Model for simulating ALS constructed based on CASP4 and its construction method

Abstract

An amyotrophic lateral sclerosis (ALS)-simulating model and a method for constructing the ALS-simulating model based on a caspase-4 (CASP4) gene are provideds. The method includes: (1) constructing a targeting fragment for knock-in of the CASP4 gene; (2) injecting gRNA, Cas9 mRNA, and the targeting fragment into a mouse zygote, culturing, and passaging to produce a hCASP4flox mouse with the CASP4 gene stably inherited; and (3) crossing the hCASP4flox mouse with a Cre driver mouse to produce a double-positive heterozygous mouse, which is a mouse model in which the CASP4 gene is specifically expressed in a nervous system. An ALS-simulating animal model is constructed based on a humanized CASP4 gene. The method can effectively avoid the mouse death caused by this apoptotic factor, and leads to an ALS-simulating mouse model in which TDP-43 fragments accumulate in the cytoplasm and TDP-43 is deleted in the nucleus.

Claims

1-10. (canceled)

11. A method for constructing an amyotrophic lateral sclerosis (ALS)-simulating model based on a caspase-4 (CASP4) gene, comprising the following steps: (1) constructing a targeting fragment CAG-loxP-stop-loxP (LSL)-human CASP4(hCASP4)-posttranscriptional regulatory element of woodchuck hepatitis virus (WPRE)-polyA for a knock-in of the CASP4 gene; (2) injecting a gRNA, a Cas9 mRNA, and the targeting fragment CAG-LSL-hCASP4-WPRE-polyA into a mouse zygote, culturing, and passaging to produce a hCASP4.sup.flox mouse with the CASP4 gene stably inherited; and (3) crossing the hCASP4.sup.flox mouse with a Nestin-Cre driver mouse to produce a double-positive heterozygous mouse, namely, a mouse model, wherein in the mouse model, the CASP4 gene is specifically expressed in a nervous system; wherein amplification primers for identifying the double-positive heterozygous mouse are as follows: TABLE-US-00009 Caspase-4-F-C1: 5-TCTACCTCTTTCCTGGCAATGACTACA-3, asshowninSEQIDNO:2; Caspase-4-R-C1: 5-CTTTATTAGCCAGAAGTCAGATGC-3, asshowninSEQIDNO:3; Caspase-4-F-C2: 5-CACTTGCTCTCCCAAAGTCGCTC-3, asshowninSEQIDNO:4; Caspase-4-R-C2: 5-ATACTCCGAGGCGGATCACAA-3, asshowninSEQIDNO:5; Nestin-F-N1: 5-CCTTCCTGAAGCAGTAGAGCA-3, asshowninSEQIDNO:6; Nestin-R-N: 5-GCCTTATTGTGGAAGGACTG-3, asshowninSEQIDNO:7;and Nestin-F-N2: 5-TTGCTAAAGCGCTACATAGGA-3, asshowninSEQIDNO:8.

12. The method for constructing the ALS-simulating model based on the CASP4 gene according to claim 11, wherein a process for constructing the targeting fragment CAG-LSL-hCASP4-WPRE-polyA is as follows: ligating a CAG promoter, a loxP-PGK-Neo-6*SV40pA-loxP expression cassette, hCASP4, a WPRE, and a polyA sequence to produce the targeting fragment CAG-LSL-hCASP4-WPRE-polyA.

13. The method for constructing the ALS-simulating model based on the CASP4 gene according to claim 11, wherein the is sequence of the gRNA CTCCAGTCTTTCTAGAAGAT-GGG, as shown in SEQ ID NO:1.

14. The method for constructing the ALS-simulating model based on the CASP4 gene according to claim 11, wherein the CASP4 gene has a sequence identifier of ENST00000444739.7.

15. The method for constructing the ALS-simulating model based on the CASP4 gene according to claim 11, wherein a process for acquiring the hCASP4flox mouse with the CASP4gene stably inherited is as follows: transplanting a viable zygote undergoing an injection into a pseudopregnant female mouse, and culturing to produce F0 mice; identifying through sequencing to produce F0 positive hCASP4.sup.flox mice; and crossing the F0 positive hCASP4.sup.flox mice to produce a F1 hCASP4.sup.flox mouse model with the CASP4 gene stably inherited.

16. The method for constructing the ALS-simulating model based on the CASP4 gene according to claim 15, wherein amplification primers for acquiring the F0 positive hCASP4.sup.flox mice are as follows: TABLE-US-00010 Caspase-4-F-B1: 5-TACGCCACAGGGAGTCCAAGAATG-3, asshowninSEQIDNO:11; Caspase-4-R-B1: 5-AGATGTACTGCCAAGTAGGAAAGTC-3, asshowninSEQIDNO:12; Caspase-4-F-B2: 5-GCATCTGACTTCTGGCTAATAAAG-3, asshowninSEQIDNO:13;and Caspase-4-R-B2: 5-CTGGAAATCAGGCTGCAAATCTC-3, asshowninSEQIDNO:14;and a polymerase chain reaction (PCR) program is as follows: a pre-denaturation at 94 C. for 3min, a denaturation at 94 C. for 30 s, annealing at 60 C. for 30 s, and a first extension at 65 C. for 50 s per kb, with 33 cycles; and a second extension at 65 C. for 10 min.

17. A use of a mouse model constructed by the method according to claim 11 in constructing an ALS model simulating an intranuclear deletion of a transactive response DNA-binding protein 43 (TDP-43).

18. The use according to claim 17, wherein in the method, a process for constructing the targeting fragment CAG-LSL-hCASP4-WPRE-polyA is as follows: ligating a CAG promoter, a loxP-PGK-Neo-6*SV40pA-loxP expression cassette, hCASP4, a WPRE, and a polyA sequence to produce the targeting fragment CAG-LSL-hCASP4-WPRE-polyA.

19. The use according to claim 17, wherein in the method, the sequence of the gRNA is CTCCAGTCTTTCTAGAAGAT-GGG, as shown in SEQ ID NO: 1.

20. The use according to claim 17, wherein in the method, the CASP4 gene has a sequence identifier of ENST00000444739.7.

21. The use according to claim 17, wherein in the method, a process for acquiring the hCASP4.sup.flox mouse with the CASP4 gene stably inherited is as follows: transplanting a viable zygote undergoing the injecting into a pseudopregnant female mouse, and culturing to produce F0 mice; identifying through sequencing to produce F0 positive hCASP4.sup.flox mice; and crossing the F0 positive hCASP4.sup.flox mice to produce a F1 hCASP4.sup.flox mouse model with the CASP4 gene stably inherited.

22. The use according to claim 21, wherein in the method, amplification primers for acquiring the F0 positive hCASP4.sup.flox mice are as follows: TABLE-US-00011 Caspase-4-F-B1: 5-TACGCCACAGGGAGTCCAAGAATG-3, asshowninSEQIDNO:11; Caspase-4-R-B1: 5-AGATGTACTGCCAAGTAGGAAAGTC-3, asshowninSEQIDNO:12; Caspase-4-F-B2: 5-GCATCTGACTTCTGGCTAATAAAG-3, asshowninSEQIDNO:13;and Caspase-4-R-B2: 5-CTGGAAATCAGGCTGCAAATCTC-3, asshowninSEQIDNO:14; and a PCR program is as follows: a pre-denaturation at 94 C. for 3 min, a denaturation at 94 C. for 30 s, annealing at 60 C. for 30 s, and a first extension at 65 C. for 50 s per kb, with 33 cycles; and a second extension at 65 C. for 10 min.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

[0032] FIG. 1 is a map of a constructed targeting fragment CAG-LSL-hCASP4-WPRE-polyA;

[0033] FIG. 2 shows the electrophoresis results for testing of knock-in of a target gene in F1 positive mice;

[0034] FIG. 3 shows the gel electrophoresis results of PCR products of genomic DNAs from double-positive heterozygous mice;

[0035] FIG. 4 shows the immunofluorescence staining results of the ALS-simulating mouse model constructed in the present disclosure;

[0036] FIG. 5 shows the immunohistochemical staining results of the ALS-simulating mouse model constructed in the present disclosure;

[0037] FIG. 6 shows the motor behavioral testing results of the ALS-simulating mouse model constructed in the present disclosure;

[0038] FIG. 7 shows the hindlimb muscle morphology testing results of the ALS-simulating mouse model constructed in the present disclosure;

[0039] FIGS. 8A-8B show the gene expression profile analysis results of the ALS-simulating mouse model constructed in the present disclosure; and

[0040] FIG. 9 shows the immunofluorescence staining results of markers in the ALS-simulating mouse model constructed in the present disclosure.

DETAILED DESCRIPTION OF THE EMBODIMENTS

[0041] The specific embodiments of the present disclosure will be described below to make those skilled in the art easily understand the present disclosure, but it should be noted that the present disclosure is not limited to the scope of the specific embodiment. For those of ordinary skill in the art, as long as various changes fall within the spirit and scope of the present disclosure defined and determined by the appended claims, these changes are apparent, and all inventions and creations using the concept of the present disclosure are protected.

Example 1 Construction of a Targeting Fragment CAG-LSL-hCASP4-WPRE-polyA

1. Information of a Knock-In Gene

[0042] The knock-in gene was a humanized CASP4 gene CASP4-201 with a sequence identifier of ENST00000444739.7.

2. Construction of a CAG-LSL-hCASP4-WPRE-polyA Fragment

[0043] (1) Construction of a loxP-PGK-Neo-6*SV40pA-loxP expression cassette (LSL)

[0044] The expression cassette included two loxP sites between which there was a PGK promoter-driven neomycin resistance gene (Neo) and six SV40 polyadenylation signal sequences (SV40pA). [0045] (2) A plasmid that included a CAG strong promoter and could stably replicate in cells was selected, and then the loxP-PGK-Neo-6*SV40pA-loxP expression cassette, hCASP4, WPRE, and a polyA sequence were inserted into the plasmid. [0046] (3) A protein tag 3XFLAG sequence was ligated to the humanized gene CASP4. The FLAG tag was a polypeptide composed of 8 amino acids: N-DYKDDDDK-C (1,012 Da) (SEQ ID NO: 10), and a gene sequence encoding the FLAG tag was as follows: GATTACAAGGACGACGATGACAAG (SEQ ID NO: 9). A vector finally constructed was shown in FIG. 1.

Example 2 Construction of an Animal Model (hCASP4 Mice)

1. Breeding of F1 Positive Individuals

[0047] gRNA, Cas9 mRNA, and CAG-LSL-hCASP4-WPRE-polyA were injected into C57BL/6JGp mouse zygotes. Viable zygotes undergoing the injection were collected and transplanted into pseudopregnant female mice. The humanized CASP4 gene was knocked into the Rosa26 locus on chromosome 6 of the mice. Mice undergoing transplantation were cultured to produce F0 positive hCASP4.sup.flox mice. The FO mice were further crossed to produce F1positive individuals hCasp4.sup.flox with the CASP4 gene stably inherited. Primers for screening and identification were as follows:

TABLE-US-00003 Caspase-4-F-B1: (SEQIDNO:11) 5-TACGCCACAGGGAGTCCAAGAATG-3; Caspase-4-R-B1: (SEQIDNO:12) 5-AGATGTACTGCCAAGTAGGAAAGTC-3; Caspase-4-F-B2: (SEQIDNO:13) 5-GCATCTGACTTCTGGCTAATAAAG-3; and Caspase-4-R-B2: (SEQIDNO:14) 5-CTGGAAATCAGGCTGCAAATCTC-3.

[0048] A PCR program was as follows: pre-denaturation at 94 C. for 3 min, denaturation at 94 C. for 30 s, annealing at 60 C. for 30 s, and extension at 65 C. for 50 s per kb, with 33 cycles; and extension at 65 C. for 10 min. A PCR product was stored at 4 C. A PCR system was shown in Table 1.

TABLE-US-00004 TABLE 1 PCR system for identifying F1 positive mouse individuals hCasp4.sup.flox Component Amount (L) Mouse tail genomic DNA 2 Forward primer (10 M) 2 Reverse primer (10 M) 2 dNTPs (2.5 mM) 6 5 LongAmp Taq Reaction 10 LongAmp Taq DNA Polymerase 2 ddH.sub.2O 26 Total 50

[0049] A tail DNA sample was subjected to Southern blot analysis with 5 and 3 probes to verify the correct gene targeting in the F1 positive mice. Results were shown in FIG. 2.

[0050] As shown in FIG. 2, the target gene had been correctly inserted in four mice (1, 2, 3, and 4). The next model construction was then conducted.

2. Breeding of Double-Positive Heterozygous Mice

[0051] The loxP-PGK-Neo-6*SV40pA-loxP expression cassette was integrated into the F1 positive hCASP4.sup.flox mice. Mice with the expression cassette integrated were then crossed with Nestin-Cre driver mice. Screening was conducted to obtain double-positive heterozygous mice, which was a Nestin-Cre.sup.+ and hCaspase-4.sup.flox/+ mouse model in which the humanized CASP4 gene underwent targeted expression in the mouse nervous system. Specific amplification primers for screening and identification were as follows:

[0052] Primers for identifying the genomic DNA of Caspase-4.sup.flox/+ mice were as follows:

TABLE-US-00005 Caspase-4-F-C1: (SEQIDNO:2) 5-TCTACCTCTTTCCTGGCAATGACTACA-3; Caspase-4-R-C1: (SEQIDNO:3) 5-CTTTATTAGCCAGAAGTCAGATGC-3; Caspase-4-F-C2: (SEQIDNO:4) 5-CACTTGCTCTCCCAAAGTCGCTC-3; and Caspase-4-R-C2: (SEQIDNO:5) 5-ATACTCCGAGGCGGATCACAA-3.

[0053] A PCR program was as follows: pre-denaturation at 94 C. for 3 min, denaturation at 94 C. for 30 s, annealing at 60 C. for 35 s, and extension at 72 C. for 35 s, with 35 cycles; and extension at 72 C. for 5 min. A PCR product was stored at 4 C. A PCR system was shown in Table 2.

TABLE-US-00006 TABLE 2 PCR system for identifying Caspase-4.sup.flox/+ mice Component Amount (L) 10 PCR buffer 2.5 2.5 mM dNTPs 2 TaKaRa rTaq 0.25 10 M Primer forward (F-C1) 1 10 M Primer reverse (R-C1) 1 10 M Primer forward (F-C2) 1 10 M Primer reverse (R-C2) 1 H.sub.2O 14.75 Template DNA 1.5 Total 25

[0054] Primers for identifying the genomic DNA of Nestin-Cre.sup.+ mice were as follows:

TABLE-US-00007 Nestin-F-N1: (SEQIDNO:6) 5-CCTTCCTGAAGCAGTAGAGCA-3; Nestin-R-N1: (SEQIDNO:7) 5-GCCTTATTGTGGAAGGACTG-3; and Nestin-F-N2: (SEQIDNO:8) 5-TTGCTAAAGCGCTACATAGGA-3.

[0055] A PCR program was as follows: pre-denaturation at 94 C. for 4 min, denaturation at 94 C. for 30 s, annealing at 60 C. for 45 s, and extension at 72 C. for 1 min, with 32 cycles; and extension at 72 C. for 10 min. A PCR product was stored at 4 C. A PCR system was shown in Table 3.

TABLE-US-00008 TABLE 3 PCR system for identifying Nestin-Cre mice Component Amount (L) 10 PCR buffer 2 2.5 mM dNTPs 1.6 TaKaRa rTaq 0.25 10 M Primer forward (F-N1) 1 10 M Primer reverse (R-N) 1 10 M Primer forward (F-N2) 1 H.sub.2O 10.15 Template DNA 3 Total 20

[0056] 3. The double-positive heterozygous mice were identified, and results were shown in FIG. 3. As shown in FIG. 3, a proportion of the humanized gene hCASP4/Cre gene double-positive mice among littermates was 25%, which was consistent with the Mendel's law of inheritance.

Example 3

[0057] In the present disclosure, a protein tag 3XFLAG sequence was ligated to the humanized gene CASP4. The FLAG tag was a polypeptide composed of 8 amino acids: N-DYKDDDDK-C (1,012 Da) (SEQ ID NO: 10), and a gene sequence encoding the FLAG tag was as follows: GATTACAAGGACGACGATGACAAG (SEQ ID NO: 9). Therefore, the animal model constructed in Example 2 and wild-type (WT) mice each were subjected to fluorescence staining, and test results were shown in FIG. 4 and FIG. 5.

[0058] As shown in FIG. 4 and FIG. 5, TDP-43 was expressed in the nucleus in WT mice, while endogenous TDP-43 relocated from the nucleus to the cytoplasm in the animal model constructed in the present disclosure, further indicating that the animal model desired by the present disclosure was successfully established.

Example 4

[0059] 1. The animal model constructed in Example 2 of the present disclosure was subjected to motor behavioral tests, including rotarod, tensile, and balance beam tests, and a muscle morphology test. With WT mice as a control, it was determined whether the animal model could simulate the motor dysfunction in ALS patients. Results were shown in FIG. 6 and FIG. 7.

[0060] As shown in FIG. 6 and FIG. 7, compared with the WT mice, the animal model constructed in the present disclosure successfully simulated the motor dysfunction in ALS patients, and underwent the consistent muscle atrophy symptoms in lower limbs with ALS patients.

[0061] 2. The animal model (hCASP4 mice) constructed in Example 2 of the present disclosure was subjected to gene expression profile analysis and marker detection. Results were shown in FIGS. 8A-8B and FIG. 9.

[0062] As shown in FIGS. 8A-8B, a gene expression difference of the overall transcript in the prefrontal cortex between the WT mice and the hCASP4 mice was subjected to volcano plot analysis, and then compared with the overall transcript gene change in sALS patients for similarity. The publicly-available mRNA-seq data (GSE67196) was used for the comparison between RNA from the prefrontal cortex of sALS patients without mutations in the most common ALS-associated genes and RNA from healthy individuals without nervous system diseases. It was found that there was a specified similarity in gene expression between the mouse model and ALS patients.

[0063] Moreover, differentially expressed genes in prefrontal cortices of healthy individuals and sALS patients were subjected to gene ontology (GO) analysis. It was found that the differentially expressed genes in the prefrontal cortices of the healthy individuals and sALS patients were clustered in the biological process (BP) pathway of cytoplasmic translation, the cellular component (CC) pathways of ribosome, ribosomal subunit, and cytoplasmic ribosome, and the molecular function (MF) pathway of structural constituent of ribosome. These differentially expressed genes underwent similar clustering in the mouse model.

[0064] As shown in FIG. 9, in the mouse model, the expression levels of VGF, ITGB3, Mapk14, IGFBP5, and TNFRSF19 proteins as markers for detecting ALS changed in the same trend as reported in ALS patients.

[0065] In summary, an ALS-simulating mouse model in which TDP-43 fragments accumulate in the cytoplasm and TDP-43 is deleted in the nucleus is successfully established based on the CASP4 gene in the present disclosure. The ALS-simulating mouse model is expected to become a prominent experimental animal model for investigating molecular mechanisms and therapeutic strategies for TDP-43-associated diseases.

[0066] It should be noted that the above embodiments are only intended to explain, rather than to limit the technical solutions of the present disclosure. Although the present disclosure is described in detail with reference to the embodiments, those of ordinary skill in the art should understand that modifications or equivalent substitutions may be made to the technical solutions of the present disclosure without departing from the spirit and scope of the technical solutions of the present disclosure, and such modifications or equivalent substitutions should be included within the scope of the claims of the present disclosure. What is claimed is: