Isolated naive pluripotent stem cells and methods of generating same
12570957 · 2026-03-10
Assignee
Inventors
Cpc classification
C12N5/0606
CHEMISTRY; METALLURGY
C12N2501/999
CHEMISTRY; METALLURGY
C12N5/0611
CHEMISTRY; METALLURGY
C12N5/0696
CHEMISTRY; METALLURGY
C12N2501/115
CHEMISTRY; METALLURGY
C12N2501/155
CHEMISTRY; METALLURGY
International classification
Abstract
Provided is an isolated human naive pluripotent stem cell (PSC), wherein: (i) when the naive PSC is a female PSC, then said naive female PSC has two unmethylated alleles of an X-inactive specific transcript (XIST) gene; and (ii) when said naive PSC is a male PSC, then said naive male PSC has an unmethylated allele of said XIST gene. Also provided is a culture medium which comprises an ERK1/2 inhibitor, a GSK3beta inhibitor, a p38 inhibitor, a JNK inhibitor, a STAT3 activator and at least one agent selected from the group consisting of: bFGF, TGFbeta 1, a PKC inhibitor, a ROCK inhibitor and a NOTCH inhibitor; or at least agent selected from the group consisting of: a TGFR inhibitor, a FGFR inhibitor, a PKC inhibitor, a ROCK inhibitor and a NOTCH inhibitor.
Claims
1. A culture medium comprising an ERK1/2 inhibitor at a concentration of 0.3-1.5 M, a GSK3 inhibitor at a concentration of 0.1-0.5 M, a p38 inhibitor at a concentration of 0.1-2 M, a JNK inhibitor at a concentration of 0.5-5 M, a STAT3 activator at a concentration of 5-50 ng/ml and at least one agent selected from the group consisting of: a transforming growth factor receptor (TGFR) inhibitor at a concentration of 0.1-1 M, a fibroblast growth factor receptor (FGFR) inhibitor at a concentration of 0.05-0.2 M, a protein kinase C (PKC) inhibitor at a concentration of 0.5-5 M, a ROCK inhibitor at a concentration of 0.1-10 M and a NOTCH inhibitor at a concentration of 0.1-5 M, wherein said medium is capable of maintaining a nave human pluripotent stem cell (PSC) in a nave, undifferentiated and pluripotent state for at least 2 passages, wherein said naive PSC comprises: an unmethylated promoter of the X-inactive specific transcript (XIST) gene, wherein: (i) when said naive human PSC is a female PSC, then said naive female human PSC has two unmethylated alleles of the promoter of the XIST gene; and (ii) when said naive human PSC is a male PSC, then said naive male human PSC has an unmethylated allele of the promoter of the XIST gene, and an expression level of transcription factor E3 (TFE3) characterized by a nucleus to cytoplasm expression ratio which is equal to or higher than 1 as determined by an immunostaining assay.
2. The culture medium of claim 1, wherein said STAT3 activator is selected from the group consisting of leukemia inhibitory factor (LIF) and interleukin 6 (IL6).
3. The culture medium of claim 1, further comprising at least one additional agent selected from the group consisting of: insulin-like growth factor 1 (IGF1), insulin-like growth factor II (IGFII), a bone morphogenetic protein (BMP) signaling inhibitor, a Sonic Hedgehog pathway (SHH) inhibitor, an ERK5 inhibitor, Forskolin, Kenpaullone, BayK8644, Bix1294, and stem cell factor (SCF).
4. The culture medium of claim 1, further comprising at least one additional agent selected from the group consisting of: insulin-like growth factor 1 (IGF1), insulin-like growth factor II (IGFII), bone morphogenetic protein 4 (BMP4), a Sonic Hedgehog pathway (SHH) inhibitor, an ERK5 inhibitor, Forskolin, Kenpaullone, BayK8644, Bix1294, and stem cell factor (SCF).
5. The culture medium of claim 1, wherein said STAT3 activator is LIF, and wherein one of said agents is a PKC inhibitor.
6. The culture medium of claim 5, further comprising said FGFR inhibitor.
7. The culture medium of claim 5, further comprising said TGFR inhibitor.
8. The culture medium of claim 1, wherein said STAT3 activator is LIF and wherein said at least one agent selected from the group consisting of: said NOTCH inhibitor, and a fibroblast growth factor receptor (FGFR) inhibitor.
9. The culture medium of claim 8, further comprising an agent selected from the group consisting of insulin-like growth factor II (IGFII) and stem cell factor (SCF).
10. A culture medium comprising an ERK1/2 inhibitor at a concentration of 0.3-1.5 M, a GSK3 inhibitor at a concentration of 0.1-0.5 M, a p38 inhibitor at a concentration of 0.1-2 M, a JNK inhibitor at a concentration of 0.5-25 M, a STAT3 activator at a concentration of 5-50 ng/ml and at least one agent selected from the group consisting of: basic fibroblast growth factor (bFGF) at a concentration of 1-100 ng/ml, transforming growth factor A beta 1 (TGF1) at a concentration of 0.1-20 ng/ml, wherein said medium is capable of maintaining a naive human PSC in a nave, undifferentiated and pluripotent state for at least 2 passages, wherein said naive PSC comprises: an unmethylated promoter of the X-inactive specific transcript (XIST) gene, wherein: (i) when said naive human PSC is a female PSC, then said naive female human PSC has two unmethylated alleles of the promoter of the XIST gene; and (ii) when said naive human PSC is a male PSC, then said naive male human PSC has an unmethylated allele of the promoter of the XIST gene, and an expression level of transcription factor E3 (TFE3) characterized by a nucleus to cytoplasm expression ratio which is equal to or higher than 1 as determined by an immunostaining assay.
11. The culture medium of claim 10, wherein said STAT3 activator is selected from the group consisting of leukemia inhibitory factor (LIF) and interleukin 6 (IL6).
12. The culture medium of claim 10, further comprising at least one additional agent selected from the group consisting of: insulin-like growth factor 1 (IGF1), insulin-like growth factor II (IGFII), a bone morphogenetic protein (BMP) signaling inhibitor, a Sonic Hedgehog pathway (SHH) inhibitor, an ERK5 inhibitor, Forskolin, Kenpaullone, BayK8644, Bix1294, and stem cell factor (SCF).
13. The culture medium of claim 10, wherein said STAT3 activator is LIF, and wherein said at least one agent is selected from group consisting of said bFGF and said TGF 1.
14. A cell culture comprising naive human PSCs and the culture medium of claim 1.
15. The culture medium of claim 1, further comprising ascorbic acid.
16. The culture medium of claim 1, further comprising oleic Acid.
17. The culture medium of claim 1, further comprising Linoleic Acid and/or pipecolic acid.
18. The culture medium of claim 1, further comprises serum replacement.
19. A cell culture comprising naive human PSCs and the culture medium of claim 10.
Description
BRIEF DESCRIPTION OF THE DRAWINGS
(1) The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.
(2) Some embodiments of the invention are herein described, by way of example only, with reference to the accompanying drawings. With specific reference now to the drawings in detail, it is stressed that the particulars shown are by way of example and for purposes of illustrative discussion of embodiments of the invention. In this regard, the description taken with the drawings makes apparent to those skilled in the art how embodiments of the invention may be practiced.
(3) In the drawings:
(4)
(5)
(6)
(7)
(8)
(9)
(10)
(11)
(12)
(13)
(14)
(15)
(16)
(17)
(18)
(19)
(20)
(21)
(22)
(23)
(24)
(25)
(26)
(27)
(28)
(29)
(30)
(31)
(32)
(33)
(34)
(35)
(36)
(37)
(38)
(39)
(40)
(41)
(42)
(43)
(44)
(45)
(46)
(47)
(48)
(49)
(50)
(51)
(52)
(53)
(54)
(55)
(56)
(57)
(58)
(59)
(60)
(61)
This transformation represents a distance from MEF expression values (set to 0) towards iPS values (set to 1). Selected group of pluripotency related genes or selected targets of Mbd3, are plotted in different time points after DOX induction. Red bars represent progression of gene expression in Mbd3.sup.flox/ and blue bars represent progression of gene expression in Mbd3.sup.+/+.
(62)
(63)
(64)
(65)
(66)
(67)
(68)
(69)
(70)
(71)
(72)
(73)
(74)
(75)
(76)
(77)
(78)
(79)
(80)
(81)
(82)
(83)
(84)
(85)
(86)
(87)
(88)
(89)
(90)
(91)
(92)
(93)
(94)
(95)
(96)
(97)
(98)
(99)
(100)
(101)
(102)
(103)
(104)
(105)
(106)
(107)
(108)
(109)
(110)
(111)
(112)
(113)
(114)
(115)
(116) FIGS. 1O1A-101B are Western blot analyses showing expression of MBD3 (
(117)
(118)
(119)
(120)
(121)
(122)
(123)
(124)
(125)
DESCRIPTION OF SPECIFIC EMBODIMENTS OF THE INVENTION
(126) The present invention, in some embodiments thereof, relates to an isolated primate (e.g., human) naive pluripotent stem cell, novel culture medium which can be used to generate same and methods of generating and culturing same and, more particularly, but not exclusively, to methods of improving dedifferentiation of somatic cells for generation of induced pluripotent stem cells.
(127) Before explaining at least one embodiment of the invention in detail, it is to be understood that the invention is not necessarily limited in its application to the details set forth in the following description or exemplified by the Examples. The invention is capable of other embodiments or of being practiced or carried out in various ways.
(128) The present inventors have uncovered the conditions, which are required for isolating and generating a primate (e.g., human) naive pluripotent stem cell, and maintaining same in the naive state.
(129) Thus, according to an aspect of some embodiments of the invention there is provided an isolated primate (e.g., human) naive pluripotent stem cell (PSC) comprising: an unmethylated X-inactive specific transcript (XIST) gene, wherein: (i) when the naive PSC is a female PSC, then the naive female PSC has two unmethylated alleles of the XIST gene; and (ii) when the naive PSC is a male PSC, then the naive male PSC has an unmethylated allele of the XIST gene,
and/or an expression level of transcription factor E3 (TFE3) characterized by a nucleus to cytoplasm expression ratio which is equal to or higher than 1 as determined by an immunostaining assay.
(130) As used herein the phrase pluripotent stem cell (PSC) refers to an undifferentiated cell (e.g., a primate cell, a mammalian cell) capable of differentiating into all three embryonic germ cell layers, i.e., to the mesoderm, ectoderm and endoderm embryonic germ layers.
(131) According to some embodiments of the invention, the pluripotent stem cell is selected from the group consisting of embryonic stem cell (ESC), induced pluripotent stem cells (iPSCs), and embryonic germ cell (EGC).
(132) According to some embodiments of the invention, the primate naive pluripotent stem cell is of Homo sapiens (human), monkey, chimpanzee, Gorillas, Rhesus and/or Baboon.
(133) The phrase naive pluripotent stem cell (PSC) refers to a cell capable of forming a PSC, and that exhibits a pre-X-inactivation state, and therefore is considered to be the origin of the PSC.
(134) The pre-X-inactivation state according to some embodiments of the invention is characterized by presence of two unmethylated alleles of an X-inactive specific transcript (XIST) gene in the female cell, and presence an unmethylated allele of the XIST gene in a male cell.
(135) The XIST gene is located on human Xq13.2 chromosome and has the sequence depicted in clone NC_000023.10 (73040486..73072588, complement, based on GenBank version GRCh37.p10. The XIST gene has a non-coding RNA which is provided in GenBank Accession NO. NR_001564.2 (SEQ ID NO:20).
(136) According to some embodiments of the invention, presence of two unmethylated alleles of XIST gene in a female cell refers to having below about 20% of CpG methylated reads sequenced in the XIST promoter, e.g., below about 19%, below about 18%, below about 17%, below about 16%, below about 15%, below about 14%, below about 13%, below about 12%, below about 11%, below about 10%, below about 9%, below about 8%, below about 7%, below about 6%, below about 5%, below about 4%, below about 3%, below about 2%, below about 1%, e.g., 0% (e.g., complete absence) of CpG methylated reads sequenced in the XIST promoter.
(137) According to some embodiments of the invention, presence of one unmethylated allele of XIST gene in a male cell refers to having below about 20% of CpG methylated reads sequenced in the XIST promoter, e.g., below about 19%, below about 18%, below about 17%, below about 16%, below about 15%, below about 14%, below about 13%, below about 12%, below about 11%, below about 10%, below about 9%, below about 8%, below about 7%, below about 6%, below about 5%, below about 4%, below about 3%, below about 2%, below about 1%, e.g., 0% of CpG methylated reads sequenced in the XIST promoter.
(138) A non-limited example of the XIST promoter which includes CpG islands which can be either methylated or unmethylated is provided in the XIST promoter amplicon set forth by SEQ ID NO:70.
(139) According to some embodiments of the invention, the human naive PSC is characterized by a reduced methylation of CpG islands as compared to a level of methylation of the CpG islands in a human primed PSC.
(140) Thus, as shown in
(141) According to some embodiments of the invention, the human naive PSC is characterized by 0-3% of total methylated cytosine out of the total Guanine nucleotides in the naive PSC cell. For comparison, the primed PSC or a somatic cell has between 3.5%-5% of total methylated cytosine out of the total Guanine nucleotides in the primed PSC cell.
(142) Thus, the naive pluripotent stem cell of some embodiments of the invention is in a naive state.
(143) As used herein the phrase naive state refers to being in an undifferentiated state wherein both alleles of the X-inactive specific transcript (XIST) gene of the female cell are unmethylated, or wherein the XIST allele of the male cell is unmethylated.
(144) It should be noted that the naive PSCs of some embodiments of the invention (which are in a pre-X inactivation and a naive state) can upon differentiation inactivate one of the X chromosome alleles and methylate one of the XIST genes.
(145) According to some embodiments of the invention, the naive PSC maintains the naive state (as defined hereinabove) while being maintained (e.g., cultured) in the presence of ERK1/2 inhibitors (e.g., as exemplified here in below).
(146) According to some embodiments of the invention, the naive PSC maintains the naive state (as defined hereinabove) while being maintained (e.g., cultured) in the absence of TGFsignaling inhibition (e.g., in the absence of TGFi).
(147) According to some embodiments of the invention, the naive PSC maintains the naive state (as defined hereinabove) while being maintained (e.g., cultured) in the presence of TGFstimulation, e.g., in the presence of TGF1 and/or FGF2 stimulation.
(148) According to some embodiments of the invention, the naive PSC maintains the naive state (as defined hereinabove) while being maintained (e.g., cultured) in the presence of ERK1/2 inhibitors and in the presence of TGF1 stimulation (e.g., by addition of TGF1) and/or FGF2 stimulation.
(149) The phrase primed PSC or conventional PSC which are interchangeably used herein refers to a PSC which are known to date, e.g., human embryonic stem cells (hESC), human induced pluripotent stem cells (hiPSC), and human embryonic germ cells (hEGC), which are characterized by one methylated allele of XIST and one unmethylated allele of XIST in the female cell, and by one methylated allele in the male cell.
(150) As used herein the term isolated refers to at least partially separated from the natural environment e.g., from the primate (e.g., mammalian) embryo or the primate (e.g., mammalian) body.
(151) The phrase embryonic stem cells refers to embryonic cells which are capable of differentiating into cells of all three embryonic germ layers (i.e., endoderm, ectoderm and mesoderm), or remaining in an undifferentiated state. The phrase embryonic stem cells may comprise cells which are obtained from the embryonic tissue formed after gestation (e.g., blastocyst) before implantation of the embryo (i.e., a pre-implantation blastocyst), extended blastocyst cells (EBCs) which are obtained from a post-implantation/pre-gastrulation stage blastocyst (see WO2006/040763) and embryonic germ (EG) cells which are obtained from the genital tissue of a fetus any time during gestation, preferably before 10 weeks of gestation.
(152) Induced pluripotent stem cells (iPS; embryonic-like stem cells), are cells obtained by de-differentiation of adult somatic cells which are endowed with pluripotency (i.e., being capable of differentiating into the three embryonic germ cell layers, i.e., endoderm, ectoderm and mesoderm). According to some embodiments of the invention, such cells are obtained from a differentiated tissue (e.g., a somatic tissue such as skin) and undergo de-differentiation by genetic manipulation which re-program the cell to acquire embryonic stem cells characteristics. According to some embodiments of the invention, the induced pluripotent stem cells are formed by inducing the expression of Oct-4, Sox2, Kfl4 and c-Myc in a somatic stem cell.
(153) The embryonic stem cells of some embodiments of the invention can be obtained using well-known cell-culture methods. For example, human embryonic stem cells can be isolated from human blastocysts. Human blastocysts are typically obtained from human in vivo preimplantation embryos or from in vitro fertilized (IVF) embryos. Alternatively, a single cell human embryo can be expanded to the blastocyst stage. For the isolation of human ES cells the zona pellucida is removed from the blastocyst and the inner cell mass (ICM) is isolated by immunosurgery, in which the trophectoderm cells are lysed and removed from the intact ICM by gentle pipetting. The ICM is then plated in a tissue culture flask containing the appropriate medium which enables its outgrowth. Following 9 to 15 days, the ICM derived outgrowth is dissociated into clumps either by a mechanical dissociation or by an enzymatic degradation and the cells are then re-plated on a fresh tissue culture medium. Colonies demonstrating undifferentiated morphology are individually selected by micropipette, mechanically dissociated into clumps, and re-plated. Resulting ES cells are then routinely split every 4-7 days. For further details on methods of preparation human ES cells see Thomson et al., [U.S. Pat. No. 5,843,780; Science 282: 1145, 1998; Curr. Top. Dev. Biol. 38: 133, 1998; Proc. Natl. Acad. Sci. USA 92: 7844, 1995]; Bongso et al., [Hum Reprod 4: 706, 1989]; and Gardner et al., [Fertil. Steril. 69: 84, 1998].
(154) Another method for preparing ES cells is described in Chung et al., Cell Stem Cell, Volume 2, Issue 2, 113-117, 7 Feb. 2008. This method comprises removing a single cell from an embryo during an in vitro fertilization process. The embryo is not destroyed in this process.
(155) It will be appreciated that commercially available stem cells can also be used according to some embodiments of the invention. Human ES cells can be purchased from the NIH human embryonic stem cells registry [Hypertext Transfer Protocol://grants (dot) nih (dot) gov/stem_cells/registry/current (dot) htm]. Non-limiting examples of commercially available embryonic stem cell lines are BGO1, BG02, BG03, BG04, CY12, CY30, CY92, CY10, TE03, TE32, CHB-4, CHB-5, CHB-6, CHB-8, CHB-9, CHB-10, CHB-11, CHB-12, HUES 1, HUES 2, HUES 3, HUES 4, HUES 5, HUES 6, HUES 7, HUES 8, HUES 9, HUES 10, HUES 11, HUES 12, HUES 13, HUES 14, HUES 15, HUES 16, HUES 17, HUES 18, HUES 19, HUES 20, HUES 21, HUES 22, HUES 23, HUES 24, HUES 25, HUES 26, HUES 27, HUES 28, CyT49, RUES3, WA01, UCSF4, NYUES1, NYUES2, NYUES3, NYUES4, NYUES5, NYUES6, NYUES7, UCLA 1, UCLA 2, UCLA 3, WA077 (H7), WA09 (H9), WA13 (H13), WA14 (H14), HUES 62, HUES 63, HUES 64, CT1, CT2, CT3, CT4, MA135, Eneavour-2, WIBR1, WIBR2, WIBR3, WIBR4, WIBR5, WIBR6, HUES 45, Shef 3, Shef 6, BJNhem19, BJNhem20, SA001, SA001.
(156) In addition, ES cells can be obtained from other species as well, including mouse (Mills and Bradley, 2001), golden hamster [Doetschman et al., 1988, Dev Biol. 127: 224-7], rat [Iannaccone et al., 1994, Dev Biol. 163: 288-92] rabbit [Giles et al. 1993, Mol Reprod Dev. 36: 130-8; Graves & Moreadith, 1993, Mol Reprod Dev. 1993, 36: 424-33], several domestic animal species [Notarianni et al., 1991, J Reprod Fertil Suppl. 43: 255-60; Wheeler 1994, Reprod Fertil Dev. 6: 563-8; Mitalipova et al., 2001, Cloning. 3: 59-67] and non-human primate species (Rhesus monkey and marmoset) [Thomson et al., 1995, Proc Natl Acad Sci USA. 92: 7844-8; Thomson et al., 1996, Biol Reprod. 55: 254-9].
(157) Extended blastocyst cells (EBCs) can be obtained from a blastocyst of at least nine days post fertilization at a stage prior to gastrulation. Prior to culturing the blastocyst, the zona pellucida is digested [for example by Tyrode's acidic solution (Sigma Aldrich, St Louis, MO, USA)] so as to expose the inner cell mass. The blastocysts are then cultured as whole embryos for at least nine and no more than fourteen days post fertilization (i.e., prior to the gastrulation event) in vitro using standard embryonic stem cell culturing methods.
(158) EG cells are prepared from the primordial germ cells obtained from fetuses of about 8-11 weeks of gestation (in the case of a human fetus) using laboratory techniques known to anyone skilled in the arts. The genital ridges are dissociated and cut into small chunks which are thereafter disaggregated into cells by mechanical dissociation. The EG cells are then grown in tissue culture flasks with the appropriate medium. The cells are cultured with daily replacement of medium until a cell morphology consistent with EG cells is observed, typically after 7-30 days or 1-4 passages. For additional details on methods of preparation human EG cells see Shamblott et al., [Proc. Natl. Acad. Sci. USA 95: 13726, 1998] and U.S. Pat. No. 6,090,622.
(159) Induced pluripotent stem cells (iPS) (embryonic-like stem cells) can be generated from somatic cells by genetic manipulation of somatic cells, e.g., by retroviral transduction of somatic cells such as fibroblasts, hepatocytes, gastric epithelial cells with transcription factors such as Oct-3/4, Sox2, c-Myc, and KLF4 [Yamanaka S, Cell Stem Cell. 2007, 1(1):39-49; Aoi T, et al., Generation of Pluripotent Stem Cells from Adult Mouse Liver and Stomach Cells. Science. 2008 Feb 14. (Epub ahead of print); IH Park, Zhao R, West J A, et al. Reprogramming of human somatic cells to pluripotency with defined factors. Nature 2008; 451:141-146; K Takahashi, Tanabe K, Ohnuki M, et al. Induction of pluripotent stem cells from adult human fibroblasts by defined factors. Cell 2007; 131:861-872]. Other embryonic-like stem cells can be generated by nuclear transfer to oocytes, fusion with embryonic stem cells or nuclear transfer into zygotes if the recipient cells are arrested in mitosis.
(160) Chromosome X inactivation is an early developmental process in mammalian females that transcriptionally silences one of the pair of X chromosomes, thus providing dosage equivalence between males and females. The process is regulated by several factors, including a region of chromosome X called the X inactivation center (XIC). The XIC comprises several non-coding and protein-coding genes, and XIST gene was the first non-coding gene identified within the XIC.
(161) When XIST bodies are present, then XIST is exclusively expressed from the XIC of the inactive X chromosome, and is essential for the spread of X-inactivation.
(162) The methylation status of the XIST gene can be determined by various methods such as bisulfite sequencing [Lengner Cell 141, 872-883 (2010); Hanna et al., Cell 143, 508-525 (2010), each of which is fully incorporated herein by reference in its entirety] of the promoter region of the XIST gene. The XIST promoter region can be amplified by the following PCR primers: Forward primer (used on bisulfite treated DNA): 5-taa att tta aat taa tta aat tat (SEQ ID NO:22), and Reverse primer (used on bisulfite treated DNA): 5tgt ttt aga aag aat ttt aag tgt aga ga (SEQ ID NO:23). The amplicon region amplified by the above primers (203 bp covering human XIST transcription start site) is provided in SEQ ID NO:70. A representative result of such XIST bisulfite sequencing is shown in
(163) Following is a non-limiting description of a methylation specific PCR assay for the XIST gene. Bisulfite treatment of genomic DNA is performed with the EpiTect Bisulfite kit (Qiagen, Germany). Methylation-specific PCR (MS-PCR) utilizes this sodium bisulfite treatment to distinguish methylated from unmethylated DNA. Purified, non-methylated and methylated human DNA standards (for negative and positive controls in methylation detection application) include the Human Methylated & Non-methylated DNA set (Zymo Research, USA). Each sample is analyzed in two independent MS-PCR reactions. PCR reactions included 25 1 PCR reaction mix which contained 2X PCR HotStart Premix buffer (Takara, Tokyo, Japan), 0.5 M primer-M forward and 0.5 M primer-M reverse in the PCR reaction amplifying the methylated imprint specifically or 0.5 M primer-U forward and 0.5 M primer-U reverse in the unmethylated PCR, and 2 1 of bisulfite-modified DNA. Primer pairs for methylation and unmethylation specific PCR for XIST gene include: Unmethylation forward 5-TGTTTTTTTGTTTATTGGGGTTGTG (SEQ ID NO:21; M97168, 691-715), and Unmethylation reverse 5-ACAACTAACCTAAACCAAATTATACA (SEQ ID NO:67; M97168, 944-970); Methylation forward 5-TGTTTTTTTGTTTATCGGGGTCGCG (SEQ ID NO:68; M97168, 691-715) and Methylation reverse 5-CGAATTATACGACAAATCTAAAATAACG (SEQ ID NO:69; M97168, 927-954) can be used as described elsewhere (Kawakami T, et al., Lancet. 2004 Jan. 3; 363(9402):40-2. XIST unmethylated DNA fragments in male-derived plasma as a tumour marker for testicular cancer; which is fully incorporated herein by reference in its entirety), and with the following PCR conditions: The polymerase is activated at 95 C. for 5 minutes. DNA is amplified in 35 cycles at 94 C., 60 C., 72 C. for 45 seconds each, followed by a final extension at 72 C. for 5 minutes. The resulting PCR fragments are 264 bp (base pairs) for the methylated allele (M) and 280 bp for the unmethylated allele (U). PCR products are separated on a 2% agarose gel, stained with ethidium bromide and visualized under UV illumination.
(164) Additionally or alternatively, the methylation status of the XIST gene can be determined using Southern blot analyses using methylation-sensitive restriction enzymes and probes specific to the XIST gene (or CpG islands), essentially as described in Lengner Cell 141, 872-883 (2010); and Hanna et al., Cell 143, 508-525 (2010), each of which is fully incorporated herein by reference in its entirety. Following is a non-limiting description of a methylation assay which can be used to determine the methylation status of the XIST gene in a cell (TAKASHI SADO et al., DEVELOPMENTAL DYNAMICS 205: 421-434 (1996). Mosaic Methylation of Xist Gene Before Chromosome Inactivation in Undifferentiated Female Mouse Embryonic Stem and Embryonic Germ Cells; which is fully incorporated herein by reference in its entirety). Genomic DNA is prepared from the cells using known methods (e.g., Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Springs Harbor Laboratory, New York (1989, 1992)). Briefly, 10 g of DNA is digested with one of methylation sensitive enzymes (HpaII, CfoI, MZuI, SacII, and AuaI) in combination with EcoRI or EcoRI+ PuuII according to the manufacturers' recommendation. Digestion is carried out overnight with 10-fold excess of each enzyme in reaction volume of 300 l. Restricted DNA is purified by phenol extraction, precipitated with ethanol, electrophoresed on 1% or 2% agarose gel, blotted onto Hybond N+(Amersham, Buckinghamshire, UK), and probed by a cDNA fragment of Xist 5 portion (probe 1) or a genomic HpaI-MluI fragment of the 5 upstream region (probe 2) labeled by random priming. Subsequent washes are carried out in accordance with the membrane manufacturer's recommendation.
(165) Thus, the skilled in the art is capable of distinguishing between an unmethylated allele of XIST and a methylated allele of XIST, and thus can easily distinguish between a female cell having two unmethylated alleles of the XIST gene or a female cell having one methylated and one unmethylated allele of XIST. Similarly, the skilled in the art can easily distinguish between a male cell having a methylated XIST allele or a male cell having an unmethylated XIST allele.
(166) As mentioned, the isolated primate (e.g., human) naive PSC is in an undifferentiated and pluripotent state (capable of differentiating into all three embryonic germ layers).
(167) Primed human PSCs such as hiPSCs or hESCs are induced to differentiation upon incubation with bone morphogenetic protein 4 (BMP4), JNK inhibitor, and P38 inhibitor [Hanna et al., Cell 143, 508-525 (2010); De Los Angeles, et al., Curr. Opin. Genet. Dev. 22, 272-282 (2012)].
(168) Contrary to the known primed PSC, the naive PSC of some embodiments of the invention is resistant to induction of differentiation by BMP4, JNK inhibitor, and/or P38 inhibitor. Thus, as shown in
(169) According to some embodiments of the invention, when the isolated naive PSC is incubated in the presence of an agent selected from the group consisting of Bone morphogenetic protein 4 (BMP4), JNK inhibitor, and P38 inhibitor, the naive PSC remains in the pluripotent state.
(170) According to some embodiments of the invention, the naive PSC has an inhibited p38 pathway as compared to a primed PSC. For example, p38 activity is inhibited in the naive PSC.
(171) According to some embodiments of the invention, the level of p38 RNA and/or phosphorylated p38 protein in the naive PSC is less than about 30%, e.g., less than about 20%, e.g., less than about 5%, e.g., less than about 0.5%, e.g., less than about 0.1% as compared to the level of p38 RNA and/or phosphorylated p38 protein, respectively, in a non-naive PSC incubated and/or cultured under the same conditions, yet without being subject to p38 inhibition.
(172) According to some embodiments of the invention, the naive PSC has an inhibited JNK pathway as compared to a primed PSC. For example, JNK activity is inhibited in the naive PSC.
(173) According to some embodiments of the invention, the level of JNK RNA and/or phosphorylated JNK protein in the naive PSC is less than about 30%, e.g., less than about 20%, e.g., less than about 5%, e.g., less than about 0.5%, e.g., less than about 0.1% as compared to the level of JNK RNA and/or phosphorylated JNK protein, respectively, in a non-naive PSC incubated and/or cultured under the same conditions, yet without being subject to JNK inhibition.
(174) According to some embodiments of the invention, the naive PSC has an inhibited ROCK pathway as compared to a primed PSC. For example, ROCK activity is inhibited in the naive PSC.
(175) According to some embodiments of the invention, the level of ROCK RNA and/or phosphorylated ROCK protein in the naive PSC is less than about 30%, e.g., less than about 20%, e.g., less than about 5%, e.g., less than about 0.5%, e.g., less than about 0.1% as compared to the level of ROCK RNA and/or phosphorylated ROCK protein, respectively, in a non-naive PSC incubated and/or cultured under the same conditions, yet without being subject to ROCK inhibition.
(176) Monitoring the differentiation state of pluripotent stem cellsDuring the culturing step the pluripotent stem cells are further monitored for their differentiation state. Cell differentiation can be determined upon examination of cell or tissue-specific markers which are known to be indicative of differentiation. For example, primate PSCs may express the stage-specific embryonic antigen (SSEA) 4, the tumour-rejecting antigen (TRA)-1-60 and TRA-1-81. Undifferentiated pluripotent stem cells highly express SSEA4, TRA-1-60 and TRA-1-81 markers and down regulate their expression upon differentiation.
(177) Tissue/cell specific markers can be detected using immunological techniques well known in the art [Thomson J A et al., (1998). Science 282: 1145-7]. Examples include, but are not limited to, flow cytometry for membrane-bound markers, immunohistochemistry for extracellular and intracellular markers and enzymatic immunoassay, for secreted molecular markers.
(178) Determination of PSC differentiation can also be effected via measurements of alkaline phosphatase activity. Undifferentiated human ES cells have alkaline phosphatase activity which can be detected by fixing the cells with 4% paraformaldehyde and developing with the Vector Red substrate kit according to manufacturer's instructions (Vector Laboratories, Burlingame, California, USA).
(179) According to an aspect of some embodiments of the invention, there is provided an isolated population of naive PSCs comprising at least about 10%, at least about 12%, at least about 14%, at least about 16%, at least about 18%, at least about 20%, at least about 22%, at least about 24%, at least about 26%, at least about 28%, at least about 30%, at least about 32%, at least about 34%, at least about 36%, at least about 38%, at least about 40%, at least about 42%, at least about 44%, at least about 46%, at least about 48%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, e.g., 100% of the isolated human naive PSC cells of some embodiments of the invention.
(180) According to a specific embodiment of the invention the isolated population of cells is positive for one or more markers. Positive is also abbreviated by (+). Positive for a marker means that at least about 70%, 80%, 85%, 90%, 95%, or 100% of the cells in the population present detectable levels of the marker (e.g., OCT4, NANOG, TRA1-81, TRA1-60, SSEA3, SSEA4) assayed by a method known to those of skill in the art [e.g., fluorescent activated cell sorter (FACS) analysis, immunofluorescence, immunohistochemistry, Western blot analysis]. Thus, for example, the cells stain positively with anti SSEA3 antibody as determined using FACS or stained positive by immunofluorescence or immunohistochemistry using the OCT4 antibody. The OCT4, NANOG, TRA1-81, TRA1-60, SSEA3, SSEA4-positive cells according to this embodiment, stain negatively to one or more markers, e.g., SSEA1. Negative is also abbreviated by (). Negative for a marker means that no more than about 30%, no more than about 25%, no more than about 20%, no more than about 15%, no more than about 10%, no more than about 5%, no more than about 4%, no more than about 3%, no more than about 2%, no more than about 1%, of the cells in the population present detectable levels of the marker (e.g., SSEA1) assayed by a method known to those of skill in the art such as immunofluorescence or FACS. Such a marker presentation either of a single cell or an isolated population of cells is also referred to as a signature.
(181) As shown in
(182) According to some embodiments of the invention, the naive PSC expresses XIST.
(183) Methods of detecting XIST expression are known in the art and include for example reverse transcriptasepolymerase chain reaction (RT-PCR) analysis using XIST specific PCR primers, e.g., the forward primer: 5-AGGGAGCAGTTTGCCCTACT (SEQ ID NO:24), and the reverse primer: 5-CACATGCAGCGTGGTATCTT (SEQ ID NO: 25), as shown in
(184) According to some embodiments of the invention, the naive PSC is devoid of XIST bodies.
(185) As used herein the phrase XIST bodies refers to a XIST-coated inactive X chromosome.
(186) Methods of detecting XIST bodies are known in the art and include for example RNA fluorescent in situ hybridization. RNA fluorescence in situ hybridization (FISH) is carried out as previously described [Hanna J., et al., Cell 143, 508-525]. Briefly, human pluripotent stem cells are harvested, MEF-depleted, and cytospun onto glass slides before fixation. cDNA probes are generated to XIST exon 1 (GenBank Accession No. U80460: 61251-69449, SEQ ID NO:26) and exon 6 (GenBank Accession No. U80460: 75081-78658, SEQ ID NO:27) and labeled by nick translation (Roche) with Cy3dUTP (Amersham), and Cot-1 DNA is labeled with fluorescein12-dUTP using the Prime-It Fluor Labeling Kit (Stratagene).
(187) According to some embodiments of the invention, the naive PSC is devoid of an H3K27me3/polycomb focus.
(188) As used herein the phrase H3K27me3/polycomb focus refers to nuclear focus obtained following immuno-staining that corresponds to condensed inactive X chromosome.
(189) Methods of detecting H3K27me3/polycomb focus are known in the art and include for example, the use of immuno-fluorescence analysis using anti H3K27me3 antibodies (e.g., Rabbit anti H3K27me3, Millipore, CA, USA Catalogue number 07-449), as shown for example in
(190) According to some embodiments of the invention, the naive PSC has a low XIST expression level while being in the naive state, without inactivation of any of the X chromosomes and without presence of XIST bodies.
(191) According to some embodiments of the invention, the naive PSC is capable of X-inactivation when induced to differentiate.
(192) According to some embodiments of the invention, the naive PSC is capable of differentiation into the endodermal, mesodermal and ectodermal embryonic germ layers. Methods of determining ability of stem cells to differentiate into the endodermal, mesodermal and ectodermal embryonic germ layers include for example generation of embryoid bodies (in vitro) or teratomas (in vivo) as shown in the Examples section which follows and in Figures such as 12L-12N, 13K-13M, 13S-13U, 19A-19I, and 20A-20T.
(193) As used herein the phrase embryoid bodies (EBs) refers to three dimensional multicellular aggregates of differentiated and undifferentiated cells derivatives of three embryonic germ layers.
(194) Embryoid bodies are formed upon the removal of the naive PSCs from feeder layers or feeder cells-free culture systems. Naive PSCs removal can be performed using type IV Collagenase treatment or Trypsin for a limited time. Following dissociation from the culturing surface, the cells are transferred to tissue culture plates containing a culture medium supplemented with serum and amino acids.
(195) During the culturing period, EBs are further monitored for their differentiation state. Cell differentiation can be determined upon examination of cell or tissue-specific markers which are known to be indicative of differentiation. For example, EB-derived-differentiated cells may express the neurofilament 68 .sup.KD which is a characteristic marker of the ectoderm cell lineage.
(196) The differentiation level of the EB cells can be monitored by following the loss of expression of Oct-4, and the increased expression level of other markers such as a-fetoprotein, NF-68 kDa, a-cardiac and albumin. Methods useful for monitoring the expression level of specific genes are well known in the art and include RT-PCR, semi-quantitative RT-PCR, Northern blot, RNA in situ hybridization, Western blot analysis and immunohistochemistry.
(197) Teratomas: The pluripotent capacity of the naive PSCs of some embodiments of the invention can also be confirmed by injecting cells into SCID mice [Evans MJ and Kaufman M (1983). Pluripotential cells grown directly from normal mouse embryos. Cancer Surv. 2: 185-208], which upon injection form teratomas. Teratomas are fixed using 4% paraformaldehyde and histologically examined for the three germ layers (i.e., endoderm, mesoderm and ectoderm).
(198) In addition to monitoring a differentiation state, the naive PSCs are often also being monitored for karyotype, in order to verify cytological euploidity, wherein all chromosomes are present and not detectably altered during culturing. Cultured naive PSCs can be karyotyped using a standard Giemsa staining and compared to published karyotypes of the corresponding species.
(199) According to some embodiments of the invention, the naive PSC is capable of being maintained in the undifferentiated and pluripotent state, while maintaining the naive state (as defined above) for more than about 20 passages in culture, e.g., for at least about 25, about 30, about 35, about 40, about 45, about 50, about 55, about 60, about 65, about 70, about 75 and about 80 passages while in culture.
(200) According to some embodiments of the invention, the naive PSC which is maintained in the undifferentiated, pluripotent and naive state (as defined above), expresses significantly lower levels SOX1 as compared to the level of expression present in primed PSC (e.g., primed ESC) under identical SOX1 assay conditions, and wherein the primed PSC exhibits one methylated and one unmethylated allele of XIST (in a female cell) or one methylated allele of XIST (in a male cell); expresses XIST; exhibits XIST bodies; and exhibits a H3K27me3/polycomb focus.
(201) According to some embodiments of the invention, the naive PSC expresses a lower level of MHC class I as compared to a primed PSC under identical detection assay conditions, and wherein the primed PSC exhibits one methylated and one unmethylated allele of XIST (in a female cell) or one methylated allele of XIST (in a male cell); expresses XIST; exhibits XIST bodies; and exhibits a H3K27me3/polycomb focus.
(202) The level of MHC class I can be determined by various methods known in the art such as FACS analysis using specific antibodies to detect the surface expression of the MHC class I molecules (e.g., see
(203) According to some embodiments of the invention, the naive PSC is characterized by at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90% more RNA polymerase II pausing on chromosomes as compared to a primed PSC under identical assay conditions, and wherein the primed PSC exhibits one methylated and one unmethylated allele of XIST (in a female cell) or one methylated allele of XIST (in a male cell); expresses XIST; exhibits XIST bodies; and exhibits a H3K27me3/polycomb focus.
(204) According to some embodiments of the invention, the naive PSC exhibiting a pre-X inactivation status similar to the pre-X inactivation status of a human Inner cell mass (ICM).
(205) According to an aspect of some embodiments of the invention, there is provided a cell culture comprising the isolated naive PSC of some embodiments of the invention, or the isolated population of naive PSCs of some embodiments of the invention and a culture medium.
(206) According to some embodiments of the invention, the culture medium is capable of maintaining the naive PSC in an undifferentiated and pluripotent state for at least 10 passages.
(207) The cell culture can be maintained in vitro, under culturing conditions, in which the cells are being passaged for extended periods of time (e.g., for at least 20 passages, e.g., at least about 30, 40, 50, 60, 70, 80, 90, 100 passages or more), while maintaining the cells in their naive pluripotent and undifferentiated state.
(208) As used herein the phrase culture medium refers to a solid or a liquid substance used to support the growth of stem cells and maintain them in an undifferentiated state. Preferably, the phrase culture medium as used herein refers to a liquid substance capable of maintaining the stem cells in an undifferentiated state.
(209) The culture medium used by the present invention can be a water-based medium which includes a combination of substances such as salts, nutrients, minerals, vitamins, amino acids, nucleic acids, proteins such as cytokines, growth factors and hormones, all of which are needed for cell proliferation and are capable of maintaining the stem cells in an undifferentiated state. For example, a culture medium can be a synthetic tissue culture medium such as Ko-DMEM (Gibco-Invitrogen Corporation products, Grand Island, NY, USA), DMEM/F12 (Gibco-Invitrogen Corporation products, Grand Island, NY, USA), or DMEM/F12 (Biological Industries, Biet Haemek, Israel), supplemented with the necessary additives as is further described hereinunder. Preferably, all ingredients included in the culture medium of the present invention are substantially pure, with a tissue culture grade.
(210) The present inventors have identified a novel culture medium which can be used to generate naive PSC and maintain them in a pluripotent and undifferentiated state. Thus, as shown in
(211) According an aspect of some embodiments of the invention, there is provided a culture medium comprising an ERK1/2 inhibitor, a GSK3 inhibitor, a p38 inhibitor, a JNK inhibitor, a STAT3 activator and at least one agent selected from the group consisting of: basic fibroblast growth factor (bFGF), transforming growth factor beta 1 (TGF1), a protein kinase C (PKC) inhibitor, a ROCK inhibitor and a NOTCH inhibitor.
(212) According an aspect of some embodiments of the invention, there is provided a culture medium comprising an ERK1/2 inhibitor, a GSK3 inhibitor, a p38 inhibitor, a JNK inhibitor, a STAT3 activator and at least one agent selected from the group consisting of: a transforming growth factor receptor (TGFR) inhibitor, a fibroblast growth factor receptor (FGFR) inhibitor, a protein kinase C (PKC) inhibitor, a ROCK inhibitor and a NOTCH inhibitor.
(213) As used herein the term STAT3 refers to the signal transducer and activator of transcription 3 gene product (acute-phase response factor) (Gene ID 6774). In response to cytokines and growth factors, STAT family members are phosphorylated by the receptor associated kinases, and then form homo- or heterodimers that translocate to the cell nucleus where they act as transcription activators. Known STAT3 activators include, but are not limited to, interferon (IFN), epidermal growth factor (EGF), interleukin 5 (IL5), interleukin 6 (IL6), hepatocyte growth factor (HGF), leukemia inhibitory factor (LIF) and bone morphogenetic protein 2 (BMP2).
(214) According to some embodiments of the invention, the STAT3 activator, which is used by the medium, cells and/or methods of some embodiments of the invention is selected from the group consisting of LIF, IL6 and EGF.
(215) According to some embodiments of the invention, the STAT3 activator, which is used by the medium, cells and/or methods of some embodiments of the invention is selected from the group consisting of LIF, and IL6.
(216) According to some embodiments of the invention, the STAT3 activator, which is used by the medium, cells and/or methods of some embodiments of the invention is LIF.
(217) According to some embodiments of the invention, the culture medium further comprising at least one additional agent selected from the group consisting of: insulin-like growth factor 1 (IGF1), insulin-like growth factor II (IGFII), a bone morphogenetic protein (BMP) signaling inhibitor, a Sonic Hedgehog pathway (SHH) inhibitor, an ERK5 inhibitor, Forskolin, Kenpaullone, BayK8644, Bix1294, and stem cell factor (SCF).
(218) According to some embodiments of the invention, the culture medium further comprising at least one additional agent selected from the group consisting of: insulin-like growth factor 1 (IGF1), insulin-like growth factor II (IGFII), bone morphogenetic protein 4 (BMP4), a Sonic Hedgehog pathway (SHH) inhibitor, an ERK5 inhibitor, Forskolin, Kenpaullone, BayK8644, Bix1294, and stem cell factor (SCF).
(219) According to some embodiments of the invention, the STAT3 activator comprises the LIF, and wherein the at least one agent comprises the PKC inhibitor.
(220) According to some embodiments of the invention, the culture medium further comprising FGFR inhibitor.
(221) According to some embodiments of the invention, the culture medium further comprising TGFR inhibitor.
(222) According to some embodiments of the invention, the STAT3 activator comprises the LIF and wherein the at least one agent comprises the TGF1 and the protein kinase C inhibitor.
(223) According to some embodiments of the invention, the culture medium further comprising an FGFR inhibitor.
(224) According to some embodiments of the invention, the STAT3 activator comprises the LIF, and wherein the at least one agent comprises the bFGF and the TGF1.
(225) According to some embodiments of the invention, the culture medium further comprising a ROCK inhibitor.
(226) According to some embodiments of the invention, the culture medium further comprising a protein kinase C inhibitor.
(227) According to some embodiments of the invention, the STAT3 activator comprises the LIF and wherein the at least one agent comprises the bFGF, the ROCK inhibitor, a bone morphogenetic protein (BMP) inhibitor, the NOTCH inhibitor, and a transforming growth factor receptor (TGFR) inhibitor.
(228) According to some embodiments of the invention, the culture medium further comprising a Sonic Hedgehog pathway (SHH) inhibitor.
(229) According to some embodiments of the invention, the STAT3 activator comprises the LIF and wherein the at least one agent comprises the NOTCH inhibitor, and a fibroblast growth factor receptor (FGFR) inhibitor.
(230) According to some embodiments of the invention, the culture medium further comprises an agent selected from the group consisting of insulin-like growth factor II (IGFII), stem cell factor (SCF) and transforming growth factor beta 1 (TGF1).
(231) According to some embodiments of the invention, the culture medium comprising leukemia inhibitor factor (LIF), an ERK1/2 inhibitor, a GSK3b inhibitor, a p38 inhibitor, a JNK inhibitor, and a protein kinase C inhibitor.
(232) According to some embodiments of the invention, the culture medium further comprising a fibroblast growth factor receptor (FGFR) inhibitor (FGFRi).
(233) According to some embodiments of the invention, the culture medium further comprising a transforming growth factor receptor inhibitor (TGFRi).
(234) According to some embodiments of the invention, the culture medium which comprises leukemia inhibitor factor (LIF), an ERK1/2 inhibitor, a GSK3b inhibitor, a p.sup.38 inhibitor, a JNK inhibitor, and a protein kinase C inhibitor, further comprises a fibroblast growth factor receptor (FGFR) inhibitor (FGFRi).
(235) According to some embodiments of the invention, the culture medium which comprises leukemia inhibitor factor (LIF), an ERK1/2 inhibitor, a GSK3b inhibitor, a p38 inhibitor, a JNK inhibitor, and a protein kinase C inhibitor, further comprises a transforming growth factor receptor inhibitor (TGFRi).
(236) According to some embodiments of the invention, the culture medium which comprises leukemia inhibitor factor (LIF), an ERK1/2 inhibitor, a GSK3b inhibitor, a p38 inhibitor, a JNK inhibitor, and a protein kinase C inhibitor, further comprises a fibroblast growth factor receptor (FGFR) inhibitor (FGFRi) and a transforming growth factor receptor inhibitor (TGFRi).
(237) According to some embodiments of the invention, the culture medium comprising leukemia inhibitor factor (LIF), an ERK1/2 inhibitor, a GSK3b inhibitor, a p38 inhibitor, a JNK inhibitor, TGF1 and a protein kinase C inhibitor.
(238) According to some embodiments of the invention, medium which comprises leukemia inhibitor factor (LIF), an ERK1/2 inhibitor, a GSK3b inhibitor, a p38 inhibitor, a JNK inhibitor, TGF31 and a protein kinase C inhibitor further comprising FGFR inhibitor (FGFRi).
(239) According to some embodiments of the invention, the culture medium comprising leukemia inhibitor factor (LIF), an ERK1/2 inhibitor, a GSK3b inhibitor, a p38 inhibitor, a JNK inhibitor, basic fibroblast growth factor (bFGF) and transforming growth factor-beta 1 (TGF1).
(240) As used herein the term leukemia inhibitor factor (LIF) refers to a polypeptide which comprises the amino acid sequence as set forth by GenBank Accession No. NP_001244064.1 (SEQ ID NO:119), encoded by the nucleotide sequence set forth in GenBank Accession No. NM_001257135 (SEQ ID NO:30).
(241) Preferably, the LIF used by the method according to some embodiments of the invention is capable of supporting, along with other factors which are described herein, the undifferentiated growth of naive primate (e.g., human) PSCs, while maintaining their pluripotent capacity. LIF can be obtained from various manufacturers such as Millipore, Peprotech, and R&D systems.
(242) According to some embodiments of the invention, LIF is provided at a concentration range from about 0.5 nanogram per milliliter (ng/ml) to about 1000 ng/ml, e.g., about 1-1000 ng/ml, e.g., about 1-900 ng/ml, e.g., about 1-800 ng/ml, e.g., about 1-700 ng/ml, e.g., about 1-600 ng/ml, e.g., about 1-500 ng/ml, e.g., about 1-400 ng/ml, e.g., about 1-300 ng/ml, e.g., about 1-200 ng/ml, e.g., about 1-100 ng/ml, e.g., about 1-50 ng/ml, e.g., about 2-50 ng/ml, e.g., about 4-50 ng/ml, e.g., about 5-50 ng/ml, e.g., about 10-50 ng/ml, e.g., about 10-40 ng/ml, e.g., about 10-30 ng/ml, e.g., about 20 ng/ml.
(243) As used herein the term interleukin 6 (IL6) refers to a polypeptide which comprises the amino acid sequence set forth by GenBank Accession No. NP_000591.1 (SEQ ID NO: 120), which is encoded by the nucleic acid set forth by GenBank Accession No. NM_000600.3 (SEQ ID NO: 111). Preferably, the IL6 used by the method according to some embodiments of the invention is capable of supporting, along with other factors which are described herein, the undifferentiated growth of naive primate (e.g., human) PSCs, while maintaining their pluripotent capacity. IL6 can be obtained from various manufacturers such as Speed BioSystems, Millipore, Peprotech, and R&D systems.
(244) According to some embodiments of the invention, IL6 is provided at a concentration range from about 0.1 ng/ml to about 100 ng/ml, e.g., about 0.1-90 ng/ml, e.g., about 0.1-80 ng/ml, e.g., about 0.1-70 ng/ml, e.g., about 0.1-50 ng/ml, e.g., about 0.1-40 ng/ml, e.g., about 0.1-30 ng/ml, e.g., about 0.1-20 ng/ml, e.g., about 0.1-10 ng/ml, e.g., about 0.1-8 ng/ml, e.g., about 0.1-7 ng/ml, e.g., about 0.1-6 ng/ml, e.g., about 0.1-5 ng/ml, e.g., about 0.1-4 ng/ml, e.g., about 0.1-3 ng/ml, e.g., about 0.1-4 ng/ml, e.g., about 0.5-4 ng/ml, e.g., about 0.5-4 ng/ml, e.g., about 3 ng/ml.
(245) As used herein the phrase TGF1 refers to an isoform beta-1 (1) of the transforming growth factor beta (e.g., Homo sapiens TGF.sub.1, GenBank Accession No. NP_000651; SEQ ID NO:28, which is encoded by the sequence depicted in GenBank Accession No. NM_000660.5; SEQ ID NO:31). TGFacts in inducing transformation and also acts as a negative autocrine growth factor. TGF1 isoform can be obtained from various commercial sources such as R&D Systems Minneapolis MN, USA.
(246) According to some embodiments of the invention, TGF31 is provided at a concentration range from about 0.1 nanogram per milliliter (ng/ml) to about 500 ng/ml, e.g., about 0.1-400 ng/ml, e.g., about 0.1-300 ng/ml, e.g., about 0.1-200 ng/ml, e.g., about 0.1-100 ng/ml, e.g., about 0.1-50 ng/ml, e.g., about 0.1-30 ng/ml, e.g., about 0.1-20 ng/ml, e.g., about 0.1-10 ng/ml, e.g., about 0.1-8 ng/ml, e.g., about 0.1-7 ng/ml, e.g., about 0.1-6 ng/ml, e.g., about 0.1-5 ng/ml, e.g., about 0.1-4 ng/ml, e.g., about 0.1-3 ng/ml, e.g., about 0.1-2 ng/ml, e.g., about 0.5-2 ng/ml, e.g., about 0.5-1.5 ng/ml, e.g., about 1 ng/ml.
(247) According to some embodiments of the invention, activators of TGF/ACTIVIN pathway including ACTIVIN A (also known as Inhibin beta A, INHBA, Gene ID: 3624; GenBank Accession No. NM_002192.2 (SEQ ID NO:123), which encodes GenBank Accession No. NP_002183.1; SEQ ID NO:117) can be used to replace TGF1.
(248) According to some embodiments of the invention, the TGF1 cytokine can be replaced with recombinant Nodal and/or Activin.
(249) The phrases basic fibroblast growth factor (bFGF) or FGF2 which are interchangeably used herein refer to a polypeptide of the fibroblast growth factor (FGF) family, which bind heparin and possess broad mitogenic and angiogenic activities. The mRNA for the BFGF gene contains multiple polyadenylation sites, and is alternatively translated from non-AUG (CUG) and AUG initiation codons, resulting in five different isoforms with distinct properties. The CUG-initiated isoforms are localized in the nucleus and are responsible for the intracrine effect, whereas, the AUG-initiated form is mostly cytosolic and is responsible for the paracrine and autocrine effects of this FGF. According to some embodiments of the invention, the bFGF used by the medium of some embodiments of the invention is provided in GenBank Accession No. NP_001997 (SEQ ID NO:29). BFGF can be obtained from various manufacturers such as Peprotech, RnD systems, Millipore. According to some embodiments of the invention, the bFGF used by the medium of some embodiments of the invention is provided from R&D Systems (Catalog Number: 233-FB).
(250) According to some embodiments of the invention, bFGF is provided at a concentration range from about 0.5 nanogram per milliliter (ng/ml) to about 500 ng/ml, e.g., about 1-500 ng/ml, e.g., about 1-400 ng/ml, e.g., about 1-300 ng/ml, e.g., about 1-200 ng/ml, e.g., about 1-100 ng/ml, e.g., about 1-80 ng/ml, e.g., about 1-70 ng/ml, e.g., about 1-70 ng/ml, e.g., about 1-60 ng/ml, e.g., about 1-50 ng/ml, e.g., about 1-40 ng/ml, e.g., about 1-30 ng/ml, e.g., about 1-20 ng/ml, e.g., about 2-20 ng/ml, e.g., about 2-10 ng/ml, e.g., about 3-10 ng/ml, e.g., about 4-10 ng/ml, e.g., about 8 ng/ml.
(251) It will be appreciated that any of the proteinaceous factors used in the culture medium of some embodiments of the invention (e.g., the LIF, IL6, TGF1, or bFGF) can be recombinantly expressed or biochemically synthesized. In addition, naturally occurring proteinaceous factors such as bFGF and TGFcan be purified from biological samples (e.g., from human serum, cell cultures) using methods well known in the art.
(252) Biochemical synthesis of the proteinaceous factors of the present invention (e.g., the LIF, IL6, TGF1, or bFGF) can be performed using standard solid phase techniques. These methods include exclusive solid phase synthesis, partial solid phase synthesis methods, fragment condensation and classical solution synthesis.
(253) Recombinant expression of the proteinaceous factors of the present invention (e.g., the LIF, IL6, TGF1, or bFGF) can be generated using recombinant techniques such as described by Bitter et al., (1987) Methods in Enzymol. 153:516-544, Studier et al. (1990) Methods in Enzymol. 185:60-89, Brisson et al. (1984) Nature 310:511-514, Takamatsu et al. (1987) EMBO J. 6:307-311, Coruzzi et al. (1984) EMBO J. 3:1671-1680, Brogli et al., (1984) Science 224:838-843, Gurley et al. (1986) Mol. Cell. Biol. 6:559-565 and Weissbach & Weissbach, 1988, Methods for Plant Molecular Biology, Academic Press, NY, Section VIII, pp 421-463.
(254) For example, to generate the LIF, IL6, TGF1, or bFGF, a polynucleotide sequence encoding the LIF, IL6, TGF1, or bFGF [e.g., the polynucleotide set forth by SEQ ID NO: 30 (LIF, GenBank Accession No. NM_001257135), SEQ ID NO: 31 (TGF1, GenBank Accession NO. NM_000660), SEQ ID NO: 32 (BFGF, GenBank Accession NO. NM_002006), SEQ ID NO:111 (IL6, GenBank Accession No. NM_000600.3)] is preferably ligated into a nucleic acid construct suitable for expression in a host cell [i.e., a cell in which the polynucleotide encoding the polypeptide-of-choice (e.g., the LIF, IL6, TGF1, or bFGF) is expressed]. Preferably, to generate an LIF, IL6, TGF1, or bFGF with the amount and pattern of glycosylation as of the naturally occurring LIF, IL6, TGF1, or bFGF, the host cell employed is a eukaryotic host cell, more preferably a mammalian host cell such as human cell or CHO cell). Additional description of nucleic acid constructs (or expression vectors) which can be used to produce a polypeptide-of-interest (e.g., the proteinaceous factors described above) is provided hereinunder.
(255) As used herein the term ERK1 refers to the mitogen-activated protein kinase 3 (MAPK3) isoform 1 set forth by GenBank Accession No. NP_002737.2 (SEQ ID NO:33), the MAPK3 isoform 2 set forth by GenBank Accession No. NP_001035145.1 (SEQ ID NO:34), the MAPK3 isoform 3 set forth by GenBank Accession No. NP_001103361.1 (SEQ ID NO:35) and/or ERK1 set forth in GenBank Accession No. M84490 (SEQ ID NO:36) having the MAPK signaling activity.
(256) As used herein the term ERK2 refers to the mitogen-activated protein kinase 1 (MAPK1) set forth by GenBank Accession No. NP_002736.3 (SEQ ID NO:37) and/or GenBank Accession No. NP_620407.1 (SEQ ID NO:38) having the MAPK signaling activity.
(257) As used herein the term ERK1/2 inhibitor refers to any molecule capable of inhibiting the activity of ERK1/2 as determined by Western blot protein detection of phosphorylated ERK1/2 proteins.
(258) Non-limiting examples of ERK1/2 inhibitors include PD0325901 (AXONMEDCHEMAXON 1408), PD98059 (AXONMEDCHEMAxon 1223), and PD184352 (AXONMEDCHEMAXON 1368); or even inhibitors of RAF (which is upstream of ERK) such as Sorafenib or SB (AXONMEDCHEM -AXON 1397).
(259) According to some embodiments of the invention, PD0325901 is provided at a concentration range from about 0.01 micro M (M) to about 50 M, e.g., between about 0.05-45 M, e.g., between about 0.1-50 M, e.g., between about 0.1-45 M, e.g., between about 0.1-40 M, e.g., between about 0.1-35 M, e.g., between about 0.1-30 M, e.g., between about 0.1-25 M, e.g., between about 0.1-20 M, e.g., between about 0.1-15 M, e.g., between about 0.1-10 M, e.g., between about 0.2-10 M, e.g., between about 0.3-10 M, e.g., between about 0.4-10 M, e.g., between about 0.5-10 M, e.g., between about 0.6-10 M, e.g., between about 0.7-10 M, e.g., between 0.8-10 M, e.g., between 0.9-10 M, e.g., between 0.9-9 M, e.g., between 0.9-8 M, e.g., between 0.9-7 M, e.g., between 0.9-6 M, e.g., between 0.8-5 M, e.g., between 0.8-4 M, e.g., between 0.8-3 M, e.g., between 0.8-2 M, e.g., between 0.8-1.5 M, e.g., between 0.9-1.2 M, e.g., about 1 M.
(260) According to some embodiments of the invention, PD98059 is provided at a concentration range from about 0.1 micro M (M) to about 70 M, e.g., between about 0.1-65 M, e.g., between about 0.1-55 M, e.g., between about 0.1-50 M, e.g., between about 0.1-45 M, e.g., between about 0.1-40 M, e.g., between about 0.1-35 M, e.g., between about 0.1-30 M, e.g., between about 0.1-25 M, e.g., between about 0.1-20 M, e.g., between about 0.1-15 M, e.g., between about 2-20 M, e.g., between about 5-15 M, e.g., about 10 M, e.g., between about 0.1-10 M, e.g., between about 0.2-10 M, e.g., between about 0.3-10 M, e.g., between about 0.4-10 M, e.g., between about 0.5-10 M, e.g., between about 0.6-10 M, e.g., between about 0.7-10 M, e.g., between 0.8-10 M, e.g., between 0.9-10 M, e.g., between 0.9-9 M, e.g., between 0.9-8 M, e.g., between 0.9-7 M, e.g., between 0.9-6 M, e.g., between 0.8-5 M, e.g., between 0.8-4 M, e.g., between 0.8-3 M, e.g., between 0.8-2 M, e.g., between 0.8-1.5 M, e.g., between 0.9-1.2 M.
(261) According to some embodiments of the invention, PD184352 is provided at a concentration range from about 0.1 micro M (M) to about 70 M, e.g., between about 0.1-60 M, e.g., between about 0.1-50 M, e.g., between about 0.5-50 M, e.g., between about 0.5-45 M, e.g., between about 0.5-40 M, e.g., between about 0.1-35 M, e.g., between about 0.5-30 M, e.g., between about 0.5-25 M, e.g., between about 0.5-20 M, e.g., between about 0.5-15 M, e.g., between about 0.5-10 M, e.g., between 0.5-9 M, e.g., between 0.5-8 M, e.g., between 0.5-7 M, e.g., between 0.9-6 M, e.g., between 0.8-5 M, e.g., between 0.8-4 M, e.g., between 0.8-3 M, e.g., about 3 M. e.g., between 0.8-2 M, e.g., between 0.8-1.5 M, e.g., between 0.9-1.2 M.
(262) According to some embodiments of the invention, Sorafenib is provided at a concentration range from about 0.1 micro M (M) to about 70 M, e.g., between about 0.1-60 M, e.g., between about 0.1-50 M, e.g., between about 0.5-50 M, e.g., between about 0.5-45 M, e.g., between about 0.5-40 M, e.g., between about 0.1-35 M, e.g., between about 0.5-30 M, e.g., between about 0.5-25 M, e.g., between about 0.5-20 M, e.g., between about 0.5-15 M, e.g., between about 0.5-10 M, e.g., between 0.5-9 M, e.g., between 0.5-8 M, e.g., between 0.5-7 M, e.g., between 0.9-6 M, e.g., between 0.8-5 M, e.g., about 5 M, e.g., between 0.8-4 M, e.g., between 0.8-3 M, e.g., between 0.8-2 M, e.g., between 0.8-1.5 M, e.g., between 0.9-1.2 M.
(263) As used herein the term GSK3b refers to the glycogen synthase kinase 3 beta protein set forth by GenBank Accession Nos. NP_002084.2 (SEQ ID NO: 121) and/or NP_001139628.1 (SEQ ID NO: 122) having the WNT signaling regulatory activity via its kinase activity.
(264) As used herein the term GSK3b inhibitor refers to any molecule capable of inhibiting the activity of GSK3b as determined by specifically inhibiting levels of phosphorylated GSK3b (out of total GSK3b present in a cell).
(265) Non-limiting examples of GSK3b inhibitors include CHIR99021 (AXONMEDCHEMAXON 1386), BIO (AXONMEDCHEMAxon 1693), and Kenpaullone (TOCRIScat no. 1398).
(266) According to some embodiments of the invention, CHIR99021 is provided at a concentration range of between about 0.1-50 M, e.g., from about 0.2 M to about 50 M, e.g., between about 0.2-45 M, e.g., between about 0.2-50 M, e.g., between about 0.2-45 M, e.g., between about 0.2-40 M, e.g., between about 0.2-35 M, e.g., between about 0.2-30 M, e.g., between about 0.2-25 M, e.g., between about 0.2-20 M, e.g., between about 0.2-15 M, e.g., between about 0.2-10 M, e.g., between about 0.2-10 M, e.g., between about 0.3-10 M, e.g., between about 0.4-10 M, e.g., between about 0.5-10 M, e.g., between about 0.6-10 M, e.g., between about 0.7-10 M, e.g., between 0.8-10 M, e.g., between 0.9-10 M, e.g., between 0.9-9 M, e.g., between 1-8 M, e.g., between 1-7 M, e.g., between 1-6 M, e.g., between 1-5 M, e.g., between 2-4 M, e.g., about 3 M.
(267) According to some embodiments of the invention, BIO is provided at a concentration range of between about 0.1-70 M, e.g., from about 0.2 M to about 70 M, e.g., between about 0.2-60 M, e.g., between about 0.2-55 M, e.g., between about 0.2-50 M, e.g., between about 0.2-45 M, e.g., between about 0.2-40 M, e.g., between about 0.2-35 M, e.g., between about 0.2-30 M, e.g., between about 0.2-25 M, e.g., between about 0.2-20 M, e.g., between about 0.2-15 M, e.g., between about 0.2-10 M, e.g., between about 0.3-10 M, e.g., between about 0.4-10 M, e.g., between about 0.5-10 M, e.g., between about 0.6-10 M, e.g., between about 0.7-10 M, e.g., between 0.8-10 M, e.g., between 0.9-10 M, e.g., between 0.9-9 M, e.g., between 1-8 M, e.g., between 1-7 M, e.g., between 1-6 M, e.g., between 1-5 M, e.g., about 5 M, e.g., between 2-4 M.
(268) According to some embodiments of the invention, Kenpaullone is provided at a concentration range of between about 0.1-70 M, e.g., from about 0.2 M to about 70 M, e.g., between about 0.2-60 M, e.g., between about 0.2-55 M, e.g., between about 0.2-50 M, e.g., between about 0.2-45 M, e.g., between about 0.2-40 M, e.g., between about 0.2-35 M, e.g., between about 0.2-30 M, e.g., between about 0.2-25 M, e.g., between about 0.2-20 M, e.g., between about 0.2-15 M, e.g., between about 0.2-10 M, e.g., between about 0.3-10 M, e.g., between about 0.4-10 M, e.g., between about 0.5-10 M, e.g., between about 0.6-10 M, e.g., between about 0.7-10 M, e.g., between 0.8-10 M, e.g., between 0.9-10 M, e.g., between 0.9-9 M, e.g., between 1-8 M, e.g., between 1-7 M, e.g., between 1-6 M, e.g., between 1-5 M, e.g., between 2-4 M, e.g., about 5 M.
(269) As used herein the term p38 refers to the p38a (alpha) mitogen-activated protein kinase 14 (MAPK14), which includes MAPK14 isoform 1 set forth by GenBank Accession No. NP_001306.1 (SEQ ID NO:39), MAPK14 isoform 2 set forth by GenBank Accession No. NP_620581.1 (SEQ ID NO:40), MAPK14 isoform 3 set forth by GenBank Accession No. NP_620582.1 (SEQ ID NO:41) and MAPK14 isoform 4 set forth by GenBank Accession No. NP_620583.1 (SEQ ID NO:42); p380 (beta) (MAPK11), which is set forth by GenBank Accession No. NP_002742.3 (SEQ ID NO:43); p38y (gamma) (MAPK12) which is set forth by GenBank Accession No. NP_002960.2 (SEQ ID NO:44); and/or p386 (delta) (MAPK13) which is set forth in GenBank Accession No. NP_002745.1 (SEQ ID NO:45), all of them having kinase activity and involved in signal transduction.
(270) As used herein the term p38 inhibitor refers to any molecule (e.g., small molecules or proteins) capable of inhibiting the activity of p38 family members as determined by Western blot quantification of phosphorylated p38 levels.
(271) Non-limiting examples of p38 inhibitors include SB203580 (AXONMEDCHEMAxon 1363), and SB 202190 (AXONMEDCHEMAxon 1364), LY 2228820 (AXONMEDCHEMAxon 1895), BIRB796 (Axon Medchem 1358) and PD169316 (AXONMEDCHEMAxon 1365).
(272) As BMP signaling is an activator for p38 signaling, examples of p38 inhibitors also include BMP inhibitors like Dorsomorphin (AXONMEDCHEMAxon 2150) and LDN193189 (AXON MEDCHEM AXON 1509) or other inhibitors of the BMP pathway such as recombinant NOGGIN protein [GenBank Accession No. NP_005441.1 (SEQ ID NO: 118)] can be used to replace small molecule inhibitors of BMP signaling.
(273) According to some embodiments of the invention, PDSB203580 is provided at a concentration range of between about 0.5-70 M, e.g., from about 1 M to about 70 M, e.g., between about 1-60 M, e.g., between about 1-55 M, e.g., between about 1-50 M, e.g., between about 1-45 M, e.g., between about 1-40 M, e.g., between about 1-35 M, e.g., between about 1-30 M, e.g., between about 1-25 M, e.g., between about 1-20 M, e.g., between about 1-15 M, e.g., between about 1-10 M, e.g., between about 2-10 M, e.g., between about 3-10 M, e.g., between about 4-10 M, e.g., between about 4-6 M, e.g., about 5 M, e.g., about 10 M.
(274) According to some embodiments of the invention, SB 202190 is provided at a concentration range of between about 0.1 M to about 50 M, e.g., from about 0.5 M to about 50 M, e.g., from about 1 M to about 50 M, e.g., between about 1-45 M, e.g., between about 1-40 M, e.g., between about 1-35 M, e.g., between about 1-30 M, e.g., between about 1-25 M, e.g., between about 1-20 M, e.g., between about 1-15 M, e.g., between about 1-10 M, e.g., between about 1-9 M, e.g., between about 1-8 M, e.g., between about 1-7 M, e.g., between about 2-7 M, e.g., between about 3-7 M, e.g., between about 4-7 M, e.g., between about 4-6 M, e.g., about 5 M.
(275) According to some embodiments of the invention, BIRB796 is provided at a concentration range of between about 0.05 to about 30 M, e.g., from about 0.1 to about 30 M, e.g., between about 0.2-30 M, e.g., between about 0.2-25 M, e.g., between about 0.2-20 M, e.g., between about 0.2-15 M, e.g., between about 0.2-10 M, e.g., between about 0.2-8 M, e.g., between about 0.2-6 M, e.g., between about 0.5-6 M, e.g., between about 0.5-5 M, e.g., between about 0.5-4 M, e.g., between about 0.5-3 M, e.g., between about 0.5-2 M, e.g., between about 1-3 M, e.g., between about 1-2.5 M, e.g., about 2 M.
(276) As used herein the term JNK refers to the mitogen-activated protein kinase 8 (MAPK8) protein set forth by GenBank Accession Nos. NP_620637.1 (isoform alpha2) (SEQ ID NO:46), NP_620635.1 (isoform beta2) (SEQ ID NO:47), NP_620634.1 (isoform beta1) (SEQ ID NO:48), NP_002741.1 (isoform alphal) (SEQ ID NO:49) which are involved in a wide variety of cellular processes such as proliferation, differentiation, transcription regulation and development.
(277) As used herein the term JNK inhibitor refers to any molecule capable of inhibiting the activity of JNK as determined by phosphorylation of JNK family member protein by western blot analysis.
(278) Non-limiting examples of JNK inhibitors include SP600125 (TOCRISCat no. 1496), AEG3482 (AXONMEDCHEMAXON 1291), and BIRB796 (AXONMEDCHEMAxon 1358).
(279) According to some embodiments of the invention, SP600125 is provided at a concentration range of between about 0.5-100 M, e.g., from about 1 M to about 100 M, e.g., between about 1-90 M, e.g., between about 1-80 M, e.g., between about 1-70 M, e.g., between about 1-60 M, e.g., between about 1-55 M, e.g., between about 1-50 M, e.g., between about 1-45 M, e.g., between about 1-40 M, e.g., between about 1-35 M, e.g., between about 1-30 M, e.g., between about 1-25 M, e.g., between about 1-20 M, e.g., between about 1-15 M, e.g., between about 1-10 M, e.g., between about 2-10 M, e.g., between about 3-10 M, e.g., between about 4-10 M, e.g., between about 4-6 M, e.g., about 5 M.
(280) As used herein the term protein kinase C (PKC) refers to PKC (alpha), PKC (beta), PKC (gamma), PKC (delta), PKC (zeta) and PKC (mu) protein isoforms.
(281) As used herein the term protein kinase C inhibitor refers to any molecule capable of inhibiting the activity of protein kinase C as determined by reducing the levels of phosphorylated versus non phosphorylated PKC isoforms.
(282) A non-limiting example of a protein kinase C inhibitor is Go6983 (CAS 133053-19-7), a potent, cell-permeable, reversible, and ATP-competitive inhibitor of protein kinase C (PKC) with a broad spectrum protein kinase C (PKC) inhibitor (IC50 values are 7, 7, 6, 10, 60 and 20000 nM for PKCu, PKC0, PKCy, PKC6, PKC (and PKCp respectively). Go6983 is available from various suppliers such as Calbiochem (Catalogue number 365251-500UG), and TOCRIS (Catalogue number 2285).
(283) According to some embodiments of the invention, Go6983 is provided at a concentration range of between about 0.5-100 M, e.g., from about 1 M to about 100 M, e.g., between about 1-90 M, e.g., between about 1-80 M, e.g., between about 1-70 M, e.g., between about 1-60 M, e.g., between about 1-55 M, e.g., between about 1-50 M, e.g., between about 1-45 M, e.g., between about 1-40 M, e.g., between about 1-35 M, e.g., between about 1-30 M, e.g., between about 1-25 M, e.g., between about 1-20 M, e.g., between about 1-15 M, e.g., between about 1-10 M, e.g., between about 2-10 M, e.g., between about 3-10 M, e.g., between about 4-10 M, e.g., between about 4-6 M, e.g., about 5 M.
(284) As used herein the term fibroblast growth factor receptor (FGFR) refers to FGFR1, FGFR2 and FGFR3.
(285) As used herein the term FGFR inhibitor (or FGFRi) refers to a molecule capable of inhibiting FGFR expression and/or activity level as determined by levels of phosphorylated FGFR1, 2, and 3.
(286) Non-limiting examples of FGFR inhibitors include PD173074 and SU5401.
(287) According to some embodiments of the invention, the FGFR inhibitor (FGFRi) is PD173074 and is provided in a concentration range between about 0.01-40 M, e.g., between about 0.02-40 M, e.g., between about 0.05-40 M, e.g., between, about 0.1-M, about 0.5-40 M, about 1-40 M, e.g., about 2-40 M, about 5-40 M, about 10-40 M, e.g., between about 0.05-5 M, e.g., about 0.1-5 M.
(288) According to some embodiments of the invention, the FGFR inhibitor (FGFRi) is SU5401 and is provided at a concentration range of about 0.1-40 M, e.g., about 0.5-40 M, about 1-40 M, e.g., about 2-40 M, about 5-40 M, about 10-40 M.
(289) As used herein the term transforming growth factor receptor (TGFR) refers to TGF- type I receptor ALK5, type I activin/nodal receptor ALK4 and type I nodal receptor ALK7.
(290) As used herein the term TGFR inhibitor (or TGFRi) refers to a molecule capable of inhibiting TGFR expression and/or activity level as determined by phosphorylated ALK4, 5 and 7.
(291) Non-limiting examples of TGFR inhibitors include SB431542 and A 83-01 small molecule compound.
(292) According to some embodiments of the invention, the TGFR inhibitor is provided at a concentration range of about 0.1-30 M, e.g., about 1-30 M, e.g., 5-25 M, e.g., 5-10 M, e.g., 0.1-5 M, e.g., 0.2-4 M, e.g., 0.5-3 M.
(293) According to some embodiments of the invention, the culture medium further comprises a ROCK inhibitor.
(294) As used herein the term ROCK refers to the protein set forth by GenBank Accession No. NP_005397.1 (P160ROCK; SEQ ID NO: 50); and NP_004841.2 (ROCK2; SEQ ID NO:51) having the serine/threonine kinase activity, and regulates cytokinesis, smooth muscle contraction, the formation of actin stress fibers and focal adhesions, and the activation of the c-fos serum response element.
(295) As used herein the term ROCK inhibitor refers to any molecule capable of inhibiting the activity of ROCK as determined by inhibition of ROCK phosphorylation levels (detected by western blot analysis).
(296) Non-limiting examples of ROCK inhibitors include Y27632 (TOCRIS, Catalogue number 1254).
(297) According to some embodiments of the invention, Y27632 is provided at a concentration range of between about 0.1-100 M, e.g., from about 0.1 M to about 90 M, e.g., between about 0.1-85 M, e.g., between about 0.1-80 M, e.g., between about 0.1-70 M, e.g., between about 0.1-60 M, e.g., between about 0.1-55 M, e.g., between about 0.1-50 M, e.g., between about 0.1-45 M, e.g., between about 0.1-40 M, e.g., between about 0.1-35 M, e.g., between about 0.1-30 M, e.g., between about 0.1-25 M, e.g., between about 1-20 M, e.g., between about 1-15 M, e.g., between about 1-10 M, e.g., between about 2-10 M, e.g., between about 3-10 M, e.g., between about 4-10 M, e.g., between about 4-6 M, e.g., about 5 M.
(298) According to some embodiments of the invention, the culture medium which comprises leukemia inhibitor factor (LIF), an ERK1/2 inhibitor, a GSK3b inhibitor, a p38 inhibitor, a JNK inhibitor, and a protein kinase C inhibitor, further comprises a ROCK inhibitor.
(299) According to some embodiments of the invention, the culture medium which comprises leukemia inhibitor factor (LIF), an ERK1/2 inhibitor, a GSK3b inhibitor, a p38 inhibitor, a JNK inhibitor, a protein kinase C inhibitor, and a fibroblast growth factor receptor (FGFR) inhibitor (FGFRi) further comprises a ROCK inhibitor.
(300) According to some embodiments of the invention, the culture medium which comprises leukemia inhibitor factor (LIF), an ERK1/2 inhibitor, a GSK3b inhibitor, a p38 inhibitor, a JNK inhibitor, a protein kinase C inhibitor, and a transforming growth factor receptor inhibitor (TGFRi) further comprises a ROCK inhibitor.
(301) According to some embodiments of the invention, the culture medium which comprises leukemia inhibitor factor (LIF), an ERK1/2 inhibitor, a GSK3b inhibitor, a p38 inhibitor, a JNK inhibitor, a protein kinase C inhibitor, a fibroblast growth factor receptor (FGFR) inhibitor (FGFRi) and a transforming growth factor receptor inhibitor (TGFRi) further comprises a ROCK inhibitor.
(302) According some embodiments of the invention, the culture medium which comprises leukemia inhibitor factor (LIF), an ERK1/2 inhibitor, a GSK3b inhibitor, a p38 inhibitor, a JNK inhibitor, TGF1 and a protein kinase C inhibitor further comprises a ROCK inhibitor.
(303) According to some embodiments of the invention, the culture medium which comprises leukemia inhibitor factor (LIF), an ERK1/2 inhibitor, a GSK3b inhibitor, a p38 inhibitor, a JNK inhibitor, TGF1, a protein kinase C inhibitor and a fibroblast growth factor receptor (FGFR) inhibitor further comprises a ROCK inhibitor.
(304) According to some embodiments of the invention, the culture medium which comprises leukemia inhibitor factor (LIF), an ERK1/2 inhibitor, a GSK3b inhibitor, a p38 inhibitor, a JNK inhibitor, basic fibroblast growth factor (bFGF) and transforming growth factor-beta 1 (TGF1) further comprises a ROCK inhibitor.
(305) According to some embodiments of the invention, the culture medium further comprises a protein kinase C inhibitor.
(306) According to some embodiments of the invention, the culture medium which comprises leukemia inhibitor factor (LIF), an ERK1/2 inhibitor, a GSK3b inhibitor, a p38 inhibitor, a JNK inhibitor, basic fibroblast growth factor (bFGF) and transforming growth factor-beta 1 (TGF1) further comprises a protein kinase C inhibitor.
(307) According to some embodiments of the invention, the culture medium which comprises leukemia inhibitor factor (LIF), an ERK1/2 inhibitor, a GSK3b inhibitor, a p38 inhibitor, a JNK inhibitor, basic fibroblast growth factor (bFGF), transforming growth factor-beta 1 (TGF1) and a ROCK inhibitor further comprises a protein kinase C inhibitor.
(308) According to some embodiments of the invention, the culture medium further comprises a factor selected from the group consisting of: bone morphogenetic protein 4 (BMP4), insulin-like growth factor 1 (IGF1), Forskolin, fibroblast growth factor receptor (FGFR) inhibitor (FGFRi), transforming growth factor receptor inhibitor (TGFRi), Kenpaullone, BayK8644, Bix1294, and stem cell factor (SCF).
(309) According to some embodiments of the invention, the culture medium which comprises leukemia inhibitor factor (LIF), an ERK1/2 inhibitor, a GSK3b inhibitor, a p38 inhibitor, a JNK inhibitor, and a protein kinase C inhibitor further comprises at least one factor selected from the group consisting of bone morphogenetic protein 4 (BMP4), insulin-like growth factor 1 (IGF1), Forskolin, fibroblast growth factor receptor (FGFR) inhibitor (FGFRi), transforming growth factor receptor inhibitor (TGFRi), Kenpaullone, BayK8644, Bix1294, and stem cell factor (SCF).
(310) According to some embodiments of the invention, the culture medium which comprises leukemia inhibitor factor (LIF), an ERK1/2 inhibitor, a GSK3b inhibitor, a p38 inhibitor, a JNK inhibitor, a protein kinase C inhibitor and a fibroblast growth factor receptor (FGFR) inhibitor (FGFRi) further comprises at least one factor selected from the group consisting of bone morphogenetic protein 4 (BMP4), insulin-like growth factor 1 (IGF1), Forskolin, transforming growth factor receptor inhibitor (TGFRi), Kenpaullone, BayK8644, Bix1294, and stem cell factor (SCF).
(311) According to some embodiments of the invention, the culture medium which comprises leukemia inhibitor factor (LIF), an ERK1/2 inhibitor, a GSK3b inhibitor, a p38 inhibitor, a JNK inhibitor, a protein kinase C inhibitor and a transforming growth factor receptor inhibitor (TGFRi) further comprises at least one factor selected from the group consisting of bone morphogenetic protein 4 (BMP4), insulin-like growth factor 1 (IGF1), Forskolin, fibroblast growth factor receptor (FGFR) inhibitor (FGFRi), Kenpaullone, BayK8644, Bix1294, and stem cell factor (SCF).
(312) According to some embodiments of the invention, the culture medium which comprises leukemia inhibitor factor (LIF), an ERK1/2 inhibitor, a GSK3b inhibitor, a p38 inhibitor, a JNK inhibitor, a protein kinase C inhibitor, a fibroblast growth factor receptor (FGFR) inhibitor (FGFRi) and a transforming growth factor receptor inhibitor (TGFRi) further comprises at least one factor selected from the group consisting of bone morphogenetic protein 4 (BMP4), insulin-like growth factor 1 (IGF1), Forskolin, Kenpaullone, BayK8644, Bix1294, and stem cell factor (SCF).
(313) According to some embodiments of the invention, the culture medium which comprises leukemia inhibitor factor (LIF), an ERK1/2 inhibitor, a GSK3b inhibitor, a p38 inhibitor, a JNK inhibitor, TGF1 and a protein kinase C inhibitor further comprises at least one factor selected from the group consisting of bone morphogenetic protein 4 (BMP4), insulin-like growth factor 1 (IGF1), Forskolin, fibroblast growth factor receptor (FGFR) inhibitor (FGFRi), transforming growth factor receptor inhibitor (TGFRi), Kenpaullone, BayK8644, Bix1294, and stem cell factor (SCF).
(314) According to some embodiments of the invention, the culture medium which comprises leukemia inhibitor factor (LIF), an ERK1/2 inhibitor, a GSK3b inhibitor, a p38 inhibitor, a JNK inhibitor, basic fibroblast growth factor (bFGF) and transforming growth factor-beta 1 (TGF1) further comprises at least one factor selected from the group consisting of bone morphogenetic protein 4 (BMP4), insulin-like growth factor 1 (IGF1), Forskolin, fibroblast growth factor receptor (FGFR) inhibitor (FGFRi), transforming growth factor receptor inhibitor (TGFRi), Kenpaullone, BayK8644, Bix1294, and stem cell factor (SCF).
(315) According to some embodiments of the invention, the culture medium further comprises ascorbic acid.
(316) As used herein the phrase ascorbic acid or Vitamin C which is interchangeably used herein, refers to L-ascorbic acid 2-phosphate. Ascorbic acid can be obtained from e.g., Sigma (Catalogue number A8960).
(317) The concentration of ascorbic acid to be used with the medium of some embodiments of the invention can be about 1-300 g/ml, e.g., about 50 g/ml.
(318) According to some embodiments of the invention, the culture medium further comprises oleic Acid. It should be noted that oleic Acid can be used instead of ALBUMAX (Life Technologies) or together with ALBUMAX.
(319) According to some embodiments of the invention, the culture medium further comprises Linoleic Acid. It should be noted that Linoleic Acid can be used instead of ALBUMAX (Life Technologies) or together with ALBUMAX.
(320) According to some embodiments of the invention, the culture medium further comprises Pipecolic Acid. It should be noted that pipecolic acid can be used instead of ALBUMAX (Life Technologies) or together with ALBUMAX.
(321) According to some embodiments of the invention, the Oleic Acid (01257, Sigma Aldrich) can be used at a concentration of about 1-200 g/ml, e.g., about 10 g/ml in the culture medium.
(322) According to some embodiments of the invention, the Oleic Acid [01008 Sigma Aldrich, dissolved in DMSO), can be used at a concentration of 1-200 g/ml e.g., about 10 g/ml in the culture medium.
(323) According to some embodiments of the invention, the Pipecolic Acid [P2519 Sigma Aldrich, dissolved in DMSO), can be used at a concentration of 1-200 g/ml e.g., about 10 g/ml in the culture medium.
(324) According to some embodiments of the invention, the oleic Acid-Albumin (03008 Sigma Aldrich) can be used at a concentration of about 1-200 g/ml, e.g., about 10 g/ml in the culture medium.
(325) According to some embodiments of the invention, the medium comprises Linoleic/Oleic/Albumin supplement (L9655 Sigma Aldrich) at a concentration of about 1-200 g/ml, e.g., about 10 g/ml in the culture medium.
(326) A non-limiting example of a culture medium which can be used to maintain (and induce to naive state) pluripotent stem cells in a naive state include: leukemia inhibitor factor (LIF), an ERK1/2 inhibitor, a GSK3b inhibitor, a p38 inhibitor, a JNK inhibitor, basic fibroblast growth factor (bFGF) and transforming growth factor-beta 1 (TGF1), and one or more of the following components: a) IGFII (range 0.1-100 ng/ml final concentration); b) IGF1 [insulin-like growth factor 1 (somatomedin C)](range 0.1-100 ng/ml final concentration); c) SCF (range 0.1-100 ng/ml final concentration); d) BMP signaling inhibitor [examples include, but are not limited to: LDN193189 (AXON 1509-0.01-20 micro M final concentration), K02288 (Axon 2189; 0.1-20 micro M final concentration), Dorsomorphin hydrochloride (AXON 2150 0.1-20 micro M final concentration); e) NOTCH signaling inhibitors [examples include, but are not limited to the following gamma secretase inhibitors: DAPT (Axon Medchem 1484-0.05-50 micro M final concentration), LY2886721 hydrochloride (Axon Medchem 1964-0.05-50 micro M final concentration)], DBZ (Axon MedchemAxon 1488-0.05-50 micro M final concentration); f) Sonic Hedgehog pathway (SHH) inhibitors [examples include, but are not limited to the following: GANT61 (SigmaAldrich0.05-50 micro M final concentration), RU-SKI 43 (Axon MedchemAxon 2035-0.05-50 micro M final concentration)]; g) ERK5 inhibitors (BIX02189 Axon 1809; range 0.1-100 micro M final concentration); h) ROCK inhibitor [Y27632 (AXON 1683)0.05-100 micro M final]; i) FGF signaling inhibitor: Non-limiting examples of FGFR inhibitors include PD173074 and SU5401; and j) TGF pathway inhibitor: Non-limiting examples of TGFR inhibitors include SB431542 and A 83-01 small molecule compound (As used herein the term TGFR inhibitor (or TGFRi) refers to a molecule capable of inhibiting TGFR expression and/or activity level as determined by phosphorylated ALK4, 5 and 7).
(327) According to some embodiments of the invention, the culture medium of the invention is defined by any one of conditions 1-5, and 7-17 as described in Tables 3-5 in the Examples section which follows.
(328) According to some embodiments of the invention, the culture medium further comprises an MBD3 inhibitor.
(329) As used herein the term MBD3 refers to the Methyl-CpG-binding domain 3 protein set forth by GenBank Accession No. NP_003917.1 (SEQ ID NO:7) having the co-repressor and chromatin remodeling functional activity.
(330) As used herein the term MBD3 inhibitor refers to any agent (e.g., a molecule) capable of downregulating the expression level and/or activity of MBD3, and/or capable of interfering between the interaction of MBD3 with OCT4, and/or MBD3 with SOX2, and/or MBD3 and KLF4 and/or MBD3 and C-Myc, and/or inhibiting the binding of MBD3 to the nucleosome remodeling and deacetylase (NuRD). Downregulation of MBD3 can be effected on the genomic and/or the transcript level using a variety of molecules which interfere with transcription and/or translation [e.g., RNA silencing agents (e.g., antisense, siRNA, shRNA, micro-RNA), Ribozyme and DNAzyme], or on the protein level using e.g., an antibody (e.g., a neutralizing antibody), an antagonist, e.g., small molecules which inhibit MBD3 activity or ability to directly interact with any of the reprogramming factors (Oct4, Sox2, Klf4or c-Myc), enzymes that cleave the polypeptide and the like.
(331) Non-limiting examples of MBD3 inhibitors include siRNA directed against MBD3 mRNA, such as those provided from Invitrogen, mBD3HSS147581(3_RNAI) (Invitrogen): AGGUCAAGGGCAAGCCCGACCUGAA (SEQ ID NO:52); and MBD3HSS147581(3_RNAI) (Invitrogen): UUCAGGUCGGGCUUGCCCUUGACCU (SEQ ID NO:53). Another suitable siRNA directed against MBD3 mRNA which can be used is the commercially available MBD3 Stealth siRNAs that include HSS147580 and HSS147581 components (Life Techniologiesm, catalogue number 1299001) that were found efficient for MBD3 knockdown in human cells.
(332) According to some embodiments of the invention, inhibiting the binding of Mbd3 to the NuRD complex is performed using a chromodomain helicase DNA binding protein 4 (CHD4) inhibitor.
(333) Non-limiting examples of CHD4 inhibitors include the human CHD4 siRNA, such as the CHD4 stealth siRNA HSS101850 available from Life technologies, which was found to efficiently knockdown CHD4 in human cells.
(334) According to some embodiments of the invention, inhibiting the binding of Mbd3 to the NuRD complex is performed using a P66 alpha coiled-coil (P66a-CC) domain.
(335) The peptide of the P66a-CC (SEQ ID NO: 114) can be added to the medium as is, or can be recombinantly expressed from a vector encoding the P66a-CC sequence (e.g., a vector which comprises the nucleotide sequence set forth in SEQ ID NO: 113).
(336) According to some embodiments of the invention, inhibiting Mbd3 expression is performed using a protein kinase C (PKC) inhibitor (e.g., using the agents and molecules as described above).
(337) According to some embodiments of the invention, the medium further comprises an agent which increases expression of endogenous ERAS and/or a recombinant ERAS.
(338) According to some embodiments of the invention, the MBD3 inhibitor is provided in an amount sufficient to downregulate the expression level of the MBD3 RNA and/or protein in the cell by at least about 30%, e.g., at least about 35%, e.g., at least about 40%, e.g., at least about 45%, e.g., at least about 50%, e.g., at least about 55%, e.g., at least about 60%, e.g., at least about 65%, e.g., at least about 70%, e.g., at least about 75%, e.g., at least about 80% as compared to the expression level of the MBD3 RNA and/or protein, respectively, in the same cell when incubated and/or cultured under the same (e.g., identical) conditions yet without the MBD3 inhibitor.
(339) According to some embodiments of the invention, the MBD3 inhibitor is provided in an amount sufficient to downregulate the expression level of the MBD3 RNA and/or protein in the cell by about 30-90%, e.g., about 30-85%, e.g., about 40-85%, e.g., about 50-85%, e.g., about 60-85%, e.g., about 70-85%, e.g., about 80-85%, e.g., about 85% as compared to the expression level of the MBD3 RNA and/or protein, respectively, in the same cell when incubated and/or cultured under the same (e.g., identical) conditions yet without the MBD3 inhibitor.
(340) The expression level of the MBD3 in the cell can be determined by various methods such as real time reverse transcription PCR, Western blot and the like. A non-limiting example for such an assay is provided in the Examples section which follows and in
(341) According to some embodiments of the invention, the culture medium is devoid of serum, e.g., devoid of any animal serum.
(342) According to some embodiments of the invention, the culture medium is devoid of any animal contaminants, i.e., animal cells, fluid or pathogens (e.g., viruses infecting animal cells), e.g., being xeno-free.
(343) According to some embodiments of the invention, the culture medium is devoid of human derived serum.
(344) According to some embodiments of the invention, the culture medium further comprises a serum replacement (i.e., a substitute of serum) such as KNOCKOUT Serum Replacement (Gibco-Invitrogen Corporation, Grand Island, NY USA), ALBUMAXII (Gibco; Life TechnologiesInvitrogen, Catalogue No. 11021-029; Lipid-rich bovine serum albumin for cell culture) or a chemically defined lipid concentrate (Gibco; Invitrogen, Life TechnologiesInvitrogen, Catalogue No. 11905-031).
(345) According to some embodiments of the invention, the culture medium further comprises N2 supplement (Gibco; Life TechnologiesInvitrogen, Catalogue No. 17502-048) a chemically defined, serum-free supplement. For a 500 ml of culture medium 5 ml of the N2 mix (Invitrogen) can be added.
(346) Alternatively, the following materials (substitute the N2 supplement) can be added to a 500 ml culture medium: Recombinant Insulin (Sigma I-1882) at a 12.5 microg/ml (g/ml) final concentration; Apo-Transferrin (Sigma T-1147) at a 500 g/ml final concentration; Progesterone (SigmaP8783) at a 0.02 g/ml final concentration; Putrescine (SigmaP5780) at a 16 g/ml final concentration; and 5 microL (l) of 3 mM stock of Sodium Selenite (SigmaS5261) are added per 500 ml culture medium (e.g., the WIS-NHSM).
(347) According to some embodiments of the invention, the KNOCKOUT Serum Replacement is provided at a concentration of at least 0.5%, e.g., in the range of about 0.5%-25%, e.g., about 5%, about 10%, about 15%, about 20% or about 25%.
(348) According to some embodiments of the invention, the ALBUMAX is provided at a concentration of at least 0.01%, e.g., in the range of about 0.01%-10%, e.g., about 0.1%, about 0.2%, about 0.3%, about 0.4%, about 0.5%, about 0.6%, about 0.7%, about 0.8%, about 0.9%, about 1%, about 2%, about 3%, about 4%, about 5%, about 6%, about 7%, about 8%, about 9% or about 10%, e.g., 1%.
(349) According to some embodiments of the invention, the defined lipid concentrate is provided at a concentration of at least about 0.1%, e.g., in the range of 0.1-5%, e.g., about 0.2%, about 0.3%, about 0.4%, about 0.5%, about 0.6%, about 0.7%, about 0.8%, about 0.9%, about 1%, about 2%, about 3%, about 4%, about 5%, e.g., 1%.
(350) According to some embodiments of the invention, the culture medium comprises the N2 supplement (e.g., 5 ml N2 per 500 ml of culture medium) and the defined lipid concentrate (5 ml defined lipid concentrate per 500 ml medium).
(351) According to some embodiments of the invention, the culture medium comprises the N2 supplement (e.g., 5 ml N2 per 500 ml of culture medium) and ALBUMAXII (e.g., 1% AlbumaxII; Gibco; Life TechnologiesInvitrogen).
(352) According to some embodiments of the invention, the culture medium can further include antibiotics (e.g., PEN-STREP), L-glutamine, NEAA (non-essential amino acids).
(353) According to some embodiments of the invention, the culture medium comprises KO-DMEM with N2 supplement (e.g., about 5 ml N2 per 500 ml of culture medium) with about 5 ml defined lipid concentrate per 500 ml medium, LIF (about 20 ng/ml), bFGF (about 8 ng/ml), TGF1 (about 1 ng/ml), ERK1/2i (about 1 M of PD0325901), GSK3bi (CHIR99021, about 3 M), p38i (SB203580, about 5 M), and JNKi (SP600125, about 5-10 M).
(354) According to some embodiments of the invention, the culture medium comprises KO-DMEM with N2 supplement (e.g., about 5 ml N2 per 500 ml of culture medium) with about 1-2% AlbumaxII, LIF (about 20 ng/ml), bFGF (about 8 ng/ml), TGF1 (about 1 ng/ml), ERK1/2i (about 1 M of PD0325901), GSK3bi (CHIR99021, about 3 M), p38i (SB203580, about 5 M), and JNKi (SP600125, 5-about 10 M).
(355) According to some embodiments of the invention, the culture medium comprises KO-DMEM with N2 supplement (e.g., about 5 ml N2 per 500 ml of culture medium) with about 15% Kockout SR (Gibco), LIF (about 20 ng/ml), bFGF (about 8 ng/ml), TGF1 (about 1 ng/ml), ERK1/2i (about 1 M of PD0325901), GSK3bi (CHIR99021, about 3 M), p38i (SB203580, about 5 M), JNKi (SP600125, about 5-M).
(356) According to an aspect of some embodiments of the invention, there is provided a cell culture comprising cells and the culture medium of some embodiments of the invention.
(357) According to some embodiments of the invention, the cells can be any cells, e.g., prokaryotic or eukaryotic cells, e.g., primate cells, e.g., mammalian cells, e.g., human cells.
(358) According to some embodiments of the invention, the cells can be somatic cells, stem cells, primed pluripotent stem cells, and/or naive pluripotent stem cells.
(359) According to some embodiments of the invention, the culture medium is capable of maintaining naive pluripotent stem cell in an undifferentiated state for at least 2 passages, e.g., for at least 5, 10, 20, 30, 40, 50, 60, 70, 80, 90 or 100 passages.
(360) According to an aspect of some embodiments of the invention, there is provided a method of generating a naive pluripotent stem cell (PSC), comprising incubating a non-naive PSC cell under conditions which allow generation of the naive PSC from the non-naive PSC, wherein: (i) when the naive PSC is a female PSC, then the naive female PSC has two unmethylated alleles of an X-inactive specific transcript (XIST) gene; and (ii) when the naive PSC is a male PSC, then the naive male PSC has an unmethylated allele of the XIST gene, thereby generating the naive PSC.
(361) According to some embodiments of the invention, the PSC is a primate (e.g., mammalian, e.g., human) PSC.
(362) According to some embodiments of the invention, the conditions comprise the culture medium of some embodiments of the invention.
(363) According to some embodiments of the invention, the conditions comprise growing the cells in the presence of 1-20% oxygen (O.sub.2) and 5% CO.sub.2.
(364) According to some embodiments of the invention, the conditions comprise hypoxia. Hypoxic conditions (hypoxia) can be induced in the presence of less than 10% O.sub.2 (oxygen) in the growth environment.
(365) The growth environment (e.g., tissue culture incubator) can include about 37 C., 5% CO.sub.2, and hypoxia (less than 10% O.sub.2 in the air).
(366) According to some embodiments of the invention, the conditions comprise a culture medium which comprises an ERK1/2 inhibitor, a GSK3 inhibitor, a p38 inhibitor, a JNK inhibitor, a STAT3 activator and at least one agent selected from the group consisting of: basic fibroblast growth factor (bFGF), transforming growth factor beta 1 (TGF1), a protein kinase C (PKC) inhibitor, a ROCK inhibitor and a NOTCH inhibitor.
(367) According to some embodiments of the invention, the conditions comprise a culture medium which comprises an ERK1/2 inhibitor, a GSK3 inhibitor, a p38 inhibitor, a JNK inhibitor, a STAT3 activator and at least one agent selected from the group consisting of: a transforming growth factor receptor (TGFR) inhibitor, a fibroblast growth factor receptor (FGFR) inhibitor, a protein kinase C (PKC) inhibitor, a ROCK inhibitor and a NOTCH inhibitor.
(368) According to some embodiments of the invention, the STAT3 activator is selected from the group consisting of LIF, IL6 and EGF.
(369) According to some embodiments of the invention, the STAT3 activator is selected from the group consisting of LIF, and IL6.
(370) According to some embodiments of the invention, the STAT3 activator is LIF.
(371) According to some embodiments of the invention, the culture medium further comprising at least one additional agent selected from the group consisting of: insulin-like growth factor 1 (IGF1), insulin-like growth factor II (IGFII), a bone morphogenetic protein (BMP) signaling inhibitor, a Sonic Hedgehog pathway (SHH) inhibitor, an ERK5 inhibitor, Forskolin, Kenpaullone, BayK8644, Bix1294, and stem cell factor (SCF).
(372) According to some embodiments of the invention, the culture medium further comprising at least one additional agent selected from the group consisting of: insulin-like growth factor 1 (IGF1), insulin-like growth factor II (IGFII), bone morphogenetic protein 4 (BMP4), a Sonic Hedgehog pathway (SHH) inhibitor, an ERK5 inhibitor, Forskolin, Kenpaullone, BayK8644, Bix1294, and stem cell factor (SCF).
(373) According to some embodiments of the invention, the STAT3 activator comprises the LIF, and wherein the at least one agent comprises the PKC inhibitor.
(374) According to some embodiments of the invention, the culture medium further comprising FGFR inhibitor.
(375) According to some embodiments of the invention, the culture medium further comprising TGFR inhibitor.
(376) According to some embodiments of the invention, the STAT3 activator comprises the LIF and wherein the at least one agent comprises the TGF1 and the protein kinase C inhibitor.
(377) According to some embodiments of the invention, the culture medium further comprising an FGFR inhibitor.
(378) According to some embodiments of the invention, the STAT3 activator comprises the LIF, and wherein the at least one agent comprises the bFGF and the TGF1.
(379) According to some embodiments of the invention, the culture medium further comprising a ROCK inhibitor.
(380) According to some embodiments of the invention, the culture medium further comprising a protein kinase C inhibitor.
(381) According to some embodiments of the invention, the STAT3 activator comprises the LIF and wherein the at least one agent comprises the bFGF, the ROCK inhibitor, a bone morphogenetic protein (BMP) inhibitor, the NOTCH inhibitor, and a transforming growth factor receptor (TGFR) inhibitor.
(382) According to some embodiments of the invention, the culture medium further comprising a Sonic Hedgehog pathway (SHH) inhibitor.
(383) According to some embodiments of the invention, the STAT3 activator comprises the LIF and wherein the at least one agent comprises the NOTCH inhibitor, and a fibroblast growth factor receptor (FGFR) inhibitor.
(384) According to some embodiments of the invention, the culture medium further comprises an agent selected from the group consisting of insulin-like growth factor II (IGFII), stem cell factor (SCF) and transforming growth factor beta 1 (TGF1).
(385) According to some embodiments of the invention, the conditions comprise a culture medium which comprises LIF, an ERK1/2 inhibitor, a GSK3b inhibitor, a p38 inhibitor, a JNK inhibitor, and a protein kinase C inhibitor.
(386) According to some embodiments of the invention, the culture medium further comprising a FGFR inhibitor (FGFRi).
(387) According to some embodiments of the invention, the culture medium further comprising a TGFR inhibitor (TGFRi).
(388) According to some embodiments of the invention, the conditions comprise a culture medium which comprises LIF, an ERK1/2 inhibitor, a GSK3b inhibitor, a p38 inhibitor, a JNK inhibitor, and a protein kinase C inhibitor, further comprises a FGFR inhibitor (FGFRi).
(389) According to some embodiments of the invention, the conditions comprise a culture medium which comprises LIF, an ERK1/2 inhibitor, a GSK3b inhibitor, a p38 inhibitor, a JNK inhibitor, and a protein kinase C inhibitor, further comprises a TGFRi.
(390) According to some embodiments of the invention, the conditions comprise a culture medium which comprises LIF, an ERK1/2 inhibitor, a GSK3b inhibitor, a p38 inhibitor, a JNK inhibitor, and a protein kinase C inhibitor, further comprises a FGFR inhibitor and a TGFRi.
(391) According to some embodiments of the invention, the conditions comprise a culture medium which comprises LIF, an ERK1/2 inhibitor, a GSK3b inhibitor, a p38 inhibitor, a JNK inhibitor, TGF1 and a protein kinase C inhibitor.
(392) According to some embodiments of the invention, the conditions comprise a culture medium which comprises LIF, an ERK1/2 inhibitor, a GSK3b inhibitor, a p38 inhibitor, a JNK inhibitor, TGF31 and a protein kinase C inhibitor further comprising FGFR inhibitor (FGFRi).
(393) According to some embodiments of the invention, the conditions comprise a culture medium which comprises LIF, an ERK1/2 inhibitor, a GSK3b inhibitor, a p38 inhibitor, a JNK inhibitor, bFGF and TGF31.
(394) According to some embodiments of the invention, the conditions comprise a culture medium which comprises leukemia inhibitor factor (LIF), an ERK1/2 inhibitor, a GSK3b inhibitor, a p38 inhibitor, a JNK inhibitor, and a protein kinase C inhibitor.
(395) According to some embodiments of the invention, the medium further comprises an FGFR inhibitor.
(396) According to some embodiments of the invention, the medium further comprises a TGFR inhibitor.
(397) According to some embodiments of the invention, the conditions comprise a culture medium which comprises leukemia inhibitor factor (LIF), an ERK1/2 inhibitor, a GSK3b inhibitor, a p38 inhibitor, a JNK inhibitor, TGF1 and a protein kinase C inhibitor.
(398) According to some embodiments of the invention, the medium further comprises FGFR inhibitor.
(399) According to some embodiments of the invention, the conditions comprise a culture medium which comprises leukemia inhibitor factor (LIF), an ERK1/2 inhibitor, a GSK3b inhibitor, a p38 inhibitor, a JNK inhibitor, basic fibroblast growth factor (bFGF) and transforming growth factor-beta 1 (TGF1).
(400) According to some embodiments of the invention, the medium further comprises a ROCK inhibitor.
(401) According to some embodiments of the invention, the medium further comprises a protein kinase C inhibitor.
(402) According to some embodiments of the invention, the medium further comprises a factor selected from the group consisting of: bone morphogenetic protein 4 (BMP4), IGF1, Forskolin, FGFR inhibitor, TGFR inhibitor Kenpaullone, BayK8644, Bix1294, and stem cell factor (SCF).
(403) According to some embodiments of the invention, the medium further comprises an ascorbic acid.
(404) According to some embodiments of the invention, the medium further comprises an oleic Acid.
(405) According to some embodiments of the invention, the medium further comprises a Linoleic Acid.
(406) According to some embodiments of the invention, the culture medium being devoid of animal serum (e.g., devoid of bovine serum, mouse serum, being xeno-free, devoid of animal contaminants).
(407) According to some embodiments of the invention, the culture medium further comprises serum replacement.
(408) According to some embodiments of the invention, the culture medium further comprises an MBD3 inhibitor.
(409) According to some embodiments of the invention, the conditions comprise a culture medium which comprises leukemia inhibitor factor (LIF), an ERK1/2 inhibitor, a GSK3b inhibitor, a p38 inhibitor, a JNK inhibitor, basic fibroblast growth factor (bFGF) and transforming growth factor-beta 1 (TGF1).
(410) According to some embodiments of the invention, the culture medium further comprises a ROCK inhibitor.
(411) According to some embodiments of the invention, the culture medium further comprises an MBD3 inhibitor.
(412) According to some embodiments of the invention, the non-naive PSC is selected from the group consisting of a primed PSC, a blastocyst, an induced pluripotent stem cell (a primed iPSC) and a somatic cell.
(413) It should be noted that when the non-naive PSC is a primed PSC (e.g., a blastocyst, an embryonic stem cell, an embryonic germ cell, or an induced pluripotent stem cell) there is no need for exogenous expression of the Oct4, Sox2, Klf4 and c-Myc, nor for the addition of isolated Oct4, Sox2, Klf4 and/or c-Myc factors to the medium.
(414) According to some embodiments of the invention, when the non-naive PSC is a primed PSC, a blastocyst, or an induced pluripotent stem cell (a primed iPSC) the medium does not include the Oct4, Sox2, Klf4 and/or c-Myc factors.
(415) According to some embodiments of the invention, when the non-naive PSC is a primed PSC, a blastocyst, or an induced pluripotent stem cell (a primed iPSC) the cells are not genetically modified to express the Oct4, Sox2, Klf4 and/or c-Myc factors.
(416) According to some embodiments of the invention, wherein when the non-naive PSC comprises a somatic cell then the method further comprising subjecting the somatic cell to de-differentiation conditions, to thereby obtain an induced pluripotent stem cell.
(417) According to some embodiments of the invention, de-differentiation conditions comprise exogenously expressing within the somatic cell at least two growth factors selected from the group consisting of OCT4 [GenBank Accession Nos. NP_002692.2 (SEQ ID NO:54) and NM_002701.4 (SEQ ID NO:55)], SOX2 [GenBank Accession Nos. NP_003097.1 (SEQ ID NO:56) and NM_003106.3 (SEQ ID NO:57)], KLF4 [GenBank Accession Nos. NP_004226.3 (SEQ ID NO:58) and NM_004235.4 (SEQ ID NO:59)] and c-Myc [GenBank Accession Nos. NP_002458.2 (SEQ ID NO:60) and NM_002467.4 (SEQ ID NO:61)].
(418) As used herein the phrase exogenously expressing refers to expressing a heterologous nucleic acid sequence which may not be naturally expressed within the cell or which overexpression in the cell is desired. The exogenous polynucleotide may be introduced into the cell in a stable or transient manner, so as to produce a ribonucleic acid (RNA) molecule and/or a polypeptide molecule. It should be noted that the exogenous polynucleotide may comprise a nucleic acid sequence which is identical or partially homologous to an endogenous nucleic acid sequence of the cell.
(419) The term endogenous as used herein refers to any polynucleotide or polypeptide which is present and/or naturally expressed within the cell.
(420) According to some embodiments of the invention, de-differentiation conditions comprise expressing within the somatic cell Klf4 and Oct4.
(421) According to some embodiments of the invention, de-differentiation conditions comprise expressing within the somatic cell Oct4, Sox2 and Klf4.
(422) According to some embodiments of the invention, de-differentiation conditions comprise expressing within the somatic cell Oct4, Klf4 and cMyc.
(423) According to some embodiments of the invention, expressing the growth factors is performed using DNA transfection of the growth factors.
(424) Methods of DNA transfections into mammalian cells are known in the art and include those described for example in
(425) According to some embodiments of the invention, expressing the growth factors is performed using RNA transfection of the growth factors.
(426) Methods of RNA transfections into mammalian cells are known in the art and include those described for example in (Warren et al. 2010) which is fully incorporated herein by reference in its entirety.
(427) Once obtained, the cells are cultured in a medium and being serially passaged.
(428) It should be noted that culturing the naive PSC involves replacing the culture medium with a fresh medium (of identical composition) every 24-48 hours, and passaging each culture dish (e.g., a plate) to 2 or 3 culture dishes (e.g., plates) every 3-5 days. Thus, when cells in the culture reach about 60-90% confluence the supernatant is discarded, the culture dishes are washed [e.g., with phosphate buffered saline (PBS)] and the cells are subjected to enzymatic dissociation from the culture dish, e.g., using trypsinization (0.25% or 0.05% Try sin+ EDTA), e.g., until single cells or cell clumps are separated from each other.
(429) It should be noted that the culture conditions uncovered by the present inventors enables maintenance of human PSCs such as human iPSCs in the naive PSC state without the need of further exogenous expression of the Oct4, Sox2, Klf4 and/or c-Myc factors. This is in sharp contrast to all prior attempts to generate naive human PSCs which required exogenous expression of the Oct4, Sox2, Klf4 and/or c-Myc factors, and which upon withdrawal of these factors the naive PSCs spontaneously differentiated, and could not be maintained in the undifferentiated and pluripotent stem cells (See e.g., Hanna J, 2010b).
(430) According to some embodiments of the invention, exogenous expression of the growth factors is effected for a limited time, such as for no more than 10 days in culture, e.g., for no more than 1 passage.
(431) According to some embodiments of the invention, once the naive iPSCs are generated from the somatic cells, they are further being cultured in the culture medium of some embodiments of the invention (e.g., the WIS-NHSM medium) without exogenous expression of the Oct4, Sox2, Klf4 and/or c-Myc factors by the naive iPSCs, and without addition of the isolated Oct4, Sox2, Klf4 and/or c-Myc factors to the culture medium.
(432) As used herein the phrase isolated . . . factors refers to factors which are recombinantly expressed from an expression vector in a host cell (e.g., a bacteria), being biochemically synthesized, or being isolated from a biological sample (e.g., serum or cells).
(433) The method of some embodiments of the invention can be used to improve generation of iPSCs from somatic cells as compared to generation of iPSC from somatic cells using expression of the Oct4, Sox2, Klf4 and c-Myc factors in somatic cells without further inhibition of the Mbd3 expression.
(434) For example, when human somatic cells are used, the method is effected using a medium which comprises leukemia inhibitor factor (LIF), an ERK1/2 inhibitor, a GSK3b inhibitor, a p38 inhibitor, a JNK inhibitor, basic fibroblast growth factor (bFGF), transforming growth factor-beta 1 (TGF1), and an MBD3 inhibitor, and optionally also a ROCK inhibitor. When the somatic cells are subject to de-differentiation using DNA transfection of the growth factors (e.g., at least two of the Oct4, Sox2, Klf4 and c-Myc), then the method results in at least about 30%, e.g., at least about 40%, at least about 50%, e.g., at least about 60%, at least about 70%, e.g., at least about 80%, at least about 90%, e.g., at least about 95%, at least about 99%, e.g., 100% more iPSCs as compared to the yield of the iPSCs obtained when the Oct4, Sox2, Klf4 and c-Myc are expressed using DNA transfection in the somatic cell without further inhibition of the Mbd3 expression.
(435) For example, when human somatic cells are used, the method is effected using a medium which comprises leukemia inhibitor factor (LIF), an ERK1/2 inhibitor, a GSK3b inhibitor, a p38 inhibitor, a JNK inhibitor, basic fibroblast growth factor (bFGF), transforming growth factor-beta 1 (TGF1), and an MBD3 inhibitor, and optionally also a ROCK inhibitor. When the somatic cells are subject to de-differentiation using RNA transfection of the growth factors (e.g., at least two of the Oct4, Sox2, Klf4 and c-Myc), then the method results in at least about 5%, e.g., at least about 10%, at least about 20%, e.g., at least about 30%, at least about 40%, e.g., at least about 50%, at least about 60%, e.g., at least about 75%, at least about 99%, e.g., 100% more iPSCs as compared to the yield of the iPSCs obtained when the Oct4, Sox2, Klf4 and c-Myc are expressed using RNA transfection in the somatic cell without further inhibition of the Mbd3 expression. Moreover, while the prior art methods (without MBD3 inhibition and without the medium of some embodiments of the present invention) employ 10-20 rounds of RNA transfection in order to achieve de-differentiation of human somatic cells, the method of some embodiments of the invention employs 1-4 rounds of RNA transfection in order to achieve de-differentiation of human somatic cells, and thus is far more efficient and time consuming.
(436) According to an aspect of some embodiments of the invention, there is provided a method of generating a naive pluripotent stem cell (PSC), comprising incubating a non-naive PSC cell under conditions which allow generation of the naive PSC from the non-naive PSC, the naive PSC comprising: an unmethylated X-inactive specific transcript (XIST) gene, wherein: (i) when the naive PSC is a female PSC, then the naive female PSC has two unmethylated alleles of the XIST gene; and (ii) when the naive PSC is a male PSC, then the naive male PSC has an unmethylated allele of the XIST gene, and/or an expression level of transcription factor E3 (TFE3) characterized by a nucleus to cytoplasm expression ratio which is equal to or higher than 1 as determined by an immunostaining assay. wherein the conditions which comprise a culture medium which comprises KO-DMEM, N2 supplement (Gibco), defined lipid concentrate (Gibco) or Albumax I (Invitrogen), LIF, bFGF, TGF1, ERK1/2 inhibitor, GSK3b inhibitor, p38 inhibitor, and JNK inhibitor and a protein kinase C inhibitor, thereby generating the naive PSC.
(437) According to some embodiments of the invention, the culture medium further comprises FGFR inhibitor.
(438) According to some embodiments of the invention, the culture medium further comprises TGFR inhibitor.
(439) According to an aspect of some embodiments of the invention, there is provided a method of generating a naive pluripotent stem cell (PSC), comprising incubating a non-naive PSC cell under conditions which allow generation of the naive PSC from the non-naive PSC, the naive PSC comprising: an unmethylated X-inactive specific transcript (XIST) gene, wherein: (i) when the naive PSC is a female PSC, then the naive female PSC has two unmethylated alleles of the XIST gene; and (ii) when the naive PSC is a male PSC, then the naive male PSC has an unmethylated allele of the XIST gene, and/or an expression level of transcription factor E3 (TFE3) characterized by a nucleus to cytoplasm expression ratio which is equal to or higher than 1 as determined by an immunostaining assay. wherein the conditions which comprise a culture medium which comprises KO-DMEM, N2 supplement (Gibco), defined lipid concentrate (Gibco) or Albumax I (Invitrogen), LIF, bFGF, TGF1, ERK1/2 inhibitor, GSK3b inhibitor, p38 inhibitor, and JNK inhibitor and a protein kinase C inhibitor, thereby generating the naive PSC.
(440) According to some embodiments of the invention, the culture medium further comprises FGFR inhibitor.
(441) According to an aspect of some embodiments of the invention, there is provided a method of generating a naive pluripotent stem cell (PSC), comprising incubating a non-naive PSC cell under conditions which allow generation of the naive PSC from the non-naive PSC, the naive PSC comprising: an unmethylated X-inactive specific transcript (XIST) gene, wherein: (i) when the naive PSC is a female PSC, then the naive female PSC has two unmethylated alleles of the XIST gene; and (ii) when the naive PSC is a male PSC, then the naive male PSC has an unmethylated allele of the XIST gene, and/or an expression level of transcription factor E3 (TFE3) characterized by a nucleus to cytoplasm expression ratio which is equal to or higher than 1 as determined by an immunostaining assay. wherein the conditions which comprise a culture medium which comprises KO-DMEM, N2 supplement (Gibco), defined lipid concentrate (Gibco) or Albumax I (Invitrogen), LIF, bFGF, TGF1, ERK1/2 inhibitor, GSK3b inhibitor, p38 inhibitor, and JNK inhibitor, thereby generating the naive PSC.
(442) According to an aspect of some embodiments of the invention, there is provided a method of generating a naive pluripotent stem cell (PSC), comprising incubating a non-naive PSC cell under conditions which allow generation of the naive PSC from the non-naive PSC, the naive PSC comprising: an unmethylated X-inactive specific transcript (XIST) gene, wherein: (i) when the naive PSC is a female PSC, then the naive female PSC has two unmethylated alleles of the XIST gene; and (ii) when the naive PSC is a male PSC, then the naive male PSC has an unmethylated allele of the XIST gene, and/or an expression level of transcription factor E3 (TFE3) characterized by a nucleus to cytoplasm expression ratio which is equal to or higher than 1 as determined by an immunostaining assay. wherein the conditions which comprise a culture medium which comprises KO-DMEM, N2 supplement (Gibco), defined lipid concentrate (Gibco), LIF, bFGF, TGF1, ERK1/2 inhibitor, GSK3b inhibitor, p38 inhibitor, JNK inhibitor, and an MBD3 inhibitor, thereby generating the naive PSC.
(443) According to some embodiments of the invention, the method of generating a naive pluripotent stem cell (PSC) comprises incubating a non-naive PSC cell under conditions which comprise a culture medium which comprises KO-DMEM with N2 supplement (e.g., about 5 ml N2 per 500 ml of culture medium) with about 5 ml defined lipid concentrate per 500 ml medium, LIF (about 20 ng/ml), bFGF (about 8 ng/ml), TGF1 (about 1 ng/ml), ERK1/2i (about 1 M of PD0325901), GSK3bi (CHIR99021, about 3 M), p38i (SB203580, about 5 M), and JNKi (SP600125, about 5-10 M), wherein: (i) when the naive PSC is a female PSC, then the naive female PSC has two unmethylated alleles of an X-inactive specific transcript (XIST) gene; and (ii) when the naive PSC is a male PSC, then the naive male PSC has an unmethylated allele of the XIST gene, thereby generating the naive PSC.
(444) According to some embodiments of the invention, the method of generating a naive pluripotent stem cell (PSC) comprises incubating a non-naive PSC cell under conditions which comprise a culture medium which comprises KO-DMEM with N2 supplement (e.g., about 5 ml N2 per 500 ml of culture medium) with about 1-2% AlbumaxII, LIF (about 20 ng/ml), bFGF (about 8 ng/ml), TGF1 (about 1 ng/ml), ERK1/2i (about 1 M of PD0325901), GSK3bi (CHIR99021, about 3 M), p38i (SB203580, about 5 M), and JNKi (SP600125, about 5-10 M), wherein: (i) when the naive PSC is a female PSC, then the naive female PSC has two unmethylated alleles of an X-inactive specific transcript (XIST) gene; and (ii) when the naive PSC is a male PSC, then the naive male PSC has an unmethylated allele of the XIST gene, thereby generating the naive PSC.
(445) According to some embodiments of the invention, the method of generating a naive pluripotent stem cell (PSC) comprises incubating a non-naive PSC cell under conditions which comprise a culture medium which comprises KO-DMEM with N2 supplement (e.g., 5 ml N2 per 500 ml of culture medium) with about 15% Kockout SR (Gibco), LIF (about 20 ng/ml), bFGF (about 8 ng/ml), TGF1 (about 1 ng/ml), ERK1/2i (about 1 M of PD0325901), GSK3bi (CHIR99021, about 3 M), p38i (SB203580, about 5 M), JNKi (SP600125, about 5-10 M), wherein: (i) when the naive PSC is a female PSC, then the naive female PSC has two unmethylated alleles of an X-inactive specific transcript (XIST) gene; and (ii) when the naive PSC is a male PSC, then the naive male PSC has an unmethylated allele of the XIST gene, thereby generating the naive PSC.
(446) According to some embodiments of the invention, the method of generating a naive pluripotent stem cell (PSC) comprises incubating a non-naive PSC cell under conditions which comprise a culture medium which comprises KO-DMEM with N2 supplement (e.g., about 5 ml N2 per 500 ml of culture medium) with about 5 ml defined lipid concentrate per 500 ml medium, LIF (about 20 ng/ml), bFGF (about 8 ng/ml), TGF1 (about 1 ng/ml), ERK1/2i (about 1 M of PD0325901), GSK3bi (CHIR99021, about 3 M), p38i (SB203580, about 5 M), JNKi (SP600125, about 5-10 M) and an MBD3 inhibitor, wherein: (i) when the naive PSC is a female PSC, then the naive female PSC has two unmethylated alleles of an X-inactive specific transcript (XIST) gene; and (ii) when the naive PSC is a male PSC, then the naive male PSC has an unmethylated allele of the XIST gene, thereby generating the naive PSC.
(447) According to some embodiments of the invention, the method of generating a naive pluripotent stem cell (PSC) comprises incubating a non-naive PSC cell under conditions which comprise a culture medium which comprises KO-DMEM with N2 supplement (e.g., about 5 ml N2 per 500 ml of culture medium) with about 1-2% AlbumaxII, LIF (about 20 ng/ml), bFGF (about 8 ng/ml), TGF1 (about 1 ng/ml), ERK1/2i (about 1 M of PD0325901), GSK3bi (CHIR99021, about 3 M), p38i (SB203580, about 5 M), JNKi (SP600125, about 5-10 M), and an MBD3 inhibitor, wherein: (i) when the naive PSC is a female PSC, then the naive female PSC has two unmethylated alleles of an X-inactive specific transcript (XIST) gene; and (ii) when the naive PSC is a male PSC, then the naive male PSC has an unmethylated allele of the XIST gene, thereby generating the naive PSC.
(448) According to some embodiments of the invention, the method of generating a naive pluripotent stem cell (PSC) comprises incubating a non-naive PSC cell under conditions which comprise a culture medium which comprises KO-DMEM with N2 supplement (e.g., about 5 ml N2 per 500 ml of culture medium) with about 15% Kockout SR (Gibco), LIF (about 20 ng/ml), bFGF (about 8 ng/ml), TGF1 (about 1 ng/ml), ERK1/2i (about 1 M of PD0325901), GSK3bi (CHIR99021, about 3 M), p38i (SB203580, about 5 M), JNKi (SP600125, about 5-10 M), and an MBD3 inhibitor, wherein: (i) when the naive PSC is a female PSC, then the naive female PSC has two unmethylated alleles of an X-inactive specific transcript (XIST) gene; and (ii) when the naive PSC is a male PSC, then the naive male PSC has an unmethylated allele of the XIST gene, thereby generating the naive PSC.
(449) According to an aspect of some embodiments of the invention, there is provided a method of improving generation of induced pluripotent stem cells (iPSCs) from a somatic cell, comprising: (a) expressing within the somatic cell at least two growth factors selected from the group consisting of Oct4, Sox2, Klf4 and c-Myc and (b) inhibiting Mbd3 expression in the somatic cell, and/or inhibiting binding of the Mbd3 to the nucleosome remodeling and deacetylase (NuRD) complex in the somatic cell, thereby improving generation of the iPSCs from a somatic cell.
(450) According to some embodiments of the invention, inhibiting the binding of the Mbd3 to the NuRD complex is performed using a chromodomain helicase DNA binding protein 4 (CHD4) inhibitor.
(451) According to some embodiments of the invention, inhibiting the binding of the Mbd3 to the NuRD complex is performed using a P66 alpha coiled-coil domain.
(452) According to some embodiments of the invention, inhibiting the Mbd3 expression is performed using a protein kinase C (PKC) inhibitor.
(453) As described in Example 15 of the Examples section which follows, the present inventors have uncovered that overexpression of ERAS or activation of endogenous human ERAS in pluripotent stem cells can be used to induce a naive state in pluripotent stem cells.
(454) According to some embodiments of the invention, the method further comprising exogenously expressing ES cell expressed Ras (ERAS) coding sequence (e.g., SEQ ID NO: 109) or activating endogenous expression of the ERAS in the somatic cell.
(455) According to some embodiments of the invention, activating endogenous expression of ERAS is performed by removing the premature poly adenylation sites of the endogenous ERAS gene (SEQ ID NO: 108), e.g., in A-1, A2 or A-3 boxed sequences in
(456) According to some embodiments of the invention, expressing is effected for at least 48 hours such that the inhibiting the Mbd3 is effected to 10-30% of a level of the Mbd3 prior to the expressing.
(457) According to some embodiments of the invention, expressing is effected for about 48 hours and the inhibiting is effected after the about 48 hours.
(458) It should be noted that when inhibition of Mbd3 is performed after 48 hours, the inhibition can be of 100% of the expression level of activity of MBD3.
(459) According to some embodiments of the invention, the iPSC is a murine iPSC.
(460) According to some embodiments of the invention, the method further comprising culturing the murine iPSC in a medium which comprises LIF, an ERK1/2 inhibitor, and a GSK3b inhibitor.
(461) According to some embodiments of the invention, wherein when the iPSC is a human iPSC, the method further comprising: (c) culturing the human iPSC in a culture medium which comprises LIF, an ERK1/2 inhibitor, a GSK3b inhibitor, a P38 inhibitor, a JNK inhibitor, basic fibroblast growth factor (bFGF) and transforming growth factor-beta 1 (TGF1).
(462) According to some embodiments of the invention, step (c) is performed following about 48 hours from the beginning of expression as recited in step (a).
(463) According to some embodiments of the invention, the medium further comprises a ROCK inhibitor.
(464) According to some embodiments of the invention, expressing is performed using DNA transfection of the growth factors.
(465) According to some embodiments of the invention, expressing is performed using RNA transfection of the growth factors.
(466) According to some embodiments of the invention, expressing is performed using protein transfection of the growth factors.
(467) It should be noted that protein transfection into cells and cell nuclei can be performed as described by Hongyan Zhou, Shili Wu, et al. Generation of Induced Pluripotent Stem Cells Using Recombinant Proteins. Cell Stem Cell5 Jun. 2009, Vol. 4, Issue 6, pp. 581; which is incorporated herein by reference in its entirety, essentially by conjugating signal peptides which direct the recombinant factors into the cell or cell nucleus.
(468) According to an aspect of some embodiments of the invention, there is provided an isolated naive pluripotent stem cell obtainable by the method of some embodiments of the invention.
(469) According to some embodiments of the invention, the naive pluripotent stem cell comprising: an unmethylated X-inactive specific transcript (XIST) gene, wherein: (i) when the naive PSC is a female PSC, then the naive female PSC has two unmethylated alleles of the XIST gene; and (ii) when the naive PSC is a male PSC, then the naive male PSC has an unmethylated allele of the XIST gene, and/or an expression level of transcription factor E3 (TFE3) characterized by a nucleus to cytoplasm expression ratio which is equal to or higher than 1 as determined by an immunostaining assay.
(470) According to an aspect of some embodiments of the invention there is provided a method of generating differentiated cells, comprising subjecting the naive pluripotent stem cells generated according to the method of some embodiments of the invention to differentiating conditions, thereby generating the differentiated cells.
(471) According to some embodiments of the invention, the naive PSCs of some embodiments of the invention can be used to isolate lineage specific cells.
(472) As used herein, the phrase isolating lineage specific cells refers to the enrichment of a mixed population of cells in a culture with cells predominantly displaying at least one characteristic associated with a specific lineage phenotype. It will be appreciated that all cell lineages are derived from the three embryonic germ layers. Thus, for example, hepatocytes and pancreatic cells are derived from the embryonic endoderm, osseous, cartilaginous, elastic, fibrous connective tissues, yachts, myocardial cells, bone marrow cells, vascular cells (namely endothelial and smooth muscle cells), and hematopoietic cells are differentiated from embryonic mesoderm and neural, retina and epidermal cells are derived from the embryonic ectoderm.
(473) Lineage specific cells can be obtained by directly inducing the expanded, undifferentiated naive PSCs to culturing conditions suitable for the differentiation of specific cell lineage.
(474) Following is a non-limiting description of a number of procedures and approaches for inducing differentiation of EBs to lineage specific cells.
(475) Neural Precursor Cells
(476) To differentiate the EBs of some embodiments of the invention into neural precursors, four-day-old EBs are cultured for 5-12 days in tissue culture dishes including DMEM/F-12 medium with 5 mg/ml insulin, 50 mg/ml transferrin, 30 nM selenium chloride, and 5 mg/ml fibronectin (Its medium, Okabe, S. et al., 1996, Mech. Dev. 59: 89-102). The resultant neural precursors can be further transplanted to generate neural cells in vivo (Bristle, O. et al., 1997. In vitro-generated neural precursors participate in mammalian brain development. Proc. Natl. Acad. Sci. USA. 94: 14809-14814). It will be appreciated that prior to their transplantation, the neural precursors are trypsinized and triturated to single-cell suspensions in the presence of 0.1% DNase.
(477) Oligodendrocytes and Myelinate Cells
(478) EBs of some embodiments of the invention can differentiate to oligodendrocytes and myelinate cells by culturing the cells in modified SATO medium, i.e., DMEM with bovine serum albumin (BSA), pyruvate, progesterone, putrescine, thyroxine, triiodothyronine, insulin, transferrin, sodium selenite, amino acids, neurotrophin 3, ciliary neurotrophic factor and Hepes (Bottenstein, J. E. & Sato, G. H., 1979, Proc. Natl. Acad. Sci. USA 76, 514-517; Raff, M. C., Miller, R. H., & Noble, M., 1983, Nature 303: 390-396]. Briefly, EBs are dissociated using 0.25% Trypsin/EDTA (5 min at 37 C.) and triturated to single cell suspensions. Suspended cells are plated in flasks containing SATO medium supplemented with 5% equine serum and 5% fetal calf serum (FCS). Following 4 days in culture, the flasks are gently shaken to suspend loosely adhering cells (primarily oligodendrocytes), while astrocytes are remained adhering to the flasks and further producing conditioned medium. Primary oligodendrocytes are transferred to new flasks containing SATO medium for additional two days. Following a total of 6 days in culture, oligospheres are either partially dissociated and resuspended in SATO medium for cell transplantation, or completely dissociated and a plated in an oligosphere-conditioned medium which is derived from the previous shaking step [Liu, S. et al., (2000). Embryonic stem cells differentiate into oligodendrocytes and myelinate in culture and after spinal cord transplantation. Proc. Natl. Acad. Sci. USA. 97: 6126-6131].
(479) Mast Cells
(480) For mast cell differentiation, two-week-old EBs of some embodiments of the invention are transferred to tissue culture dishes including DMEM medium supplemented with 10% FCS, 2 mM L-glutamine, 100 units/ml penicillin, 100 mg/ml streptomycin, 20% (v/v) WEHI-3 cell-conditioned medium and 50 ng/ml recombinant rat stem cell factor (rrSCF, Tsai, M. et al., 2000. In vivo immunological function of mast cells derived from embryonic stem cells: An approach for the rapid analysis of even embryonic lethal mutations in adult mice in vivo. Proc Natl Acad Sci USA. 97: 9186-9190). Cultures are expanded weekly by transferring the cells to new flasks and replacing half of the culture medium.
(481) Hemato-Lymphoid Cells
(482) To generate hemato-lymphoid cells from the EBs of some embodiments of the invention, 2-3 days-old EBs are transferred to gas-permeable culture dishes in the presence of 7.5% CO2 and 5% 02 using an incubator with adjustable oxygen content. Following 15 days of differentiation, cells are harvested and dissociated by gentle digestion with Collagenase (0.1 unit/mg) and Dispase (0.8 unit/mg), both are available from F. Hoffman-La Roche Ltd, Basel, Switzerland. CD45-positive cells are isolated using anti-CD45 monoclonal antibody (mAb) M1/9.3.4.HL.2 and paramagnetic microbeads (Miltenyi) conjugated to goat anti-rat immunoglobulin as described in Potocnik, A. J. et al., (Immunology Hemato-lymphoid in vivo reconstitution potential of subpopulations derived from in vitro differentiated embryonic stem cells. Proc. Natl. Acad. Sci. USA. 1997, 94: 10295-10300). The isolated CD45-positive cells can be further enriched using a single passage over a MACS column (Miltenyi).
(483) It will be appreciated that since EBs are complex structures, differentiation of EBs into specific differentiated cells, tissue or organ may require isolation of lineage specific cells from the EBs.
(484) Such isolation may be effected by sorting of cells of the EBs via fluorescence activated cell sorter (FACS) or mechanical separation of cells, tissues and/or tissue-like structures contained within the EBs.
(485) Methods of isolating EB-derived-differentiated cells via FACS analysis are known in the art. According to one method, EBs are disaggregated using a solution of Trypsin and EDTA (0.025% and 0.01%, respectively), washed with 5% fetal bovine serum (FBS) in phosphate buffered saline (PBS) and incubated for 30 min on ice with fluorescently-labeled antibodies directed against cell surface antigens characteristics to a specific cell lineage. For example, endothelial cells are isolated by attaching an antibody directed against the platelet endothelial cell adhesion molecule-1 (PECAMI) such as the fluorescently-labeled PECAMI antibodies (30884X) available from PharMingen (PharMingen, Becton Dickinson Bio Sciences, San Jose, CA, USA) as described in Levenberg, S. et al., (Endothelial cells derived from human embryonic stem cells. Proc. Natl. Acad. Sci. USA. 2002. 99: 4391-4396). Hematopoietic cells are isolated using fluorescently-labeled antibodies such as CD34-FITC, CD45-PE, CD31-PE, CD38-PE, CD90-FITC, CD117-PE, CD15-FITC, class I-FITC, all of which IgGI are available from PharMingen, CD133/1-PE (IgGI) (available from Miltenyi Biotec, Auburn, CA), and glycophorin A-PE (IgGI), available from Immunotech (Miami, FL). Live cells (i.e., without fixation) are analyzed on a FACScan (Becton Dickinson Bio Sciences) by using propidium iodide to exclude dead cells with either the PC-LYSIS or the CELLQUEST software. It will be appreciated that isolated cells can be further enriched using magnetically-labeled second antibodies and magnetic separation columns (MACS, Miltenyi) as described by Kaufman, D. S. et al., (Hematopoietic colony-forming cells derived from human embryonic stem cells. Proc. Natl. Acad. Sci. USA. 2001, 98: 10716-10721).
(486) An example for mechanical isolation of beating cardiomyocytes from EBs is disclosed in U.S. Pat. Appl. No. 20030022367 to Xu et al. Briefly, four-day-old EBs of some embodiments of the invention are transferred to gelatin-coated plates or chamber slides and are allowed to attach and differentiate. Spontaneously contracting cells, which are observed from day 8 of differentiation, are mechanically separated and collected into a 15-mL tube containing low-calcium medium or PBS. Cells are dissociated using Collagenase B digestion for 60-120 minutes at 37 C., depending on the Collagenase activity. Dissociated cells are then resuspended in a differentiation KB medium (85 mM KCl, 30 mM K.sub.2HPO.sub.4, 5 mM MgSO4, 1 mM EGTA, 5 mM creatine, 20 mM glucose, 2 mM Na2ATP, 5 mM pyruvate, and 20 mM taurine, buffered to pH 7.2, Maltsev et al., Circ. Res. 75:233, 1994) and incubated at 37 C. for 15-30 min. Following dissociation cells are seeded into chamber slides and cultured in the differentiation medium to generate single cardiomyocytes capable of beating.
(487) It will be appreciated that the culturing conditions suitable for the differentiation and expansion of the isolated lineage specific cells include various tissue culture medium, growth factors, antibiotic, amino acids and the like and it is within the capability of one skilled in the art to determine which conditions should be applied in order to expand and differentiate particular cell types and/or cell lineages [reviewed in Fijnvandraat A C, et al., Cardiovasc Res. 2003; 58: 303-12; Sachinidis A, et al., Cardiovasc Res. 2003; 58: 278-91; Stavridis MP and Smith AG, 2003; Biochem Soc Trans. 31(Pt 1): 45-9].
(488) In addition to the lineage-specific primary cultures, EBs of the invention can be used to generate lineage-specific cell lines which are capable of unlimited expansion in culture.
(489) Cell lines of some embodiments of the invention can be produced by immortalizing the EB-derived cells by methods known in the art, including, for example, expressing a telomerase gene in the cells (Wei, W. et al., 2003. Mol Cell Biol. 23: 2859-2870) or co-culturing the cells with NIH 3T3 hph-HOX11 retroviral producer cells (Hawley, R. G. et al., 1994. Oncogene 9: 1-12).
(490) Following are non-limiting examples of culturing conditions which are suitable for differentiating and/or expanding lineage specific cells from the naive PSCs of some embodiments of the invention. It should be noted that for inducing differentiation of the naive PSCs into differentiated cells, the medium which was used to maintain the cells in the naive undifferentiated and pluripotent state should be replaced with the appropriate differentiation medium.
(491) Mesenchymal stromal cells which are CD73-positive and SSEA-4-negative can be generated from naive PSCs by mechanically increasing the fraction of fibroblast-like differentiated cells formed in cultures of naive hPSCs, essentially as described in Trivedi P and Hematti P. Exp Hematol. 2008, 36(3):350-9. Briefly, to induce differentiation of hESC the intervals between medium changes are increased to 3-5 days, and the cells at the periphery of the naive PSCs colonies become spindle-shaped fibroblast-looking cells. After 9-10 days under these conditions when about 40-50% of the cells in the culture acquire the fibroblast-looking appearance, the undifferentiated portions of naive PSCs colonies are physically removed and the remaining differentiated cells are passaged to new culture plates under the same conditions.
(492) To induce differentiation of naive hPSCs into dopaminergic (DA) neurons, the cells can be co-cultured with the mouse stromal cell lines PA6 or MS5, or can be cultured with a combination of stromal cell-derived factor 1 (SDF-1/CXCL12), pleiotrophin (PTN), insulin-like growth factor 2 (IGF2) and ephrin B1 (EFNB1) essentially as described in Vazin T, et al., PLoS One. 2009 Aug. 12; 4(8):e6606; and in Elkabetz Y., et al., Genes Dev. 2008 January 15; 22: 152-165.
(493) To generate mesencephalic dopamine (mesDA) neurons, naive hPSCs can be genetically modified to express the transcription factor Lmxla (e.g., using a lentiviral vector with the PGK promoter and Lmxla) essentially as described in Friling S., et al., Proc Natl Acad Sci USA. 2009, 106: 7613-7618.
(494) To generate lung epithelium (type II pneumocytes) from naive hPSCs, the naive PSCs can be cultured in the presence of a commercially available cell culture medium (Small Airway Growth Medium; Cambrex, College Park, MD), or alternatively, in the presence of a conditioned medium collected from a pneumocyte cell line (e.g., the A549 human lung adenocarcinoma cell line) as described in Rippon HJ., et al., Proc Am Thorac Soc. 2008; 5: 717-722.
(495) To induce differentiation of naive hPSCs cells into neural cells, the pluripotent stem cells can be cultured for about 5 days in the presence of a serum replacement medium supplemented with TGF-b inhibitor (SB431542, Tocris; e.g., 10 nM) and Noggin (R&D; e.g., 500 ng/ml), following which the cells are cultured with increasing amounts (e.g., 25%, 50%, 75%, changed every two days) of N2 medium (Li XJ., et al., Nat Biotechnol. 2005, 23:215-21) in the presence of 500 ng/mL Noggin, essentially as described in Chambers SM., et al., Nat Biotechnol. 2009, 27: 275-280.
(496) The invention, according to some embodiments thereof, contemplates the use of cells, tissues and organs generated from the naive pluripotent stem cells of the invention using any differentiation protocol known in the art.
(497) It will be appreciated that since the lineage-specific cells or cell lines obtained according to the teachings of some embodiments of the invention are developed by differentiation processes similar to those naturally occurring in the human embryo they can be further used for human cell-based therapy and tissue regeneration.
(498) Thus, the invention according to some embodiments thereof envisages the use of the expanded and/or differentiated lineage-specific cells or cell lines of some embodiments of the invention for treating a disorder requiring cell replacement therapy.
(499) For example, diseases presently expected to be treatable by therapeutic transplantation of PSC or PSC-derived cells include Parkinson's disease, cardiac infarcts, juvenile-onset diabetes mellitus, and leukemia (Gearhart J. Science 1998, 282:1061; Rossant and Nagy, Nature Biotech. 1999, 17:23).
(500) For example, oligodendrocyte precursors can be used to treat myelin disorders (Repair of myelin disease: Strategies and progress in animal models. Molecular Medicine Today. 1997. pp. 554-561), chondrocytes or mesenchymal cells can be used in treatment of bone and cartilage defects (U.S. Pat. No. 4,642,120) and cells of the epithelial lineage can be used in skin regeneration of a wound or burn (U.S. Pat. No. 5,716,411).
(501) For certain disorders, such as genetic disorders in which a specific gene product is missing [e.g., lack of the CFTR gene-product in cystic fibrosis patients (Davies JC, 2002. New therapeutic approaches for cystic fibrosis lung disease. J. R.
(502) Soc. Med. 95 Suppl 41:58-67)], PSC-derived cells are preferably manipulated to over-express the mutated gene prior to their administration to the individual. It will be appreciated that for other disorders, the PSC-derived cells should be manipulated to exclude certain genes.
(503) Over-expression or exclusion of genes can be effected using knock-in and/or knock-out constructs [see for example, Fukushige, S. and Ikeda, J. E.: Trapping of mammalian promoters by Cre-lox site-specific recombination. DNA Res 3 (1996) 73-50; Bedell, M. A., Jerkins, N. A. and Copeland, N. G.: Mouse models of human disease. Part I: Techniques and resources for genetic analysis in mice. Genes and Development 11 (1997) 1-11; Bermingham, J. J., Scherer, S. S., O'Connell, S., Arroyo, E., Kalla, K. A., Powell, F. L. and Rosenfeld, M. G.: Tst-1/Oct-6/SCIP regulates a unique step in peripheral myelination and is required for normal respiration. Genes Dev 10 (1996) 1751-62].
(504) In addition to cell replacement therapy, the lineage specific cells of some embodiments of the invention can also be utilized to prepare a cDNA library. mRNA is prepared by standard techniques from the lineage specific cells and is further reverse transcribed to form cDNA. The cDNA preparation can be subtracted with nucleotides from embryonic fibroblasts and other cells of undesired specificity, to produce a subtracted cDNA library by techniques known in the art.
(505) The lineage specific cells of some embodiments of the invention can be used to screen for factors (such as small molecule drugs, peptides, polynucleotides, and the like) or conditions (such as culture conditions or manipulation) that affect the differentiation of lineage precursor to terminally differentiated cells. For example, growth affecting substances, toxins or potential differentiation factors can be tested by their addition to the culture medium.
(506) According to an aspect of some embodiments of the invention, there is provided a method of generating a primordial germ cell, comprising culturing primate naive pluripotent stem cells in a culture medium selected capable of inducing the primate naive pluripotent stem cells into primordial germ cell, wherein the culture medium comprises a Rho kinase (ROCK) inhibitor and bone morphogenetic protein 4 (BMP4), thereby generating the primordial germ cell.
(507) According to some embodiments of the invention, the primate naive pluripotent stem cell comprises: an unmethylated X-inactive specific transcript (XIST) gene, wherein: (i) when the naive PSC is a female PSC, then the naive female PSC has two unmethylated alleles of the XIST gene; and (ii) when the naive PSC is a male PSC, then the naive male PSC has an unmethylated allele of the XIST gene, and/or an expression level of transcription factor E3 (TFE3) characterized by a nucleus to cytoplasm expression ratio which is equal to or higher than 1 as determined by an immunostaining assay.
(508) According to some embodiments of the invention, the primordial germ cell is characterized by CD61 (intergrin beta 3) positive expression pattern.
(509) According to some embodiments of the invention, the primordial germ cell is characterized by CD61.sup.+/SSEA4.sup.+ expression pattern (expression signature).
(510) According to some embodiments of the invention, the culture medium selected capable of inducing the primate naive pluripotent stem cells into primordial germ cell further comprises at least one agent selected from the group consisting of: leukemia inhibitory factor (LIF), Stem Cell Factor (SCF) and Epidermal Growth Factor (EGF).
(511) According to an aspect of some embodiments of the invention, there is provided an isolated population of primate primordial germ cells comprising primate primordial germ cells generated according to the method of some embodiments of the invention.
(512) According to some embodiments of the invention, the isolated population of primate primordial germ cells comprising at least about 50%, e.g., at least about 60%, e.g., at least about 70%, e.g., at least about 80%, e.g., at least about 90%, e.g., at least about 95%, e.g., at least about 99%, e.g., 100% of primordial germ cells characterized by CD61.sup.+/SSEA4.sup.+ expression pattern.
(513) It should be noted that the isolated primordial germ cells (PGCs) of some embodiments of the invention can be injected into adult human testis or ovary to complete their maturation and generate sperm or eggs.
(514) According to an aspect of some embodiments of the invention, there is provided a method of treating a subject in need thereof, comprising administering the primordial germ cells of some embodiments of the invention to a gonad tissue of the subject, thereby treating the subject in need thereof.
(515) The term subject refers to a mammal, e.g., a primate, preferably a human being at any age which suffer from the pathology.
(516) The term treating refers to inhibiting, preventing or arresting the development of a pathology (disease, disorder or condition) and/or causing the reduction, remission, or regression of a pathology. Those of skill in the art will understand that various methodologies and assays can be used to assess the development of a pathology, and similarly, various methodologies and assays may be used to assess the reduction, remission or regression of a pathology.
(517) According to some embodiments of the invention, the subject suffers from infertility.
(518) According to an aspect of some embodiments of the invention, there is provided a kit comprising the primate primordial germ cells of some embodiments of the invention and a medicament for treating infertility.
(519) The kit may also include appropriate buffers and preservatives for improving the shelf-life of the kit.
(520) The kit may include appropriate instructions for use and labels indicating FDA approval for use in treating a subject, such as treating infertility in the subject.
(521) As shown in
(522) Thus, according to an aspect of some embodiments of the invention, there is provided a method of generating a chimeric animal. The method comprising introducing the isolated primate (e.g., human) naive PSC of some embodiments of the invention, or the primordial germ cells of some embodiments of the invention into a pre-implantation embryo of a host animal, thereby generating the chimeric animal.
(523) According to some embodiments of the invention, the method further comprising allowing the chimeric animal to grow in vivo or ex vivo.
(524) It should be noted that since the isolated naive pluripotent stem cells or the primordial germ cells are introduced into the pre-implantation embryo they are likely to form a normal embryo.
(525) As used herein, the phrase chimeric animal refers to an animal comprising cells of at least two genetically distinct individuals.
(526) As used herein, the term pre-implantation embryo refers to an embryo at an 8-cell stage, 16-cell stage embryo, early morula, late morula, early blastocyst, and/or a late blastocyst.
(527) It is noted that the chimeric animal can be composed of cells of two different individuals belonging to two different species, or to the same species.
(528) According to some embodiments of the invention, the isolated naive PSC or the primordial germ cell is allogeneic to the host animal.
(529) As used herein, the term alloegeneic refers to at least two genetically different individuals of the same species.
(530) According to some embodiments of the invention, the isolated naive PSC or the primordial germ cell is xenogeneic to the host animal.
(531) As used herein, the term xenogeneic refers to at least two individuals of different species.
(532) According to some embodiments of the invention, the host animal is not human.
(533) According to some embodiments of the invention, introducing the cells is performed in vivo.
(534) Methods of in vivo administration of cells into a morula of an animal are well known in the art, such as in Gafni O, Weinberger L, Mansour AA, Manor YS, Chomsky E, Ben-Yosef D, Kalma Y, Viukov S, Maza I, Zviran A, Rais Y, Shipony Z, Mukamel Z, Krupalnik V, Zerbib M, Geula S, Caspi I, Schneir D, Shwartz T, Gilad S, Amann-Zalcenstein D, Benjamin S, Amit I, Tanay A, Massarwa R, Novershtern N, Hanna JH. Nature. 2013 Dec. 12; 504(7479):282-6. doi: 10.1038/nature12745. Epub 2013 Oct 30.; and Manipulating the Mouse Embryo: A Laboratory Manual, Fourth Edition. By Richard Behringer; Marina Gertsenstein; Kristina Vintersten Nagy; Andras Nagy, each of which is fully incorporated herein by reference.
(535) According to some embodiments of the invention, introducing the cells is performed in vitro or ex vivo via direct injection or aggregation with the developing host embryo.
(536) According to some embodiments of the invention, the morula comprises at least 4 cells.
(537) According to some embodiments of the invention, the morula comprises no more than 128 cells.
(538) According to some embodiments of the invention, the host animal is a primate, e.g., a mammal.
(539) According to some embodiments of the invention, the host animal is mouse.
(540) According to some embodiments of the invention, the host animal is pig.
(541) According to some embodiments of the invention, the host animal is monkey.
(542) According to some embodiments of the invention, the host animal is chimpanzee.
(543) It should be noted that once the chimeric animal is formed, and allowed to grow, the cells of the chimeric animal can be used for cell therapy. For example, the mature differentiated cells (e.g., hematopoietic stem cells, liver hepatocytes, insulin producing Beta cells) generated in the chimeric animal based on some embodiments of the invention can be used for transplantation in adult humans or for biomedical applications.
(544) Thus, according to an aspect of some embodiments of the invention, there is provided a method of isolating differentiated cells, cell lineages, tissues or organs from the chimeric animal of some embodiments of the invention.
(545) Methods of isolating such differentiated cells, tissues or organs are well known in the art and are also described hereinabove.
(546) Thus, in case the naive PSCs that were used to form the chimeric animal are human cells, these cells can be further isolated from the formed chimeric animal and used for treating a human subject.
(547) According to some embodiments of the invention, the method further comprises isolating human-derived (human-originated) cells or tissues from the chimeric animal.
(548) Non-limiting examples of using such human-originated cells, tissues or organs include cell based therapy, tissue replacement, organ or tissue implantation.
(549) Following is a non-limiting description of expression vectors and modes of administering thereof into cells which can be used to express a polypeptide-of-interest (e.g., any of the proteins described hereinabove, e.g., OCT4, c-MYC, SOX2, KLF4, LIF, bFGF, TGF1) in a cell.
(550) To express an exogenous protein in mammalian cells, a polynucleotide sequence encoding the polypeptide-of-interest is preferably ligated into a nucleic acid construct suitable for mammalian cell expression. Such a nucleic acid construct includes a promoter sequence for directing transcription of the polynucleotide sequence in the cell in a constitutive or inducible manner.
(551) The nucleic acid construct (also referred to herein as an expression vector) of some embodiments of the invention includes additional sequences which render this vector suitable for replication and integration in prokaryotes, eukaryotes, or preferably both (e.g., shuttle vectors). In addition, a typical cloning vectors may also contain a transcription and translation initiation sequence, transcription and translation terminator and a polyadenylation signal. By way of example, such constructs will typically include a 5 LTR, a tRNA binding site, a packaging signal, an origin of second-strand DNA synthesis, and a 3 LTR or a portion thereof.
(552) The nucleic acid construct of some embodiments of the invention typically includes a signal sequence for secretion of the peptide from a host cell in which it is placed. Preferably the signal sequence for this purpose is a mammalian signal sequence or the signal sequence of the polypeptide variants of some embodiments of the invention.
(553) Eukaryotic promoters typically contain two types of recognition sequences, the TATA box and upstream promoter elements. The TATA box, located 25-30 base pairs upstream of the transcription initiation site, is thought to be involved in directing RNA polymerase to begin RNA synthesis. The other upstream promoter elements determine the rate at which transcription is initiated.
(554) Enhancer elements can stimulate transcription up to 1,000 fold from linked homologous or heterologous promoters. Enhancers are active when placed downstream or upstream from the transcription initiation site. Many enhancer elements derived from viruses have a broad host range and are active in a variety of tissues. For example, the SV40 early gene enhancer is suitable for many cell types. Other enhancer/promoter combinations that are suitable for some embodiments of the invention include those derived from polyoma virus, human or murine cytomegalovirus (CMV), the long term repeat from various retroviruses such as murine leukemia virus, murine or Rous sarcoma virus and HIV. See, Enhancers and Eukaryotic Expression, Cold Spring Harbor Press, Cold Spring Harbor, N.Y. 1983, which is incorporated herein by reference.
(555) In the construction of the expression vector, the promoter is preferably positioned approximately the same distance from the heterologous transcription start site as it is from the transcription start site in its natural setting. As is known in the art, however, some variation in this distance can be accommodated without loss of promoter function.
(556) Polyadenylation sequences can also be added to the expression vector in order to increase the efficiency of mRNA translation. Two distinct sequence elements are required for accurate and efficient polyadenylation: GU or U rich sequences located downstream from the polyadenylation site and a highly conserved sequence of six nucleotides, AAUAAA, located 11-30 nucleotides upstream. Termination and polyadenylation signals that are suitable for some embodiments of the invention include those derived from SV40.
(557) In addition to the elements already described, the expression vector of some embodiments of the invention may typically contain other specialized elements intended to increase the level of expression of cloned nucleic acids or to facilitate the identification of cells that carry the recombinant DNA. For example, a number of animal viruses contain DNA sequences that promote the extra chromosomal replication of the viral genome in permissive cell types. Plasmids bearing these viral replicons are replicated episomally as long as the appropriate factors are provided by genes either carried on the plasmid or with the genome of the host cell.
(558) The vector may or may not include a eukaryotic replicon. If a eukaryotic replicon is present, then the vector is amplifiable in eukaryotic cells using the appropriate selectable marker. If the vector does not comprise a eukaryotic replicon, no episomal amplification is possible. Instead, the recombinant DNA integrates into the genome of the engineered cell, where the promoter directs expression of the desired nucleic acid.
(559) The expression vector of some embodiments of the invention can further include additional polynucleotide sequences that allow, for example, the translation of several proteins from a single mRNA such as an internal ribosome entry site (IRES) and sequences for genomic integration of the promoter-chimeric polypeptide.
(560) It will be appreciated that the individual elements comprised in the expression vector can be arranged in a variety of configurations. For example, enhancer elements, promoters and the like, and even the polynucleotide sequence(s) encoding a the protein-of-interest can be arranged in a head-to-tail configuration, may be present as an inverted complement, or in a complementary configuration, as an anti-parallel strand. While such variety of configuration is more likely to occur with non-coding elements of the expression vector, alternative configurations of the coding sequence within the expression vector are also envisioned.
(561) Examples for mammalian expression vectors include, but are not limited to, pcDNA3, pcDNA3.1(+/), pGL3, pZeoSV2(+/), pSecTag2, pDisplay, pEF/myc/cyto, pCMV/myc/cyto, pCR3.1, pSinRep5, DH26S, DHBB, pNMT1, pNMT41, pNMT81, which are available from Invitrogen, pCI which is available from Promega, pMbac, pPbac, pBK-RSV and pBK-CMV which are available from Strategene, pTRES which is available from Clontech, and their derivatives.
(562) Expression vectors containing regulatory elements from eukaryotic viruses such as retroviruses can be also used. SV40 vectors include pSVT7 and pMT2. Vectors derived from bovine papilloma virus include pBV-1MTHA, and vectors derived from Epstein Bar virus include pHEBO, and p205. Other exemplary vectors include pMSG, pAV009/A.sup.+, pMTO10/A.sup.+, pMAMneo-5, baculovirus pDSVE, and any other vector allowing expression of proteins under the direction of the SV-40 early promoter, SV-40 later promoter, metallothionein promoter, murine mammary tumor virus promoter, Rous sarcoma virus promoter, polyhedrin promoter, or other promoters shown effective for expression in eukaryotic cells.
(563) As described above, viruses are very specialized infectious agents that have evolved, in many cases, to elude host defense mechanisms. Typically, viruses infect and propagate in specific cell types. The targeting specificity of viral vectors utilizes its natural specificity to specifically target predetermined cell types and thereby introduce a recombinant gene into the infected cell. Thus, the type of vector used by some embodiments of the invention will depend on the cell type transformed. The ability to select suitable vectors according to the cell type transformed is well within the capabilities of the ordinary skilled artisan and as such no general description of selection consideration is provided herein. For example, bone marrow cells can be targeted using the human T cell leukemia virus type I (HTLV-I) and kidney cells may be targeted using the heterologous promoter present in the baculovirus Autographa californica nucleopolyhedrovirus (AcMNPV) as described in Liang C Y et al., 2004 (Arch Virol. 149: 51-60).
(564) Recombinant viral vectors are useful for in vivo expression of the protein-of-interest since they offer advantages such as lateral infection and targeting specificity. Lateral infection is inherent in the life cycle of, for example, retrovirus and is the process by which a single infected cell produces many progeny virions that bud off and infect neighboring cells. The result is that a large area becomes rapidly infected, most of which was not initially infected by the original viral particles. This is in contrast to vertical-type of infection in which the infectious agent spreads only through daughter progeny. Viral vectors can also be produced that are unable to spread laterally. This characteristic can be useful if the desired purpose is to introduce a specified gene into only a localized number of targeted cells.
(565) Various methods can be used to introduce the expression vector of some embodiments of the invention into stem cells. Such methods are generally described in Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Springs Harbor Laboratory, New York (1989, 1992), in Ausubel et al., Current Protocols in Molecular Biology, John Wiley and Sons, Baltimore, Md. (1989), Chang et al., Somatic Gene Therapy, CRC Press, Ann Arbor, Mich. (1995), Vega et al., Gene Targeting, CRC Press, Ann Arbor Mich. (1995), Vectors: A Survey of Molecular Cloning Vectors and Their Uses, Butterworths, Boston Mass. (1988) and Gilboa et at. [Biotechniques 4 (6): 504-512, 1986] and include, for example, stable or transient transfection, lipofection, electroporation and infection with recombinant viral vectors. In addition, see U.S. Pat. Nos. 5,464,764 and 5,487,992 for positive-negative selection methods.
(566) Introduction of nucleic acids by viral infection offers several advantages over other methods such as lipofection and electroporation, since higher transfection efficiency can be obtained due to the infectious nature of viruses.
(567) Currently preferred in vivo nucleic acid transfer techniques include transfection with viral or non-viral constructs, such as adenovirus, lentivirus, Herpes simplex I virus, or adeno-associated virus (AAV) and lipid-based systems. Useful lipids for lipid-mediated transfer of the gene are, for example, DOTMA, DOPE, and DC-Chol [Tonkinson et al., Cancer Investigation, 14(1): 54-65 (1996)]. The most preferred constructs for use in gene therapy are viruses, most preferably adenoviruses, AAV, lentiviruses, or retroviruses. A viral construct such as a retroviral construct includes at least one transcriptional promoter/enhancer or locus-defining element(s), or other elements that control gene expression by other means such as alternate splicing, nuclear RNA export, or post-translational modification of messenger. Such vector constructs also include a packaging signal, long terminal repeats (LTRs) or portions thereof, and positive and negative strand primer binding sites appropriate to the virus used, unless it is already present in the viral construct. In addition, such a construct typically includes a signal sequence for secretion of the peptide from a host cell in which it is placed. Preferably the signal sequence for this purpose is a mammalian signal sequence or the signal sequence of the polypeptide variants of some embodiments of the invention. Optionally, the construct may also include a signal that directs polyadenylation, as well as one or more restriction sites and a translation termination sequence. By way of example, such constructs will typically include a 5 LTR, a tRNA binding site, a packaging signal, an origin of second-strand DNA synthesis, and a 3 LTR or a portion thereof. Other vectors can be used that are non-viral, such as cationic lipids, polylysine, and dendrimers.
(568) Other than containing the necessary elements for the transcription and translation of the inserted coding sequence, the expression construct of some embodiments of the invention can also include sequences engineered to enhance stability, production, purification, yield or toxicity of the expressed peptide. For example, the expression of a fusion protein or a cleavable fusion protein comprising the polypeptide-of-interest of some embodiments of the invention and a heterologous protein can be engineered. Such a fusion protein can be designed so that the fusion protein can be readily isolated by affinity chromatography; e.g., by immobilization on a column specific for the heterologous protein. Where a cleavage site is engineered between the protein-of-interest and the heterologous protein, the protein-of-interest can be released from the chromatographic column by treatment with an appropriate enzyme or agent that disrupts the cleavage site [e.g., see Booth et al. (1988) Immunol. Lett. 19:65-70; and Gardella et al., (1990) J. Biol. Chem. 265:15854-15859].
(569) As mentioned hereinabove, a variety of prokaryotic or eukaryotic cells can be used as host-expression systems to express the polypeptides of some embodiments of the invention. These include, but are not limited to, microorganisms, such as bacteria transformed with a recombinant bacteriophage DNA, plasmid DNA or cosmid DNA expression vector containing the coding sequence; yeast transformed with recombinant yeast expression vectors containing the coding sequence; plant cell systems infected with recombinant virus expression vectors (e.g., cauliflower mosaic virus, CaMV; tobacco mosaic virus, TMV) or transformed with recombinant plasmid expression vectors, such as Ti plasmid, containing the coding sequence. Mammalian expression systems can also be used to express the polypeptides of some embodiments of the invention.
(570) Examples of bacterial constructs include the pET series of E. coli expression vectors [Studier et al. (1990) Methods in Enzymol. 185:60-89).
(571) In yeast, a number of vectors containing constitutive or inducible promoters can be used, as disclosed in U.S. Pat. No. 5,932,447. Alternatively, vectors can be used which promote integration of foreign DNA sequences into the yeast chromosome.
(572) In cases where plant expression vectors are used, the expression of the coding sequence can be driven by a number of promoters. For example, viral promoters such as the 35S RNA and 19S RNA promoters of CaMV [Brisson et al. (1984) Nature 310:511-514], or the coat protein promoter to TMV [Takamatsu et al. (1987) EMBO J. 6:307-311] can be used. Alternatively, plant promoters such as the small subunit of RUBISCO [Coruzzi et al. (1984) EMBO J. 3:1671-1680 and Brogli et al., (1984) Science 224:838-843] or heat shock promoters, e.g., soybean hsp17.5-E or hsp17.3-B [Gurley et al. (1986) Mol. Cell. Biol. 6:559-565] can be used. These constructs can be introduced into plant cells using Ti plasmid, Ri plasmid, plant viral vectors, direct DNA transformation, microinjection, electroporation and other techniques well known to the skilled artisan. See, for example, Weissbach & Weissbach, 1988, Methods for Plant Molecular Biology, Academic Press, NY, Section VIII, pp 421-463.
(573) Other expression systems such as insects and mammalian host cell systems which are well known in the art and are further described hereinbelow can also be used by some embodiments of the invention.
(574) Transformed cells are cultured under effective conditions, which allow for the expression of high amounts of the recombinant polypeptide-of-interest (e.g., the LIF, TGF1, bFGF, OCT4, c-myc, SOX2, KLF-4). Following a predetermined time in culture, recovery of the recombinant polypeptide is effected. The phrase recovery of the recombinant polypeptide used herein refers to collecting the whole fermentation medium containing the polypeptide and need not imply additional steps of separation or purification.
(575) Thus, polypeptide-of-interest can be purified using a variety of standard protein purification techniques, such as, but not limited to, affinity chromatography, ion exchange chromatography, filtration, electrophoresis, hydrophobic interaction chromatography, gel filtration chromatography, reverse phase chromatography, concanavalin A chromatography, chromatofocusing and differential solubilization.
(576) The polypeptide-of-interest is preferably retrieved in substantially pure form.
(577) As used herein, the phrase substantially pure refers to a purity that allows for the effective use of the polypeptide-of-interest (e.g., the LIF, TGF1, bFGF) in maintaining the human embryonic stem cells in an undifferentiated state while in culture.
(578) As used herein the term about refers to 10%.
(579) The terms comprises, comprising, includes, including, having and their conjugates mean including but not limited to.
(580) The term consisting of means including and limited to.
(581) The term consisting essentially of means that the composition, method or structure may include additional ingredients, steps and/or parts, but only if the additional ingredients, steps and/or parts do not materially alter the basic and novel characteristics of the claimed composition, method or structure.
(582) As used herein, the singular form a, an and the include plural references unless the context clearly dictates otherwise. For example, the term a compound or at least one compound may include a plurality of compounds, including mixtures thereof.
(583) Throughout this application, various embodiments of this invention may be presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the invention. Accordingly, the description of a range should be considered to have specifically disclosed all the possible subranges as well as individual numerical values within that range. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual numbers within that range, for example, 1, 2, 3, 4, 5, and 6. This applies regardless of the breadth of the range.
(584) Whenever a numerical range is indicated herein, it is meant to include any cited numeral (fractional or integral) within the indicated range. The phrases ranging/ranges between a first indicate number and a second indicate number and ranging/ranges from a first indicate number to a second indicate number are used herein interchangeably and are meant to include the first and second indicated numbers and all the fractional and integral numerals therebetween.
(585) As used herein the term method refers to manners, means, techniques and procedures for accomplishing a given task including, but not limited to, those manners, means, techniques and procedures either known to, or readily developed from known manners, means, techniques and procedures by practitioners of the chemical, pharmacological, biological, biochemical and medical arts.
(586) As used herein, the term treating includes abrogating, substantially inhibiting, slowing or reversing the progression of a condition, substantially ameliorating clinical or aesthetical symptoms of a condition or substantially preventing the appearance of clinical or aesthetical symptoms of a condition.
(587) It is appreciated that certain features of the invention, which are, for clarity, described in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the invention, which are, for brevity, described in the context of a single embodiment, may also be provided separately or in any suitable subcombination or as suitable in any other described embodiment of the invention. Certain features described in the context of various embodiments are not to be considered essential features of those embodiments, unless the embodiment is inoperative without those elements.
(588) Various embodiments and aspects of the present invention as delineated hereinabove and as claimed in the claims section below find experimental support in the following examples.
EXAMPLES
(589) Reference is now made to the following examples, which together with the above descriptions illustrate some embodiments of the invention in a non limiting fashion.
(590) Generally, the nomenclature used herein and the laboratory procedures utilized in the present invention include molecular, biochemical, microbiological and recombinant DNA techniques. Such techniques are thoroughly explained in the literature. See, for example, Molecular Cloning: A laboratory Manual Sambrook et al., (1989); Current Protocols in Molecular Biology Volumes I-III Ausubel, R. M., ed. (1994); Ausubel et al., Current Protocols in Molecular Biology, John Wiley and Sons, Baltimore, Maryland (1989); Perbal, A Practical Guide to Molecular Cloning, John Wiley & Sons, New York (1988); Watson et al., Recombinant DNA, Scientific American Books, New York; Birren et al. (eds) Genome Analysis: A Laboratory Manual Series, Vols. 1-4, Cold Spring Harbor Laboratory Press, New York (1998); methodologies as set forth in U.S. Pat. Nos. 4,666,828; 4,683,202; 4,801,531; 5,192,659 and 5,272,057; Cell Biology: A Laboratory Handbook, Volumes I-III Cellis, J. E., ed. (1994); Current Protocols in Immunology Volumes I-III Coligan J. E., ed. (1994); Stites et al. (eds), Basic and Clinical Immunology (8.sup.th Edition), Appleton & Lange, Norwalk, CT (1994); Mishell and Shiigi (eds), Selected Methods in Cellular Immunology, W. H. Freeman and Co., New York (1980); available immunoassays are extensively described in the patent and scientific literature, see, for example, U.S. Pat. Nos. 3,791,932; 3,839,153; 3,850,752; 3,850,578; 3,853,987; 3,867,517; 3,879,262; 3,901,654; 3,935,074; 3,984,533; 3,996,345; 4,034,074; 4,098,876; 4,879,219; 5,011,771 and 5,281,521; Oligonucleotide Synthesis Gait, M. J., ed. (1984); Nucleic Acid Hybridization Hames, B. D., and Higgins S. J., eds. (1985); Transcription and Translation Hames, B. D., and Higgins S. J., Eds. (1984); Animal Cell Culture Freshney, R. I., ed. (1986); Immobilized Cells and Enzymes IRL Press, (1986); A Practical Guide to Molecular Cloning Perbal, B., (1984) and Methods in Enzymology Vol. 1-317, Academic Press; PCR Protocols: A Guide To Methods And Applications, Academic Press, San Diego, CA (1990); Marshak et al., Strategies for Protein Purification and CharacterizationA Laboratory Course Manual CSHL Press (1996); all of which are incorporated by reference as if fully set forth herein. Other general references are provided throughout this document. The procedures therein are believed to be well known in the art and are provided for the convenience of the reader. All the information contained therein is incorporated herein by reference.
(591) General Materials and Experimental Methods
(592) Mouse stem cell lines and cell cultureReprogramming and maintenance of murine naive pluripotent cells were conducted in serum-free chemically defined N2B27-based media: 240 ml DMEM/F12 (Biological Industriescustom made), 240 ml Neurobasal (Invitrogen; 21103), 5 ml N2 supplement (Invitrogen; 17502048), 5 ml B27 supplement (Invitrogen; 17504044), 15% knockout serum replacement (Invitrogen10828), 1 mM glutamine (Invitrogen), 1% nonessential amino acids (Invitrogen), 0.1 mM -mercaptoethanol (Sigma), penicillin-streptomycin (Invitrogen), 5 mg/ml BSA (Sigma). Naive conditions for murine PSCs included 10 ng/ml recombinant human LIF (Millipore; LIF1005) (5 g per 500 ml). Where indicated 2i inhibitors the following agents were added: small-molecule inhibitors CHIR99021 (CH, 3 MAxon Medchem) and PD0325901 (PD, 1 MTOCRIS).
(593) The 2i was added 48 hours after OSKM induction. Primed N2B27 media for murine cells (EpiSCs) contained 8 ng/ml recombinant human bFGF (Peprotech Asia) and 20 ng/ml recombinant human Activin (Peprotech Asia).
(594) Stem cell lines and mice deficient for Mbd3 and their derived ES lines were obtained as previously described (Kaji et al., 2007) (Mbd3.sup.flox/f.sup.loX, Mbd3.sup.flox/ and Mbd3.sup.+ i-) (Kaji et al., 2006). For additional gene targeting of mouse pluripotent stem cell lines (Nanog-GFP reporter, pBRY-Mbd3 rescue constructs, Rosa26-CreER) 50 g DNA of the targeting construct was linearized and electroporated into the indicated pluripotent cell lines, that were then subjected to selection with G418 (300 microg/ml) or Puromycin (1 microg/ml). After 10 days of antibiotic selection, drug resistant clones were analyzed for correct targeting by PCR or Southern blot analysis.
(595) Mbd3Utx.sup.+/ males and females for ESC derivation in defined mouse 2i/LIF conditions were mated and E3.5 blastocysts were harvested and explanted for ESC derivation in defined mouse 2i/LIF conditions on MEF coated plates.
(596) NGFP1-Mbd3.sup.KD was established by infection and sub cloning of secondary NGFP1 iPSC line with a ShRNA pLKO-Tet-On vector (addgene) as previously described (Hanna, J. et al. Nature 462, 595-601, 2009). V6.5 mouse ESCs harboring a Flag-tagged endogenous Oct4 allele (
(597) Epigenetic reversion of mouse primed epiblast cellsMale naive V6.5 (Mbd3.sup.+/+) Nanog-GFP ESCs (Mansour et al., 2012) cells maintained in 2i/LIF conditions, were injected into BDF2 blastocysts and Epiblast. Chimeric embryos were dissected at day E6.5 and explanted on gelatin/vitronectin-coated plates in N2B27 bFGF/Activin conditions supplemented with 1 g/ml puromycin, allowing the isolation of Nanog-GFP EpiSCs. For epigenetic reversion of murine EpiSCs to naive pluripotency, cells were passaged into N2B27 2i/LIF conditions on vitronectin (1 g/ml) and gelatin (0.2%) coated plates (without overexpression of exogenous reprogramming factors). When epigenetic reversion assay involved single cell plating, EpiSC growth medium was supplemented with ROCK inhibitor for 24 hours before trypsinization. siRNAs (ON-TARGETplus SMARTpools) and the control siRNA (ON-TARGETplus Non-targeting pool D-001810-10-05) were purchased from Dharmacon. 10 nM siRNA or control was used for each transfection with Lipofectamine RNAiMAX (Invitrogen).
(598) For EG (mouse embryonic germ cells) derivation experiments, Oct4-GFP.sup.+ PGC (Primordial Germ Cells) cells were sorted from E8.5 dissected chimeric embryos and single plated in N2B27 15% KSR, LIF (20 ng/ml)/SCF (10 ng/ml)/bFGF (8 ng/ml) medium and 2i (supplemented 48 hours later). Nuclear mCherry labeling of EpiSCs and their derived PGCs was used to allow calculating plating efficiency and calculate reprogramming efficiency (reprogramming efficiency %=Oct4 or Nanog-GFP clones/mCherry+ clones).
(599) OKSMfactors: Oct4 (SEQ ID NO:54 protein), Sox2 (SEQ ID NO:56 protein), c-Myc (SEQ ID NO:60 protein) and Klf4 (SEQ ID NO:58 protein).
(600) Reprogramming of mouse somatic cells and cell infectionVirus-containing supernatants of the different reprogramming viruses (STEMCA-OKSM polycistronic vector (SEQ ID NO:62) (Dox inducible and constitutive expression) (Mansour et al., 2012), STEMCCA-OKS polycistronic vector (DOX inducible and constitutive expression), FUW-tetO-lox-hKLF4, FUW-tetO-lox-hOCT4 and FUW-tetO-lox-hSOX2, FUW-tetO-mKlf4, FUW-tetO-mOct4, FUW-tetO-mSox2, FUW-tetO-c-Myc, FUW-Oct4-2A-Sox2, FUW-Oct4-2A-Klf4, FUW-tetO-lox-SOX2, pMXs-OCT4, pMXs-SOX2, pMXs-KLF4, pMXs-cMYC) was supplemented with the FUW-lox-M2rtTA virus (when necessary) and an equal volume of fresh culture medium for infection. Mouse fibroblast and other somatic cells types were isolated and single cell sorted from secondary transgenic reprogrammable chimeras (Hanna et al., 2009a; Mansour et al., 2012). Secondary transgenic mouse somatic cells carrying DOX inducible OSKM encoding transgene (Hanna et al. Cell 2008, Mansour et al. Nature 2012) were reprogrammed by applying mouse naive ESCs medium+ Doxycycline (DOX) (without 2i in the first 48 hours and then adding also 2i until completion of process). Human iPSC reprogramming was applied by lentiviral infection of human differentiated cells with OSKM encoding lentivirus and applying WIS-NHSM conditions starting from 48 hours after infection. iPSCs reprogramming by using mouse naive ESCs medium 2i/LIF+ DOX (1 g/ml) (without 2i in the first 48 hours) under physiological 5% O.sub.2 conditions.
(601) Mbd3.sup./ MEF (but not pluripotent cells) experience accelerated senescence and proliferation capacity loss, and thus Mbd3.sup./ cells were reprogrammed by applying tamoxifen on Mbd3.sup.flox/ cells after 48 hours of OSKM induction. Similarly, for acute knockdown of Mbd3 in somatic cells with Mbd3 siRNAs in an attempt to boost reprogramming, transfection were conducted at least after 48 hours of OSKM induction. Alternatively, somatic cells with hypomorphic expression (rather than complete ablation) of Mbd3 do not demonstrate proliferation defects or accelerated senescence due to the residual Mbd3 expression levels, yet they retain sufficiently reduced Mbd3 levels that allow deterministic synchronized reprogramming by OSKM (
(602) DNA plasmids and TALEN gene editingThe following lentiviral and mammalian constitutive over-expression vectors were used in somatic and pluripotent cells: pBRY-Mbd3-Ires-Zeocin. Constitutively expressed lenti-viruses FUW-Mbd2 and FUW-Mbd3 were generated by insert cloning into EcoRI sites of FUW vector to generate constitutive expression following viral transduction and stable integration in somatic or PSC lines.
(603) Flag-Mbd3 mutations and deletions were done by PCR with Q5 DNA polymerase (NEB). TALEN expressing plasmids were designed with a help of TALEN targeter 2.0 [talent (dot) cac (dot) cornell (dot) edu/] and cloned using GoldenGate TALEN kit 2.0 purchased from Addgene (Bedell, V M, et al. Nature 491: 114-8, 2012) according to the published protocol. For targeting G the present inventors have used NN-type repeat. Donor construct was made with DNA fragments amplified from WIBR3 HUMAN ESC genomic DNA. 10.sup.7 ESCS were electroporated with 30 g of donor plasmid and 10 g of each of the TALEN expressing plasmids and grown in the presence of G418 (75 g/ml) and Oiclovir (1 M). Resistant clones were isolated and genomic DNA was extracted for Southern Blot and PCR analysis. For generating OCT4-GFP reporter subcloned cell lines, 10.sup.7 MBD3.sup.+/+ and MBD3.sup.flox/ iPSCs were electroporated with 30 g of previously described OCT4-GFP-2A-PURO knock-in donor plasmid (Hockemeyer, D. et al. Nat Biotechnol 29, 731-734, 2011; kindly provided by Prof. Jaenisch through Addgene) and 10 g of each of the TALEN expressing plasmids and grown in the presence of Puromycin (0.4 g/ml). Resistant clones were isolated and genomic DNA was extracted for Southern Blot and PCR analysis. In vitro differentiated fibroblasts from human ESCs/iPSCs were generated as previously described (Hockemeyer, D. et al. Cell Stem Cell 3, 346-353, 2008).
(604) Reprogramming of human somatic cells and cell infectionReprogramming was conducted at 5% pO.sub.2 in DOX (1-2 g/ml) supplemented conditions: 1) First 48 hours cells were incubated in conventional human ES medium (hESMsee below). 2) After 48 hours, cells were transferred until day 7-8 to naive defined growth conditions termed WIS-NHSM (see below) and supplemented with ROCKi (5 mM final concentration). 3) After 8 days DOX was withdrawn and cells were expanded in WIS-NHSM conditions. MBD3 Stealth siRNAs that includes HSS147580, HSS147581 components (Cat. #1299003) were used for efficient MBD3 knockdown in human cells. Transfections were conducted with RNAiMAX (Invitrogen) according to manufacturer instructions.
(605) Conventional human ES conditions (hESM) include: 475 ml Knockout DMEM (Invitrogen 10829), 15% KSR (Invitrogen), 8 ng/ml recombinant bFGF (Peprotech) and 1 ng/ml recombinant TGFP 1 (Peprotech), 1 mM glutamine (Invitrogen), 1% nonessential amino acids (Invitrogen), 0.1 mM -mercaptoethanol (Sigma), Penicillin-Streptomycin (Invitrogen).
(606) The following serum free defined conditions, termed WIS-NHSM (Weizmann Institute of Science Naive human Stem cell Medium) were used to isolate, generate, derive and stabilize naive human pluripotent stem cells (PSCs and ESCs). WIS-NHSM media was generated by including: 475 ml Knockout DMEM (Invitrogen 10829), 15% KSR (Invitrogen) or 5 gr AlbuMAX (Invitrogen 11020-021), 5 ml N2 supplement (Invitrogen 17502048), 10 g of recombinant human LIF (Peprotech), 8 ng/ml recombinant bFGF (Peprotech), 1 ng/ml recombinant TGFP1 (Peprotech), 1 mM glutamine (Invitrogen), 1% nonessential amino acids (Invitrogen), 0.1 mM -mercaptoethanol (Sigma), Penicillin-Streptomycin (Invitrogen) and small molecule inhibitors: PD0325901 (1 M, ERK1/2i, AXON MEDCHEM); CHIR99021 (3 M, GSK3i, AXON MEDCHEM); SB203580 (5 M, p38i, TOCRIS); SP600125 (10 M, JNKi, TOCRIS). Throughout the study Naive hESCs/hiPSCs were grown on 0.2% gelatin+1 ng/ml vitronectin coated plates for at least 1 hour in 37 C. Cells were passage by single cell trypsinization (0.25% or 0.05% Trysin+ EDTA) every 3-4 days. Although not essential, enhanced single cell cloning efficiency can be obtained with WIS-NHSM supplementation with ROCK pathway inhibitor Y-27632 (5 M, ROCKi Axon Medchem) for 24 hours before and after cell passaging.
(607) Immunofluorescence staining of pre- and post-implantation embryosFor pre-implantation, oocytes and one-cell embryos were collected from the oviducts of hormone-primed B6D2F1 mice, and cultured in KSOM (Millipore) until desired stage. Immunostaining was performed as described previously with modifications (Silva, J. et al. Cell 138, 722-737, 2009). Briefly, The zona pellucida was removed using acid Tyrode's solution (Sigma). Embryos were transferred to watch-glass dish (Genenet), fixed for 15 minutes in 4% PFA in phosphate buffer (PB), rinsed three times in PBS containing 3 mg/ml PVP, permeabilized in PBS/PVP with 1% triton X-100 for 30 minutes, and blocked in blocking solution (2% normal donkey serum, 0.05% BSA, 0.01% Tween in PBS) for 1 hour. Embryos were then incubated overnight at 4 C. in primary antibodies diluted in blocking solution, washed three times in blocking solution for 15 minutes each, incubated with secondary antibodies for 1 hour at room temperature, counterstained with DAPI for 15 minutes, washed twice in PBS, and mounted in 96 well glass bottom plates for confocal imaging. Post-implantation embryos were fixed and embedded in paraffin as described previously (Acampora, D., et al. Development. 1997; 124:3639-50) with modification. Embryos in the maternal decidua, were fixed in 4% PFA/PB overnight at 4 C., washed 3 times in PBS for 30 minutes each, dehydrated and embedded in paraffin using standard procedure. Embryonic Paraffin sections (5-7 m) were rehydrated, treated with antigen retrieval, rinsed in PBS, permeabilized in 0.1% Triton/PBS for 10 minutes, rinsed in PBT (0.02% Tween/PBS), and blocked in blocking solution (5% normal donkey serum, 0.05% BSA, in PBT) for 1 hour. Slides were then incubated in the appropriate primary and secondary antibodies diluted in blocking solution as described above, and processed as described previously (Mansour, A A, et al. Nature 488, 409-413, 2012). The following antibodies were used: mouse anti-Oct4 (1:100, C-10; Santa Cruz SC-5279), goat anti-Mbd3 (1:50, C-18; Santa Cruz SC9402).
(608) Immunoprecipitation and immunoblotting analysesHEK293T cells were transfected with each cDNA clones in an expression vector using jetPEI (Polyplus transfection) and were lysed 48 hours later in lysis buffer (50 mM Tris-HCl pH 7.4, 150 mM NaCl, 1% Triton, 0.1% NP40 and 1.5 mM EDTA). The following plasmids were used for transfections in different combinations: pCaggs-Mbd3, FUW-Oct4, FUW-Klf4, FUW-Sox2, FUW-c-Myc, FUW-Nanog, pCaggs-Flag-Mbd3, pMSCV-Flag-OCT4, pMSCV-Flag-SOX2, pMSCV-Flag-KLF4, pCaggs-Flag-c-Myc, pCaggs-Flag-Nanog, pcDNA3.1-Flag-HDAC1 (obtained through addgene). 30 1 of anti-FlagM2 Magnetic beads (Sigma) were incubated for 6 hours in cell lysate fractions, for IgG control 6 g of IgG and 50 1 of protein-G Dynabeads (Invitrogen) were added to the cell lysate for 6 hours. Both fractions (the anti-flag and anti-IgG) were loaded on Invitrogen magnetic separator and the beads were washed six times with lysis buffer. The binding proteins were eluted with 0.5 g/ml of X3Flag peptide (sigma) buffer for the anti-flagM2 beads or by boiling with sample buffer and analyzed by SDS-polyacrylamide gel electrophoresis and immunoblotting. The immunoblot analyses were performed using the following primary antibodies: anti-Flag (clone M2, F3165, Sigma), anti-Mbd3 (A300-258A, Bethyl), anti-Nanog (A300-397A, Bethyl), anti-OCT4 (sc-9081, H134, Santa Cruz), anti-KLF4 (sc20691,H180, Santa Cruz), anti-SOX2 (#2748s, Cell signaling), anti-c-Myc (#9402s, Cell signaling)
(609) Primordial germ cell (PGC) isolation differentiationFor EG derivation experiments, Oct4-GFP.sup.+ cells were sorted from E8.5 dissected chimeric embryos and single plated in N2B27 2i/LIF/SCF (10 ng/ml)/bFGF (8 ng/ml) medium.
(610) RT-PCR analysisTotal RNA was isolated using the RNeasy Kit (Qiagen). Three g of total RNA was treated with DNase I to remove potential contamination of genomic DNA using a DNA Free RNA kit (Zymo Research). 1 g of DNase-I-treated RNA was reverse transcribed using a First Strand Synthesis kit (Invitrogen) and ultimately re-suspended in 100 l of water. Quantitative PCR analysis was performed in triplicate using 1/50 of the reverse transcription reaction in an Viia7 platform (Applied Biosystems). Error bars indicate standard deviation of triplicate measurements for each measurement.
(611) For single cell RT-PCR analysis, single cells from different samples were single cell sorted, and Ambion Single Cell-to-CT Kit was used for sample processing according to Manufacturer Instructions. TaqMan probe based chemistry and TaqMan Real-Time PCR master mix were used on Viia7 platform for gene expression detection. The following TaqMan (Invitrogen) probes were used: Sa114 Mm00453037_s1, Esrrb Mm00442411_ml, Utf1 Mm00447703_g1; Sox2 (endogenous mouse allele specific) Mm03053810_s1; Nanog Mm02384862_g1; Gapdh Mm99999915_g1. C.sub.T cutoff of 39 cycles was used as threshold for defining transcript detection.
(612) Knock down of human mbd3 by siRNAThe present inventors used for human cells siRNA the Stealth from Invitrogen, with the following catalogue numbers: Cat. No/Lot -10620318/168750 F02 MBD3HSS147581 (3_RNAI) for-AGGUCAAGGGCAAGCCCGACCUGAA (SEQ ID NO:52), and Cat. No/Lot -10620319/168750 F03 MBD3HSS147581 (3_RNAI) for-UUCAGGUCGGGCUUGCCCUUGACCU (SEQ ID NO:53).
(613) Knock down of mouse mbd3 by shRNAFor mouse cells the present inventors used the pLKO.1 lentiviral or the pLKO-Tet-On systems with the following sequences:
(614) TABLE-US-00001 TRCN0000039069F- (SEQIDNO:63) CCGGCTAAGTGGATTGAGTGCCTTTCTCGAGAAAGG CACTCAATCCACTTAGTTTTTG and theTRCN0000039069R- (SEQIDNO:64) AATTCAAAAACTAAGTGGATTGAGTGCCTTTCTCGA GAAAGGCACTCAATCCACTTAG; or theTRCN0000039071F|- (SEQIDNO:65) CCGGGCGCTATGATTCTTCCAACCACTCGAGTGGTT GGAAGAATCATAGCGCTTTTTG and theTRCN0000039071R- (SEQIDNO:66) AATTCAAAAAGCGCTATGATTCTTCCAACCACTCGA GTGGTTGGAAGAATCATAGCGC.
(615) Microscopy image acquisition and analysisSecondary OKSM inducible Mbd3.sup.+/+ and Mbd3.sup.flox/ MEFs carrying Oct4-GFP pluripotency reporter and constitutively expressed nuclear mCherry marker, were plated in 12-well plates at low densities (150 cells per well) and imaged using AxioObserver Z1 (Zeiss) in %5 O.sub.2, %5 CO.sub.2, 37 C. controlled conditions. Plates were taken out at day 3-4 for media replacement (but without passaging/splitting) and put back for the automated live imaging stage. Full well mosaic images were taken every 12 hours for 6 days at 5 magnification, including phase contrast and two fluorescent wavelength images. In house automated segmentation protocol was developed and implemented in Matlab to analyze time-lapse measurements of full well mosaics with fluorescent mCherry and Oct4-GFP markers.
(616) The challenge in this protocol was to implement fast segmentation of unknown number of colonies in 10.sup.8 pixels mosaic image. Main protocol steps (as shown in
(617) Adaptive Detection: Erasing the plate margins with circular filter. Defining detection threshold using median with offset (10% of the dynamic_range), and creating a binary image of detected pixels. These steps were carried out separately for each time-point and each fluorescent wavelength.
(618) Complexity Reduction: For this task the present inventors applied a morphological filter to isolate mCherry colonies using median sliding filter (60 [m]*60 [m]) (Arce, G. R. Nonlinear Signal Processing: A Statistical Approach -Gonzalo R. ArceGoogle Books, 2005). This filter retains only dense colonies, erasing noise and single isolated cells (a single nucleus is approximately 6 [um]*6 [um]), this step is crucial for reducing the dimension of the clustering task.
(619) Colony Segmentation: The segmentation was done using Moving average filter (Low-pass filter) (60 [um]*60 [um]) (Arce, G. R. Nonlinear Signal Processing: A Statistical ApproachGonzalo R. ArceGoogle Books, 2005) to merge adjacent colony fragments into large connected colonies and then apply connected components clustering, labeling connected objects using 8-connected neighborhood.
(620) Colony Feature Extraction: Extracting the features of each mCherry colony including area, bounding box and centroid. By overlay mCherry colony segmentation on the GFP binary image (detected pixels) the present inventors extract for each colony the GFP.sup.+ indicator (0/1) and the fraction of GFP.sup.+ and mCherry* pixels out of all mCherry* pixels.
(621) This segmentation protocol was run over time-lapse mosaics collecting information on colony formation dynamics, colony GFP.sup.+ dynamics and ratios of offspring Oct4-GFP.sup.+ cells. Colony and reprogramming dynamics features were then statistically analyzed using Matlab program, including estimation of the cumulative distribution, density function and box-plot graphical interpretation (
(622) Chromatin Immuno-precipitation and Sequencing Library Preparation (for Examples 1-4 hereinbelow)Chromatin Immuno-precipitation followed by deep sequencing (ChIP-Seq) was measured for the following proteinsH3K4me3, H3K27me3, H3K27ac and Mbd3in 4 different time points throughout reprogramming: 0 (MEF), 4 days, 8 days, iPS. The binding of each protein was measured in both Mbd3.sup.+/+ and Mbd3.sup.flox/ conditions, as well as in Mbd3.sup./ ES cells. Oct4 was measured in all the above conditions, excluding 8 day. Approximately 40*10.sup.6 cells were cross-linked in formaldehyde (1% final concentration, 10 minutes at room temperature (RT)), and then quenched with glycine (5 minutes at RT). Fixed cells were lysed in 50 mM HEPES KOH pH 7.5, 140 mM NaCl, 1 mM EDTA, 10% Glycerol, 0.5% NP-40 alternative, 0.25% Triton supplemented with protease inhibitor at 4 C. (Roche, 04693159001), centrifuged at 950g for 10 minutes and re-suspended in 0.2% SDS, 10 mM EDTA, 140 mM NaCl and 10 mM Tris-HCL. Cells were then fragmented with a Branson Sonifier (model S-450D) at 4 C. to size ranges between 200 and 800 b, nd precipitated by centrifugation. 10 g of each antibody was pre-bound by incubating with Protein-G Dynabeads (Invitrogen100-07D) in blocking buffer (PBS supplemented with 0.5% TWEEN and 0.5% BSA) for 2 hours at room temperature. Washed beads were added to the chromatin lysate, and then incubated overnight. Samples were washed 5 times with RIPA buffer, twice with RIPA buffer supplemented with 500 mM NaCl, twice with LiCi buffer (10 mM TE, 250 mM LiCl, 0.5% NP-40, 0.5% DOC), once with TE (10 mM Tris-HCl pH 8.0, 1 mM EDTA), and then eluted in 0.5% SDS, 300 mM NaCl, 5 mM EDTA, 10 mM Tris Hcl pH 8.0 at 65 C. Eluate was incubated in 65 C. for 8 hours, and then treated sequentially with RNaseA (Roche, 11119915001) for 30 minutes and Proteinase K (NEB, P8102S) for two hours. DNA was purified with The Agencourt AMPure XP system (Beckman Coulter Genomics, A63881). Libraries of cross reversed ChIP DNA samples were prepared according to a modified version of the Illumina Genomic DNA protocol, as described previously .sup.75 (Blecher-Gonen, R., et al. Nat. Protoc. 2013, 8: 539-54). Briefly, ChIP DNA was ligated to Illumina adaptors and subjected to 14 cycles of PCR amplification. Amplified products between 200 and 800 bp were purified on a 2% agarose gel. Roughly 5 picomoles of DNA library was then applied to each lane of the flow cell and sequenced on Illumina Hiseq2000 sequencer according to standard Illumina protocols. The following antibodies were used for chromatin-IP experiments: Control IgG (ChIP grade, ab46540, Abcam), Anti-Histone H3 tri methyl K4 (ChIP grade, ab8580, Abcam), Anti-Histone H3 acetyl K27 (ChIP grade, ab4729, Abcam), anti-Histone H3 tri methyl K27 (ChIP grade, 07-449, Millipore), anti-Oct4 (sc5729 (C-10), Santa Cruz), anti-Chd4 (ChIP Grade, ab70469, Abcam). For Mbd3 chip 1:1 antibody mix was used: anti-Mbd3 (Bethyl laboratories A302-5289A) and anti-Mbd3 (ab16057, Abcam).
(623) Alignment and Peak DetectionThe present inventors used bowtie software (Langmead, B., Trapnell, C., Pop, M. & Salzberg, S. L. Ultrafast and memory-efficient alignment of short DNA sequences to the human genome. Genome Biol. (2009)) version 0.12.5 to align reads to mouse mm9 reference genome (UCSC, July 2007). The present inventors only considered reads that were uniquely aligned to the genome with up to a single mismatch, taking the single best match of each read. The present inventors identified enriched intervals of H3K4me3, H3K27me3, H3K27ac, Mbd3 and Oct4 using MACS version 1.4.1 (Zhang, Y., et al. Genome Biol. 2008, 9(9):R137). The present inventors used sequencing of whole cell extract as control in order to define a background model. Duplicate reads aligned to the exact same location are excluded by MACS default configuration. Enriched intervals were mapped to genes if they overlapped a single Kb symmetric interval around their Transcription Start Sites (Taken from RefSeq known gene table in UCSC genome browser). ChIP-seq data on wild-type samples were highly reproducible in comparison to previous publications (Sridharan, R., et al. Cell 36(2):364-77, 2009; Mikkelsen, T. S. et al. Nature 454, 49-55, 2008) (data not shown).
(624) Motif detection (
(625) Histone mark profiles (Figures C-E)were calculated using in-house script. Shortly, this script generates a matrix of read densities in given genomic intervals. In this case, the profiles of all 29,952 Entrez genes (mm9, taken from UCSC known gene tables) were calculated between 1 kb upstream to TSS and TES. These read densities were then converted to z-score by normalizing each position by the mean and standard deviation of the sample noise
(626)
Noise parameters were estimated for each sample from 6*10.sup.7 random bp across the genome. Finally, to present aligned profiles, the z-score profile of each gene was binned to 20 bins upstream to TSS and another 100 quantiles between TSS to TES. The value of each bin or quantile was selected to be the max value within that interval.
(627) In the histone mark distribution analysis (
(628) Annotation Enrichment AnalysisMbd3 target genes were tested for enrichment of functional gene sets taken from Gene Ontology [GO, geneontology (dot) org]. Protein-DNA binding annotations were taken from various publications (Boyer, L. A., et al. Cell. 2005, 122(6):947-56; Mikkelsen, T. S. et al. Nature 448, 553-560, 2007; Kim, J., et al., Cell 132(6):1049-61, 2008; Loh, Y H. et al. Nat Genet 38, 431-440, 2006). Enrichment P values were calculated using Fisher exact test (Fisher, S., Genetiker, S., Fisher, R. A. & Genetician, S. Statistical methods for research workers, 1970) and corrected for multiple hypotheses using false discovery rate (FDR) threshold of 0.0001%.
(629) Gene expression data acquisition, processing and analysisTotal RNA was isolated from indicated cell lines. The concentration of RNA was quantified and subjected to quality control on Agilent Bioanalyzer. 250 ng of RNA was simultaneously processed from each sample. cDNA was fragmented, labeled, and hybridized to Affymetrix Mouse Gene 1.0 ST GeneChip (Affymetrix, Santa Clara, CA), which contain 35,557 probes. Affymetrix arrays were used for analysis of human cell samples. Transcripts levels were processed from image files [from Affymetrix CEL files and CDF file (version V1.r3, which maps probes into 33,252 probe sets)] using RMA method (Irizarry, R. A. et al. Biostatistics, 2003, 4:249-64), which corrects for non-biological sample variation using quantile normalization, implemented by the Affymetrix Expression Console software. Data was further filtered to include probes that have at least one call higher than 64 (=2.sup.6), resulting in 21,811 probes that are mapped to 15,815 RefSeq transcripts [ncbi (dot) nlm (dot) nih (dot) gov/RefSeq/]. Unique Entrez IDs using current annotations from Affymetrix (NetAffx Annotation Files version 33.1) and NCBI sites. Probes targeting the same gene were collapsed by median resulting in 13,894 genes. Microarray data are available at the National Center for Biotechnology Information Gene Expression Omnibus database under the series accession nos. GSE37822, GSE45352, and GSE46872. Additional human ESC samples data from previously described Affymetrix GeneChip Human Genome U133 Plus 2.0 Arrays which contain 54,675 probe sets (GSE21222; (Hanna, J. et al. Proc. Natl. Acad. Sci. U.S.A. 107, 9222-9227, 2010) were passed through the same processing as previously described, resulting in 15,571 genes. The two gene lists were then intersected into one list containing 12,071 genes. The batch effect resulting from two different platforms was corrected by normalizing each data set to a sample of the same genotype (WIBR3, reference samples excluded from further analyses), allowing the two datasets to be united for further analysis. The samples were hierarchically clustered using average linkage and either Spearman or Pearson correlation as a distance matrix as noted, with similar results. In order to compare the samples to Inner-Cell-Mass (ICM)-stage cells, Human pre-implantation data from Vassena et al. (Vassena, R. et al. Development 138, 3699-3709, 2011) were included. This data, from Affymetrix HuGene 1.0 st microarrays described before, was passed through the same processing as previously described, resulting in 16,953 genes before and 12,062 genes after intersection with the previous gene list. Batch effect was corrected by normalization of the new data to the mean values of its ESC samples. Differentially Expressed Genes between Naive and Primed samples were found using two-sample two-sided t-test, whose p-values were corrected for multiple hypotheses using the Benjamini-Hochberg false discovery rate (FDR) threshold of 0.05, combined with a two-fold change expression threshold. Differentially expressed genes were checked for functional enrichment using the online tool GOrilla [cbl-gorilla (dot) cs (dot) technion (dot) ac (dot) il/(Eden, E., et al. BMC Bioinformatics 10, 48, 2009)], with the entire gene list used as background. An FDR-corrected p-value threshold of 0.05 was used. For gene expression statistical analysis, the present inventors used Cluster software [rana (dot) lbl (dot) gov/EisenSoftware (dot) htm] to run hierarchical clustering on the samples, using complete linkage centered correlation as a distance metric. The present inventors used Matlab version R2011a and Version R2012b and their Bioinformatics toolbox to run Principle Component Analysis that detects the principle components with the largest variation in the data.
(630) Gene expression analysisProbes were mapped to Entrez Gene IDs and further filtered to include IDs that have at least one call higher than 32 (=25), resulting in 16,620 gene IDs. For gene expression analysis, the present inventors used Matlab version R2011b. Gene signatures differentially expressed between MEF samples (Mbd3.sup.+/+, Mbd3.sup.f/-, Mbd3.sup./ MEF samples) and ES samples (ES V6.5, Mbd3.sup./ ES, Mbd3.sup.f/IPS and Mbd3.sup.+/+ iPS) were characterize using two-sample t-test and corrected for multiple hypotheses using false discovery rate (FDR) [Benjamini, Y. and Hochberg, Y. Journal of the Royal Statistical Society Series B (Methodological), 57: 289-300, 1995]. Differentially expressed gene signatures include genes that are under FDR threshold of 5%, as well as above 4-fold change, resulting in 1,323 genes. Sample clustering with all 16,620 genes (
(631)
Where, Xj(t) denotes gene j expression value at time t (e.g. Xj(4d) or Xj(MEF)) and
(632) Preparation and analysis of reduced representation bisulfite sequencing librariesRRBS libraries were generated as described previously with slight modifications (Smith, Z. D. et al. Nature 484, 339-344, 2012). Briefly, DNA was isolated from snap-frozen cell pellets using the Quick-gDNA mini prep kit (Zymo). Isolated DNA was then subjected to MspI digestion (NEB), followed by end repair using T4 PNK/T4 DNA polymerase mix (NEB), A-tailing using Klenow fragment (3.fwdarw.5 exo-) (NEB), size selection for fragments shorter than 500-bp using SPRI beads (Beckman Coulter) and ligation into a plasmid using quick T4 DNA ligase (NEB). Plasmids were treated with sodium bisulfite using the EZ DNA Methylation-Gold kit (Zymo) and the product was PCR amplified using GoTaq Hot Start DNA polymerase (Promega). The PCR products were A-taild using Klenow fragment, ligated to indexed Illumina adapters using quick T4 DNA ligase and PCR amplified using GoTaq DNA polymerase. The libraries were then size-selected to 200-500-bp by extended gel electrophoresis using NuSieve 3:1 agarose (Lonza) and gel extraction (Qiagen). Libraries were pooled and sequenced on an Illumina HiSeq 2500 system. The sequencing reads were aligned to the Mouse Genome Build 37 (mm9) using Bismark. Methylation levels were calculated and averaged only for CpGs that were covered by 5 or more distinct sequencing reads across all libraries. The CpG content experienced by each CpG site was defined as the number of CpG dinucleotides found within a 500-bp window surrounding the site divided by the window size.
(633) Numerical Modeling Analysis
(634) Data acquisition for modelingThe present inventors measured reprogramming latencies for multiple systems in order to establish empirical cumulative distributions for reprogramming dynamics. Monoclonal secondary NGFP1 (Mbd3.sup.+/+) B-cell reprogramming dynamics with or without additional genetic perturbations (scrambled shRNA, Nanog over expression (Nanog.sup.OE)) were measured weekly using FACS, as described before (Hanna, J. et al. Nature 462, 595-601, 2009). NGFP1-Mbd3.sup.KD iPSC line was established, and Pre-B cells were harvested from chimeric animals and subjected to DOX reprogramming. Monoclonal follow-up measurements were conducted by single cell plating followed by Nanog-GFP detection at day 7 (1 week). Since monoclonal follow-up yielded 100% efficiency in NGFp1-Mbd3.sup.KD pre-B cells, the present inventors also conducted polyclonal reprogramming experiments on NGFP1 and NGFP1-Mbd3.sup.KD derived pre-B cells and measured Nanog-GFP daily by FACS during the first 8-10 days of OSKM induction (
(635) Implementation of model fitThe fitting for the models (detailed below) were implemented by Matlab program performing nonlinear regression fitting with adjusted R.sup.2 statistic. Definition of the adjusted R.sup.2 is
(636)
Here, y.sub.i is the measured latency distribution data point, y.sub.i, is the estimated data point according to the predicted model and
(637) Fitting to a step-function modelIn the deterministic case all cells become pluripotent at the same time following to DOX induction. This behavior is well approximated by step function like dynamics. The present inventors fitted the observed reprogramming latency to a step function, where the deterministic transition time was estimated by optimizing adjusted R.sup.2 statistic. The fitting was done on Matlab using nonlinear regression (
(638) Fitting to Gaussian modelIn order to estimate the variability observed in the reprogramming latency measurements, we used fitting to Gaussian distribution and calculated the mean, variance and coefficient of variation (CV=std/mean) for each sample (Mbd3.sup.+/+ and Mbd3.sup.KD) (
(639) Fitting to Brownian motion modelBiological changes (e.g. gene expression) may be described by the chemical Langevin equation (CLE) [Wilkinson, D. J. Stochastic modelling for quantitative description of heterogeneous biological systems. Nat Rev Genet 10, 122-133 (2009).
dX.sub.t=(-.Math.X.sub.t).Math.dt++.Math.X.sub.t.Math.dW.sub.t
Where, X.sub.t is the gene/protein expression as a function of time, A denotes the production rate, denotes the degradation rate and 6 is a Wiener process (or standard Brownian motion). However, the measured reprogramming duration is one or two orders of magnitude (10d for Mbd3.sup.KD and >100d for WT) higher than the production/degradation time scale. Moreover, the time between samples in the measured reprogramming latency is longer than the half-life (T.sub.1/2) time of the production/degradation process. Therefore, due to the separation of time scales the present inventors assume that the production/degradation process is at quasi-steady state, where the steady state expression (/) value changes slowly due to regulatory changes that effect the production rate , possibly due to epigenetic modifications.
(640) For these slow accumulating changes, we assume a simpler linear diffusion model
.Math.=0+V.Math.+.
(641) Now, X.sub.t is the quasi-steady state expression as function of time, vt represents the deterministic dynamics where v is called the process drift, and .Math.W.sub.t represents the gene expression noise where a is the standard deviation and Wt is a Wiener process.
(642) The present inventors assume that the observed reprogramming dynamics is dominated by the transition of some master regulators (possibly Nanog or Oct4) from their low inactive state to high expression state. For this transition the reprogramming latency corresponds with the first passage time distribution (see illustration in
(643)
Where T is a random variable representing reprogramming time (or first passage time), IG(:,:) denotes the Inverse Gaussian distribution (or Wald distribution), with the parameters
(644)
(mean) and
(645)
(shape parameter), and f.sub.T is the density function. The present, without loss of generality, that X.sub.0 is zero, elsewhere the present inventors can shift everything including =X.sub.0>0.
(646) Thus, the present inventors fit the observed reprogramming latency to Inverse Gaussian distribution using maximum likelihood estimator, finding the best fit parameters (, ) for each sample. Still is an unknown model parameter, but the present inventors can calculate /{square root over ()}=/v from the fitting results, this defines the dynamic variability for each sample. This variability is the ratio of the Brownian motion standard deviation () divided by the Brownian motion drift parameter (v), where /v>1 corresponds to a high variability dynamics. The present inventors show that while the dynamics variability in the Mbd3.sup.+/+ sample is /v>5, the Mbd3.sup.KD and cell cycle measurements show both a dynamic variation of /v0.5 (
(647) Propagation of errorFitting Gaussian and inverse Gaussian distributions returns 95% confidence intervals for the parameters. Calculating the ratio for the coefficient of variation and dynamics variability, the present inventors assumed that and are uncorrelated and used the following equation for the error:
(648)
Where .sub.CV, .sub. and .sub. denotes the errors in the coefficient of variation, mean and standard deviation, respectively.
(649) Modeling cell cycle durationDoubling time parameters (mean and standard deviation) were measured as previously described in Hanna, J. et al. 2009 [Nature 462, 595-601] for the current Mbd3.sup.+/+ and Mbd3.sup.KD cell lines. The present inventors sought to estimate the number of generations according to the reprogramming duration, and fit the cell cycle time distribution to the observed reprogramming latency. Note that Hanna, J. et al. 2009 (Nature 462, 595-601) showed a dependency between cell cycle duration and reprogramming latency distribution. Without being bound by any theory, the present inventors argue that the reduction in rate-limiting barriers may reduce reprogramming variability to variability explained by cell-cycles alone. Doubling time distribution was previously characterized (Duffy, K. R. et al. Science 335, 338-344, 2012) for B lymphocytes, the present inventors assume for simplicity that the cell cycle duration obeys a Gaussian distribution, this is supported by (Duffy K.R, 2012, Science 335: 338-344,
(650) Independent model: Cell cycle duration is independent between siblings and generations. Therefore for each mono-clonal population (each well) i the time to achieve K divisions is a random walk process. Hence, T.sub.t.sup.K=.sub.i.sup.K+.sub.i.sup.2+ . . . , where .sub.i.sup.jN(, ) are iid (independent identically distributed) random variables.
(651) The real biological process probably lies between those two opposing models.
(652) Correlation between siblings has been characterized (Duffy K.R, 2012, Science 335: 338-344,
(653) Fitting procedure consists of: 1) Estimating the mean () and standard deviation () of doubling time in each sample (Mbd3+ and Mbd3.sup.KD), as previously described in (Hanna, Nature 2009). 2) Fitting the observed reprogramming latency to both models: N(K.Math.,K. ) for the dependent and N(K.Math.{square root over (K)}.Math.. ) for the independent model. The mean (,p) and standard deviation (oa) are empirically estimated from each sample. The fitting was done on Matlab using nonlinear regression. 3) Estimating the number of generations (K) required to account for the measured reprogramming duration, by optimizing adjusted R.sup.2 statistic (see above for details on adjusted R.sup.2).
(654) Fitting of the dependent model is given in (
(655) TABLE-US-00002 TABLE 1 Dependent model Independent model Mbd3.sup.KD Adj R.sup.2 = 0.9986 Adj R.sup.2 = 0.9982 Mbd3.sup.+/+ Adj R.sup.2 = 0.73 Adj R.sup.2 = 0.69
Therefore the fitting results in the dependent and independent models are equivalent and should be valid to realistic cell cycle model (with partial generation dependent correlation).
(656) Inferring structural model (Phase-Type model)Several papers have suggested that the reprogramming process can be modeled by tandem rate limiting steps [Buganim, Y. et al. Cell 150, 1209-1222 (2012); Polo, J. M. et al. Cell 151, 1617-1632 (2012); Hanna, J. et al. Nature 462, 595-601 (2009); Smith, Z. D., et al. Nat. Biotechnol 28, 521-526 (2010)]. To study how this multiple step process changes following Mbd3 depletion in reprogramming, the present inventors applied a Phase-Type (PH) modeling (Bolch, G., Greiner, S., de Meer, H. & Trivedi, K. S. Queueing networks and Markov chains: modeling and performance evaluation with computer science applications. WILEY, Second Edition, 2006) that is a novel approach used to characterize the dynamics of finite-space continuous-time Markov chain models with a single absorbing phase (in our case iPSC phase). Mbd3.sup.KD and Mbd3.sup.+/+ observed reprogramming latencies were fit to multiple tandem step model, where convergence of estimation efficiency was used in order to select the best fit model (
(657) Without being bound by any theory, the present inventors describe the reprogramming process as a sequential Markov chain model with M phases, where the probability of being in phase i (i{1,, M}) at time t is denoted by P1(t). In this model the probability of an induced cell to be a B-cell is P1(t), the probability of being an iPSC is P.sub.M(t), and there are M-2 intermediate phases within the path from the B-cell to iPSC phases. It is assumed that transition occurs between the i.sup.th and (i+).sup.thphases with transition rate .sub.i, meaning that the current model neglects feedbacks between phases. In addition, in order to allow for a deterministic delay in the model, the present inventors incorporated to the fitting an additional parameter t.sub.0 denoting a deterministic shift in the model dynamics. Therefore an M phases model can be characterize by the following equations for all t>t.sub.0
(658)
This model can be solved with the following initial conditions: P.sub.1(t)=1, P.sub.1(t)=0 for all i>1 and for all tt.sub.0. The solution for the M phases model defines P.sub.1(t) for all t>0 as a function of the transition rates (p, i E {1, . . . , M -1}) and to, in a physical context P.sub.1(t) describes the time evolution of the ratio of population of cells in phase i.
(659) The present inventors constructed a nested fitting procedure for the fitting of Mbd3.sup.KD and control Mbd3.sup.+/+ dynamics to multiple models with M varies from 2 to 6. Since the present inventors measured only the distribution of complete reprogramming latency the fit was done between the measured latency distribution of each system and the P.sub.M(t) function calculated for each model, seeking the best fit model for each measured latency distribution. The present inventors applied nonlinear regression fitting for each model with adjusted R.sup.2 statistic for the rejection of over fitted models. Note that over fitting is rejected by the adjusted R.sup.2 since that increased number of model parameters m decreases the adjusted R.sup.2 statistic as long as the sum of squares of residuals converge (estimation efficiency convergence).
(660) The best-fit model defines the number of phases that recapitulate the dynamics of each reprogramming system (Mbd3.sup.KD and Mbd3.sup.+/+), the fitting procedure calculates the optimized transition rates .sub.i and the deterministic delay to. Consistent with previous reports [Buganim, Y. et al. Single-cell expression analyses during cellular reprogramming reveal an early stochastic and a late hierarchic phase. Cell 150, 1209-1222 (2012); Polo, J. M. et al. A Molecular Roadmap of Reprogramming Somatic Cells into iPS Cells. Cell 151, 1617-1632 (2012); Hanna, J. et al. Direct cell reprogramming is a stochastic process amenable to acceleration. Nature 462, 595-601 (2009); Smith, Z. D., Nachman, I., Regev, A. & Meissner, A. Dynamic single-cell imaging of direct reprogramming reveals an early specifying event. Nat Biotechnol 28, 521-526 (2010)], Mbd3.sup.+/+ dynamics fit a multi-step process consisting 1 or 2 but not 0 intermediate phases (
(661)
for each sample. Fitting results and estimated model parameters were documented (data not shown). Note that the models fit was validated using a second fitting procedure based on weighted nonlinear fit by chi.sup.2 minimization. The results show (
(662) The result obtained for the Mbd3.sup.KD may infer a reduction in intermediate states and therefore reduction in rate-limiting barriers. It does not directly argue for stochasticity, but there is clearly a connection between the barriers and the process variability. The obtained results also have many experimental observations supporting them, such as previous established intermediate phases in reprogramming that were characterized extensively in previous works (Mikkelsen, T. S. et al. Nature 454, 49-55, 2008). The model prediction that Mbd3.sup.K protocol achieves barrier free reprogramming dynamics is supported by the fact that intermediates (SSEA1 positive with negative Oct4 and Nanog) were detected in the WT (wild type) sample, but none were observed in the Mbd3.sup.KD sample (
(663) Additional technical notes: First, note that the rates for Mbd3.sup.KD and Mbd3.sup.+/+ are scaled differently due to differences in measurements of polyclonal and monoclonal assays (
(664)
according to the model previously described (Hanna, J. et al. Nature 462, 595-601, 2009), the reason behind this scaling is that each activation event (well) represent a competition between many iid (identical and independently distributed) exponential variables. On the other hand for the Mbd3.sup.KDpolyclonal assay, the global fraction of Nanog-GFP.sup.+ cells out of the entire population was measured daily, for this single cell measurement the transition rates need not to be scaled to population-average.
(665) Second, note that non-linear effects such as in Hill functions may result a similar dynamics to the observed reprogramming latency, but due to the multi-well mono-clonal (homogeneous population) measurement scheme the present inventors can rule out such effects. Clearly each activation event (each well) is independent and physically isolated from all other wells so cannot be influenced by proximal well activations. In addition the reprogrammed cell lines were secondary systems with homogeneous DOX induction stable constructs. So the S function dynamic must correspond to the reprogramming latency distribution and not to other nonlinear effect.
(666) Finally, the present inventors note that the parameter to used in the model fitting is not the onset of the process. By examining the gene expression and chromatin results one can see that major changes in gene expression and chromatin are already evident in 4d after induction (for Mbd3.sup.KD) and 8d (for WT) (see
(667) Non-linear regression assumptionsMost of the above model estimations utilized nonlinear regression as their fitting procedure. For this we assume that: 1) The observational errors, i.e. the residuals defined as a difference between observed and model-predicted values, are normally distributed. 2) The errors in observations at successive times are independent. 3) The variance of observation errors (.sup.2) is the same for all the state variables and observation times. The present inventors checked the distribution of the residuals for all previous estimation problems using Kolmogorov-Smirnov and Shapiro-Wilk normality tests [Shapiro, S. S. & Wilk, M. B. An analysis of variance test for normality (complete samples). Biometrika (1965), 52: 591; Smirnov, N. JSTOR: The Annals of Mathematical Statistics, Vol. 19, No. 2 (Jun., 1948), pp. 279-281]. The residuals passed the normality tests with the P values reported in Supplementary table 1 in Rais Y, et al. [Deterministic direct reprogramming of somatic cells to pluripotency, Nature. 2013 Oct. 3; 502(7469): 65-70. Epub 2013 Sep 18], which is fully incorporated herein by reference in its entirety.
(668) Evolutionary analysis of the NuRD complex and other associated proteinsThe present inventors assigned orthologs for 15 human proteins that are either known to be part of the NuRD complex or are related to these proteins (MBD1; Gene ID: 4152; SEQ ID NO: 5), MBD2 (Gene ID: 8932; SEQ ID NO: 6), MBD3 (Gene ID: 53615; SEQ ID NO: 7), MBD4 (Gene ID: 8930; SEQ ID NO: 8), OCT4 (Gene ID: 5460; SEQ ID NO: 9), SOX2 (Gene ID: 6657; SEQ ID NO: 10), CHD4 (Gene ID: 1108; SEQ ID NO: 11), Nanog (Gene ID: 79923; SEQ ID NO: 12), RBBP4 (Gene ID: 5928; SEQ ID NO: 13), RBBP6 (Gene ID: 5930; SEQ ID NO: 14), RBBP7 (Gene ID: 5931; SEQ ID NO: 15), HDAC1 (Gene ID: 3065; SEQ ID NO: 16), HDAC2 (Gene ID: 3066; SEQ ID NO: 17), MTA1 (Gene ID: 9112; SEQ ID NO: 18), MTA2 (Gene ID: 9219; SEQ ID NO: 19), for 15 representative metazoan species (mouse -M. musculus, platypusO. anatinus, zebra finchT. guttata, chickenG. gallus, frog -X. tropicalis, zebrafishD. rerio, pufferfishT. nigroviridis, lanceletB. floridae, sea urchinS. purpuratus, mosquitoA. gambiae, fruit fly -D. melanogaster, honeybee -A. mellifera, beetleT. castaneum, sea anemoneN. vectensis, trichoplaxT. adhaerens), and the yeast S. cerevisiae, as an outgroup. The last metazoan in this list T. adhaerens, represents a basal group of metazoan, and is used to study the origins of animal multicellularity [Rokas, A. Annual review of genetics, 42: 235-251, 2008; Knoll, A. H. Annu. Rev. Earth Planet. Sci. 39, 217-239, 2011]. Proteins that have an ortholog in T. adhaerens were likely to be present in the basal multicellular animals, while proteins that appear in yeast precede animal multicellularity. The orthologs were retrieved using the COG component (version 9.0) of the STRING database (version 9.0) (Szklarczyk, D. et al. The STRING database in 2011: functional interaction networks of proteins, globally integrated and scored. Nucleic Acids Res. 39, D561-D568, 2010). The present inventors limited the analysis to orthologs that are found in the same cluster of orthologs (COG) as the human proteins (and ignored any other similar proteins, if they are assigned to a different COG). In cases where more than one ortholog (Altschul, S. F., et al. Nucleic Acids Res. 1997, 25:3389-402) for a species were found, the present inventors blasted the various orthologs of that species against the human ortholog to quantify their relative degrees of similarity. The present inventors discarded proteins that are shorter than 50 residues, or that had e-values higher than 0.001. As the closest homolog for the human protein, the present inventors chose the ortholog in the compared species with the lowest e-value from the remaining proteins. The present inventors calculated a normalized similarity score between the two orthologs, by dividing the similarity score in the length of the longer protein of the two orthologs (the human ortholog and the compared species' ortholog).
(669) Capturing naive human pluripotent cellsThe following serum free defined conditions, termed WIS-NHSM (Weizmann Institute of Science Naive human Stem cell Medium) were used to isolate, generate, derive and stabilize naive human pluripotent stem cells (iPSCs and ESCs) with the unique biological properties described in this study. WIS-NHSM-(i) medium was generated by including: 475 ml Knockout DMEM (Invitrogen 10829), 5 grams AlbuMAX (Invitrogen 11020-021), 5 ml N2 supplement (Invitrogen 17502048), 10 g (micrograms) of recombinant human LIF (leukemia inhibitory factor) (Peprotech), 8 ng/ml recombinant bFGF (Peprotech) and 1 ng/ml recombinant TGFP 1 (Peprotech), 1 mM glutamine (Invitrogen), 1% nonessential amino acids (Invitrogen), 0.1 mM -mercaptoethanol (Sigma), Penicillin-Streptomycin (Invitrogen) and small molecule inhibitors: PD0325901 (1 M, ERK1/2i, Axon Medchem); CHIR99021 (3 M, GSK3i, Axon Medchem); SP600125 (10 M, JNKi, TOCRIS), SB203580 (5-10 M, p38i, TOCRIS). After further optimization the present inventors alternatively used SB202190 (5 P.sub.M, p38i, Axon Medchem) or BIRB796 (2 M, P38i Axon Medchem) for enhanced P38 inhibition instead of using SB203580.
(670) Throughout the study Naive hESCs/hiPSCs were grown on 0.2% gelatin+1 ng/ml vitronectin coated plates for at least 1 hour in 37 C. Notably, 1 ng/ml recombinant vitronectin or laminin (Sigma Aldrich L2020, 1 ng/ml for at least 1 hour at 37 C.) can also be used to maintain human naive cells in WIS-NHSM conditions.
(671) Cells were passaged by single cell trypsinization (0.25% or 0.05% Trysin+ EDTA) every 3-4 days. Although not essential, enhanced single cell cloning efficiency can be obtained with WIS-NHSM supplementation with ROCK pathway inhibitor Y-27632 (5 M, ROCKi Axon Medchem) for 24 hours before and after cell passaging. Passage numbers of naive -hiPSC/hESCs indicates number of passages counted after induction or stabilization of the naive state (and do not include previous passages when the cells were established and maintained in conventional/primed ESC conditions). For transfection of mouse and human naive iPSCs/ESCs, cells were harvested with 0.05% trypsin-EDTA solution (Invitrogen), and cells resuspended in PBS were transfected with 75 g DNA constructs (Gene Pulser Xcell System; Bio-Rad; 500 V, 25 F, 0.4-cm cuvettes).
(672) While the cells described and analyzed in this study were maintained as described above, the present inventors note that naive hESCs/iPSCs can be expanded on gelatin coated plates together with mitomycin C-inactivated, or gamma irradiated mouse embryonic fibroblast (MEF) feeder cells.
(673) Further, alternative composition of WIS-NHSM is possible by replacing Albumax component with 15-20% knockout serum replacement (KSR; Invitrogen 10828-028) or chemically Defined Lipid Concentrate (GIBC00 Invitrogen 11905-031) or Oleic Acid-Albumin (03008 Sigma Aldrich, 10p/ml final) or Oleic Acid (01257, Sigma Aldrich, 10 g/ml final concentration) or Linoleic/Oleic/Albumin supplement (L9655 Sigma Aldrich, 10 g/ml final concentration) or Oleic Acid [01008 Sigma Aldrich (dissolved in DMSO), 10 g/ml final concentration].
(674) Instead of adding 5 ml of ready N2 mix, individual components can be added to 500 ml media bottle at the indicated final concentration: 1) Recombinant Human Insulin (Sigma I-1882)12.5 g/ml Final concentration; 2) Apo-Transferrin (Sigma T-1147)500 g/ml Final concentration; 3) Progesterone (SigmaP8783)0.02 g/ml Final concentration; 4) Putrescine (SigmaP5780)16 g/ml Final concentration; 5) Sodium Selenite (SigmaS5261)add 5 L of 3 mM stock solution per 500 ml WIS-NHSM media.
(675) Instead of SB203580 (p38i), the WIS-NHSM medium can include SB202190 (5 M, p38i, TOCRIS) or BIRB796 (2 M, P38i Axon Medchem) without any change in OCT4-GFP expression in WIS-NHSM conditions.
(676) Supplementation of Vitamin C (L-ascorbic acid 2-phosphate, Sigma, A8960, 50 microg/ml final concentration) and/or Hypoxia growth conditions (5% PO.sub.2), were tested and found accommodating for expanding Oct4-GFP.sup.+ naive human ESCs and iPSCs.
(677) Instead of KO-DMEM the following media can also be alternatively used: DMEM-F12 (Biological Industries or Invitrogen), KO-DMEM/F12 (Invitrogenl2660-012), GMEM (Invitrogen 11710) or 1:1 DMEM/F12:Neurobasal mix (Invitrogen 21103-049).
(678) Following is a non-limiting example of an alternative WIS-NHSM medium (termed WIS-NHSM-ii) which was used to culture the naive cells of some embodiments of the invention: 425 ml Knockout DMEM (Invitrogen 10829), 74 ml of knockout serum replacement (Invitrogen 10828-028), 5 ml N2 supplement (Invitrogen 17502048), 10 g of recombinant human LIF (Millipore, LIF1005), 8 ng/ml recombinant bFGF and 1 ng/ml recombinant TGFP 1 (Peprotech), 1 mM glutamine (Invitrogen), 1% nonessential amino acids (Invitrogen), 0.1 mM 0-mercaptoethanol (Sigma), Penicillin-Streptomycin (Invitrogen) and small molecule inhibitors: PD0325901 (1 M, ERK1/2i, AXONMEDCHEM); CHIR99021 (3 M, GSK3bi, AXON MEDCHEM); SB203580 (5 M, p38i, TOCRIS); SP600125 (5 M, JNKi, TOCRIS) with or without Y-27632 (5 M, ROCKi Axon Medchem).
(679) Alternative composition of WIS-NHSM medium involved replacing 15% KSR with 1% albumax: 500 ml Knockout DMEM (Invitrogen 10829), 5 gr of AlbuMAX (Invitrogen 11020-021), 5 ml N2 supplement (Invitrogen 17502048), 10 g of recombinant human LIF (Millipore, LIF1005), 8 ng/ml recombinant bFGF and 1 ng/ml recombinant TGF31 (Peprotech), 1 mM glutamine (Invitrogen), 1% nonessential amino acids (Invitrogen), 0.1 mM -mercaptoethanol (Sigma), Penicillin-Streptomycin (Invitrogen) and small molecule inhibitors: PD0325901 (1 M, ERK1/2i, AXONMEDCHEM); CHIR99021 (3 M, GSK3bi, AXON MEDCHEM); SB203580 (5 M, p38i, TOCRIS); SP600125 (5 M, JNKi, TOCRIS) with or without Y-27632 (5 M, ROCKi Axon Medchem).
(680) Derivation of iPSCsFor derivation of iPSCs directly from fibroblasts (and not from already established iPSC lines), BJ fibroblasts or C1/2 derived secondary fibroblast cells (Hanna, J., et al. 2010. Proc. Natl. Acad. Sci. U.S.A. 107, 9222-9227) harboring doxycycline (DOX) lentiviral vectors encoding Oct4, Sox2, and Klf4 reprogramming factors (Hanna, J., et al. 2010. Proc. Natl. Acad. Sci. U.S.A. 107, 9222-9227) and a constitutively active lentivirus encoding the reverse tetracycline transactivator were grown in the presence of DOX in WIS-NHSM conditions (as described above) on vitronectin/gelatin-coated plates until initial PSC colonies were observed and subcloned.
(681) ESC derivation form human blastocystsThe use of human preimplantation embryos for ESC derivation was performed in compliance with protocols approved by a Weizmann Institute ESCRO committee, Lis hospital Institutional review committee and Israeli National Ethics Committee (7/04-043) and following the acceptance of a written informed consent. The couples' participation in the study was voluntary after signing informed consent forms and there was no monetary compensation for their embryo donation. Inner cell masses (ICMs) were isolated mechanically by laser-assisted micromanipulation from spare IVF embryos, at day 6-7 following fertilization [Ben-Yosef, D. et al. Female Sex Bias in Human Embryonic Stem Cell Lines. Stem Cells and Development 21, 363-372 (2012)]. The intact ICM clumps were placed on a feeder cell layer of irradiation treated DR4 mouse embryonic fibroblasts and cultured in WIS-NHSM media. Initial outgrowths of proliferating ESCs were evident by day 6, and were trypsinized into single cells, 6-10 days following ICM plating. The newly established cell lines were further propagated by trypsin and then either frozen or used for further analysis.
(682) Small molecule compounds and cytokinesSmall molecules and cytokines were purchased from Tocris, Calbiochem, Stemgent, Peprotech or Sigma, and were supplemented as indicated at the following final concentration: JAK inhibitor (420099 JAKi, 0.6 MCAL BIOCHEM), Kenopaullone (KP, 5 M, Sigma Aldrich), PD0325901 (PD, 1 M, Axon Medchem); CHIR99021 (CH, 3 M, AXON MEDCHEM), Forskolin (FK, 10 M, TOCRIS), FGF4-Receptor inhibitors PD173074 (0.1 M, TOCRIS) and SU5401 (2 M, TOCRIS); TGF/ALK inhibitors A83-01 (1 M, STEMGENT), PKC inhibitor Go6983 (1 M,TOCRIS), ALK inhibitor (ALKi: SB431542, 2 M,TOCRIS); AICAR (0.5 mM); Bix01294 (1 M); BayK8644 (1 M, Stemgent); SB203580 (5-10 M, p38i, TOCRIS); SBS202190 (5 M, p38i, TOCRIS), BIRB796 (2 M Axon Medchem), SP600125 (10 M, JNKi, TOCRIS); recombinant human BMP4 (5-10 ng/ml; Peprotech), recombinant human SCF (10 ng/ml, Peprotech), recombinant human IGF1 (10 ng/ml, Peprotech), Media with inhibitors was replaced every 24-48 hours.
(683) Culture of conventional/primed human ESCs and iPSCsThe following already established conventional human ESCs and iPSC lines were used (indicated passage number of the cell line taken for conversion into naive pluripotency is indicated in parentheses): Human induced pluripotent stem cells C1 (P21) and C2 (P9) hiPSC lines (Hanna, J. et al. Proc. Natl. Acad. Sci. U.S.A. 107, 9222-9227, 2010) and the human embryonic stem cell (hESC) lines BGO1 (P35) (National Institutes of Health ID code BGO1; BresaGen], H1 (P40), H9 (P37), WIBR1 (P13), WIBR2, WIBR3 (P11) hESCs (Lengner, C. J. et al. Cell 141, 872-883, 2010) were maintained in 20% PO2 conditions (unless indicated otherwise) on irradiated mouse embryonic fibroblast (MEF) feeder layers or Gelatin/vitronectin coated plates, in hESC medium: 425 ml Knockout-DMEMInvitrogen 10829) supplemented with 15% Knockout Serum Replacement (Invitrogen 10828-028), 1 mM glutamine (Invitrogen), 1% nonessential amino acids (Invitrogen), 0.1 mM -mercaptoethanol (Sigma), 8 ng/mL bFGF (Peprotech) and 1-8 ng/ml (e.g., 1-2 ng/ml) recombinant human TGFP1 (Peprotech). Cultures were passaged every 5-7 days either manually or, or by trypsinization (24 hour pre and 24 hour after addition of ROCK inhibitor at 5-10 nM concentration). For transfection of hiPSC and hESC lines, cells were cultured in Rho kinase (ROCK) inhibitor (Calbiochem; Y-27632) 24 hours before electroporation.
(684) Primed/conventional human ESC and iPSC cells were harvested with 0.05% trypsin-EDTA solution (Invitrogen), and cells resuspended in PBS were transfected with 75 g DNA constructs (Gene Pulser Xcell System; BioRad; 250 V, 500 F, 0.4-cm cuvettes). Cells were subsequently plated on MEF feeder layers (DR4 MEFs for puromycin selection) in hESC medium supplemented with ROCK inhibitor for the first 24 hours, and then antibiotic selection was applied. Mouse naive and primed stem cell lines and cultivationMurine naive V6.5 ESCs (C57B6/129sJae) pluripotent cells were maintained and expanded in serum-free chemically defined N2B27-based media: 500 ml KO-DMEM (Invitrogen), 5 ml N2 supplement (Invitrogen; 17502048), 5 ml B27 supplement (Invitrogen; 17504044), 1 mM glutamine (Invitrogen), 1% nonessential amino acids (Invitrogen), 0.1 mM 0-mercaptoethanol (Sigma), penicillin-streptomycin (Invitrogen), 5 mg/ml BSA (bovine serum albumin; Sigma). Naive 2i/LIF conditions for murine PSCs included 5 g recombinant human LIF (Peprotech). Where indicated 2i the following was added: small-molecule inhibitors CHIR99021 (CH, 3 MAxon Medchem) and PD0325901 (PD, 1 MTOCRIS). Murine Naive ESCs and iPSCs were expanded on gelatin-coated plates, unless indicated otherwise. Previously described Eras-/ ESCs were kindly provided by Dr. Shinya Yamanaka [Takahashi, K., Mitsui, K. & Yamanaka, S. Nature 423, 541-545 (2003)]. Primed 129Jae EpiSC line (derived from E6.5 embryos) or C57BL6/129sJae EpiSC line (derived following in vitro priming of V6.5 mouse ESCs) were expanded in N2B27 with 8 ng/ml recombinant human bFGF (Peprotech Asia) and 20 ng/ml recombinant human Activin (Peprotech Asia) and 1% KSR (knockout serum replacement). Murine EpiSC were expanded on feeder free Gelatin/Vitronectin or Matrigel coated plates. Cell lines were routinely checked for Mycoplasma contaminations every month (LONZAMYCOALERT KIT), and all samples analyzed in this study were not contaminated.
(685) Reprogramming of somatic cells and cell infectionVirus-containing supernatants of the different reprogramming viruses: STEMCA-OKSM polycistronic vector (DOX inducible and constitutive expression) [Mansour, A. A. et al. Nature 488, 409-413 (2012)] was supplemented with the FUW-lox-M2rtTA virus (when necessary) and an equal volume of fresh culture medium for infection. For derivation of iPSCs directly from fibroblasts (and not from already established iPSC lines), BJ fibroblasts or C1.2 derived secondary fibroblast cells [Hockemeyer, D. et al. Cell Stem Cell 3, 346-353 (2008)] harboring doxycycline (DOX) lentiviral vectors encoding Oct4, Sox2, and Klf4 reprogramming factors and a constitutively active lentivirus encoding the reverse tetracycline transactivator [Hockemeyer, D. et al. Cell Stem Cell 3, 346-353 (2008)], were grown in the presence of DOX in WIS-NHSM conditions on vitronectin/gelatin-coated plates until initial iPSC colonies were observed and subcloned. Generation of BJ1 hiPSCs form human BJ foreskin fibroblasts was conducted by OSKM and LIN28 mRNA transfection kit (Stemgent) according to manufacturers' instructions, but in WIS-NHSM conditions applied starting from day 2 of the reprogramming process. Fragile X male patient specific fibroblasts were obtained through Coriell repository (GM05131 and GM07071). iPSCs were reprogrammed either in conventional or naive (WIS-NHSM) conditions as indicated in
(686) Differentiation Assays of human iPSCs and ESCsFor embryoid body (EB) induced differentiation, naive hESCs/hiPSCs were trypsinized and cultured for 6-8 days in non-adherent suspension culture dishes (Coming) in DMEM supplemented with 15% fetal bovine serum. For teratoma formation and analysis, naive hESCs and iPSCs were harvested by trypsinization before injection. Cells were injected sub-cutaneously (s.c.) into 6-8 week old male NSG mice (Jackson laboratories). Tumors generally developed within 4-6 weeks and animals were sacrificed before tumor size exceeded 1.5 cm in diameter. Naive C1 hiPSCs were infected with a lentivirus harboring a VASA-EGFP reporter construct, selected with neomycin, subcloned, and subsequently used for primordial germ cell (PGC) differentiation protocol (Hanna et al., 2010b). All animal studies were conducted according to the guideline and following approval by the Weizmann Institute IACUC (approval #00960212-3).
(687) Mouse embryo micromanipulationPluripotent mouse ESCs or naive human iPSCs (pre-treated with 10 M ROCKi for 12 hours) were trypsinized and subsequently injected into BDF2 diploid mouse morulas or blastocysts, harvested from hormone primed BDF1 6 week old females. Microinjection into E2.5 morulas or E3.5 blastocysts placed in M16 medium under mineral oil was done by a flat-tip microinjection pipette. Embryos injected with human iPSCs were allowed to recover in KSOM medium (Invitrogen) supplemented with ROCKi (5 ptM) for 3-9 hours before they were transplanted into surrogate pseudo-pregnant mice. A controlled number of 10-12 cells were injected into the blastocyst cavity. After injection, blastocysts were returned to KSOM media (Invitrogen) and placed at 37 C. until transferred to recipient females. Ten to fifteen injected blastocysts were transferred to each uterine horn of 2.5 days post coitum pseudo-pregnant females. 4n tetraploid complementation assay was performed by fusing BDF2 embryos at 2 cell stage [Stadtfeld, M. et al. Nature 465, 175-181 (2010)], and subsequently allowing the embryos to develop until the blastocyst stage at day 3.5, and were then utilized for PSC micro-injection. Embryos were allowed to develop into full term. Determining germ-line transmission was performed by mating chimeric animals with C57B/6 females, and continuous checking for agouti colored pups. For teratoma formation and analysis, naive hESCs and hiPSCs were harvested by trypsinization before injection. Cells were injected sub cutaneously into NSG mice (Jackson laboratories). Tumors generally developed within 4-6 weeks and animals were killed before tumor size exceeded 1.5 cm in diameter. All animal studies were conducted according to the guideline and following approval by the Weizmann Institute IACUC (approval #00960212-3). The present inventors have not excluded animals from the analysis, and did not apply randomization by blinding.
(688) BAC recombineering and TALEN gene editingTALEN expressing plasmids were designed with a help of TALEN targeter 2.0 and cloned using GoldenGate TALEN kit 2.0 purchased from Addgene [Bedell, V M, et al., Nature 491:114-8. (2012)] according to the published protocol. For targeting G the present inventors have used NN-type repeat. 10.sup.7 ESCs/iPSCs were electroporated with 30 g of previously described OCT4-GFP-2A-PURO knock-in donor plasmid [Hockemeyer, D. et al., Nat Biotechnol 29, 731-734 (2011)](kindly provided by R. Jaenisch through Addgene) and 10 g of each of the TALEN expressing plasmids and grown in the presence of antibiotic selection. Resistant clones were isolated and genomic DNA was extracted for Southern Blot and PCR analysis. OCT4-GFP-2A-PURO, APE-OCT4-GFP-2A-PURO, ADE-OCT4-GFP-2APURO constructs were made from BAC clone containing human OCT4 gene locus by using Red/ET recombination (Gene Bridges). Briefly, GFP-2A-puro cassette was inserted into translation start site of OCT4, and then genomic region from 8 kb upstream to 10 kb downstream of TSS was subcloned into pBS vector. Proximal (PE) and distal (DE) elements were determined by homology with respective elements of mouse Oct4 described in [Bao, S. et al. Nature 461, 1292-1295 (2009)], and based on results obtained with luciferase test assay (
(689) DNA constructs and plasmid cloningThe pCAG-IresPuro or pCAG-flox-DsRed-IRES-Puro vectors [Ficz G, et al. Cell Stem Cell. 2013 Sep. 5; 13(3):351-9. doi: 10.1016/j.stem.2013.06.004. Epub 2013 Jul 11] encoded the following inserts (which were cloned by either cohesive or blunt-end ligations in XhoI-NotI sites): Stat3-CA mutant (Addgene 13373) (A662C and N664C mutationsby substituting cysteine residues for A662 and N664 of the Stat3 molecule, disulfide bonds may form between Stat3 monomers and render the molecule capable of dimerizing without a phosphate on Y705); Stat3-Y705F (dominant-negative alleleAddgene 8709). Human OCT4 enhancer sequences [the Oct4DE- and Oct4PE-SV40-luciferase (Luc) constructs] were cloned into the pGL3-Promoter Vector (Promega) with the following
(690) TABLE-US-00003 primers:5hOcCT4PEKpnI: (SEQIDNO:74 5-GGTACCGGATACTCAGGCCAGGCCCAGAAA-3; 3hOCT4PEXhoI: (SEQIDNO:75) 5-CTCGAGTCCACAGACCTCTGGCACT-3; 5hOCT4DEKpnI: (SEQIDNO:76) 5-GGTACCCATTGAGTCCAAATCCTCTTTACTAGGTG-3; 3hOCT4DEXhoI: (SEQIDNO:77) 5-CTCGAGCTGAGGCTCATGCTGCTGG-3
(691) Reporter constructs were used to determine the regulation pattern of Oct4 expression and were electroporated into 0.5-310.sup.6 cells along with the pRL-TK (Renilla) vector for normalization. Assays were performed 48 hours later using the Dual-Glo Luciferase Assay System (Promega). The basal activity of the empty luciferase vector was set as 1.0. Recombinant vitronectin was produced and purified as previously described [Chen, G. et al. Chemically defined conditions for human iPSC derivation and culture. Nat. Methods 8, 424-429 (2011)] after obtaining express ion construct through Addgene (vector 30225).
(692) RT-PCR analysis (description for Examples 5-9)Total RNA was isolated using Trizol (Invitrogen). 1 g of DNase-I-treated RNA was reverse transcribed using a First Strand Synthesis kit (Invitrogen) and ultimately re-suspended in 100 l of water. Quantitative PCR analysis was performed in triplicate using 1/50 of the reverse transcription reaction in an Viia7 platform (Applied Biosystems). Error bars indicate standard deviation of triplicate measurements for each measurement. RT-PCR primers used herein are:
(693) TABLE-US-00004 XIST-Forward: (SEQIDNO:78) 5-AGGGAGCAGTTTGCCCTACT-3; XIST-Reverse: (SEQIDNO:79) 5-CACATGCAGCGTGGTATCTT-3; OCT4-Forward: (SEQIDNO:80) 5-AGTGATTCTCCTGCCTCAGC-3; OCT4-Reverse: (SEQIDNO:81) 5-CTTCTGCTTCAGGAGCTTGG-3; SOX1-Forward: (SEQIDNO:82) 5-GGAATGGGAGGACAGGATTT-3; SOX1-Reverse: (SEQIDNO:83) 5-AACAGCCGGAGCAGAAGATA-3; PAX6-Forward: (SEQIDNO:84) 5-AAGGATGTTGAACGGGCAGA-3; PAX6-Reverse: (SEQIDNO:85) 5-TCCGTTGGAACTGATGGAGT-3; HPRT-Forward: (SEQIDNO:86) 5-TGACACTGGCAAAACAATGCA-3; HPRT-Reverse: (SEQIDNO:87) 5-GGTCCTTTTCACCAGCAAGCT-3; EOMES-Forward: (SEQIDNO:88) 5-CGCCACCAAACTGAGATGAT-3; EOMES-Reverse: (SEQIDNO:89) 5-CACATTGTAGTGGGCAGTGG-3; CDX2-Forward: (SEQIDNO:90) 5-CAGTCGCTACATCACCATCC-3; CDX2-Reverse: (SEQIDNO:91) 5-TTTCCTCTCCTTTGCTCTGC-3; HAND1-Forward: (SEQIDNO:92) 5-AACTCAAGAAGGCGGATGG-3; HAND1-Reverse: (SEQIDNO:93) 5-CGGTGCGTCCTTTAATCCT-3; GSC-Forward: (SEQIDNO:94) 5-CGCCTCGGCTACAACAACTA-3; GSC-Reverse: (SEQIDNO:95) CGCCTCGGCTACAACAACTA-3; ID1-Forward: (SEQIDNO:96) 5-AAACGTGCTGCTCTACGACA-3; ID1-Reverse: (SEQIDNO:97) 5-TAGTCGATGACGTGCTGGAG-3; ID3-Forward: (SEQIDNO:98) 5-CTACAGCGCGTCATCGACTA-3; ID3-Reverse: (SEQIDNO:99) 5-TCGTTGGAGATGACAAGTTCC-3; ZIC1-Forward: (SEQIDNO:100) 5-GCGCTCCGAGAATTTAAAGA-3; ZIC1-Reverse: (SEQIDNO:101) 5-GTCGCTGCTGTTAGCGAAG-3; NANOG-Forward: (SEQIDNO:102) 5-GATTTGTGGGCCTGAAGAAA-3; NANOG-Reverse: (SEQIDNO:103) 5-CAGATCCATGGAGGAAGGAA-3; MIXL1-Forward: (SEQIDNO:104) 5-AGCTGCTGGAGCTCGTCTT-3; MIXL1-Reverse: (SEQIDNO:105) 5-CGCCTGTTCTGGAACCATAC-3.
(694) Immunofluorescence stainingCells were grown for two days on glass cover slips (13 mm 1.5H; Marienfeld, 0117530) fixed with 4% paraformaldehyde/phosphate buffer for 15 minutes at room temperature, washed three times with phosphate buffered saline (PBS), and permeabilized in PBS/0.1% Triton for 10 minutes. Cells were blocked with blocking solution (2% normal donkey serum, 0.1% BSA in PBS/0.05% Tween) and incubated with primary antibody diluted in blocking solution overnight at 4 C. (Antibodies in this study have all been validated in the literature and by ourselves). Cells were then washed three times with PBS/0.05% Tween, incubated with secondary antibodies for 1 hour at room temperature, washed in PBS/0.05% Tween, counterstained with DAPI (1 g/ml), mounted with Shandon Immu-Mount (Thermo Scientific, 9990412), and imaged. For staining of H3K27me3 and nuclear proteins, cells were permeabilized in PBS/0.5% Triton for 30 or 10 minutes, respectively, and 0.1% Triton was included in the blocking solution. All comparative experiments were done simultaneously. For MHC class I staining of human cells, anti MHC class I antibody (BE pharmingen) was used and cells were analyzed on FACS ARIA III analyzer and sorter system. The following antibodies were used at the indicated dilutions:
(695) TABLE-US-00005 TABLE 2 Manufacturer (or supplier) with Antibody Catalogue number Dilution Mouse anti-TRA-1-60 Abcam (ab16288) 1:500 Mouse anti-TRA-1-81 Abcam (ab16289) 1:500 Mouse anti-SSEA1 Abcam (ab16285) 1:100 (MC480) Mouse anti-SSEA4 Abcam (ab16287) 1:50 (MC813) Rat anti-SSEA3 Abcam (ab16286) 1:50 (MC631) Rabbit anti-Klf2 Millipore (09-820) 1:500 Rabbit anti-Nanog Bethyl (A300-397A) 1:400 Rabbit anti-Nanog Abcam (ab80892) 1:200 Rabbit anti- Oct3/4 Santa Cruz (SC9081) 1:400 (H134 clone) Mouse anti-Oct4 Santa Cruz (SC5279) 1:200 (C-10 clone) Rabbit anti-Klf4 Santa Cruz (SC20691) 1:200 (H-180 clone) Mouse anti-E-cadherin Abcam (ab1416-500) 1:100 Rabbit anti-N-cadherin Abcam (ab12221) 1:800 Rabbit anti-Sox2 Millipore AB5603 1:500 Mouse anti-NR3B2 R&D Systems 1:1000 (ESRRB) (PP-H6705-00) Rabbit anti-TFE3 Sigma (HPA023881) 1:200; 1:500 Rabbit anti-H3K27me3 Millipore (07-449) 1:4000 Donkey anti-Mouse Jackson Immuno 1:200 IgG Alexa 488 (715-545-150) Donkey anti-Mouse Jackson Immuno 1:200 IgG RRX (715-295-150) Donkey anti-Mouse Jackson Immuno 1:200 IgG Alexa 647 (715-605-150) Donkey anti-Rabbit Jackson Immuno 1:200 IgG Alexa 488 (711-545-152) Donkey anti-Rabbit Jackson Immuno 1:200 IgG RRX (711-295-152) Donkey anti-Rabbit Jackson Immuno 1:200 IgG Alexa 647 (711-605-152) Donkey anti-Mouse Jackson Immuno 1:200 IgM RRX (715-295-020) Goat anti-Rat IgM Jackson Immuno 1:200 RRX (112-295-075)
(696) Imaging, quantifications, and statistical analysisImages were acquired with D1 inverted microscope (Carl Zeiss, Germany) equipped with DP73 camera (Olympus, Japan) or with Zeiss LSM 700 inverted confocal microscope (Carl Zeiss, Germany) equipped with 405 nm, 488 nm, 555 nm and 635 solid state lasers, using a 20x Plan-Apochromat objective (NA 0.8). All images were acquired in sequential mode. For comparative analysis, all parameters during image acquisition were kept constant throughout each experiment. Images were processed with Zen blue 2011 software (Carl Zeiss, Germany), and Adobe Photoshop CS4. X chromosome inactivation was assayed by presence of a condensed H3K27me3 staining focus per individual nucleus and quantified manually using ImageJ software (NIH) using.
(697) Automated and quantitative image analysis for TFE3 localizationSingle cell fluorescence intensity was analyzed by profile function in Zen Blue 2011 software. An in house developed automated segmentation protocol segments the cell's nucleus contained in each image. Nucleus was defined by intersection by both DAPI and OCT4 fluorescent illumination. This protocol is described in Rais et al (Rais Y., et al. Nature. 2013 Oct. 3; 502(7469):65-70. doi: 10.1038/naturel2587. Epub 2013 Sep 18) and deposited on the lab website [weizmann (dot) ac (dot) il/molgen/Hanna/Home (dot) html]. The segmented cells are then processed individually in order to estimate the ratio between intra-nucleus TFE3 intensity and cytoplasmic TFE3 intensity. Major steps in the processing: 1) Defining a bounding box containing the segmented nucleus and 10 pixels margin around the nucleus. 2) Estimating the average TFE3 intensity within nucleus mask. 3) Estimating the average TFE3 intensity within the bounding box but outside of the nucleus mask. Data were measured per sample from 200 cells obtained from at least four independent image fields. Distribution of intensity ratios for all cells is presented using box-plot. Box plot centers indicate the median value, and box edges indicate the 25.sup.th and 75.sup.th percentiles. -values of distribution differences indicated in the graph were estimated with paired sample t-test.
(698) Protein Western blotting analysisWhole-cell protein extracts were isolated from human ES cells. Blots were incubated with the following antibodies in 3% BSA/TBST or PBST: pSTAT3 (9318; 1:1,000; Cell Signaling), STAT3 (C-20; 1:1,000; Santa Cruz), po-Catenin (9561; 1:750; Cell Signaling), -Catenin (610153; 1:2,000; BD Biosciences), HSP90a (CA1016; 1:5,000; Calbiochem), pJNK (9251; 1:500; Cell Signaling), JNK (SC-571; 1:100; Santa Cruz), pp.sup.38 (9215; 1:100; Cell Signaling), p38 (9212; 1:1,000; Cell Signaling), pERK (E4; 1:100; Santa Cruz), ERK1,2 (C-14; 1:100; Santa Cruz), KLF4 (AF3158; 1:200; R&D), OCT4 (H-134; 1:1,000; Santa Cruz), Nanog (397A; 1:1,000; Bethyl). Secondary antibodies were HRP-linked goat anti-mouse, goat anti-rabbit and rabbit anti-goat (1:10,000; Jackson). Blots were developed using ECL (Thermo).
(699) Cross-species gene expression analysiswas conducted on human arrays described above and previously described mouse ESC and EpiSC gene expression datasets on an Agilent 444 k array platform (GSE15603; described in [Hanna, J. et al. Cell Stem Cell 4, 513-524 (2009)] containing 45,018 probes. Mouse data was processed as described above, resulting in 17,885 unique genes. Human-mouse orthology was downloaded from MGI [informatics (dot) jax (dot) org] containing 17,772 pairs of orthologous genes. Of these, 9,803 were mapped to the expression data of the present inventors. The expression values from mouse and human were transformed separately into relative abundance values [Liao, B. Y. Molecular Biology and Evolution 23, 530-540 (2005)]: For each gene, the relative abundance value is the expression value divided by the mean of expression values within the same gene across samples in the same species. The resulting expression matrix was subjected to hierarchical clustering (Spearman correlation, average linkage), as was the spearman correlation matrix of the samples. Coefficient of variance, a measure for noise defined as the standard deviation divided by the mean, was calculated separately for each of the two species and for the Naive and Primed states. The statistical significance between the distributions of coefficient of variance for the two states was calculated using single-tail t-test. Outliers were not shown in the plot, but were included in the statistical tests.
(700) Chromatin Immuno-precipitation and Sequencing Library Preparation (for Examples 5-9 below)Chromatin Immuno-precipitation followed by deep sequencing (ChIP-Seq) was measured for the following proteinsH3K4me3, H3K27me3, H3K4mel, H3K27Ac and H3K9me3in mouse and human pluripotent cells (ESCs, EpiSCs and/or iPSCs) expanded in fetal bovine free and feeder free naive or primed/conventional growth conditions (FBS and feeder free expansion, on gelatin/vitronectin coated plates). Approximately 40*10.sup.6 cells were cross-linked in formaldehyde (1% final concentration, 10 minutes at room temperature (RT)), and then quenched with glycine (5 minutes at RT). Fixed cells were lysed in 50 mM HEPES KOH pH 7.5, 140 mM NaCl, 1 mM EDTA, 10% Glycerol, 0.5% NP-40 alternative, 0.25% Triton supplemented with protease inhibitor at 4 C. (Roche, 04693159001), centrifuged at 950g for 10 minutes and re-suspended in 0.2% SDS, 10 mM EDTA, 140 mM NaCl and 10 mM Tris-HCL. Cells were then fragmented with a Branson Sonifier (model S-450D) at 4 C. to size ranges between 200 and 800 b, nd precipitated by centrifugation. 10 g of each antibody was pre-bound by incubating with Protein-G Dynabeads (Invitrogen100-07D) in blocking buffer (PBS supplemented with 0.5% TWEEN and 0.5% BSA) for 2 hours at room temperature. Washed beads were added to the chromatin lysate, and then incubated overnight. Samples were washed 5 times with RIPA buffer, twice with RIPA buffer supplemented with 500 mM NaCl, twice with LiCl buffer (10 mM TE, 250 mM LiCl, 15 0.5% NP-40, 0.5% DOC), once with TE (10 mM Tris-HCl pH 8.0, 1 mM EDTA), and then eluted in 0.5% SDS, 300 mM NaCl, 5 mM EDTA, 10 mM Tris Hcl pH 8.0 at 65 C. Eluate was incubated in 65 C. for 8 hours, and then treated sequentially with RNaseA (Roche, 11119915001) for 30 min and Proteinase K (NEB, P8102S) for two hours. DNA was purified with The Agencourt AMPure XP system (Beckman Coulter Genomics, A63881). Libraries of cross reversed ChIP DNA samples were prepared according to a modified version of the Illumina Genomic DNA protocol, as described previously [Blecher-Gonen, R., et al. Nat Protoc. 2013 March;8(3):539-54. doi: 10.1038/nprot.2013.023. Epub 2013 Feb 21]. Briefly, ChIP DNA was ligated to Illumina adaptors and subjected to 14 cycles of PCR amplification. Amplified products between 200 and 800 bp were purified on a 2% agarose gel. Roughly 5 picomoles of DNA library was then applied to each lane of the flow cell and sequenced on Illumina Hiseq2000 sequencer according to standard Illumina protocols. The following antibodies were used for chromatin-IP experiments: Control IgG (ChIP grade, ab46540, Abcam), Anti-H3K4me3 (ab8580, Abcam), H3K27me3 (07-449, Millipore).
(701) Chromatin IP Sequencing data analysisThe chromatin markers H3K27me3, H3K4me3, H3K4mel, H3K27Ac and H3K9me3 were measured in 4 different human pluripotent cell lines: Cl, WIBR3, LIS2 (naive and primed), BGO1 and WIBR3-MBD3.sup.mut (naive ). In addition, H3K27me3, H3K4me3, H3K4mel and H3K27Ac were measured in mouse V6.5 naive and primed EpiSCs. H3K27me3 and H3K4me3 measurements in naive mouse ES were previously published by our group [Mansour, A. A. et al. Nature 488, 409-413 (2012)]. Each sample was accompanied by control sequencing experiment of whole cell extract input. We used bowtie software [Langmead, B., et al. Genome Biol. 2009; 10(3):R25] version 1.0.0 to align human reads to human reference genome hg19 (UCSC, Feb 2009) and mouse reads to mouse mm9 reference genome (UCSC, July 2007). The present inventors only considered reads that were uniquely aligned to the genome with up to a single mismatch, taking the single best match of each read. To rule out sequencing depth bias, the aligned sequences were down-sampled such that all samples had the same number of aligned reads. Human samples of the marks H3K4me3, H3K27me3, H3K4mel and H3K27Ac, as well as whole-cell extract, were down-sampled to include 3,750,000 aligned reads. H3K9me3 samples were down-sampled to 5,900,000 aligned reads. Mouse samples of the marks H3K4me3, H3K27me3, H3K4mel and H3K27Ac, were down-sampled to 3,420,000 aligned reads.
(702) Chromatin profiles (
(703) Accumulation of H3K9me3 marker on chromosome X (
(704) Enhancers were detected following the guidelines set by Rada-Iglesias et al. [Rada-Iglesias, A. et al. Nature 470, 279-283 (2011)]. Shortly, enhancers of type one are genomic intervals that contain H3K4mel and H3K27Ac marks, do not contain H3K4me3 or H3K27me3 marks and are at least 500 bp away from any TSS. Enhancers of type two are genomic intervals that contain H3K4mel and H3K27me3 marks, do not contain H3K27Ac mark, and are at least 500 bp away from any TSS. To find those enhancers the present inventors first identified enriched intervals of the marks above using MACS version 1.4.1 [Zhang, Y., Genome Biol. 2008; 9(9):R]37]. The present inventors used sequencing of whole cell extract as control in order to define a background model. Duplicate reads aligned to the exact same location are excluded by MACS default configuration. Enriched intervals (peaks) that overlap by at least 1 bp were considered as overlapping, and their union was defined as the enhancer interval, unless at least 10% of it overlapped with any of the excluded marks (e.g. H3K27me3 in the case of type one enhancers) or with TSS. To calculate the number of enhancers in human samples (
(705) To detect bivalent genes the present inventors identified enriched intervals of H3K4me3 and H3K27me3 using MACS. Enriched intervals were mapped to genes if they overlapped a 3 kb interval before their Transcription Start Sites and after their Transcription End Site. Genes marked as bivalent if they had both H3K27me3 and H3K4me3. In human samples the present inventors required that the genes are bivalent in at least 2 cell lines. Distribution of H3K27me3 mark in genomic components was calculated by counting the number of H3K27me3 peaks in each component: promoter (6 Kb symmetric interval around TSS), Gene body (between 3 Kb downstream to TSS and TES), and intergenic (outside promoter and gene body). The peaks were divided to bins according to their height, calculated as RPKM.
(706) DNA Constructs inserted into human pluripotent cells. The pCAG-IresPuro or pCAG-flox-DsRed-IRES-Puro vectors (7) encoded the following inserts (which were cloned by either cohesive or blunt-end ligations in XhoI-NotI sites): Stat3-C(A662C and N664C mutations) (8), Stat3-Y705F (dominant-negative allele). Human Oct4 enhancer sequences [the Oct4DE- and Oct4PE-SV40-luciferase (Luc) constructs] were cloned into the pGL3-Promoter Vector (Promega) with the following
(707) TABLE-US-00006 primers:5hOcCT4PEKpnI: (SEQIDNO:1) 5-GGTACCGGATACTCAGGCCAGGCCCAGAAA-3; 3hOCT4PEXhoI: (SEQIDNO:2) 5-CTCGAGTCCACAGACCTCTGGCACT-3; 5hOCT4DEKpnI: (SEQIDNO:3) 5-GGTACCCATTGAGTCCAAATCCTCTTTACTAGGTG-3; 3hOCT4DEXhoI: (SEQIDNO:4) 5-CTCGAGCTGAGGCTCATGCTGCTGG-3.
Reporter constructs were used to determine the regulation pattern of Oct4 expression and were electroporated into 0.5-310-6 cells along with the pRL-TK vector for normalization. Assays were performed 48 hours later using the Dual-Glo Luciferase Assay System (Promega). The basal activity of the empty luciferase vector was set as 1.0.
(708) Generation of the NGFP1-Mbd3.sup.KD cell line: NGFP1-Mbd3.sup.KD was established by infection and sub cloning of secondary NGFP1 iPSC line with a ShRNA pLKO-Tet-On vector (addgene) as previously described (Hanna et al. Nature 2009).
(709) Immunocytochemistry and FACS AnalysisCells were fixed in 4% paraformaldehyde in PBS and immunostained according to standard protocols using the following primary antibodies: SSEA1, SSEA4 and SSEA3 (Developmental Studies Hybridoma Bank); Tra-1-60 and Tra-1-81 (Millipore); SOX2 (R&D Systems); OCT3/4 (Santa Cruz Biotechnology); human NANOG (goat polyclonal; R&D Systems), mouse Nanog (polyclonal rabbit; Bethyl). Appropriate Alexa Fluor dye-conjugated secondary antibodies (Molecular Probes, Invitrogen) were used. For MHC class I staining of human cells, the present inventors used anti MHC class I antibody (BE pharmingen). For mouse cells, the present inventors used anti-mouse MHC class I H-2 Kb and H-2Kd (eBioscience). Human Cells were stained with specific cell surface markers; SSEA4 conjugated APC or TRA-1-60(R) conjugated PE (R&D). Data were collected on BD FACS ARIA III and analyzed with Flowjow software.
(710) DNA Methylation AnalysisDNA was proteinase K-treated and extracted, and 1 g of DNA was subjected to conversion using the Qiagen EpiTect Bisulfite Kit. Promoter regions of OCT4 and XIST were amplified using previously described primers (Hanna et al., 2010b; Lengner C J, et al. (2010) Derivation of pre-x inactivation human embryonic stem cell line in physiological oxygen conditions. Cell. 2010 May 28; 141(5):872-83; Hockemeyer D, et al. (2008) A drug-inducible system for direct reprogramming of human somatic cells to pluripotency. Cell Stem Cell 3:346-353; and Soldner F, et al. (2009) Parkinson's disease patient-derived induced pluripotent stem cells free of viral reprogramming factors. Cell 136:964-977; each of which is fully incorporated herein by reference in its entirety). XIST forward primer (used on bisulfite treated DNA): 5-taa att tta aat taa tta aat tat-3 (SEQ ID NO:106); XIST reverse primer (used on bisulfite treated DNA): 5-tgt ttt aga aag aat ttt aag tgt aga ga-3 (SEQ ID NO:107). PCR products were cloned using the pCR2.1-TOPO vector and sequenced using the M13 forward primer. Method for LC-MS quantification of relative cytosine methylation: Mass spectrometry measurement of 5-methylcytosine (5mC) content was conducted (on human primed iPSCs/ESCs, and human naive iPSCs/ESCs expanded in a modified WIS-NHSM conditions which included PKCi and which did not include FGF2 and TGFB cytokines, as previously described [Leitch, H. G. et al. Naive pluripotency is associated with global DNA hypomethylation. Nat. Struct. Mol. Biol. 20, 311-316 (2013)] with a slight modification. Briefly, 250 ng genomic DNA from naive or primed pluripotent cells expanded without MEF feeder cells, was denatured by heating at 100 C. for 3 minutes. Samples were incubated with 1/10 volume of 0.1 M ammonium acetate, pH 5.3, and 2 Units (U) of nuclease P1 for 2 hours at 45 C. A 1/10 volume of 1 M ammonium bicarbonate and 0.002 units of phosphodiesterase I were added, followed by incubation for 2 hours at 37 C. Finally, samples were incubated for 1 hour at 37 C. with 0.5 U alkaline phosphatase. Samples were subsequently diluted in 2 mM ammonium formate, pH 5.5. The nucleosides were separated on an Agilent RRHD Eclipse Plus C18 2.1100 mm 1.8u column by using the HPLC system 1200 (Agilent) and were analyzed by using an Agilent 6490 triple quadrupole mass spectrometer. To calculate the concentrations of individual nucleosides within the samples analyzed, standard curves with known amounts of synthetic nucleosides were generated and used to convert the peak-area values to corresponding concentrations.
(711) Reduced representation bisulfite sequencing (RRBS) libraries for genome wide sequencing profile of DNA methylationRRBS libraries were generated as described previously with slight modifications [Smith, Z. D. et al. Nature 484, 339-344 (2012)]. Briefly, DNA was isolated from snap-frozen cell pellets using the Quick-gDNA mini prep kit (Zymo). Isolated DNA was then subjected to MspI digestion (NEB), followed by end repair using T4 PNK/T4 DNA polymerase mix (NEB), A-tailing using Klenow fragment (3.fwdarw.5 exo-) (NEB), size selection for fragments shorter than 500-bp using SPRI beads (Beckman Coulter) and ligation into a plasmid using quick T4 DNA ligase (NEB). Plasmids were treated with sodium bisulfite using the EZ DNA Methylation-Gold kit (Zymo) and the product was PCR amplified using GoTaq Hot Start DNA polymerase (Promega). The PCR products were A-taild using Klenow fragment, ligated to indexed Illumina adapters using quick T4 DNA ligase and PCR amplified using GoTaq DNA polymerase. The libraries were then size-selected to 200-500-bp by extended gel electrophoresis using NuSieve 3:1 agarose (Lonza) and gel extraction (Qiagen). Libraries were pooled and sequenced on an Illumina HiSeq 2500 system. The sequencing reads were aligned to the Mouse Genome Build 37 (mm9) using Bismark. Methylation levels were calculated and averaged only for CpGs that were covered by 5 or more distinct sequencing reads across all libraries. The CpG content experienced by each CpG site was defined as the number of CpG dinucleotides found within a 500-bp window surrounding the site divided by the window size.
(712) Protocol for Injecting Human and Primate Naive Pluripotent Stem Cells:
(713) 1. Dissect oviducts of hormone primed and mated B6D2F1 females X B6D2F1 males, and extract zygotes (as routinely done with mouse micro-manipulation). 2. Culture zygotes for 2 days in KSOM medium droplets (Zenith Biotech KSOMaa Evolve cat #ZEKS-050) covered with mineral oil at 37 C., 5% O.sub.2 incubator, until they develop to morula stage. 3. Grow human naive cells to 70-90% confluence in NHSM medium on gelatin/DR4 irradiated MEF coated plates. 4. The day before cell harvesting add 10 M ROCKi to the cells (in case not continuously used in the NHSM medium). 5. Trypsinize the cells for5 minutes with 0.05% trypsin, shake and pipette thoroughly to yield one cell suspension. Stop the reaction with DMEM+15% FBS and centrifuge at 1000 RPM for 3 Minutes. Aspirate and discard medium. 6. Resuspend cells in 900 l NHSM medium, add 100 l filtered FBS (to reduce stickiness of cells) and 10 M ROCKi. Keep on ice until and during injections (very important). It is preferable to inject the cells as soon as they are harvested. 7. Inject 15-20 human naive cells to a mouse morula by using of Piezo (as routinely done with mouse ES injections). 8. After injection, incubate for 3-4 hours in KSOM droplets supplemented with 10 M ROCKi covered with mineral oil. 9. After 3-4 hours transfer the morulas to KSOM droplets (without ROCKi) covered with mineral oil, incubate over night. 10. The next day, most morulas should develop to blastocysts. Transfer 15-20 blastocysts to uterus of pseudo-pregnant B6D2F1 female mice.
Example 1
(714) Boosting Primed Stem Cells Reversion to Naive Pluripotency
(715) The present inventors set out to test whether additional genetic manipulations may enable radically efficient and homogenous reprogramming towards ground state pluripotency. Recent studies have pointed out the importance of chromatin derepression in converting somatic cells into iPSCs (Mansour et al., 2012; Soufi et al., 2012). In addition, the ground state of pluripotency pertains an open chromatin configuration with reduced levels of repressive chromatin marks (Marks et al., 2012). Therefore, the present inventors aimed to conduct a loss of function screen for epigenetic repressor factors in an attempt to dramatically boost the efficiency of reprogramming to ground state pluripotency. The present inventors initially focused on reverting primed epiblast stem cells (EpiSCs) (Mansour et al., 2012), that in the absence of exogenous transcription factor over-expression, can convert within 7 days into naive pluripotent state in naive 2i/LIF (2i=PD0325901 ERK1/2 inhibitor and GSK30 inhibitor CHIR99021) growth conditions. The present inventors utilized an EpiSC line carrying a Nanog-GFP knock-in reporter that is active only in the naive ground state (Mansour et al., 2012), and applied siRNA screening in order to identify boosters of EpiSC reversion into Nanog-GFP.sup.+ naive pluripotent cells (
(716) Methyl-CpG-binding domain 3 (Mbd3; SEQ ID NO:7) is a structural component protein in the Nucleosome remodeling and Deacetylation (NuRD) complex, and together with Mbd 1, 2 and 4, was originally characterized as a protein containing a region with high homology to the methyl-CpG-binding domain (MBD) of MeCP2 (Kaji et al., 2007). Mbd2 and Mbd3 assemble into mutually exclusive distinct NuRD complexes (Le Guezennec, X. et al. Mol. Cell. Biol. 26, 843-851, 2006), which can mediate gene repression through histone deacetylation via histone deacetylase 1 (HDAC1) and 2, and chromatin remodeling ATPase activities through its chromodomain helicase DNA binding protein 3 (CHD3) (Mi2a) and CHD4 (Mi2b) subunits (Zhu et al., 2009).
(717) Mbd3/NuRD preferentially binds and represses actively transcribed genes, and some of its components (e.g. Chd4) have also been implicated in serving as transcriptional activators at certain loci [Reynolds, N., et al., Cell Stem Cell, 2012, 10: 583-594; Gunther, K. et al. Nucleic Acids Res. 2013, 41: 3010-3021].
(718) To validate the siRNA screening results, the present inventors used Mbd3.sup.+/+ and Mbd3.sup.flox/ ESCs (Kaji et al., 2007) and introduced Rosa26-CreER and a Nanog-GFP knock-in alleles by gene targeting (
(719) The fact that lack of Mbd3 promotes reversion to pluripotency is seemingly contradictory to previous in vivo studies that had suggested that Mbd3 is essential for establishing the ground state of pluripotency after fertilization (Kaji et al., 2006; 2007). This conclusion was based on the fact that while Oct4.sup.+ cells could be observed in the inner cell mass of Mbd3.sup./ E3.5 embryos, Mbd3.sup./ ESCs could not be derived in vitro after explantation in serum/LIF derivation conditions (Kaji et al., 2006; 2007). However, already established ES cells, that can tolerate loss of Mbd3 following gene targeting, show a propensity for trophoblast differentiation in serum containing conditions (
(720) A. Reprogramming primordial germ cells into pluripotent stem cells. PLoS ONE 3, e3531 (2008); Leitch, H. G. et al. Embryonic germ cells from mice and rats exhibit properties consistent with a generic pluripotent ground state. Development 137, 2279-2287 (2010)]. Single cell sorted Mbd3.sup.flox/ Oct4-GFP.sup.+ E8.5 PGCs from chimeric animals, were proficient in forming EG cell colonies and lines (>95% efficiency), while PGCs isolated from chimeras generate from Mbd3.sup.+/+ or Mbd3.sup.flox/ cells carrying an exogenous Mbd3 expressing transgene reprogrammed at less than 10% efficiency (
Example 2
(721) Alleviating Mbd3 Inhibition Facilitates Somatic Cell Reprogramming
(722) The present inventors tested whether Mbd3 inhibition in somatic cells, that lack expression of endogenous pluripotency markers like Oct4 and are more developmentally restricted in comparison to EpiSCs and PGCs, facilitates their direct conversion to ground state pluripotency at efficiencies nearing 100%. Mbd3.sup.+/+, Mbd3.sup.flox/ and Mbd3.sup./ fibroblasts carrying Oct4-GFP reporter were directly infected with O, K, S, M encoding moloney viruses, and Oct4-GFP reactivation was evaluated by flow cytometry. While Mbd3 depleted cells reprogrammed more efficiently in comparison to wild type cells, only 15% Oct4-GFP cells were obtained from Mbd3.sup.flox/ and Mbd3.sup./ depleted samples (
(723) The present inventors analyzed the reprogramming dynamics of secondary Mbd3.sup.flox/ and control Mbd3.sup./+ fibroblasts by applying microscopic live imaging (Smith et al., 2010) (
(724) To evaluate the molecular extent of reprogramming in OSKM transduced Mbd3.sup.flox/ and Mbd3.sup.+/+ somatic cells, the present inventors conducted global gene expression analysis on donor MEFs and at days 0, 4 and 8 following DOX induction without cell passaging, and compared them to iPSC and ESC lines. Only Mbd3.sup.flo-somatic cells clustered separately from donor fibroblasts already at day 4 following DOX. Amazingly, by Day 8 they were transcriptionally indistinguishable from multiple ESC and subcloned established iPSC lines (
(725) Following the depletion of Mbd3 expression, the present inventors were not able to isolate stable partially reprogrammed cells that did not reactivate Oct4/Nanog-GFP and could be stably expanded in vitro as typically can be obtained from OSKM transduced wild-type somatic cells (
(726) Phylogenetic analysis of Mbd3 and other NuRD complex proteins across 16 metazoan which span the entire clade (from mammals to the simplest multicellular animal T. adhaerens) showed that Mbd3 and other NuRD complex proteins were found to have an ortholog in T.adhaerens, but not in yeast, which might imply on their appearance in the first multicellular animals alongside with Oct4 and developmental pluripotency (
(727) To functionally validate a conserved inhibitory role for MBD3 in human iPSC reprogramming (
Example 3
(728) Numerical Description of Oskm Reprogramming Following Mbd3 Depletion
(729) The present inventors next sought to quantitatively characterize the reprogramming latency distribution for both Mbd3+ and Mbd3.sup.KD samples, and compare it to known deterministic behavior. To do so, the present inventors applied a previously described approach for monoclonal murine Pre-B cell weekly follow-up for reactivation of Nanog-GFP (
(730) Indeed, only NGFP1-Mbd3.sup.KD derived monoclonal B cell populations converted into Nanog-GFP.sup.+ iPSCs at day 7 at 100% efficiency (
Example 4
(731) Mechanisms for Mbd3 Inhibition of Ipsc Reprogramming by Oskm Recent work has shown that the pluripotency factor Zfp281 directly recruits Mbd3/NuRD to Nanog promoter and repress its expression (Fidalgo et al., 2012), and that inhibition of Zfp5281 led to a modest 2-fold increase in iPSC formation efficiency (Fidalgo et al., 2012). Given that Mbd3 inhibition conducted here led to a much more pronounced effect, in comparison to Zfp281 depletion, this has raised the hypothesis that Mbd3 may be acting more globally in pluripotency regulation by directly interacting with many other pluripotency promoting factors. The present inventors show that Flag-Tagged Oct4, Klf4, and Sox2 specifically co-immunoprecipitated with Mbd3 following overexpression in 293HEK cells (
(732) Mbd3 inhibition was a key and dominant contributor to the radically efficient progression towards pluripotency reported herein. Thus the present inventors aimed to define the mechanisms of Mbd3 inhibition of iPSC reprogramming. Inhibiting Mbd3 expression was not sufficient to induce iPSC formation in the absence of exogenous OSKM overexpression in somatic cells (even in NPCs that can be reprogrammed with Oct4 expression alone) (Kim, J. B. et al. Nature 461, 649-653, 2009) (
(733) Consistent with the direct protein interactions for Mbd3/NuRD complex with OSKM reported above, genome wide ChIP-seq analysis of Mbd3 binding in DOX induced wild type MEFs, identified a global increase in Mbd3 recruitment and binding following OSKM induction (1177 binding regions in MEF compared to 8657 following OSKM induction). Only after DOX induction, Mbd3 bound genes are enriched for targets of Klf4, Oct4, Sox2 and Esrrb (p<10.sup.22) as well for genes with H3K4me3 active chromatin mark in ES cells (p<10.sup.38) (
(734) Transcription level of Mbd3 target genes following 4 days of DOX was significantly upregulated following DOX in Mbd3 depleted samples (
(735) Analysis and Discussion
(736) Mbd3 And Deterministic Reprogramming To Ground State Naive Pluripotency
(737) Here the present inventors identify the specific of Mbd3/NuRD repressor complex as major barrier preventing epigenetic reversion of EpiSCs, PGCs and somatic cells to ground state pluripotency by defined signaling and transcriptional input. This complex is evolutionary conserved since the emergence of multicellularity and counteracts the reprogramming potential of a variety of pluripotency factors that cooperatively establish the ground state of pluripotency. Mbd3 repression is tolerated once pluripotency is established, however when trying to enter this state the inhibitory function become dramatically rate limiting and preventing majority of cells assume the pluripotent state. Collectively, these findings show that direct reprogramming to pluripotency need not be stochastic, and that OSKM and other reprogramming methods applied thus far are reductionist. It would be interesting to investigate whether there are alternative pathways that can enable deterministic induction of pluripotency and/or further accelerate the deterministic reprogramming dynamics observed in Mbd3 depleted cells following OSKM induction. It will also be of great interest to determine whether and how is Mbd3 neutralized in vivo during pre-implantation and germ-line reprogramming.
(738) The ability to directly reprogram somatic cells into iPSCs has boosted the scientific interest to comprehend the dynamics of epigenetic reprogramming at high resolution, and to accurately define the temporal regulation between transcription factors and chromatin remodelers throughout the entire process of iPSC formation. Despite of the great progress achieved in the field, the present inventors are still highly limited in comprehending the molecular mechanisms, dynamics and interdependence between different layers of chromatin regulation, and how they lead to the establishment of distinct pluripotent states. The latter directly results from the inefficiency and stochasticity of currently devised reprogramming methods together with the difficulty to prospectively isolate the rare cells that correctly and rapidly reprogram into iPSCs. While the study of intermediate populations has provided important insights into mechanisms of pluripotency reprogramming, such cells overly great molecular heterogeneity and retain randomness in progressive towards pluripotency. The near deterministic reprogramming strategies reported herein can allow dissection of authentic molecular events accompanying a more synchronized and non-saltatory progression pattern towards iPSCs, which is critical for molecular deciphering of the black box of reprogramming.
(739) The present inventors show that the stochastic and a-synchronized trajectory of direct reprogramming by OSKM (Hanna, J. H., et al., Cell, 143, 508-525, 2010) can be coaxed to become radically efficient and deterministic with modified reprogramming approaches. The present inventors highlight Mbd3/NuRD repressor complex, which is naturally depleted during normal pre-implantation development (
Example 5
(740) Chemically Defined Growth Conditions for Deriving Transgene Independent and Indefinitely Stable Human Naive Pluripotent Cells
(741) The recent isolation of naive pluripotent stem cells from non-obese diabetic (NOD) mouse strains and rats (Hanna et al., 2009a), previously considered non-permissive for ESC derivation, has been achieved by supplementation with small molecules or growth factors that alleviate inhibitory differentiation cues and/or reinforce key signaling pathways that stabilize core transcriptional circuitry of naive pluripotency (Hanna et al., 2010b).
(742) Defining Human Naive Pluripotency Growth Conditions
(743) To define conditions for expanding human naive pluripotent cells that are independent of ERK1/2 signaling, the present inventors first utilized a previously described secondary human female C1.2 iPSC line containing Doxycycline (DOX) inducible lentiviral transgenes encoding OCT4 (SEQ ID NO:54 protein), SOX2 (SEQ ID NO:56 protein) and KLF4 (SEQ ID NO:58 protein) reprogramming factors (Hanna, J. et al. Proc. Natl. Acad. Sci. U.S.A. 107, 9222-9227, 2010; Chia, N.-Y. et al. Nature 468, 316-320 (2010); Lengner, C. J. et al. Cell 141, 872-883 (2010); Tomoda, K. et al. Cell Stem Cell 11, 91-99 (2012); Bernstein, B. E. et al. Cell 125, 315-326 (2006); Guenther, M. G. et al. Cell Stem Cell 7, 249-257 (2010)], and a constitutively active lentivirus encoding the reverse tetracycline transactivator (FUW-M2rtTA) (
(744) While C1.2 cells rapidly differentiated in 2i/LIF only conditions, the combined action of 16 factor conditions (16F- divided into Pool 1 and Pool 2 subgroups) attenuated the differentiation propensity and allowed retaining 32% of OCT4-GFP+ cells as measured at day 14 after DOX withdrawal (
Example 6
(745) Derivation of Ground State Naive Human Escs
(746) New human embryo derived naive ESCsThe present inventors next examined whether WIS-NHSM conditions allow derivation of new hESC lines from the ICM of human blastocysts [Lengner, C. J. et al. Cell 141, 872-883 (2010); Roode, M. et al. Dev. Biol. 361, 358-363 (2012)]. In contrast to the lack of derivation of any cell lines from blastocysts explanted in 2i/LIF/FGF2 conditions (0% efficiency, n=82), human blastocysts plated on mouse embryonic fibroblast (MEF) coated plates and WIS-NHSM medium successfully generated domed cell outgrowths following only 6-8 days of plating (
(747) Naive hESCs and hiPSC lines were expanded in defined growth conditions independent of feeders or fetal bovine serum on vitronectin/gelatin coated plates, and passaged following trypsinization into single cells. Human naive pluripotent lines maintained normal karyotype after extended passaging (
(748) The naive hESC/hiPSCs described herein are stably pluripotent in vitro -All cell lines stained uniformly positive for Oct4, Sox2, Nanog, SSEA3, SSEA4, TRA1-60 and TRA1-81 pluripotency markers (representative images in
(749) The naive hESC/hiPSCs described herein are stably pluripotent in vivoTo test pluripotency in vivo, the present inventors transplanted naive hESC/hiPSCs subcutaneously into immunodeficient (SCID) mice and 3-5 weeks after injection, teratomas were extracted for histological examination that showed that the tumor contained various tissues, including gut-like epithelial tissues (endoderm), striated muscle (mesoderm), cartilage (mesoderm), neural tissues (ectoderm) (
(750) Together these results indicate that naive hESC/hiPSC lines established from previously isolated primed hESCs/iPSCs have the functional properties and developmental potency of pluripotent ESCs and iPSCs. .
(751) The WIS-NHSM medium can be used to generate naive PSC from a human inner cell mass (ICM)The present inventors examined the ability to expand human ICM derived cells (Lengner et al., 2010) in WIS-NHSM conditions. A human blastocyst was plated on mouse embryonic fibroblast (MEF) cells in WIS-NHSM medium (
Example 7
(752) Epigenetic Features of Human Naive Pluripotency
(753) The present inventors next moved to characterize epigenetic features in naive hiPSCs and genetically unmodified hESCs established in WIS-NHSM conditions. The evolutionary conserved distal (DE) and proximal enhancer (PE) regions of Oct4 gene are reciprocally regulated in the pre- and post-implantation mouse embryo, and thus the Oct4 distal enhancer is predominantly utilized in naive mESCs (Hanna, J. et al. Proc. Natl. Acad. Sci. U.S.A. 107, 9222-9227, 2010), while the proximal enhancer element is preferentially active in primed mEpiSCs. Primed and naive hESC/hiPSCs were transfected with a luciferase reporter construct under the control of either the human distal or the proximal enhancer sequences that control expression of the OCT4 gene (
(754) As a minority of human primed PSC lines can maintain a pre-X inactivation state [Mekhoubad, S. et al. Cell Stem Cell 10, 595-609 (2012); Papp, B. & Plath, K. Cell 152, 1324-1343 (2013)], X chromosome epigenetic status may not be a single reliable marker to unequivocally distinguish between naive and primed state. However, the present inventors aimed to analyze the frequency and properties of X inactivation state in multiple naive hESC/hiPSC lines.
(755) Human ICM (inner cell mass) cells of late stage blastocysts display a unique pre-X inactivation state in females, where despite XIST gene is weakly transcribed (even in male embryos), both X chromosomes are in a pre X-inactivation state and do not demonstrate H3K27me3 and XIST chromosome coating until differentiation [Okamoto, I. et al. Nature. 2011; 472(7343):370-4].
(756) The present inventors characterized X-chromosome inactivation state in naive-hESCs/hiPSCs. Primed/conventional WIBR3 hESCs demonstrate X inactivation as evident by -50% methylation of XIST gene, very high transcription of XIST transcript consistent with initiation of X chromosome inactivation (
(757) Close monitoring of X chromosome dynamics in primed female hESC lines during in vitro derivation in conventional bFGF/TGF only conditions, demonstrated that the cells have a great tendency to undergo X chromosome inactivation as a part of an in vitro adaptation process [Lengner, C. J. et al. Cell 141, 872-883 (2010); Papp, B. & Plath, K. Cell 152, 1324-1343 (2013); O'Leary, T. et al. Nat Biotechnol 30, 278-282 (2012)]. Indeed, naive pluripotent cells captured in WIS-NHSM uniformly maintain a pre-inactivated X chromosome as evident by nearly complete lack of H3K27me3 nuclear foci and down regulation of XIST expression (
Example 8
(758) Transcriptional and Chromatin State of Human Naive Pluripotency
(759) The present inventors compared global gene expression patterns between naive and primed hESCs and hiPSCs, many of which were genetically matched. Unbiased clustering of genome-wide expression profiles demonstrated that naive hESC and hiPSCs possess a distinct gene expression pattern and clustered separately from conventional/primed hESCs and hiPSCs (
(760) The present inventors next tested whether a difference between human naive and primed cells is also apparent at the chromatin level, as priming of murine naive ESCs induced by 2i withdrawal and providing serum is associated with accumulation of H3K27me3 mark and formation of bivalent domains (gene promoter marked by H3K27me3 and H3K4me3) on developmental regulatory genes [Marks, H. et al. Cell 149, 590-604 (2012)]. The present inventors mapped H3K4me3 and H3K27me3 chromatin marks by using ChIP-Seq in mouse and human naive ESCs and primed EpiSCs (both expanded in serum free conditions). Indeed, while distribution of both epigenetic markers over all genes showed a significant (p<2e-.sup.37) decrease in H3K27me3 (
(761) The present inventors tested whether the WIS-NHSM naive human conditions have an effect also in other genomic components such as enhancers. For this, the present inventors first measured the distribution of H3K27me3 in three genomic components: promoters, genes body and intergenic regions. Consistent with what was observed in mouse cells [Marks, H. et al. Cell 149, 590-604 (2012)], the present inventors found that in naive cell state, H3K27me3 peaks are depleted more from promoters and gene-bodies, than from intergenic regions (
(762) Rodent ground state naive pluripotency is associated with global DNA hypomethylation, while maintaining epigenetic imprinting signatures. This effect is mediated by 2i-mediated down regulation of de novo methyltransferase enzymes, and maintaining expression of TET hydroxylases and Dnmtl enzyme. Remarkably, human naive ESC sand IPSCs expanded in WIS-NHSM conditions demonstrated a dramatic down-regulation of DNMT3a, DNMT3b and DNMT3L methyl-transferase enzymes, but not of DNMT1 and TET1/2 enzymes (
(763) ICM-Like Pre-x Inactivation State in Naive Human PSCs
(764) The highly conserved distal and proximal enhancer regions of Oct4 genes are reciprocally regulated in the pre and post implantation mouse embryo, and thus the Oct4 distal enhancer is predominantly utilized in mouse naive ESCs (Hanna et al., 2010b). Primed and naive hESC/hiPSCs were transfected with a luciferase reporter construct under the control of either the human distal or the proximal enhancers sequences that control expression of the Oct4 gene (
(765) Naive human iPSCs can contribute to mouse development in vivoHuman naive C2 iPSCs were constitutively labeled with GFP and BCL-2 overexpression vector. Cells were aggregated with developing mouse embryo morulas, and 24 hours GFP cells were viable in developing early mouse embryos (
Example 9
(766) Functional and Signaling Properties of Human Naive Pscs
(767) The above results indicate that while both human naive and primed growth conditions that contain bFGF and TGF cytokines, the supplementation of the naive conditions with 2i/LIF, p38 and JNK inhibitors reconfigures the molecular and epigenetic properties of human pluripotent cells. Thus, the present inventors next characterized the signaling dependence and response patterns of naive and primed human pluripotent cells to different signaling stimuli or inhibitors, in comparison to their rodent counterparts. The pluripotency of mESCs is stabilized upon inhibition of RAF-ERK1/2 pathway, while in hESCs and mEpiSCs (Hanna, J. et al. Proc. Natl. Acad. Sci. U.S.A. 107, 9222-9227, 2010), ERK and RAF inhibition with either one out of four different small molecules leads to their differentiation (
(768) LIF/Stat3 signaling is an important pathway in promoting the rodent ground state of naive pluripotency, and in 2i/LIF conditions, mESCs are dependent on LIF signaling and readily differentiate when exposed to JAK inhibitor (JAKi) that blocks Stat3 phosphorylation (
(769) The present inventors next characterized functional difference between human naive and primed pluripotent cells. Naive human pluripotent cells were reproducibly more amenable to gene targeting by homologous recombination with isogenic targeting vectors directed at the endogenous OCT4 and COL1A loci, in comparison to their genetically matched primed cells (
(770) Notably however, naive human ESC/iPSCs generated herein are distinct from murine naive cells, in the way that they are still dependent on bFGF and TGF signaling, and inhibition of these pathways leads to their naive cells state loss and differentiation.
(771) Collectively these findings indicate that the naive ground state of pluripotency requires a unique combination of growth factors and cytokines. Human cells are more stringent from mouse, thus they need simultaneous inhibition of different MAPK pathways (ERK and JNK and p38 simultaneous inhibition) together with LIF and WNT stimulation (by CHIR99021). Also, bFGF and TGF have diverged between mouse and humans, and in humans they are also essential to promote naive pluripotency and contribute to the unique molecular and epigenetic configuration of naive pluripotency described herein.
(772) These findings substantiate the concept of naive ground state in human pluripotent cells, and indicate that its maintenance requires a unique combination of growth factors and cytokines. Human pluripotent cells are more stringent relative to their mouse counterparts, as they need simultaneous inhibition of different MAPK pathways (ERK, JNK and P38 MAPK simultaneous inhibition) together with LIF and WNT stimulation (by CHIR99021). FGF2 and TGF signaling are divergent between mice and humans [Greber, B. et al. Cell Stem Cell 6, 215-226 (2010); Roode, M. et al. Dev. Biol. 361, 358-363 (2012)], as in humans they are also essential to promote naive pluripotency and contribute to the unique molecular and epigenetic configuration of naive pluripotency described herein. These results suggest that epigenetic priming of human pluripotent cells is predominantly caused by withdrawal of LIF and inhibitors of MAPK signaling [Pribluda, A. & Hanna, J. H. Nat Biotechnol 30, 247-249 (2012)]. These findings are consistent with the notion that different genetic backgrounds assume distinct states of pluripotency in vitro, the stability of which is regulated by endogenous genetic determinants and can be modified by defined exogenous factors that support the naive ground state of pluripotency. The stringency in requirement for these factors appears to be different among distinct species, as exemplified by the requirement for simultaneous inhibition of multiple MAPK kinase pathways in human naive cells [Hanna, J. et al. Cell Stem Cell 4, 513-524 (2009); Hanna, J. H., et al., Cell 143, 508-525 (2010); Hanna, J. et al. Proc. Natl. Acad. Sci. U.S.A. 107, 9222-9227, 2010]. It would be of interest to explore whether the naive ground state of pluripotency in humans could be captured merely by signaling pathway inhibition [Ying, Q.-L. et al. Nature 453, 519-523 (2008)]. The epigenetic changes induced by naive pluripotency conditions indicate that naive conditions might influence previously described phenotypes of epigenetic memory and aberrant reprogramming in human iPSCs.
(773) Without being bound by any theory, these data do not claim that naive and primed pluripotent states are identical between humans and mice, and in fact differences may still exist between naive mESCs and the naive human pluripotent cells described in this work. Without being bound by any theory, the present inventors cannot exclude that alternative growth conditions may be devised to capture human naive pluripotent cells with features similar to those described herein, or that WIS-NHSM conditions might be modified for improving the extent of naive features in human pluripotent cells. Further molecular characterization of human ICM cells will help improve and understand the relevance of naive pluripotency in vitro characteristics described herein [Smith, Z. D. et al. Nature 484, 339-344 (2012); Okamoto, I. et al. Nature. 2011, 472(7343):370-4; Niakan K K, et al. Dev. Biol. 375, 54-64 (2013)]. Finally, defining a novel naive pluripotent state in humans that is stable and does not require any genetic modifications might be relevant for the molecular study of early lineage commitment in vitro, and for expanding the capabilities for utilizing hESCs and hiPSCs in regenerative medicine research and disease modeling in vitro and in vivo [Dimos J T, et al. Science 321, 1218-1221 (2008); Sandoe, J. et al. Nature Publishing Group 16, 780-789 (2013)].
(774) The results described herein demonstrate that naive hESC/iPSCs grown in WIS-NHSM are distinct from previously isolated hESCs/hiPSCs and extensively recapitulate growth characteristics, signaling dependence, epigenetic and transcriptional properties that define naive mouse ESCs, rather than the mouse post-implantation epiblast and EpiSCs. Further, they capture molecular features of human ICM that are not present in rodent/mouse ICM. These findings supports the notion that different genetic backgrounds assume distinct states of pluripotency in vitro, the stability of which is regulated by endogenous genetic determinants and can be modified by defined exogenous factors that support the naive pluripotent state. The threshold and requirement for these factors is different among different species where in the permissive 129 mouse strain LIF/Stat3 signaling can stabilize mouse ESCs, while on the NOD genetic background promotion of Wnt signaling and inhibition of ERK1 or providing small molecules that promote Klf2/4 expression (KP or FK) stabilize NOD ESCs. The human genetic background seems to be further non-permissive, as it required modulation of additional signaling pathways to stabilize the naive state in vitro. Evolutionary divergence has contributed to the findings that in humans, and possibly other species, as bFGF and TGF signaling contribute to human naive pluripotency maintenance. Finally, defining a novel naive pluripotent state in humans that is indefinitely stable and does not require any genetic modifications might be relevant for the molecular study of early lineage commitment in vitro and for expanding the capabilities for utilizing human ESCs and iPSCs in regenerative medicine research and disease modeling in vitro and in vivo.
(775) Framing these challenges by WIS-NHSM conditions and/or Mbd3 inhibition, may prove to be key not only for understanding early human development, but also for dissecting the core-transcriptional circuitry in human naive pluripotent cells in the absence of exogenous transgenes, as it allows more authentic analysis of this state. Most importantly, Human primed ESCs display great level of heterogeneity in gene expression, including differential expression of lineage commitment genes and X chromosome activation status. Moreover, substantial differences among cell lines in gene expression are not evident in the undifferentiated state but appear when cells differentiate in same growth conditions. Careful comparative analysis for directed differentiation into specific lineages uncovered dramatic heterogeneity that was evident by marked differences in differentiation propensity among human embryonic stem cell line. It is possible that this properties are direct result of the cells used correspond to EpiSC stage, where the cells become highly sensitive to exogenous differentiating cues and initiate lineage commitment. Naive human ESCs/iPSCs are homogenous functionally and molecularly when expanded in WIS-NHSM conditions. Without being bound by any theory is seems that the naive pluripotent cells are inherently resistant to differentiation signals by the presence that promote naive pluripotency, and thus may prove to display reduced heterogeneity upon differentiation.
(776) In addition to heterogeneity in differentiation propensity, naive human pluripotent state might facilitate adaptation of differentiation protocols that have only been successful with naive mouse ESCs. A prominent example is the generation of engraftment competent hematopoietic progenitors with mouse ESC capable of long-term in vivo re-population and secondary engraftment, while the success with conventional human ESC has been rudimentary. It remains to be seen whether human naive pluripotent cells will be more useful and more efficient in generating Disease-Relevant Phenotypes with Human-Animal Chimeras (as shown here in
Example 10
(777) P66 Alpha Coiled-Coil Domain as a Dominant Negative Inhibitor of Mbd31Nurd and as a Facilitator for Deterministic Ipsc Reprogramming
(778) Following the studies described hereinabove concerning the effect of Mbd3 upon the reprogramming process, the present inventors aimed to screen for an Mbd3 inhibitor, in order to neutralize the function of the MBD3NuRD complex.
(779) Since the inhibitory effect of Mbd3 is probably mediated by the recruitment of the NuRD complex, one of the approaches that were taken by the present inventors was to try and prevent the binding of MBD3 to the complex.
(780) Gnanapragasam et al. (Gnanapragasam et al. 2011. p66a-MBD2 coiled-coil interaction and recruitment of Mi-2 are critical for globin gene silencing by the MBD2-NuRD complex. Proc. Natl. Acad. Sci. 108:7487-7492) describe a unique coiled-coil interaction between MBD2 and p66u, another component of the NuRD complex, mediated by two coiled-coil regions in these proteins.
(781) The MBD2 coiled coil region is highly conserved between the MBD2 homologs (including MBD3), and interspecies.
(782) Gnanapragasam et al. 2011 (Supra) show that overexpression of p66u coiled-coil region competes with the wild type p66u, and inhibits the binding of MBD2 to Mi-2(a or 0). Moreover, they show that the p66u-CC also binds to MBD3 in the same region, and creates a similar structure [Nuclear magnetic resonance (NMR) structure of MBD2 binding to the p66u-CC is found under the Protein Data Bank (PDB) ID2L2L; An Information Portal to Biological Macromolecular Structures]. This interaction between the p66u-CC and the MBD2 inhibits the ability of MBD2 to repress its downstream target gene expression, probably mediated through the binding to CHD4 (chromodomain helicase DNA binding protein 4).
(783) Another paper that was recently published by Walavalkar et al. (Walavalkar et el. 2013. Unique features of the anti-parallel, heterodimeric coiled-coil interaction between methyl-cytosine-binding domain 2 (MBD2) homologues and GATA zinc finger domain containing 2A (GATAD2AP66a). J. Biol. Chem. 288: 3419-3427) shows that the p66u coiled-coil domain interacts with Mbd3, mbd311, mbd312 in different efficiency; MBD2 and MBD3 binds approximately in the same efficiency to p66u. Therefore, without being bound by any theory, the present inventors envisage that the p66u coiled-coil domain can interfere with the NuRD complex assembly, and inhibit the recruitment of Chd4, a critical component.
(784) As mentioned, p66u is a component of the NuRD complex. It has been shown that P66u null (loss of function) mice die during early development (day 10), and that p66 is not required for blastocyst formation (Marino et al. 2007. Mutants in the mouse NuRD/Mi2 component p66 are embryonic lethal. PLoS ONE 2(6): e519. doi:10.1371/journal.pone.0000519).
(785) As a proof of concept the present inventors cloned p66u coiled-coil domain into the pCAG-HA vector, in order to check its effect upon the NuRD complex assembly.
(786) The present inventors overexpressed MBD3-WT (SEQ ID NO: 112) and the HA-tagged p66u-CC in 293T cells, and further show in a co-immunoprecipitation for anti-Mbd3 pulldown, that the presence of p66u inhibits MBD3 binding and recruitment to CHD4 (
(787) In addition,
(788) Following are the MBD3 and CHD4 siRNAs used by the present inventors:
(789) For Mouse:
(790) Mbd3 Stealth siRNA mix that includes MSS-237238, MSS-275658 andMSS-275659 components (Invitrogen);
(791) Chd4 Stealth siRNA mix that includes MSS-200894, MSS-200895 and MSS-200896 (Invitrogen), were used for efficient knockdown in mouse cells.
(792) For Human:
(793) MBD3 Stealth siRNAs that include HSS147580 and HSS147581 components (catalogue number 1299003) were used for efficient MBD3 knockdown in human cells.
(794) Human CHD4 stealth siRNALife technologies HSS101850 was used to efficiently knockdown CHD4 in human.
(795) Since the present inventors have proved in previous experiments that MBD3 inhibitory effect is probably mediated mainly by Chd4, without being bound by any theory it is assumed that a peptide which can inhibit Chd4 binding to Mbd3 can serve as a potent inhibitor to MBD3.
(796) Further biochemical investigation of MBD3 loss of function as a result of P66aCC over expression (examining the interactions with the OSKM and the NuRD complex other members Mta2, Hdacl, 2) are ongoing. The coding sequence of the P66 alpha coiled-coil domain was amplified using the primers depicted in SEQ ID NOs: 115 and 116. The resulting P66 alpha coiled-coil domain coding sequence is set forth in SEQ ID NO: 113, and the encoded P66 alpha coiled-coil domain amino acid sequence is set forth in SEQ ID NO: 114. The P66 alpha coiled-coil domain (SEQ ID NO:114) can be used as an inhibitor of MBD3.
(797) Functional assays, including reprogramming (following chip-seq with and without p66aCC treatment) are ongoing.
(798) Deep structural analysis of the predicted NMR in order to find or design compounds which can bind this region of MBD3 is ongoing.
(799) Synthesizing a peptide of the p66alpha CC region (with TAT-NLS- signal) for functional test is ongoing.
Example 11
(800) Ipsc Reprogramming from Human Adult Somatic Cells Via Oksm and Eras Over Expression, Together with Mbd3 Depletion
(801) Human BJ fibroblasts were infected with TRIPZ MBD3 shRNA lentiviruses (3.1, 3.2, 3.3 indicate three different hairpin constructs targeting MBD3). Real time PCR expression for MBD3 was conducted after 72 hours with or without DOX induction. The results presented in
(802) Human primary fibroblast cell lines #13 and 14 #(obtained from adult healthy dermal biopsy) were infected with lentiviruses encoding OKSM, RtTa, ERAS (SEQ ID NO:109) (for overexpression of OKSM, RtTa, and ERAS) and with a lentivirus encoding MBD3 shRNAs (for downregulation of MBD3).
(803) RtTa (also known as M2rtTA) is the element that allows responding to Doxyccycline. Any DOX inducible system requires introducing RtTA element, so the present inventors used a Lentiviral plasmid expressing the reverse tetracycline transactivator (M2rtTA) [vector from addgene, Catalogue Number: 20342; SEQ ID NO:110).
(804) The following DOX inducible MBD3 knockdown lentiviral clones were used: TRIPZ Human MBD3 shRNA Clone ID: V3THS_392206 (#1) and V3THS_392210 (#3)Thermo Scientific). Clonal populations with ES-like morphology appeared 6-10 days after DOX induction (
(805)
(806)
(807)
(808) Primary females adult dermal fibroblast cells (line #13) were transduced with RtTa, OSKM and ERAS vectors in WIS-NHSM conditions, with or without TRIPZ-MBD3 shRNAs 1+3 mix (to knockdown human MBD3). iPSC colony numbers were counted at day 10 by staining for NANOG and TRA1-60 markers (
Example 12
(809) Human Naive Ipscs and Escs can Differentiate into Primordial Germ Cells Precursors
(810) Primordial germ cell (PGC)-like cells (PGCLC) derived from human naive iPSCs/ESCs can be injected in human/primate or mouse testis and give rise to functional sperm. Alternatively, they may be used for oocyte generation.
(811) Materials and Media:
(812) N2-KSR medium250 ml Neurobasal medium (Invitrogen#21103-049), 250 ml DMEM-F12, N2 supplement (Invitrogen, #17502-048), 1% KSR (knockout serum replacement, Invitrogen, #10828028) medium] with 8 ng/ml bFGF (Peprotech), 1 ng/ml TGF-1 (Peprotech) and ROCKi (10 M).
(813) PGC medium is comprised of GMEM (Invitrogen, #21710082), 15% KSR, 1% NNEA (Biological industries, 01-340-1B), Penicillin-Streptomycin, 1 mM L-Glutamine, 5 M ROCKi (Y-27632, Axon Medchem) and the following cytokines: 500 ng/ml BMP4 (bone morphogenetic protein 4; R&D Systems Inc.), 20 ng/ml LIF (leukemia inhibitory factor; PeproTech), 100 ng/ml SCF (Stem Cell Factor; PeproTech), 50 ng/ml EGF (Epidermal Growth Factor; Peprotech).
(814) Experimental Methods:
(815) Generation of mCherry knock in reporter allele in NANOS3 locusIn order to create mCherry reporter expression driven by endogenous human NANOS3 locus, the present inventors have chosen to knock in p2a-mCherry coding sequence in frame with the last exon of the NANOS3 gene. The present inventors have generated plasmids encoding TALEN molecules specific to the region covering NANOS3 stop codon. TALEN constructs were generated using GoldenGate TALEN kit2.0 (addgene cat #1000000024).
(816) Targeting construct for 2A-mCherry knock in was designed as shown in
(817) Inducement of epiblast stateNaive human ESCs, either genetically modified cells with the NANOS3-mCherry construct or unmodified cells, were grown on irradiated mouse embryonic fibroblasts (MEFs) or 0.2% Gelatin or vitronectin\gelatin coated plates, in WIS-NHSM medium supplemented with 5 M ROCKi (Y-27632, Axon Medchem). The cells were trypsinized with 0.05% Trypsin+ EDTA, and 50,000 cells/6-well were plated on 1 ng/ml Fibronectin (F1141, Sigma) covered plates in N2-KSR medium, which induces epiblast like (EpiLC) state.
(818) After two days in the N2-KSR medium the EpiLC cells were trypsinized and moved to low-cell-binding 96-well plates (145399, NUNC), at a density of 2500 cells/well, in 120 l PGC medium.
(819) Fifty microliters (50 l) of fresh PGC medium were added to each well after two days. Four or six days after the cells were moved to the PGC medium, they were separated using TripLE select (10x) (Invitrogen) for flow-cytometry or molecular analysis.
(820) Experimental Results
(821) Generation of mCherry knock in reporter allele in Nanos3 locusAs shown in
(822) Naive ESCs were induced to the epiblasts state by plating the cells on fibronectin covered plates and incubation in the presence of N2-KSR medium for 2 days. Following, the cells were removed by trypsinization from the plates and were transferred to low-cell binding plates in the presence of the PGC medium. Four to six days later, the cells were separated from the plates using TripLE select agent and were subjected to flow cytometry and molecular analysis.
(823) BMP4 induces expression of NANOS3-mCherry reporter geneCells that were subjected to the differentiation process described herein, using the N2-KSR and PGC media were examined by FACS for the expression of the NANOS3-mCherry reporter gene which indicates that the cells are in the PGC-like state. Thus, as shown in
(824) Evaluation of PGC markers in the PGCLC cells induced from the naive ESCs demonstrates generation of PGC from naive pluripotent stem cellsThe PGCLC cells generated by the method described herein were further evaluated for expression of PGC makers. Thus, as shown in
(825) Primed ESCs, that were genetically modified with the NANOS3-mCherry knock in vector, were subjected to the same differentiation protocol described herein. However, they failed to form PGCLC. Thus, as shown in
(826) Further FACS analyses (
Example 13
(827) Inhibition of Protein Kinase C Resutls in Reduced Mbd3 Protein Levls of Embryonic Stem Cells
(828) The present inventors tested various factors, small molecules and agents for the ability to reduce MBD3 protein expression levels in embryonic stem cells.
(829) V6.5 mouse ES cells were expanded for 4 days in various conditions in order to identify combination of factors which result in reduced MBD3 protein levels. As shown in
Example 14
(830) Adjustment of the Wis-Nhsm Media
(831) The present inventors have devised various modifications of the basic WIS-NHSM medium in order to test the effect of inhibitors and growth factors on naive pluripotent stem cells. Table 3 hereinbelow and
(832) TABLE-US-00007 TABLE 3 WIS-NHSM media Condition No./agents 1 2 3 4 5 6 LIF 20 ng/ml 20 ng/ml 20 ng/ml 20 ng/ml 20 ng/ml 20 ng/ml ERK1/2i (PD0325901) 1 M 1 M 1 M 1 M 1 M 1 M GSK3i (CHIR99021) 3 M 3 M 3 M 3 M 3 M 3 M JNKi (SP600125) 5 M 5 M 5 M 5 M 5 M 5 M P38i (BIRB796) 2 M 2 M 2 M 2 M 2 M FGF2 16 ng/ml 16 ng/ml 16 ng/ml 16 ng/ml 16 ng/ml 16 ng/ml TGF1 2 ng/ml 2 ng/ml 2 ng/ml 2 ng/ml 2 ng/ml 2 ng/ml ROCKi (Y27632) 5 M 5 M 5 M 5 M 5 M 5 M IGFII 20 ng/ml 20 ng/ml 20 ng/ml SCF 10 ng/ml 10 ng/ml BMPi (LDN-193189) 0.5 M 0.5 M 0.5 M Table 3: Provided are the agents (factors, inhibitors) included in various modifications of the basic WIS-NHSM medium. LIF - leukemia inhibitory factor; FGF2 = fibroblast growth factor 2 (also termed basic FGF); TGF1 = transforming growth factor beta 1; SCF = stem cell factor; BMPi = bone morphogenetic protein inhibitor; IGFII = insulin-like growth factor 2 (somatomedin A). Note that condition No. 6 is devoid of the p38i.
(833)
(834) Similarly, Tables 4 and 5 below and
(835) TABLE-US-00008 TABLE 4 WIS-NHSM media (Conditions 1 and 7-11) Condition No./agents 1 7 8 9 10 11 LIF 20 ng/ml 20 ng/ml 20 ng/ml 20 ng/ml 20 ng/ml 20 ng/ml ERK1/2i (PD0325901) 1 M 1 M 1 M 1 M 1 M 1 M GSK3i (CHIR99021) 3 M 3 M 3 M 3 M 3 M 3 M JNKi (SP600125) 5 M 5 M 5 M 5 M 5 M 5 M P38i (BIRB796) 2 M 2 M 2 M 2 M 2 M 2 FGF2 16 ng/ml 16 ng/ml 16 ng/ml 16 ng/ml 16 ng/ml 16 ng/ml TGF1 2 ng/ml 2 ng/ml 2 ng/ml 2 ng/ml 2 ng/ml 2 ng/ml ROCKi (Y27632) 5 M 5 M 5 M 5 M 5 M 5 M IGFII 20 ng/ml SCF BMPi (LDN-193189) 0.5 M 0.5 M 0.5 M 0.5 M NOTCHi (DBZ) 2 M 2 M 2 M 2 M SHHi (RU-SKI-43) 5 M Table 4: Provided are the agents (factors, inhibitors) included in the WIS-NHSM medium. LIF - leukemia inhibitory factor; FGF2 = fibroblast growth factor 2 (also termed basic FGF; TGF1 = transforming growth factor bet 1; SCF = stem cell factor; BMPi = bone morphogenetic protein inhibitor; IGFII = insulin-like growth factor 2 (somatomedin A). NOTCHi = NOTCH inhibitor; SHHi = Sonic Hedgehog pathway (SHH) inhibitor; TGFRi = transforming growth factor receptor inhibitor; FGFRi = fibroblast growth factor receptor inhibitor.
(836) TABLE-US-00009 TABLE 5 WIS-NHSM media (Conditions 12-17) Condition No./agents 12 13 14 15 16 17 LIF 20 ng/ml 20 ng/ml 20 ng/ml 20 ng/ml 20 ng/ml 20 ng/ml ERK1/2i (PD0325901) 1 M 1 M 1 M 1 M 1 M 1 M GSK3i (CHIR99021) 3 M 3 M 3 M 3 M 3 M 3 M JNKi (SP600125) 5 M 5 M 5 M 5 M 5 M 5 M P38i (BIRB796) 2 M 2 M 2 M 2 M 2 M 2 FGF2 16 ng/ml 16 ng/ml 16 ng/ml TGF1 2 ng/ml 2 ng/ml ROCKi (Y27632) 5 M 5 M 5 M 5 M 5 M 5 M IGFII 20 ng/ml 20 ng/ml 20 ng/ml 20 ng/ml SCF 10 ng/ml 10 ng/ml 10 ng/ml 10 ng/ml BMPi (LDN-193189) 0.5 M 0.5 M 0.5 M 0.5 M 0.5 M 0.5 M NOTCHi (DBZ) 2 M 2 M 2 M 2 M 2 M 2 M SHHi (RU-SKI-43) 5 M 5 M 5 M TGFRi (SB432541) 2 M 2 M 2 M 2 M FGFRi (PD173471) 0.1 M 0.1 M 0.1 M Table 5: Provided are the agents (factors, inhibitors) included in the WIS-NHSM medium. LIF - leukemia inhibitory factor; FGF2 = fibroblast growth factor 2 (also termed basic FGF; TGF1 = transforming growth factor bet 1; SCF = stem cell factor; BMPi = bone morphogenetic protein inhibitor; IGFII = insulin-like growth factor 2 (somatomedin A). NOTCHi = NOTCH inhibitor; SHHi = Sonic Hedgehog pathway (SHH) inhibitor; TGFRi = transforming growth factor receptor inhibitor; FGFRi = fibroblast growth factor receptor inhibitor.
(837) As shown in
(838) It is noted that in conditions 12 and 15 (Table 5 above), when NOTCHi is used, TGFRi can then be used (and recombinant TGFB1 can be omitted) to maintain naive pluripotency with reduced DNA methylation levels.
(839) In addition, in condition 16, when NOTCHi is used, FGFRi can then be used (and recombinant FGF2 can be omitted) to maintain naive pluripotency with reduced DNA methylation levels. Recombinant IGFII and SCF are used in these conditions to boost human naive cells proliferation in the absence of FGF2 signaling.
(840) In addition, in conditions 14 and 17, when NOTCHi is used, FGFRi and TGRFi can then be used (and recombinant FGF2 and TGFB1 can be omitted) to maintain naive pluripotency with reduced DNA methylation levels. Recombinant IGFII and SCF are used in these conditions to boost human naive cells proliferation in the absence of FGF2 signaling.
(841) It should be noted that WIS-NHSM condition 15 medium (Table 5 above) is excellent for culturing human pluripotent stem cells in the naive state as is evidenced by the domed colony morphology and lack of defined borders between individual cells in each colony (data not shown).
(842) It should be noted that the above WIS-NHSM conditions can be used to maintain the naive state of non-human primates pluripotent stem cells.
(843) In summary, the following modifications of the medium for establishing a naive pluripotent state can be used: P38i: Inhibitors for P38 include upstream blockers for pathways that activate p38 signaling: including BMP signaling inhibitors/STAT3 activation: Activators for STAT3 signaling can be used to replace LIF including IL-6.
(844) TGFB1Activators of TGF/ACTIVIN pathway including ACTIVIN A (also known as Inhibin beta A, Gene ID: 3624 can be sued to replace TGFB1).
(845) BMPi: protein inhibitors of BMP pathway like recombinant NOGGIN protein, can be used to replace small molecule inhibitors of BMP signaling.
(846) A non-limiting example of a culture medium which can be used to maintain (and induce to naive state) pluripotent stem cells in a naive state include: A culture medium comprising leukemia inhibitor factor (LIF), an ERK1/2 inhibitor, a GSK3b inhibitor, a p38 inhibitor, a JNK inhibitor, basic fibroblast growth factor (bFGF) and transforming growth factor-beta 1 (TGF1), and one or more of the following components: a) IGFII (range 0.1-100 ng/ml final concentration); b) IGF1 [insulin-like growth factor 1 (somatomedin C)](range 0.1-100 ng/ml final concentration); c) SCF (range 0.1-100 ng/ml final concentration); d) BMP signaling inhibitor [examples include, but are not limited to: LDN193189 (AXON 1509-0.01-20 micro M final concentration), K02288 (Axon 2189; 0.1-20 micro M final concentration), Dorsomorphin hydrochloride (AXON 2150 0.1-20 micro M final concentration); e) NOTCH signaling inhibitors [examples include, but are not limited to the following gamma secretase inhibitors: DAPT (Axon Medchem 1484-0.05-50 micro M final concentration), LY2886721 hydrochloride (Axon Medchem 1964-0.05-50 micro M final concentration)], DBZ (Axon MedchemAxon 1488-0.05-50 micro M final concentration). f) Sonic Hedgehog pathway (SHH) inhibitors [examples include, but are not limited to the following: GANT61 (SigmaAldrich0.05-50 micro M final concentration), RU-SKI 43 (Axon MedchemAxon 2035-0.05-50 micro M final concentration)]. g) ERK5 inhibitors (BIX02189 Axon 1809; range 0.1-100 micro M final concentration) h) ROCK inhibitor [Y27632 (AXON 1683)0.05-100 micro M final]. i) FGF signaling inhibitor: Non-limiting examples of FGFR inhibitors include PD173074 and SU5401. j) TGF pathway inhibitor: Non-limiting examples of TGFR inhibitors include SB431542 and A 83-01 small molecule compound (As used herein the term TGFR inhibitor (or TGFRi) refers to a molecule capable of inhibiting TGFR expression and/or activity level as determined by phosphorylated ALK4, 5 and 7).
Example 15
(847) Activation of Eras for Inducing and Maintenece of Naive Pluripotent State
(848) Human ES Ras (ERAS) gene (Gene ID: 3266) has an upstream premature polyadenylation signal that results in a truncated, noncoding transcript (Kameda T, and Thomson JA, Stem Cells 2005, 23:1535-40).
(849) The present inventors have further envisaged that overexpression of ERas or activation of endogenous human ERas in pluripotent stem cells can be used to induce a naive state in pluripotent stem cells. Thus, genetically modified pluripotent stem cells in which ERas is either over expressed or endogenously activated exhibit a naive state of the pluripotent stem cells.
(850) Overexpression of ERas in pluripotent stem cellshuman pluripotent stem cells are transformed with a nucleic acid construct designed for constitutive or transient expression of ERas (SEQ ID NO: 109).
(851) Activation of endogenous ERAS expression in human pluripotent stem cellsIn human cells, the ERAS gene is not expressed due to the presence of viral sequences that integrated into the human genome and block ERAS expression. Activation of endogenous human ERAS expression is achieved by removing the combinations of polyadenylation sites (Marked as pre-mature polyadenylation sites in SEQ ID NO: 108 in the sequence listing; also defined as poly-A signal in A-1, A2 or A-3 boxed sequences in
(852) Human ERAS gene expression/reactivation may be used in combination with any of the media described herein for naive pluripotent stem cells to boost human naive pluripotent cells proliferation.
(853) Although the invention has been described in conjunction with specific embodiments thereof, it is evident that many alternatives, modifications and variations will be apparent to those skilled in the art. Accordingly, it is intended to embrace all such alternatives, modifications and variations that fall within the spirit and broad scope of the appended claims.
(854) All publications, patents and patent applications mentioned in this specification are herein incorporated in their entirety by reference into the specification, to the same extent as if each individual publication, patent or patent application was specifically and individually indicated to be incorporated herein by reference. In addition, citation or identification of any reference in this application shall not be construed as an admission that such reference is available as prior art to the present invention. To the extent that section headings are used, they should not be construed as necessarily limiting. In addition, any priority document(s) of this application is/are hereby incorporated herein by reference in its/their entirety.
REFERENCES
(855) (Additional References are Cited in Text)
(856) Ang, Y.-S., Tsai, S.-Y., Lee, D.-F., Monk, J., Su, J., Ratnakumar, K., Ding, J., Ge, Y., Darr, H., Chang, B., et al. (2011). Wdr5 mediates self-renewal and reprogramming via the embryonic stem cell core transcriptional network. Cell 145, 183-197. De Los Angeles, A., Loh, Y.-H., Tesar, P. J., and Daley, G.Q. (2012). Accessing naive human pluripotency. Curr. Opin. Genet. Dev. 22, 272-282. Durcova-Hills, G., Tang, F., Doody, G., Tooze, R., and Surani, M.A. (2008). Reprogramming primordial germ cells into pluripotent stem cells. PLoS ONE 3, e3531. Fidalgo, M., Faiola, F., Pereira, C.-F., Ding, J., Saunders, A., Gingold, J., Schaniel, C., Lemischka, I.R., Silva, J. C. R., and Wang, J. (2012). Zfp281 mediates Nanog autorepression through recruitment of the NuRD complex and inhibits somatic cell reprogramming. Proc. Natl. Acad. Sci. U.S.a. 109, 16202-16207. Hanna, J.H. (2010). The STATs on naive iPSC reprogramming. Cell Stem Cell 7, 274-276. Hanna, J.H., Saha, K., and Jaenisch, R. (2010a). Pluripotency and cellular reprogramming: facts, hypotheses, unresolved issues. Cell 143, 508-525. Hanna, J., Cheng, A.W., Saha, K., Kim, J., Lengner, C.J., Soldner, F., Cassady, J.P., Muffat, J., Carey, B. W., and Jaenisch, R. (2010b). Human embryonic stem cells with biological and epigenetic characteristics similar to those of mouse ESCs. Proc. Natl. Acad. Sci. U.S.a. 107, 9222-9227. Hanna, J., Markoulaki, S., Mitalipova, M., Cheng, A.W., Cassady, J.P., Staerk, J., Carey, B.W., Lengner, C.J., Foreman, R., Love, J., et al. (2009a). Metastable pluripotent states in NOD-mouse-derived ESCs. Cell Stem Cell 4, 513-524. Hanna, J., Saha, K., Pando, B., van Zon, J., Lengner, C.J., Creyghton, M.P., van Oudenaarden, A., and Jaenisch, R. (2009b). Direct cell reprogramming is a stochastic process amenable to acceleration. Nature 462, 595-601. Hockemeyer, D., Wang, H., Kiani, S., Lai, C.S., Gao, Q., Cassady, J.P., Cost, G.J., Zhang, L., Santiago, Y., Miller, J. C., et al. (2011). Genetic engineering of human pluripotent cells using TALE nucleases. Nat Biotechnol 29, 731-734. Kaji, K., Caballero, I.M., MacLeod, R., Nichols, J., Wilson, V. A., and Hendrich, B. (2006). The NuRD component Mbd3 is required for pluripotency of embryonic stem cells. Nat Cell Biol 8, 285-292. Kaji, K., Nichols, J., and Hendrich, B. (2007). Mbd3, a component of the NuRD co-repressor complex, is required for development of pluripotent cells. Development 134, 1123-1132. Lengner, C.J., Gimelbrant, A.A., Erwin, J.A., Cheng, A.W., Guenther, M.G., Welstead, G.G., Alagappan, R., Frampton, G.M., Xu, P., Muffat, J., et al. (2010). Derivation of pre-X inactivation human embryonic stem cells under physiological oxygen concentrations. Cell 141, 872-883. Li, W., Wei, W., Zhu, S., Zhu, J., Shi, Y., Lin, T., Hao, E., Hayek, A., Deng, H., and Ding, S. (2009). Generation of rat and human induced pluripotent stem cells by combining genetic reprogramming and chemical inhibitors. Cell Stem Cell 4, 16-19. Mansour, A.A., Gafni, O., Weinberger, L., Zviran, A., Ayyash, M., Rais, Y., Krupalnik, V., Zerbib, M., Amann-Zalcenstein, D., Maza, I., et al. (2012). The H3K27 demethylase Utx regulates somatic and germ cell epigenetic reprogramming. Nature 488, 409-413. Marks, H., Kalkan, T., Menafra, R., Denissov, S., Jones, K., Hofemeister, H., Nichols, J., Kranz, A., Francis Stewart, A., Smith, A., et al. (2012). The transcriptional and epigenomic foundations of ground state pluripotency. Cell 149, 590-604. Mikkelsen, T.S., Hanna, J., Zhang, X., Ku, M., Wernig, M., Schorderet, P., Bernstein, B.E., Jaenisch, R., Lander, E. S., and Meissner, A. (2008). Dissecting direct reprogramming through integrative genomic analysis. Nature 454, 49-55. Nichols, J., and Smith, A. (2012). Pluripotency in the embryo and in culture. Cold Spring Harb Perspect Biol 4, a008128. Okamoto, I., Patrat, C., Th6pot, D., Peynot, N., Fauque, P., Daniel, N., Diabangouaya, P., Wolf, J.-P., Renard, J.-P., Duranthon, V., et al. (2011). Eutherian mammals use diverse strategies to initiate X-chromosome inactivation during development. Nature 1-7. Onder, T.T., Kara, N., Cherry, A., Sinha, A.U., Zhu, N., Bernt, K.M., Cahan, P., Marcarci, B.O., Unternaehrer, J., Gupta, P. B., et al. (2012). Chromatin-modifying enzymes as modulators of reprogramming. Nature 483, 598-602. Orkin, S. H., and Hochedlinger, K. (2011). Chromatin Connections to Pluripotency and Cellular Reprogramming. Cell 145, 835-850. Polo, J.M., Anderssen, E., Walsh, R.M., Schwarz, B.A., Nefzger, C.M., Lim, S.M., Borkent, M., Apostolou, E., Alaei, S., Cloutier, J., et al. (2012). A Molecular Roadmap of Reprogramming Somatic Cells into iPS Cells. Cell 151, 1617-1632. Pribluda, A., and Hanna, J.H. (2012). Tracing the genesis of human embryonic stem cells. Nat Biotechnol 30, 247-249. Roode, M., Blair, K., Snell, P., Elder, K., Marchant, S., Smith, A., and Nichols, J. (2012). Human hypoblast formation is not dependent on FGF signalling. Dev. Biol. 361, 358-363. Silva, J., Nichols, J., Theunissen, T.W., Guo, G., van Oosten, A.L., Barrandon, O., Wray, J., Yamanaka, S., Chambers, I., and Smith, A. (2009). Nanog is the gateway to the pluripotent ground state. Cell 138, 722-737. Smith, Z.D., Nachman, I., Regev, A., and Meissner, A. (2010). Dynamic single-cell imaging of direct reprogramming reveals an early specifying event. Nat Biotechnol 28, 521-526. Soufi, A., Donahue, G., and Zaret, K.S. (2012). Facilitators and Impediments of the Pluripotency Reprogramming Factors' Initial Engagement with the Genome. Cell 1-11. Sridharan, R., Tchieu, J., Mason, M. J., and Yachechko, R. (2009). ScienceDirect.com CellRole of the Murine Reprogramming Factors in the Induction of Pluripotency. Cell. Takahashi, K., and Yamanaka, S. (2006). Induction of pluripotent stem cells from mouse embryonic and adult fibroblast cultures by defined factors. Cell 126, 663-676. Tesar, P.J., Chenoweth, J.G., Brook, F.A., Davies, T.J., Evans, E.P., Mack, D.L., Gardner, R. L., and McKay, R.D.G. (2007). New cell lines from mouse epiblast share defining features with human embryonic stem cells. Nature 448, 196-199. Tiwari, V.K., Stadler, M.B., Wirbelauer, C., Paro, R., Schubeler, D., and Beisel, C. (2011). A chromatin-modifying function of JNK during stem cell differentiation. Nat Genet. Tomoda, K., Takahashi, K., Leung, K., Okada, A., Narita, M., Yamada, N.A., Eilertson, K.E., Tsang, P., Baba, S., White, M. P., et al. (2012). Derivation conditions impact x-inactivation status in female human induced pluripotent stem cells. Cell Stem Cell 11, 91-99. Warren, L., Ebina, W., Mandal, P.K., Smith, Z.D., Meissner, A., and Daley, G.Q. (2010). ScienceDirect.comCell Stem CellHighly Efficient Reprogramming to Pluripotency and Directed Differentiation of Human Cells with Synthetic Modified mRNA. Cell Stem Cell. Wernig, M., Lengner, C.J., Hanna, J., Lodato, M.A., Steine, E., Foreman, R., Staerk, J., Markoulaki, S., and Jaenisch, R. (2008). A drug-inducible transgenic system for direct reprogramming of multiple somatic cell types. Nat Biotechnol 26, 916-924. Ying, Q.-L., Wray, J., Nichols, J., Batlle-Morera, L., Doble, B., Woodgett, J., Cohen, P., and Smith, A. (2008). The ground state of embryonic stem cell self-renewal. Nature 453, 519-523. Zhu, D., Fang, J., Li, Y., and Zhang, J. (2009). Mbd3, a Component of NuRD/Mi-2 Complex, Helps Maintain Pluripotency of Mouse Embryonic Stem Cells by Repressing Trophectoderm Differentiation. PLoS ONE 4, e7684.