Application based nucleotides of <i>Lactobacillus rhamnosus </i>to prepare a composition for anti-lipogenesis

12576101 ยท 2026-03-17

Assignee

Inventors

Cpc classification

International classification

Abstract

An application based on nucleotide fragments of Lactobacillus rhamnosus GM-020, to prepare a composition for anti-lipogenesis. The Lactobacillus rhamnosus GM-020 was deposited on Dec. 18, 2003 and has the CCTCC designation number CCTCC M203098. Also provided is a composition containing Lactobacillus rhamnosus GM-020 or nucleotide fragments thereof as effective ingredients for anti-lipogenesis.

Claims

1. A method of preparing a pharmaceutical composition comprising adding SEQ ID No. and/or and SEQ ID No. 5 to a composition comprising a pharmaceutical excipient and/or a pharmaceutical vehicle.

2. A method of inhibiting lipid droplet formation in adipocytes in vitro comprising the administration of a composition comprising SEQ ID No. 1 and/or SEQ ID No. 5.

3. A method of inhibiting the expression of fatty acid synthase (FAS) in adipocytes in vitro comprising the administration of a composition comprising SEQ ID No. 1 and/or SEQ ID No. 5.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) The present invention will become more fully understood from the detailed description given hereinbelow and the accompanying drawings which are given by way of illustration only, and thus are not limitative of the present invention.

(2) FIG. 1A illustrates circular genome data of the whole genome of GM-020.

(3) FIG. 1B illustrates functional analyses of the whole genome of GM-020.

(4) FIG. 1C illustrates sequencing analyses of GM-020.

(5) FIG. 1D illustrates speciational evolution of GM-020.

(6) FIG. 1E illustrates speciational evolution of GM-020.

(7) FIG. 2A illustrates the effect of IM3-1 on inhibiting lipid droplets generated.

(8) FIG. 2B illustrates the effect of IM3-5 on inhibiting lipid droplets generated.

(9) FIG. 3 illustrates no effect of IM3-2, IM3-3 or IM3-4 on inhibiting lipid droplets generated.

(10) FIG. 4 illustrates the effect of IM3-1 or IM3-5 on inhibiting gene expression of FAS.

DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS

(11) The technical and scientific terminologies in the patent specification are well known to persons with common knowledge in the art unless otherwise specified.

(12) A singular noun joined by a/an, one, or the in the patent specification or claims may refer to more than one object unless otherwise specified.

(13) Words like or or and refer to and/or unless otherwise specified. Moreover, words like comprise or contain are open-ended terms. The descriptions in a previous section refer to general involvement but are not interpreted as restrictions to the subject of the present invention.

(14) The effective ingredients or the composition in the present disclosure, as well as at least a pharmaceutically acceptable vehicle, can be chosen by a person with common and well-known knowledge in the art for preparation of a formulation applicable to the composition. The formulation includes, without limitation, a solution, an emulsion, a suspension liquid, powders, a pastille, an oral ingot, a tablet, a chewing gum, a capsule, and another similar formulation applicable to the present invention.

(15) The terminology of pharmaceutically acceptable means a substance or a composition and other components of a pharmaceutical concoction thereof being compatible with each other but not aggravating a patient's symptoms.

(16) The terminology of pharmaceutically acceptable vehicle comprises one or more types of ingredients selected from: a solvent, an emulsifier, a suspension agent, a decomposing agent, a binding agent, an excipient, a stabilizing agent, a chelating agent, a diluent, a gelling agent, a preservative, a lubricating agent, a surfactant, and another similar vehicle applicable to the present invention.

(17) One or more co-solvents, buffer agents, coloring agents, and flavoring agents common in the pharmaceutical industry can be discretionarily added in the composition as required.

(18) The terminology of pharmaceutical composition means a solid or liquid composition with a form, concentration, and purity applicable to medicine administration for a patient from whom an expected physiological change is induced after administration. The pharmaceutical composition is sterile and/or non-pyrogenic.

(19) The materials used in the patent specification are substances commercially available unless otherwise specified. Lactobacillus rhamnosus (also known as Lacticaseibacillus rhamnosus) GM-020, in an embodiment hereinafter, was deposited on Dec. 18, 2003 and has the designation number of CCTCC M203098 at the China Center for Type Culture Collection (CCTCC).

Embodiment 1, Whole Genome Sequencing of GM-020

(20) Culturing and Sequencing of Probiotics

(21) 0.1 ml lactobacilli in 1 ml lactobacilli cultured overnight was instilled into 10 ml MRS broths for activation of second-generation strains and observation of the growth curve. After OD.sub.600 of 0.8 was detected, 3 ml Lactobacillus broths were flushed twice with filtered sterile water (13,000 rpm; 1 min) and Lactobacilli remained were prepared for genomic DNA extraction. DNAs were extracted with QIAGEN DNeasy Blood & Tissue Kit (QIAGEN; Cat. No. 69504). The quality of genomic DNAs was checked through the Qubit fluorometer, the nanophotometer, and agarose gels. The whole-genome DNA sequencing was done by Health GeneTech Corp. DNAs to be tested were sequenced with Illumina Hiseq 2000 (for next generation sequencing) and Nanopore GridION (for third generation sequencing), respectively.

(22) Pretreatment of Sequence Assembly:

(23) Low-quality noises inside sequencing data were filtered with FASTX-Toolkit and MinIONQC (Quality Value=20, that is, error rate per base= 1/100) before sequence assembly, respectively.

(24) Sequence Assembly and Correction of Sequencing Data:

(25) The nucleotide sequences of the filtered high-quality second-generation sequencing short fragments and the third-generation sequencing data were assembled to be the longer continuous sequences with a published tool, MaSuRCA v3.3.1, based on the hybrid assembly method. The bridging sequences constructed were aligned based on the sequences of third-generation sequencing data for verification of the precedence relationship between contigs. Moreover, the variation test and the genome assembly improvement were completed by Pilon. With the Nanopore long-read sequence taken as a reference sequence, each discrepancy or gap of a single base in one reading was checked and corrected after short-read sequence alignment for reducing false positive.

(26) Speciational Evolution Analysis, Sequencing Genome Annotation and Functional Pathway Analysis:

(27) The sequence of a subtype strain collected after the sequence assembly and the sequence to be tested were checked during the multiple sequence alignment as a critical reference for completing the molecular evolution analysis, the evolutionary analysis, and traceability and facilitating rapid and accurate strain identification on the next-generation sequencing platform. The genome annotation was completed with several tools: Prokka for gene prediction of the whole genome of a procaryotic organism including protein coding and non-coding regions; Plasflow for plasmid identification; PHASTER for filtration of a phagore region inside a genome; Bagel4 & CARD for predictions of both genes correlated with generation of bacteriocin and probable drug resistance regions; eggNOG as one tool facilitating functional classifications on a region of functional proteins probably translated from a protein coding region and combined with the Cluster of Orthologous Genes (COG) of the protein database for annotations and classifications.

(28) According to data analyses of the whole genome, genetic information and the phylogenetic tree, GM-020 is recognized as Lactobacillus rhamnosus and characteristic of the genome size of 3,037,161 bp. The whole genome, the functional analyses and the speciational evolution correlated with GM-020 are shown in FIG. 1A, FIG. 1B, FIG. 1C, FIG. 1D and FIG. 1E.

(29) The frequency of IM1 (TTAGGG) (SEQ ID NO. 10), IM2 (TTTCGTTT) (SEQ ID NO. 11), and IM3 (TCAAGCTTGA) (SEQ ID NO. 12) sequences appearing in the whole genome were further analyzed in GM-020 and three other Lactobacillus rhamnosus strains, 4B15, DSM14870 and BPL5, as disclosed in published literature.

(30) As summarized in Table 1, the frequency of IM1, IM2 and IM3 sequences in the whole genome was higher in GM-020 than in the other three Lactobacillus rhamnosus strains such as 4B15, DSM14870 and BPL5. It suggested that IM1, IM2, and IM3 sequences probably contribute to the specific functions of GM-020.

(31) TABLE-US-00001 TABLE 1 the frequency of IM1, IM2 and IM3 sequences in the different strain of Lactobacillus rhamnosus GM-020 4B15 DSM 148709 BPL5 Code Sequence Genome size (bp) 3,037,161 3,047,840 3,013,150 3,024,030 IM1 TTAGGG Frequency 363 229 233 230 No. copies per 10.sup.6 bases 11.96 7.51 7.73 7.60 IM2 TTTCGTTT Frequency 98 60 66 65 No. copies per 10.sup.6 bases 3.23 1.97 2.19 2.14 IM3 TCAAGCTTGA Frequency 5 3 3 3 No. copies per 10.sup.6 bases 0.16 0.10 0.10 0.10

(32) Furthermore, the function of ODN with IM3 core sequence was tested with adipocytes. The five ODN sequences were characteristic of IM3 core sequence (TCAAGCTTGA) (SEQ ID NO. 12), and distinct sequences forward of 5 TCAAGCTTGA and backward of TCAAGCTTGA 3, named for IM3-1, IM3-2, IM3-3, IM3-4 and IM3-5, in Table 2.

(33) TABLE-US-00002 TABLE2 ThefiveODNsequencesofGM-020containing IM3coresequence Code Core ODNsequencesof name sequence SequenceID GM-020 IM3 TCAAGCTTGA IM3-1 SEQIDNO.1 CCATTTTCAAGCTTGACTTT IM3-2 SEQIDNO.2 GACATTTCAAGCTTGAACAA IM3-3 SEQIDNO.3 TTGGTGTCAAGCTTGACATC IM3-4 SEQIDNO.4 TCAGGCTCAAGCTTGAGTTC IM3-5 SEQIDNO.5 TAGGACTCAAGCTTGATCTC

Embodiment 2, Syntheses of CpG-ODN and Pretreatment

(34) Five ODN fragments, IM3-1, IM3-2, IM3-3, IM3-4 and IM3-5, chemically synthesized by Genomics BioSci & Tech Co., Ltd., were based on the location of TCAAGCTTGA (SEQ ID NO. 12), five nucleotide bases forward of 5 TCAAGCTTGA, and four nucleotide bases backward of TCAAGCTTGA3 in the GM-020 genome. After being rapidly centrifuged, the powdered form of synthesized DNA was diluted to 200 M with sodium chloride. After 10 minutes, the solutions were continuously diluted and prepared to be stock solutions with concentrations of 100, 50, 25 and 12.5 M, respectively.

Embodiment 3, Cultivation of Adipocytes

(35) Preadipocyte 3T3-L1 was seeded in DMEM medium with 10% FBS for two days and occupied to be 70% confluent. Then, cell culture medium was replaced by induction medium (10% FBS DMEM+1 M Dexamethasone, 0.5 mM 3-isobutyl-1-methyl-xathine (IBMX) and 10 g/mL insulin) and further by growth medium (10% FBS DMEM+10 g/mL insulin) two days later. The cells were stimulated with IM3-1, -2, -3, -4 and -5. The growth medium (10% FBS DMEM+10 g/mL insulin) containing IM3-1, -2, -3, -4 and -5 were replaced every three days until the end of experiment.

Embodiment 4, Lipogenesis Test

(36) The adipocytes 3T3-L1 differentiated were flushed twice with PBS. The adipocytes were immobilized with 4% paraformaldehyde (PFA) at room temperate for 0.5 to 1 hour and flushed twice with pure water. Then, 60% isopropanol was added to the adipocytes for five minutes and then absorbed. The adipocytes were stained with Oil Red O for 10 to 20 minutes and were flushed twice with pure water until no stain color observed. The adipocytes were dipped with 60% isopropanol for five minutes. Lipid droplets inside adipocytes were dissolved out by 250 L of 100% isopropanol. Finally, 200 L of lipid droplets were carried on a 96-well plate for measurement of the optical density (OD) at the wave length 492 nm.

(37) The differentiated adipocytes 3T3-L1 were stimulated with chemically synthesized IM3-1, -2, -3, -4, and -5, respectively. The intracellular lipid droplets were stained with Oil red O dyes and quantified based on the OD value. As shown in FIG. 2A and FIG. 2B, generation of lipid droplets in adipocytes were inhibited effectively when cells were stimulated with IM3-1 and IM3-5. In FIG. 3, IM3-2, IM3-3 and IM3-4 showed no effect on the inhibition of lipogenesis.

Embodiment 5, Expression of the FAS Gene (Lipogenesis-Related Gene)

(38) RNA from adipocytes 3T3-L1 was extracted by TRIZol and to be a template transcribed to cDNA by Q-PCR mechine. Each reaction reagent contained 5 L 2 Rotor-Gene SYBR Green PCR Master Mix (QIAGEN) in which 2 L cDNA and 2 L of 10 M Forward (F)+Reverse (R) primers were added in turn. Primer sequences of FAS gene were (1) forward: GGAGGTGGTGATAGCCGGTAT (SEQ ID NO:6); (2) reversed: TGGGTAATCCATAGAGCCCAG (SEQ ID NO:7). Primer sequences of GAPDH gene were (1) forward: TGCACCACCAACTGCTTAGC (SEQ ID NO:8); (2) reversed: GGCATGGACTGTGGTCATGAG (SEQ ID NO:9). The reaction solution was placed inside the Q-PCR machine (model: QIAGEN Rotor-Gene Q 2Plex) for Real-time PCR (Real-time Pmerase Chain Reaction). After the house-keeping gene, GAPDH, and the amount of the relative expression for the control group, (2.sup.Ct), were deducted from CT derived at Q-PCR in turn, the amount of gene expression was determined.

(39) TABLE-US-00003 TABLE3 Thesequencesofforwardandreversed primerforFASandGAPDHgene Sequence Primername IDNo. Nucleotidesequence Forwardprimer SEQID GGAGGTGGTGATAGCCGGTAT ofFASgene NO:6 Reverseprimer SEQID TGGGTAATCCATAGAGCCCAG ofFASgene NO:7 Forwardprimer SEQID TGCACCACCAACTGCTTAGC ofGAPDHgene NO:8 Reverseprimer SEQID GGCATGGACTGTGGTCATGAG ofGAPDHgene NO:9

(40) Lipogenesis-related gene, such as FAS (fatty acid synthase), was over-expressed in the cells which accumulated lipids excessively. Therefore, FAS gene expression was further checked after adipocytes were simulated with IM3-1 or IM3-5. By the analysis of RT-PCR, the activation of FAS gene expressing was inhibited after adipocytes were simulated with IM3-1 or IM3-5 (FIG. 4). It can be seen from the present disclosure that two ODN sequences from GM-020 genome, IM3-1 (CCATTTTCAAGCTTGACTTT) (SEQ ID NO. 1) and IM3-5 (TAGGACTCAAGCTTGATCTC) (SEQ ID NO. 5), significantly inhibited lipid generation through down-regulating the lipogenesis-related gene expression, such as FAS.

(41) The core sequence, TCAAGCTTGA (SEQ ID NO: 12), was unexceptionally contained in the five ODN fragments However, the sequence connecting with 5 and 3 ends of TCAAGCTTGA was distinct among the fragments. The results showed that the five ODN fragments had varying effect on the inhibition of lipogenesis. Only IM3-1 or IM3-5 exhibited a significant effect on lipogenesis inhibition, while IM3-2, IM3-3 or IM3-4 did not demonstrate the significant effect on lipogenesis inhibiting. In the present invention, through experimental measures such as the lipogenesis test and lipogenesis-related FAS gene expression, ODN fragments with health benefits provide a novel and safe prevention and improvement strategy for improving obesity caused by high-fat diet.

(42) As disclosed in preferred embodiments of the patent specification, the embodiments are only examples well known to persons skilled in the art and having common knowledge. Any change or modification of the technical features in the patent specification made by persons skilled in the art and having common knowledge should not be taken as differences from the features in the present disclosure. The present invention could be fulfilled based on embodiments in the patent specification and even other changes in embodiments. As defined in claims of the patent specification, the scope of the present invention should cover the method as well as architecture mentioned above and any equivalent modification.

(43) As presented in many effects hereinbefore, an application based on nucleotides of Lactobacillus rhamnosus to prepare a composition for anti-lipogenesis in the patent specification meets novelty and non-obviousness for patentability.

(44) The above detailed descriptions are feasible embodiments of an application based on nucleotides of Lactobacillus rhamnosus to prepare a composition for anti-lipogenesis that should not restrict the scope of the present application. Any equivalent implementation or modification without departing from the spirit and scope of the present application should be incorporated in claims hereinafter.

(45) Accordingly, it is to be understood that the embodiments of the invention herein described are merely illustrative of the application of the principles of the invention. Reference herein to details of the illustrated embodiments is not intended to limit the scope of the claims, which themselves recite those features regarded as essential to the invention.

(46) As presented in many effects hereinbefore, an application based on nucleotides of Lactobacillus rhamnosus to prepare a composition for anti-lipogenesis in the patent specification meets novelty and non-obviousness for patentability.

Biological Material Deposit

(47) Lactobacillus rhamnosus (also known as Lacticaseibacillus rhamnosus) GM-020 was deposited on Dec. 18, 2003 and has designation number CCTCC M203098 at the China Center for Type Culture Collection (CCTCC).