed with the primers for the upstream homologous arm (UP-argB-argD-argF-S, UP-argB-argD-argF-A) designed according to the argB-argD-argF genes (NCBI-GeneID: 1019372, 1019373, 1019374) and their upstream sequence to amplify the upstream homologous arm of the argB-argD-argF genes. Using E. coli W3110 (ATCC27325) genome as the template, PCR was performed with the primers for the downstream homologous arm (DN-yghX-S2, DN-yghX-A) designed according to the downstream sequence of its yghX gene to amplify the downstream homologous arm of the yghX gene. The overlap PCR method was applied to fuse the above fragments to obtain a fragment for integrating argB-argD-argF genes (argB upstream fragment-argB-argD-argF-downstream homologous arm). The DNA fragment containing the target sequence was obtained by annealing primers gRNA-argBDF-S and gRNA-argBDF-A, and then ligated with the plasmid pGRB to construct a recombinant plasmid pGRB-argBDF. E. coli W3110 ARG5 competent cells were prepared, according to the methods described in sections 1.3 and 1.4. The plasmid pGRB-argBDF and the fragment for integrating argB-argD-argF genes were electro-transformed into the competent cells at the same time, and finally a strain named E. coli W3110 ARG6 was obtained. The electropherogram of the construction of the fragment for integration and the PCR verification of the positive bacteria during the argB-argD-argF fragment integration process was shown in FIG. 7, wherein, the full length of the argB upstream fragment-argB-argD-argF was 3575 bp, the length of the downstream homologous arm was 561 bp, and the length of the overlapping fragment was 4219 bp, and the length of the fragment amplified by the identification primers was 1034 bp, and no bands should be amplified from the original bacteria.

(66) 3.2.3 Integration of argG-argH

(67) Using Corynebacterium glutamicum (ATCC13032) genome as the template, PCR was performed with the primers for the upstream homologous arm (UP-argG-argHS, UP-argG-argH-A) and the primers for the argG-argH fragment (argG-argH-S, argG-argH-A) designed according to argG-argH (NCBI-GeneID: 1019376, 1019377) and their upstream sequence to amplify the upstream homologous arm of the argG-argH genes and the argG-argH fragment. Using E. coli W3110 (ATCC27325) genome as the template, PCR was performed with the primers for the downstream homologous arm (DN-yghX-S3, DN-yghX-A) designed according to the downstream sequence of its yghX gene to amplify the downstream homologous arm of the yghX gene. The overlap PCR method was applied to fuse the above fragments to obtain a fragment for integrating argG-argH genes (argG upstream fragment-argG-argH-downstream homologous arm). The DNA fragment containing the target sequence was obtained by annealing primers gRNA-argG-argH-S and gRNA-argG-argH-A, and then ligated with the plasmid pGRB to construct a recombinant plasmid pGRB-argG-argH. E. coli W3110 ARG6 competent cells were prepared, according to the methods described in sections 1.3 and 1.4. The plasmid pGRB-argG-argH and the fragment for integrating argG-argH genes were electro-transformed into the competent cells at the same time, and finally a strain named E. coli W3110 ARG7 was obtained. The electropherogram of the construction of the fragment for integration and the PCR verification of the positive bacteria during the argG-argH fragment integration process was shown in FIG. 8, wherein, the full length of the argG upstream fragment was 405 bp, the full length of the argG-argH fragment was 2826 bp, the length of the downstream homologous arm was 561 bp, and the length of the overlapping fragment should be 3875 bp, and the length of the fragment amplified by the identification primers should be 1521 bp, and no bands should be amplified from the original bacteria.

(68) 3.3 Integration of the pyrAA-pyrAB Genes from B. subtilis into the yjiT Gene Locus of E. coli

(69) B. subtilis A260 was bred from B. subtilis 168 as the starting strain by combining ARTP mutagenesis and high-throughput screening (this strain was deposited on Dec. 2, 2015 at China General Microbiological Culture Collection Center (Address: Institute of Microbiology, Chinese Academy of Sciences, No. 1 West Beichen Road, Chaoyang District, Beijing, Postcode: 100101) with a deposition number of CGMCC No. 11775). The strain relieved the feedback regulation of uridylic acid and arginine on the carbamyl phosphate synthetase, and by sequencing the pyrimidine nucleotide operon gene, it was found that the glutamic acid residue at position 949 was deleted from the large subunit of carbamyl phosphate (encoded by pyrAB) (publication number: CN105671007A). The carbamyl phosphate synthetase genes (pyrAA, pyrAB) in B. subtilis A260 without feedback inhibition of arginine were integrated into E. coli to improve the supply of the precursor carbamyl phosphate in the process of arginine synthesis.

(70) The pyrAA-pyrAB gene fragment of 4292 bp in length from B. subtilis was integrated into E. coli in two segments, wherein the first segment was 2651 bp and the second segment was 1641 bp.

(71) 3.3.1 Integration of the First Segment Pure-pyrAA-pyrAB

(72) Using E. coli W3110 (ATCC27325) genome as the template, PCR was performed with the primers for the upstream homologous arm (UP-yjiT-S, UP-yjiT-A) and the primers for the downstream homologous arm (DN-yjiT-S, DN-yjiT-A) designed according to the upstream and downstream sequences of its yjiT gene to amplify the upstream and downstream homologous arms of the yjiT gene. Using B. subtilis (CGMCC No. 11775) genome as the template, PCR was performed with the primers (1-pyrAA-pyrAB-S, 1-pyrAA-pyrAB-A) designed according to pyrAA gene (NCBI-GeneID: 937368) and pyrAB gene (NCBI-GeneID: 936608) to amplify the first segment pyrAA-pyrAB gene fragment. Promoter Pire was designed in the reverse primer for the upstream homologous arm and the forward primer for the pyrAA-pyrAB genes. The overlap PCR method was applied to fuse the above fragments to obtain a fragment for integrating the first segment pyrAA-pyrAB (upstream homologous arm-P.sub.trc-pyrAA-pyrAB-downstream homologous arm). The DNA fragment containing the target sequence was obtained by annealing primers gRNA-yjiT-S and gRNA-yjiT-A, and then ligated with the plasmid pGRB to construct a recombinant plasmid pGRB-yjiT. E. coli W3110 ARG7 competent cells were prepared, according to the methods described in sections 1.3 and 1.4. The plasmid pGRB-yjiT and the fragment for integrating the first segment pyrAA-pyrAB were electro-transformed into the competent cells at the same time, and finally a strain named E. coli W3110 ARG8 was obtained. The electropherogram of the construction of the fragment for integrating the first segment pyrAA-pyrAB and the PCR verification of the positive bacteria was shown in FIG. 9, wherein, the length of the upstream homologous arm should be 316 bp, the length of the first segment pyrAA-pyrAB gene fragment should be 2651 bp, the length of the downstream homologous arm should be 667 bp, and the full length of the integrated fragment should be 3634 bp, and the length of the fragment amplified by the identification primers should be 1100 bp, and no bands should be amplified from the original bacteria.

(73) 3.3.2 Integration of the Second Segment pyrAA-pyrAB

(74) Using B. subtilis A260 (CGMCC No. 11775) genome as the template, PCR was performed with the primers for the upstream homologous arm (2-pyrAA-pyrAB-S, 2-pyrAA-pyrAB-A) designed according to the second segment pyrAA-pyrAB and its upstream sequence to amplify the upstream downstream homologous arm (containing the 266 bp first segment pyrAA-pyrAB downstream sequence and the 1641 bp second pyrAA-pyrAB sequence, 1907 in total). Using E. coli W3110 (ATCC27325) genome as the template, PCR was performed with the primers for the downstream homologous arm (DN-yjiT-S1, DN-yjiT-A) designed according to the downstream sequence of its yjiT gene to amplify the downstream homologous arm of the yjiT gene. The overlap PCR method was applied to fuse the above fragments to obtain the fragment for integrating the second segment pyrAA-pyrAB (second segment pyrAA-pyrAB-downstream homologous arm). The DNA fragment containing the target sequence was obtained by annealing primers gRNA-pyrAA-pyrAB-S and gRNA-pyrAA-pyrAB-A, and then ligated with the plasmid pGRB to construct a recombinant plasmid pGRB-pyrAA-pyrAB. E. coli W3110 ARG8 competent cells were prepared, according to the methods described in sections 1.3 and 1.4. The plasmid pGRB-pyrAA-pyrAB and the fragment for integrating the second segment pyrAA-pyrAB were electro-transformed into the competent cells at the same time, and finally a strain named E. coli W3110 ARG9 was obtained. The electropherogram of the construction of the integrated fragment and the PCR verification of the positive bacteria during the second segment pyrAA-pyrAB integration process was shown in FIG. 10, wherein, the full length of the upstream sequence of the second segment pyrAA-pyrAB should be 1907 bp, the length of the downstream homologous arm should be 667 bp, and the full length of the overlapping fragment should be 2574 bp, and the length of the fragment amplified by the identification primers should be 1135 bp, and no bands should be amplified from the original bacteria.

(75) 3.4 Integration of the Lys E Gene from Corynebacterium efficiens into the ilvG Gene Locus in E. coli

(76) Using E. coli W3110 (ATCC27325) genome as the template, PCR was performed with the primers for the upstream homologous arm (UP-ilvG-S, UP-ilvG-A) and the primers for the downstream homologous arm (DN-ilvG-S, DN-ilvG-A) designed according to the upstream and downstream sequences of its ilvG gene to amplify the upstream and downstream homologous arms of the ilvG gene; PCR was performed with the primers (lysE-S, lysE-A) designed according to the lysE gene (NCBI Reference Sequence: WP_143758438.1) sequence (SEQ ID NO: 68) to amplify the lysE gene fragment. Promoter P.sub.trc was designed in the reverse primer for the upstream homologous arm and the forward primer for the lysE gene. The overlap PCR method was applied to fuse the above fragments to obtain a fragment for integrating lysE gene (upstream homologous arm-Pure-lysE-downstream homologous arm). The DNA fragment containing the target sequence was obtained by annealing primers gRNA-ilvG-S and gRNA-ilvG-A, and then ligated with the plasmid pGRB to construct a recombinant plasmid pGRB-ilvG. E. coli W3110 ARG9 competent cells were prepared, according to the methods described in sections 1.3 and 1.4. The plasmid pGRB-ilvG and the fragment for integrating lysE gene were electro-transformed into the competent cells at the same time, and finally a strain named E. coli W3110 ARG10 was obtained. The electropherogram of the construction of the integrated fragment Pirc-lysE and the PCR verification of the positive bacteria was shown in FIG. 11, wherein, the length of the upstream homologous arm should be 412 bp, the length of the Pure-lysE gene fragment should be 806 bp, the length of the downstream homologous arm should be 481 bp, and the full length of the integrated fragment should be 1699 bp, and for the PCR verification, the fragment amplified by PCR from the positive bacteria should be 1699 bp, and the fragment amplified by PCR from the original bacteria should be 1426 bp.

Example 2

(77) The method of producing arginine by fermenting the genetically engineered strain E. coli W3110 ARG10 was as follows: (1) Shake flask fermentation slant culture: inoculating the bacterial strain preserved at 80 C. onto an activated slant using the streak method, culturing at 37 C. for 12 h and passaging once; shake flask seed culture: scraping a ring of seeds on the slant with an inoculating loop and inoculating into a 500 ml conical flask containing 30 mL of seed medium, sealing the conical flask with nine layers of gauze, and culturing at 37 C. and 200 rpm for 7-10 h; shake flask fermentation culture: inoculating the seed culture at the concentration of 15% (v/v) into a 500 ml conical flask containing fermentation medium (final volume: 30 mL), sealing the conical flask with nine layers of gauze, culturing at 37 C. and 200 r/min in a shaking table, during the fermentation, adding ammonia water to maintain pH at 7.0-7.2; adding 60% (m/v) glucose solution to maintain fermentation; the fermentation period lasting for 26-30 h.

(78) Components of slant medium: 1 g/L glucose, 10 g/L peptone, 10 g/L beef extract, 5 g/L yeast powder, 2.5 g/L NaCl, 20 g/L agar, the residual was water, pH 7.0-7.2.

(79) Components of seed medium: 25 g/L glucose, 5 g/L yeast extract, 3 g/L peptone, 1 g/L K.sub.2HPO.sub.4, 1 g/L MgSO.sub.4.Math.7H.sub.2O, 10 mg/L FeSO.sub.4.Math.7H2O, 10 mg/L MnSO.sub.4.Math.7H.sub.2O, 1 mg/L each of V.sub.B1, V.sub.B3, V.sub.B5, V.sub.B12 and V.sub.H, the residual was water, pH 7.0-7.2.

(80) Components of fermentation medium: 25 g/L glucose, 3 g/L yeast extract, 2 g/L peptone, 3 g/L K.sub.2HPO.sub.4, 2 g/L MgSO.sub.4.Math.7H.sub.2O, 10 mg/L FeSO.sub.4.Math.7H.sub.2O, 10 mg/L MnSO.sub.4.Math.7H.sub.2O, 1 mg/L each of V.sub.B1, V.sub.B3, V.sub.B5, V.sub.B12 and V.sub.H, the residual was water, pH 7.0-7.2.

(81) After 26-30 h shake flask fermentation, the yield of L-arginine in the fermentation broth of E. coli W3110 ARG10 strain was 30-32 g/L.

(82) (2) Fermenter fermentation slant activation culture: scraping a ring of the bacterial strain preserved at 80 C. and spreading evenly onto an activated slant, culturing at 37 C. for 12-16 h and transferring to an eggplant-shaped flask to continue the culture for 12-16 h; seed culture: taking an appropriate amount of sterilized water into the eggplant-shaped flask, inoculating the bacterial suspension into the seed medium, keeping pH at about 7.0, the temperature at 37 C. and the dissolved oxygen between 25-35%, and culturing the cells until reaching 5-6 g/L dry weight of cells; fermentation culture: inoculating the seed culture at the concentration of 15% into a fresh fermentation medium, starting fermentation and during the fermentation process, keeping pH stable at about 7.0, temperature at 35 C. and dissolved oxygen between 25-35%; when the glucose in the medium was exhausted, 80% (m/v) glucose solution was added to maintain the glucose concentration in the fermentation medium at 0.1-5 g/L.

(83) The slant medium, seed medium and fermentation medium were the same as that in the shake flask fermentation . . .

(84) The accumulation of L-arginine reached 130-135 g/L after culture for 50-55 h in a 5 L fermenter. The conversion rate was 0.48 g arginine/g glucose, and the production intensity was 2.5 g arginine/L/h. The fermentation curve is shown in FIG. 12.

(85) The embodiments of the present invention are described above. However, the present invention is not limited to the above embodiments. Any modification, equivalent replacement, improvement, etc. made within the spirit and principles of the present invention shall be included in the protection scope of the invention.