NFAT binding polynucleotides

Abstract

The present invention relates to a polynucleotide comprising a Nuclear factor of activated T-cells (NFAT) binding site sequence and a reverse complement of said NFAT binding site sequence separated by a spacer sequence, to said polynucleotide for use in treating and/or preventing disease, and to viral particles, compositions, and uses related thereto. The present invention further relates to a polynucleotide comprising a Nuclear factor of activated T-cells (NFAT) binding site sequence and a reverse complement of said NFAT binding site sequence for use in treating and/or preventing an NFAT-mediated disease.

Claims

1. A polynucleotide comprising a Nuclear factor of activated T-cells (NFAT) binding site sequence and a reverse complement of said NFAT binding site sequence separated by a spacer sequence, wherein said polynucleotide is an RNA, wherein said NFAT binding site sequence comprises the sequence GGAAA, and wherein said polynucleotide comprises the sequence: GAGTGGAAACATACAGCCACTGAAACAGTGGCTGTATGTTTCCACTC (SEQ ID NO: 1) or a sequence at least 75% identical thereto.

2. The polynucleotide of claim 1, wherein said NFAT binding site sequence comprises the sequence RWGGAAANA, wherein R is A or G and W is A or T.

3. The polynucleotide of claim 1, wherein said polynucleotide comprises at least one further transcription factor binding site sequence and a corresponding reverse complement of said at least one further transcription factor binding site sequence.

4. The polynucleotide of claim 1, wherein said polynucleotide is a short-hairpin RNA.

5. The polynucleotide of claim 1, wherein said NFAT is NFATc1 (NFAT2, GenBank BC112243.1), NFATc2 (NFAT1, GenBank BC144074.1), NFATc3 (NFAT4, GenBank BC001050.2), and/or NFATc4 (NFAT3, GenBank BC053855.1).

6. The polynucleotide of claim 1, wherein said NFAT binding site sequence comprises the sequence NRWGGAAANA, wherein N is any base, R is A or G and W is A or T.

7. The polynucleotide of claim 1, wherein said NFAT binding site sequence comprises the sequence AGTGGAAACA.

8. A composition comprising a polynucleotide according to claim 1 and a carrier.

9. The composition of claim 8, wherein the composition is a pharmaceutical composition and wherein said carrier is a pharmaceutically acceptable carrier.

10. A method for treating and/or preventing NFAT-mediated disease in a subject suffering therefrom or expected to suffer therefrom, the method comprising: a) administering an effective dose of the polynucleotide according to claim 1 to said subject; and, thereby, b) treating and/or preventing NFAT-mediated disease.

11. The method of claim 10, wherein said administering comprises topical and/or systemic administration of said polynucleotide.

12. The method of claim 10, wherein said administering comprises epicutaeous, transcutaenous, intraarterial, or intravenous administration of said polynucleotide.

13. The method of claim 10, wherein said administering comprises catheter-assisted intraarterial or intravenous administration of said polynucleotide.

14. The method of claim 10, wherein said NFAT-mediated disease is selected from cardiac remodeling, in particular cardiomyopathy and/or heart failure; chronic inflammatory disease; and transplant rejection.

15. The method of claim 14, wherein said cardiac remodeling is caused by (i) arterial hypertension; (ii) congenital, age-related degenerative, or infection-related semilunar valve stenosis, in particular aortic valve stenosis; (iii) cardiomyopathy, in particular dilated cardiomyopathy, hypertrophic cardiomyopathy, arrhythmogenic right ventricular cardiomyopathy, left ventricular noncompaction, or restrictive cardiomyopathy; (iv) coronary heart disease; or (v) myocarditis.

Description

FIGURE LEGENDS

(1) FIG. 1: Naked hairpin consensus NFAT decoy ODN (hpNFATcons) but not the mutant control ODN (hpNFATmut) inhibits induction by ET-1 of the fetal gene program in HL-1 cells. (A) Messenger RNA levels of ANP and BNP were analysed in HL-1 cardiomyocytes as markers of the ET-1 (100 nmol/L) induced hypertrophic response. Gene expression was normalized to RPL32 as a housekeeping gene. (B) BNP protein levels were measured in HL-1 cells supernatants and lysates using ELISA and expressed relative to the concentration measured in non-stimulated control cells. (n=4, * p<0.05 as indicated).

(2) FIG. 2: Naked hairpin consensus NFAT decoy ODN (hpNFATcons) but not the mutant control ODN (hpNFATmut) inhibits induction by ET-1 of the fetal gene program also in murine neonatal cardiomyocytes. Summary data for ANP and BNP mRNA levels in neonatal cardiomyocytes as indicated. RPL32 was used for normalization of mRNA levels and non-stimulated neonatal cardiomyocytes served as a control. (n=4, * p<0.05 as indicated).

(3) FIG. 3: Naked hairpin consensus NFAT decoy ODN (hpNFATcons) but not the mutant control ODN (hpNFATmut) blocks upregulation by ET-1 of protein translation in HL-1 cells. (Left) Representative images showing puromycin staining in cardiac tissue sections from the different treatment groups. A Cy5-labelled secondary antibody (grey fluorescence) was used and nuclei were stained with DAPI (light grey fluorescence). (Right) The graph summarizes the statistical quantification of mean fluorescence intensity in the indicated treatment groups. (n=4 with 20 images analyzed/treatment group, ** p<0.01 as indicated).

(4) FIG. 4: AAV6-mediated delivery of consensus hpNFAT RNA decoy ODN (AAV6cons) but not the mutant control ODN (AAV6mut) inhibits induction by ET-1 of the fetal gene program in HL-1 cells. (A) ANP and BNP mRNA levels were analyzed HL-1cells that had been transduced with the RNA decoy ODN-expressing viral vectors. RPL32 was used as a housekeeping gene. (n=5, * p<0.05, ** p<0.01 as indicated) (B) BNP protein levels in the supernatant of the cardiomyocyte cell line were determined by ELISA and values normalized to the BNP concentration in the supernatant of non-stimulated control cells. (n=4, * p0.05, ** p<0.01 as indicated).

(5) FIG. 5: AAV6-mediated delivery of consensus hpNFAT RNA decoy ODN (AAV6cons) but not the mutant control ODN (AAV6mut) inhibits induction by ET-1 of the rate of protein translation in the HL-1 cells. (Left) Representative images showing puromycin staining in cardiac tissue sections from the different treatment groups. A Cy5-labelled secondary antibody (grey fluorescence) was used and nuclei were stained with DAPI (light grey fluorescence). The scale bar represents 10 μm. (Right) The graph summarizes the statistical quantification of mean fluorescence intensity in the indicated treatment groups. (n=4 with 20 images analyzed/treatment group, * p<0.01 as indicated).

(6) FIG. 6: Neither the naked hairpin DNA (hpNFATcons) nor the AAV6-transduced hairpin RNA decoy ODN (AAV6cons) affect NFATS translocation and function in HL-1 cells subjected to hyperosmotic stress. (A, B) Analysis of NFATS distribution in HL-1 cells subjected to hyperosmotic stress (100 mmol/L LiCl). The graph in B) summarizes quantification by immunofluorescence analysis of NFAT5-positive nuclei (grey fluorescence) marked in addition with DAPI (light grey fluorescence). The scale bar represents 25 μm. (n=4 with 20 images analyzed/group, *** p<0.001 vs. all other treatment groups) (C,D) Quantitative RT-PCR analysis (summary data) of NFAT5 target gene products SMIT (sodium/myoinositol cotransporter) and HSP70 (heat shock protein 70). RPL32 was used as a housekeeping gene and mRNA values were normalized to the mRNA level determined in untreated control cells. (n=4, ** p<0.01 vs. all other treatment groups).

(7) FIG. 7: Principle of the expression of a cDNA-based consensus hpNFAT decoy ODN in cardiomyocytes and confirmation of successful transfection of HL-1 cells with the plasmid-based expression construct. (Upper panel) The figure illustrates the principle of the approach taken. (Lower panel) Reverse transcriptase (RT) is expressed by HL-1 cells 2 days post transfection. RT activity in the HL-1 cells was determined by using the C-Type Reverse Transcriptase activity kit from Cavidi, Uppsala, Sweden. (n=4, ** p<0.01 as indicated); The sequence shown is SEQ ID NO: 20.

(8) FIG. 8: Principle of the molecular beacon technique and detection of an expressed cDNA-based consensus bait decoy ODN in HeLa cells. The cells were transfected with a plasmid harboring a CMV promotor-driven reverse transcriptase/consensus bait decoy ODN expression construct. A molecular beacon complementary to the expressed and reverse transcribed single-stranded cDNA bait molecule, labeled with the fluorophore 6-carboxyfluorescein (6-FAM) at the 5′ end and the black hole quencher-1 (BHQ-1) at the 3′ end, was added to the fixed cells or lysates thereof 2 days post transfection overnight. (Left panel) Detection of the decoy ODN mostly in the nucleus and in part in the cytoplasm of the HeLa cells 2 days post transfection by using the molecular beacon Nuclei were counterstained with DAPI, the scale bar corresponds to 15 μm, shown is a representative experiment. (Right panel) The figure illustrates the principle of the molecular beacon technique (top) and a typical readout (bottom) for the cDNA-based bait decoy ODN present in lysates of the HeLa cells 2 days post transfection and overnight incubation with the molecular beacon. For the latter, samples (cell lysate) were placed in glass capillaries in a LightCycler 2.0 instrument and heated to 95° C. followed by a cool-down phase to 25° C. while continuously recording fluorescence emission at 517 nm.

(9) FIG. 9: Plasmid-mediated delivery of the cDNA-based consensus hpNFAT decoy ODN but not the mutant control ODN to HL-1 cells for 2 days inhibits induction by ET-1 (100 nmol/L, 24 hours) of the fetal gene program. ANP and BNP mRNA levels were determined by qRT-PCR, BNP protein abundance by ELISA. (n=5, * p<0.05 as indicated).

(10) FIG. 10: AAV6-mediated delivery of the cDNA-based consensus hpNFAT decoy ODN but not the mutant control ODN to HL-1 cells for 3 days inhibits induction by ET-1 (100 nmol/L, 24 hours) of the fetal gene program. (Upper panel) Detection of the decoy ODN in the nucleus and in part in the cytoplasm of HL-1 cells 3 days post transduction with the viral vector by using the molecular beacon technique. Nuclei were counterstained with DAPI, the scale bar corresponds to 15 μm, shown is a representative experiment. (Lower panel) ANP and BNP mRNA levels were determined by qRT-PCR. (n=6, * p<0.05, p<0.01 as indicated).

(11) FIG. 11: Transduction efficiency in cardiomyocytes of AAV9 injected mice, 2 weeks after virus injection. (A) Representative images showing EGFP immunohistochemistry (green fluorescence) performed in heart cryosections. (B) Detection of the hpNFAT consensus RNA decoy ODNs in heart cryosections by F.I.S.H. Red fluorescence corresponds to hybridization of the probe to the target and proves generation of the decoy ODNs in situ. Scale bar represents 10 μm. (n=3 for PBS injected mice, n=8 for AAV9 injected groups, exemplary pictures).

(12) FIG. 12: Scheme of the work flow for the animal proof-of-concept model used (prevention study).

(13) FIG. 13: Echocardiographic assessment of heart function in AAV9 injected mice prior to hypertrophy induction by TAC. Representative M-mode echocardiograms and analysis of ejection fraction as a functional cardiac parameter and left ventricular mass at baseline. EF: ejection fraction; LV: left ventricle. (n=3 for PBS injected group, n=8 for AAV9 injected groups).

(14) FIG. 14: AAV9-mediated generation of hpNFAT consensus RNA decoy ODNs decreases TAC-induced heart hypertrophy. (A) The graphs summarizes the statistical quantification of markers of heart hypertrophy (HW/TL) and heart failure (LW/TL). The images on the left show gross morphology of the different AAV9 injected groups after TAC. (n=3 for PBS injected group, n=8 for AAV9 injected groups, ** p<0.01). (B) Representative M-mode echocardiograms of control mice and of animals subjected to TAC. On the right, the graphs present the statistical analyses of calculated LV (left ventricular) mass and EF (ejection fraction). (n=3 for PBS injected group, n=8 for AAV9 injected groups ** p<0.01; HW: heart weight, TL: tibia length, LW: lung weight, EF: ejection fraction).

(15) FIG. 15: AAV9-mediated expression of hpNFAT consensus RNA decoy ODNs decreases the phosphorylation level of phospholamban (PLN) at Ser16 in heart tissue. Western blot analysis using a specific antibody that recognizes the phosphorylated PLN at Ser16. Ponceau S staining was used as a loading control. (n=3, ** p<0.01).

(16) FIG. 16: AAV9-mediated delivery of hpNFAT consensus RNA decoy ODNs into the myocardium decreases the expression of TAC-induced pro-hypertrophic markers. (A) Gene expression analysis of ANP, BNP and ROAN-1 in the heart tissue, using RPL32 as a housekeeping gene. Values were normalized to sham-operated mice as control. (B) BNP protein level was measured by ELISA in plasma and heart protein extracts. (n=3 for sham and PBS injected groups, n=8 for AAV9 injected groups, * p<0.05, ** p<0.01).

(17) FIG. 17: AAV9-mediated delivery of hpNFAT consensus RNA decoy ODNs into the myocardium decreases fibrosis markers in heart sections. (A) mRNA levels of fibrosis markers collagen-3, TGF-β and CTGF in cardiac tissue. Gene expression was normalized to RPL32 as a housekeeping gene (n=3 for sham and PBS injected groups, n=8 for AAV9 injected groups, * p<0.05, ** p<0.01). (B) Representative left ventricular cross sections revealing perivascular and interstitial fibrosis. The graphs present the statistical quantification of the percentage of fibrosis (blue area) in the myocardium of mice from the different treatment groups. Scale bar represents 20 μm. (n=3 for sham and PBS injected groups, n=8 for AAV9 injected groups, * p<0.05, ** p<0.01).

(18) FIG. 18: AAV9-mediated delivery of hpNFAT consensus RNA decoy ODNs into the myocardium reduces β-MHC protein level. Representative images depicting β-MHC immunohistochemistry (red fluorescence) in heart cryosections. Nuclei were stained with DAPI (blue). The graph shows the statistical summary of the quantification of mean red fluorescence intensity in the different treatment groups. The scale bar represents 10-μm. (n=3 for PBS injected groups, n=8 for AAV9 injected groups, 20 images analyzed/group. *** p<0.001).

(19) FIG. 19: AAV9-mediated delivery of hpNFAT consensus RNA decoy ODNs decreases the rate of protein translation. Representative images of anti-puromycin immunohistochemistry (red fluorescence) which correlates with the total protein translation rate. The graph depicts the quantification of mean red fluorescence intensity of confocal images in the different treatment groups. Scale bar represents 20 μm. (n=3 for PBS injected groups, n=8 for AAV9 injected groups, 20 images analyzed/group. *** p<0.001).

(20) FIG. 20: AAV9-mediated delivery of hpNFAT consensus RNA decoy ODNs decreases cardiomyocyte dimensions. Representative images of wheat germ agglutinin (WGA) stainings (red fluorescence), labeling cell membranes of cells in short and long axis. Cardiomyocyte width and length were analyzed using ImageJ. Scale bar represents 20 μm. (n=3 for PBS injected groups, n=8 for AAV9 injected groups, 20 images analyzed/group, *** p<0.001).

(21) FIG. 21: AAV9-mediated delivery of hpNFAT consensus RNA decoy ODNs reduces left ventricular and cardiomyocyte size. Representative images of hematoxylin-eosin stainings of cardiac tissue sections from mice after TAC as well as from sham operated control animals. The graph shows relative cell area calculated using ImageJ. Values were normalized to the sham group. Scale bar represents 10 μm. (n=3 for PBS injected groups, n=8 for AAV9 injected groups, 15 images analysed/group, *** p<0.001).

(22) FIG. 22: AAV9-mediated delivery of hpNFAT consensus RNA decoy ODNs improves T-tubule organization in cardiomyocytes. (A) Representative images of WGA stainings (red fluorescence) of myocardium cryosections. Note, that the high red fluorescence background observed in confocal images of the stained tissue next to cell membrane is due to fibrotic areas around cardiomyocytes. (B) Plot profile of WGA stainings showing the regularity of the T-tubule system. (C) Statistical quantification of T-index, percentage of tubulated cells and T-power. The graphs on the right represent the plots obtained after Fourier transformation, showing the frequency of T-tubules at different distances. Scale bar represents 25 μm. (n=3 for PBS injected groups, n=8 for AAV9 injected groups, 30 images were taken/group with different magnifications, *** p<0.001).

(23) FIG. 23: Scheme of the work flow for the animal proof-of-concept model used (treatment study).

(24) FIG. 24: Detection of the hpNFAT decoy ODNs in the left ventricles of mice subjected to the method of treatment regimen. Representative confocal microscopy images demonstrating the detection of the decoy ODNs (light fluorescence) by fluorescence in situ hybridization (FISH). Nuclei were stained with DAPI (bright fluorescence). Arrows show nuclear localization of the hpNFAT decoy ODNs. Scale bar represents 20 μm.

(25) FIG. 25: Reduced hypertrophy and improved heart function following AAV9-mediated hpNFAT consensus RNA decoy ODN delivery into the myocardium 3 days post transverse aortic constriction (TAC). Statistical quantification of hypertrophy markers (A) HW/TL and (B) LV mass, and cardiac functional parameters, measured by echocardiography, (C) ejection fraction (EF) and (D) fractional shortening (FS). LV: left ventricle, HW: heart weight. (n=6 mice/group, *p<0.05, **p<0.01, ***p<0.001, One-way ANOVA followed by Tukeys multiple comparisons test)

(26) FIG. 26: Reduced fetal gene program following AAV9-mediated hpNFAT consensus RNA decoy ODN delivery into the myocardium 3 days post TAC. Gene expression analysis of (A) ANP, (B) BNP and (C) 3-MHC in the left ventricle, using RPL32 as a housekeeping gene. Values were normalized to sham-operated mice as control. (D) Representative image and (E) corresponding quantification of β-MHC protein level in left ventricular whole cell lysates in the mentioned treatment groups. (F) Representative images of β-MHC immunohistochemistry (red fluorescence) in myocardial frozen sections. Nuclei were stained with DAPI (blue). Scale bar represents 20 μm. (n=6 mice/group, *p<0.05, **p<0.01, One-way ANOVA followed by Tukeys multiple comparisons test)

(27) FIG. 27: Decreased cardiomyocyte dimensions following AAV9-mediated hpNFAT consensus RNA decoy ODN delivery into the myocardium 3 days post TAC. Representative images of WGA stainings (magenta), labeling cell membranes of cells in short long axis. Cardiomyocyte cross sectional area was analysed using ImageJ. Scale bar represents 20 μm. (n=6 mice/group, **p<0.01, ***p<0.001, One-way ANOVA followed by Tukeys multiple comparisons test)

(28) FIG. 28: Decreased fibrosis markers following AAV9-mediated hpNFAT consensus RNA decoy ODN delivery into the myocardium 3 days post TAC. (A, B) mRNA levels of fibrosis markers collagen 3 and TGF-β in cardiac tissue. Gene expression was normalized to RPL32 as a housekeeping gene. (C, D) Western blot analysis of collagen 3a1 protein level in whole cell lysates. (n=6 mice/group, * p<0.05, **p<0.01, ***p<0.001, One-way ANOVA followed by Tukeys multiple comparisons test)

(29) The following Examples shall merely illustrate the invention. They shall not be construed, whatsoever, to limit the scope of the invention.

(30) Uptake of Naked Hairpin (hp) DNA Decoy ODNs into Cardiomyocytes In Vitro

(31) HL-1 cells (murine cardiomyocyte cell line), neonatal as well as adult murine cardiomyocytes were incubated with the Atto-590 labelled decoy ODNs for 2 hours followed by confocal fluorescence microscopy. This unequivocally revealed uptake of the decoy ODNs into the different cardiomyocytes without any auxiliary means with the Atto-590 fluorescence signal detected both in the nuclei and in the cytoplasm. Transfection with lipofectamine in fact reduced HL-1 cell uptake of the decoy ODNs by approximately 60% (data not shown).

(32) Effects of the Naked DNA-Based hpNFAT Decoy ODNs on Cardiomyocyte Gene Expression and Protein Translation

(33) Following serum deprivation HL-1 cells were incubated with the consensus decoy ODN or the mutant control ODN at a concentration of 10 μmol/L for 2 hours followed by exposure to 100 nmol/L endothelin-1 (ET-1), a well-known pro-hypertrophic stimulus for cardiomyocytes, for 24 hours. Exposure to ET-1 resulted in a significant increase in transcription of the fetal genes ANP (atrial natriuretic peptide) and BNP (brain natriuretic peptide) that was virtually abolished by pre-incubation of the HL-1 cells with the consensus decoy ODN but not the mutant control ODN (FIG. 1). The same effect was observed in neonatal murine cardiomyocytes (FIG. 2). Hypertrophic growth of cardiomyocytes is accompanied by an increase in the rate of total protein translation (Hannan R, Jenkins A, Jenkins A, Brandenburger Y (2003) Cardiac hypertrophy: A matter of translation. Clinical and Experimental Pharmacology and Physiology 30: 517-527) that can be determined by employing the non-radioactive SUnSET assay. Pre-treatment of the HL-1 cells with the naked DNA-based consensus hpNFAT decoy ODN but not the mutant control ODN virtually abolished the ET-1-stimulated overall rise in protein translation in the cardiomyocyte cell line (FIG. 3).

(34) Effects of the AAV6-Mediated Expression of RNA-Based hpNFAT Decoy ODNs on Cardiomyocyte Gene Expression and Protein Translation

(35) After having demonstrated that the naked DNA-based consensus hpNFAT decoy ODN essentially abolishes the changes in gene expression and protein translation elicited by ET-1 in the cultured cardiomyocytes the next aim was to show that the same effects can be achieved by transducing the cardiomyocytes with an AAV6-based expression vector for expression of a RNA-based consensus hpNFAT decoy ODN. When using these adeno-associated viral vectors at a MOI of 10.sup.5 viral particles/cell. Using the co-expressed EGFP protein as readout, transduction efficiency for AAV6 in the HL-1 cells was determined to be 80%. Cell viability after transduction was not affected by exposure to AAV6, so that 3 days post transduction, serum-deprived HL-1 cells were stimulated with ET-1 at 100 nmol/L for 24 hours. The resulting increase in fetal gene expression (FIG. 4) and overall protein translation (FIG. 5) was essentially abolished by prior transduction of the HL-1 cells with the RNA-based consensus hpNFAT decoy ODN but not the mutant control ODN.

(36) No Effect of the DNA or RNA-Based Consensus Decoy ODN on NFAT5 Translocation to the Nucleus and NFAT5-Dependent Gene Expression

(37) The designed hpNFAT decoy ODN have due to their sequence characteristics a high specificity toward NFAT1 through 4 but should not neutralize NFAT5 because of the different DNA-binding motif recognized by this transcription factor. NFAT5 is a critical transcription factor for the development of the heart and the cellular response to hyperosmotic stress. Consequently, knockout of this transcription factor causes embryonic lethality and for various reasons increased loss of ventricular cardiomyocytes in mice (Mak M C, Lam K M, Chan P K, Lau Y B, Tang W H, Yeung P K K, Ko B C B, Chung S M S, Chung S K (2011) Embryonic lethality in mice lacking the nuclear factor of activated T cells 5 protein due to impaired cardiac development and function. PLOS One 6: 1-8). Therefore, the effects of both the DNA and RNA-based consensus hpNFAT1-4 decoy ODN on hyperosmotic stress-induced nuclear translocation of NFAT5 and NFAT5 target gene expression were investigated in HL-1 cells. As shown in FIG. 6, both decoy ODNs, regardless of the principle of administration, did not affect either parameter in the murine cardiomyocyte cell line, hence proving their specificity for NFAT1-4.

(38) Biological Activity of a cDNA-Based Consensus hpNFAT Decoy ODN In Vitro

(39) In addition, the possibility was explored to express a cDNA-based hpNFAT decoy ODN in the cardiomyocytes and test its biological activity. To this end, an expression vector was designed encoding a viral reverse transcriptase (RT) and the corresponding ODN flanked by a primer binding site. Both sequences are separated by a stem loop structure so that the RT is first transcribed and translated into the active enzyme which then reverse transcribes the other single-stranded RNA template into a single stranded cDNA molecule. The cDNA hybridizes with itself only leaving the hairpin single stranded. The principle of this approach is depicted in FIG. 7 (upper panel).

(40) Subsequently, the expression vector was cloned into a plasmid which was then transfected into HL-1 cells. Successful transfection was verified by the resulting increase in RT activity over baseline in the transfected HL-1 cells (FIG. 7, lower panel). In addition, the molecular beacon technique was used to verify expression of the cDNA-based consensus hpNFAT decoy ODN by the HL-1 cells 2 days post transfection. Both the principle of the molecular beacon technique and the detection of such a single-stranded cDNA-based hairpin decoy ODN is exemplified in FIG. 8 for a bait decoy ODN expressed by HeLa cells. As shown in FIG. 9, plasmid-mediated delivery of the cDNA-based consensus hpNFAT decoy ODN (corresponding to SEQ ID NO:1) but not that of the mutant control ODN to the HL-1 cells nearly abolished ET-1-stimulated fetal gene expression.

(41) Finally, the expression vectors for the consensus and mutant control ODN were cloned into the genome of AAV6 and viral particles produced therefrom. HL-1 cells transduced with these AAVs expressed the cDNA-based decoy ODNs 2 days post transduction as shown by employing the molecular beacon technique (FIG. 10, upper panel). Moreover, only the consensus decoy ODN but not the mutant control ODN expressed by the HL-1 cells virtually abolished the ET-1-stimulated upregulation of ANP and BNP expression in these cells (FIG. 10, lower panel).

(42) Hairpin (hp) NFAT RNA Decoy ODNs Effects In Vivo

(43) In order to prove the in vivo efficiency of the designed AAV, heart hypertrophy was induced by transverse aortic constriction (TAC). AAV9 was previously shown to be the most effective virus serotype to transduce cardiomyocytes in vivo following systemic tail-vein injection (Inagaki K, Fuess S, Storm T A, Gibson G A, Mctiernan C F, Kay M A, Nakai H (2006) Robust systemic transduction with AAV9 vectors in mice: Efficient global cardiac gene transfer superior to that of AAV8. Mol Ther 14: 45-53). Hence, the delivery of hpNFAT RNA decoy ODNs was made by using this virus serotype (10.sup.12 viral particles/mouse) 2 weeks before surgery, in order to allow the generation of RNA decoy ODNs within the tissue/cardiomyocytes. The survival rate after TAC was 95% (19 surviving mice out of 20). One mouse in the control AAV9 injected group lost a significant amount of weight, developed drastic dilated heart failure with extremely low ejection fraction (20%) and died 5 weeks after surgery.

(44) EGFP and RNA Decoy ODNs Expression after Transduction

(45) Successful cardiomyocyte transduction by AAV9 was demonstrated employing EGFP immunohistochemistry 2 weeks after injection. As shown in FIG. 11A, EGFP protein was detected in the myocardium of both AAV9-injected groups while control PBS treated mice did not present any EGFP signal in cardiomyocytes. These data suggest that cardiomyocyte transduction can be achieved by systemic tail-vein injection of AAV9. The next aim was the detection of hpNFAT RNA decoy ODNs in the cardiomycytes of AAV9 injected animals. Hence, 5-μm heart cryosections were subjected to RNA F.I.S.H. The detection of shRNAs was carried out using a molecular beacon with complementary sequence to the decoy ODNs and which emits red fluorescence when bound to the target. As a control, heart cryosections of PBS-injected mice were used. As presented in FIG. 11B, hpNFAT RNA decoy ODNs were expressed in the tissue isolated from AAV9 injected mice, while samples of PBS treated mice showed no fluorescence signal.

(46) Effect of AAV9 Injection on Heart Function (Prevention Study)

(47) Having determined that AAV9 systemic application leads to cardiomyocyte transduction and subsequently to hpNFAT RNA decoy ODNs production, its effect on heart function was further investigated. A general work flow for the in vivo experiments performed is depicted in FIG. 12. Echocardiography was performed 2 weeks after AAV9 injection to analyze the effect of the designed AAV9 before TAC-induced heart hypertrophy. As shown in FIG. 13, neither AAV9 expressing the consensus hpNFAT nor the mutated RNA decoy ODN had any effect on the ejection fraction at baseline. Consistently, no differences were observed in the calculated LV mass values.

(48) Having established that AAV9 expressing hpNFAT decoy ODNs does not affect heart function at baseline, TAC was performed in AAV9 injected mice and the effect of cell-specific NFAT1-4 neutralization in this heart hypertrophy model was analyzed. Mice were sacrificed 6 weeks after surgery. Since a high variation of body weight was observed between control and TAC-treated groups, the ratio heart weight/tibia length (HW/TL) was used as an established readout for myocardial hypertrophic growth. As shown in FIG. 14A, AAV9 mediated consensus but not mutant hpNFAT RNA decoy ODN expression significantly reduced left ventricular hypertrophy (HW/TL) as compared to the PBS treated group. Moreover, heart failure induced lung edema was analyzed, and the lung weight/TL ratio was in fact dramatically improved following treatment with the consensus decoy ODN expressing AAV9 as compared to vehicle control whereas this parameter tended to be even worse in the mutant control decoy ODN treated group (FIG. 14A). Follow-up echocardiography also revealed prominent amelioration of left ventricular function parameters ejection fraction and left ventricular mass 6 weeks post TAC following NFAT1-4 neutralization by the expressed consensus hpNFAT RNA decoy ODN (FIG. 14B).

(49) Effect of AAV9 Injection on Phospholamban Phosphorylation Status

(50) Phospholamban (PLN) is an important regulator of cardiac contractility by inhibiting SERCA mediated calcium re-uptake into the sarcoplasmic reticulum. Normally, PLN is phosphorylated by protein kinase A (PKA) at serine 16, resulting in an increased calcium sequestration and hence accelerated relaxation of the heart muscle fibers. This so-called lusitropic effect which speeds up ventricular relaxation in diastole is physiologically very important to economize cardiac work during exercise, i.e. at increased heart rate. In pressure overload conditions, such as after TAC surgery, PLN tends to be excessively phosphorylated thus negatively impacting the lusitropic effect. In vehicle control treated mice TAC caused an excessive phosphorylation of PLN at serine 16 (FIG. 15) which was highly significantly inhibited (by 72%) in the TAC group that had been treated with the consensus hpNFAT RNA decoy ODN expressing AAV9 but not with the mutant control decoy ODN expressing AAV9 (FIG. 15).

(51) Effects of AAV9 Injection on the Fetal Gene Program

(52) Next, effects of the AAV9 injection on expression of the pro-hypertrophic markers ANP, BNP and RCAN-1 was examined. As expected, 6 weeks of pressure overload induced a significant increase in expression of these fetal genes in the myocardium as compared to the sham-operated group. Notably, AAV9-mediated expression of the consensus hpNFAT RNA decoy ODN in the cardiomyocytes prior to TAC strongly reduced abundance of these fetal gene products (FIG. 16A). In addition, BNP protein levels were measured in the heart tissue as well as in the plasma from these mice by ELISA. Again, injection of the consensus hpNFAT RNA decoy ODN expressing AAV9 highly strongly reduced both the BNP plasma and tissue level (FIG. 16B).

(53) Effect of AAV9 Injection on Cardiac Fibrosis

(54) Fibrosis is a hallmark of heart failure and associated with collagen deposition contributing to an impairment of cardiac function. It is also known to be part of the TAC-induced cardiac pathology in mice. When analyzed on the mRNA level, the fibrosis markers collagen-3, TGF-β and CTGF were strongly upregulated in the left ventricle of vehicle control treated mice subjected to TAC (FIG. 17A). Treatment with the consensus hpNFAT RNA decoy ODN expressing AAV9 but not the mutant control ODN prior to TAC significantly reduced expression of these markers of fibrosis. It also reduced the rather prominent perivascular and interstitial fibrosis that had developed in the left ventricle of the mice subjected to TAC (FIG. 17B).

(55) Effect of AAV9 Injection on β-MHC Protein Abundance

(56) Heart hypertrophy is characterized by re-activation of the β isoform of the myosin heavy chain, which under normal conditions is expressed in the late stages of embryonic development. Therefore, the relative amount of this protein was analyzed as an additional marker of the pro-hypertrophic response in the 3 different treatment groups of mice subjected to TAC. As shown in FIG. 18, only prior treatment with the consensus hpNFAT RNA decoy ODN expressing AAV9 significantly reduced β-MHC protein abundance by about 50% as compared to both control groups.

(57) Effect of AAV9 Injection on Protein Translation Rate

(58) Cardiomyocyte hypertrophy involves an accelerated protein translation rate which can be determined by using the non-radioactive SUnSET assay. This method was further applied for detection of total protein translation levels in the cardiac tissue of the different treatment groups. Analysis of the confocal images revealed a dramatic decrease in mean fluorescence intensity in the cryosections of mice injected with the consensus hpNFAT RNA decoy ODN expressing AAV9 as compared to both control groups (FIG. 19).

(59) Effect of AAV9 Injection on Cardiomyocyte Size

(60) Next, cardiomyocyte hypertrophy in situ was addressed by directly by measuring cell size. Prior to analysis, cardiomyocyte orientation was analyzed, and both long and short axis were considered for a two-dimensional assessment of cell size. The results obtained (FIG. 20) clearly confirm that AAV9-mediated consensus hpNFAT RNA decoy ODN expression in the left ventricular cardiomyocytes normalizes their size despite subjection of the mice to TAC.

(61) To further confirm these cell size measurements, hematoxilin-eosin staining was performed and relative cardiomyocyte area was analyzed. As expected, TAC induced a significant increase in cell area as compared to sham operated mice (FIG. 21 bottom panel). Moreover, the changes in left ventricular wall dimensions, as assessed by echocardiography were validated by using this technique, resulting in an increased left ventricular wall thickness following TAC (FIG. 21 top panel). Injection of the AAV9 expressing the consensus hpNFAT RNA decoy ODN in the cardiomyocytes two weeks before TAC significantly decreased both left ventricular wall thickness (FIG. 21 top panel) and cardiomyocyte area (FIG. 21 bottom panel) as compared to both control groups.

(62) Effect of AAV9 Injection on T-Tubule Organization

(63) In healthy cardiomyocytes, the T-tubule system is highly organized with a regular spacing distance of approximately 2 μm, which is essential for excitation-contraction coupling. It was previously shown that T-tubule remodeling accompanies the transition from heart hypertrophy to heart failure, namely in animal models of pressure overload. Therefore, it was finally analyzed whether AAV9-mediated neutralization of NFAT1-4 can prevent pathological reorganization of the T-tubules in the TAC model. As expected, TAC led to a dramatic decrease in T-tubule regularity and density in the cardiomyocytes of the left ventricle both in vehicle control and mutant control decoy ODN expressing, AAV9 injected mice (FIG. 22A, B). This effect was almost blunted following pre-treatment with the consensus hpNFAT RNA decoy ODN expressing AAV9. Also T-tubule frequency (T-power), tubularity (T-index) and percentage of tubularization were near normal in the cardiac tissue sections from these mice. These observations allow to conclude that T-tubule network organization and hence excitation-contraction coupling can be rescued by effectively neutralizing NFAT1-4 in the cardiomyocytes of the left ventricle under conditions of pressure overload in mice. They further suggest a beneficial effect of this novel single treatment option on the development of maladaptive heart hypertrophy as well as its transition to heart failure in vivo.

(64) Effect of AAV9 Injection on Heart Function (Treatment Study)

(65) To investigate whether AAV9-mediated delivery of the hpNFAT consensus RNA decoy ODN into the myocardium can alleviate cardiac hypertrophy after transverse aortic constriction (TAC), the vector (10.sup.12 virus particles/mouse) was injected systemically through the tail vein 3 days after surgery. Heart function was monitored in a blinded manner every 2 weeks by echocardiography. Mice were sacrificed 6 weeks after TAC (FIG. 23).

(66) Hairpin NFAT Consensus Decoy ODNs are Expressed after AAV9 Tail-Vein Injection

(67) To prove that the hpNFAT consensus RNA decoy ODN is expressed following AAV9 transduction, we subjected myocardial frozen sections to FISH. As a probe, we used a molecular beacon with complementary sequence to the decoy ODN, which emits red fluoresce following hybridization to its target. As shown in FIG. 24, successful generation of the active nucleic acid compound was detected in AAV9-transduced myocardial tissue, whereas in non-transduced control myocardial sections no fluorescence could be detected. Importantly, this method confirmed presence of the hpNFAT decoy ODNs in the nucleus, which is a key factor for exerting their activity.

(68) Decreased Hypertrophy and Improved Cardiac Function Following AAV9-Mediated hpNFAT Consensus RNA Decoy ODN Expression in the Myocardium 3 Days Post TAC

(69) Administration of hpNFAT consensus (cons) but not mutant control (mut) RNA decoy ODN-expressing AAV9 viral vectors to mice subjected to TAC 3 days before strongly ameliorated myocardial hypertrophy, as shown by the decreased HW/TL ratio and LV mass (FIG. 25A, B). Moreover, echocardiographic analysis revealed a marked improvement in cardiac function, as evidenced by normalization of both ejection fraction and fractional shortening (FIG. 25C, D). Mice treated with the mutant control RNA decoy ODN-expressing viral vectors presented with prominent cardiac hypertrophy and pronounced deterioration of myocardial function as compared to the sham group.

(70) No Switching on of the Pro-Hypertrophic Gene Program Following Following AAV9-mediated hpNFAT consensus RNA decoy ODN expression in the myocardium 3 days Post TAC

(71) The effects of AAV9-mediated hpNFAT decoy ODN delivery to the cardiomyocytes in vivo was further evaluated with respect to TAC-mediated activation of the fetal gene program. Pressure-overload induced hypertrophy caused a significant rise in mRNA levels of atrial natriuretic peptide (ANP, 3.9-fold increase), brain natriuretic peptide (BNP, 5-fold increase) and the β-isoform of myosin heavy chain (β-MHC, 14-fold increase) in mice injected with the hpNFAT mut RNA decoy ODN-expressing AAV9 as compared to sham treated mice (FIG. 26 A-C). Furthermore, β-MHC protein level was elevated in left ventricles of these mice (FIG. 26 D-F). In stark contrast, administration of the hpNFAT cons RNA decoy ODN-expressing viral vectors 3 days after TAC led to normalization of all marker gene products for the hypertrophic cardiomyocyte phenotype, validating the rapid, prominent and long-lasting positive effect of this one-time treatment.

(72) Decreased Cardiomyocyte Hypertrophy Following AAV9-Mediated hpNFAT Consensus RNA Decoy ODN Expression 3 Days Post TAC

(73) Next, cardiomyocyte cross-sectional areas in the different treatment groups was assessed by specific staining of the cell membrane using WGA. Analysis of confocal fluorescence microscopy images demonstrated substantial cardiomyocyte hypertrophy 6 weeks following TAC in the mutant control RNA decoy ODN-treated control group as compared to sham-treated mice (2-fold increase in cross sectional area, FIG. 27A, B). Conversely, expression of the hpNFAT consensus RNA decoy ODN exerted a profound anti-hypertrophic effect, as evidenced by a dramatic reduction in cross-sectional area almost back to the level of the sham-treated control mice (FIG. 27A, B).

(74) Evidence for Decreased Fibrosis in Mice Treated with the hpNFAT Consensus RNA Decoy ODN-Expressing AAV9 Vectors

(75) Considering that cardiac fibrosis is a hallmark of heart failure and cardiac dysfunction, this parameter was investigated in addition to the above. As shown in FIGS. 28A and B, gene expression analyses revealed a significant decline in collagen 3 and TGF-β mRNA levels in the heart of mice subjected to TAC and treated 3 days later with the hpNFAT consensus RNA decoy ODN-expressing viral vector (1.8-fold and 1.7-fold, respectively) as compared to mice treated with the hpNAFAT mutant control decoy ODN-expressing AAV9. Consistently, Western Blot analysis confirmed a 1.8-fold reduction (i.e. back to the level of the sham-treated control mice) in collagen 3 protein content in the myocardium of mice therapeutically treated with the hpNFAT consensus RNA decoy ODN-expressing viral vector (FIG. 28C, D).

(76) In conclusion, continuous expression of a hairpin RNA decoy ODN neutralizing the transcriptional activity of NFAT in cardiomyocytes in vivo not only effectively prevents TAC-induced cardiac hypertrophy transiting into heart failure in mice but when administered therapeutically, i.e. 3 days post TAC, almost completely normalizes cardiac structure and function on several levels in this animal model. Both proof-of-concept studies thus suggest that one-time treatment with a viral vector specifically targeting cardiomyocytes in which a NFAT-neutralizing hairpin RNA decoy ODN is subsequently expressed may not only ameliorate the symptoms of cardiac hypertrophy in humans but also prevent the transition of cardiac hypertrophy into heart failure. Hairpin RNA-based decoy ODNs are not only much more effective than double-stranded DNA-based decoy ODNs but offer the opportunity to express them directly in their target cells, here cardiomyocytes, rather than to topically administer them, which is in fact impossible with an internal organ such as the heart. AAVs offer the opportunity to specifically target cells in the body despite a systemic route of application and in addition provide long-term expression of their cargo vector in the target cells. Only the combination of cargo and vector plus the specificity of the decoy ODN for the target transcription factor therefore makes a one-time treatment option for the treatment of, e.g. cardiac diseases, feasible.

(77) The following section describes the methods used to conduct the afore-mentioned in vivo study.

(78) AAV Production

(79) AAV production was performed in collaboration with Prof. Oliver Müller, Dr. Andreas Jungmann, Clinic for Cardiology, Angiology and Pneumology, University Clinic Heidelberg according to standard protocols (Varadi K, Michelfelder S, Korff T, Hecker M, Trepel M, Katus H, Kleinschmidt J, Müller O J (2012) Novel random peptide libraries displayed on AAV serotype 9 for selection of endothelial cell-directed gene transfer vectors. Gene Therapy 19:800-809).

(80) Cloning of hpRNA Decoy ODNs Expressing Plasmids

(81) The hpRNA decoy ODNs were generated as shRNAs under the H1 promoter. The plasmids encoded EGFP as an expression marker under the control of a CMV promoter, and included inverted terminal repeats (ITR) sequences, which are crucial for AAV production. The individual sequences for each shRNA subcloning were ordered as gene synthesis (see table below). The synthetized gene sequences contained part of the H1 promoter (5′-end) and the shRNA (3′-end) flanked by KasI and XhoI restriction sites.

(82) TABLE-US-00002 TABLE List of gene synthesis sequences. Sequences recognized by restriction enzymes are presented in italic and decoy ODN sequences are shown in bold. Plasmid Sequence P-NFAT cons 5′AGGCGCCCTGCAATATTTGCATGTCG (SEQ ID NO: CTATGTGTTCTGGGAAATCACCATAAAC 18) GTGAAATGTCTTTGGATTTGGGAATCTT ATAAGTTCTGTATGAGACCACAGTCGAC GAGTGGAAACATACAGCCACTGAAACAG TGGCTGTATGTTTCCACTCCACCGCAGT TTCGACCTCGAGA3′ P-NFAT mut 5′AGGCGCCCTGCAATATTTGCATGTCG (SEQ ID NO: CTATGTGTTCTGGGAAATCACCATAAAC 19) GTGAAATGTCTTTGGATTTGGGAATCTT ATAAGTTCTGTATGAGACCACAGTCGAC GAGCTTAAACATACAGCCACTGAAACAG TGGCTGTATGTTTCCACTCCACCGCAGT TTCGACCTCGAGA3′

(83) Maintainence of Bacterial Cells

(84) For AAV plasmid cloning, recombination-deficient SURE2 (Stop Unwanted Rearrangement Events 2) bacterial cells (Agilent Genomics, Waldbronn, Germany) were used, in order to prevent the deletion of ITR sequences. Liquid cultures, grown in sterile LB medium were expanded at 37° C. under continuous agitation (150-200 rpm) in a bacterial incubator. Bacteria stocks for transformation were stored as 50 μL aliquotes at −80° C.

(85) Digestion of Plasmid DNA

(86) Plasmid digestion with KasI and XhoI restriction enzymes was performed in the corresponding buffers for 2 h for each μg plasmid DNA, at 37° C. Reaction efficiency was analyzed by agarose gel electrophoresis (100V for approximately 70 min). A molecular weight ladder was used to determine band size (GeneRuler 1 kb DNA Ladder, Thermo Fischer Scientific, Munich, Germany). The DNA was imaged by using a GelDoc XR unit and analyzed using the Quantity One software package version 4.06 (Bio Rad, Munich, Germany). The DNA bands corresponding to the backbone and the insert were cut out and DNA was purified from the gel using QIAquick Gel Extraction Kit (Qiagen, Hilden, Germany) according to the manufacturer's instructions. Eluted DNA concentration was measured using NanoDrop spectrophotometer (PeQlab Biotechnologie, Erlangen, Germany).

(87) Modification of DNA Ends

(88) In order to reduce the process of backbone re-ligation, 5′-phosphate ends were removed by using Antarctic phosphatase (New England Biolabs, Frankfurt am Main, Germany). The gel-purified vector backbone was incubated with the enzyme in the specific buffer for 30 min at 37° C. Phosphatase heat-inactivation was afterwards performed at 65° C. for 30 min on a thermoblock (Eppendorf, Hamburg, Germany).

(89) Ligation of Plasmid DNA

(90) Ligation of DNA fragments was performed in a ratio of 1:4 backbone:insert by using T4 DNA ligase in the specific ATP-containing buffer provided by the producer. For each ligation reaction, 50 μg backbone was used. The dephosphorylated backbone was incubated with the insert in the presence of ligase for 16 hours at 16° C. using a thermoblock. The reaction mixture was further used for transformation of the bacteria.

(91) Bacterial Transformation

(92) Fifty μL of bacteria were allowed to thaw on ice and then incubated with the ligation mixture for 30 min at 4° C. Heat-shock was performed at 42° C. for 45 s, on a thermoblock. Afterwards, bacteria were transferred on ice for 10 min and then cultured for 30 min at 37° C. in 300 μL LB medium without antibiotics. Next, the suspension was spread on sterile LB-plates with 15% agar and 100 μg/mL ampicillin (Sigma-Aldrich, Munich, Germany). Plates were incubated overnight at 37° C. to allow colony formation. Individual bacterial colonies were randomly picked and further cultured in 5 mL LB medium with ampicillin for 16 hours. Plasmid DNA was isolated using the QIAprep Spin Miniprep Kit (Qiagen, Hilden, Germany) according to the manufacturer's instructions.

(93) The presence of the insert was confirmed by KasI and XhoI digestion as well as DNA sequencing (Eurofins Genomic, Luxembourg). Positive colonies were expanded in 1 L of ampicillin containing LB medium overnight and DNA was isolated using the ZymoPURE Plasmid Gigaprep Kit (Zymo Research, Freiburg, Germany) according to the manufacturer's instructions. Each preparation yielded at least 1.5 g plasmid DNA, which was further used for AAV preparation.

(94) Quantitative Real Time PCR Total RNA was extracted from cardiac tissue using the RNeasy Mini Kit (Qiagen, Hilden, Germany) following the manufacturer's instructions and RNA concentration was measured using a NanoDrop spectrophotometer (PeQlab Biotechnologie, Erlangen, Germany). First strand synthesis of cDNA was completed using Omniscript Reverse Transcriptase kit (Qiagen) and OligodT primers (Promega, Mannheim, Germany), starting from equal amounts of RNA for each sample. SYBR Green (Qiagen) qRT-PCR was performed using the Qiagen Rotor-Gene cycler in reactions of 20 μL (10 μL SYBR Green, 2 μL primer mix, 3 μL RNase free water, 5 μL cDNA). cDNA was amplified using specific primers for the genes of interest. The qPCR program consisted of an initial denaturation step of at 95° C. for 5 min followed by 40 cycles of denaturation (at 95° C. for 60 s), annealing (primer dependent temperature, 25 s) and elongation (72° C. for 60 s) followed by monitoring of the melting curve. The presence of a single amplicon was determined by the existence of a single peak in the melting curve graph. Data was analyzed by relative quantification using the double delta Ct (cycle threshold) method with RPL32 as a housekeeping gene (Pfaff M W (2001) A new mathematical model for relative quantification in real-time RT PCR. Nucleic Acids Res 29: 2003-2007). The Ct was defined as the cycle number at which the fluorescence signal crosses the fluorescence threshold, considered as background. Corresponding controls (samples isolated from control mice) were used for relative gene expression calculation.

(95) In Situ Hybridization

(96) For the detection of RNA decoy ODNs ex vivo, samples (tissue sections) were subjected to RNA in situ hybridization. In brief, 5-μm tissue cryosections were fixed with DEPC (diethyl dicarbonate)-treated 4% p-formaldehyde (Sigma-Aldrich, Munich, Germany) for 10 min followed by incubation with 20 μg/mL proteinase K (Sigma-Aldrich, Munich, Germany) at 37° C. for 15 min in order to induce tissue permeabilization and antigen retrieval. As a probe, a molecular beacon (Biomers, Ulm) with complementary sequence to the hairpin decoy ODNs with 5′-Cy5 labeling and 3′-BHQ-2 (Black Hole Quencher) as a quencher was employed. In the hybridized state, the molecular beacon itself does not emit a fluorescence signal due to the dye and the quencher being located proximal to each other. After hybridization to the target sequence, red fluorescence can be detected (Wile B M, Ban K, Yoon Y S, Bao G (2014) Molecular beacon-enabled purification of living cells by targeting cell type-specific mRNAs. Nature Protocols 9: 2411-2424). Prior to hybridization, the molecular beacon was heated to 95° C. followed by gradual cool-down to ambient temperature to allow the hairpin structure to form; afterwards it was kept on ice until use.

(97) The molecular beacon technique was also used to detect the expressed and reversed transcribed cDNA-based consensus and control hpNFAT decoy ODNs, e.g. in HL-1 cells. Other than described above the molecular beacons were labeled with 6-carboxyfluorescein (6-FAM) at the 5′ end and with BHQ-1 at the 3′ end. They were incubated with the plasmid transfected HL-1 cells 2 days post transfection as described below followed by fixation of the HL-1 cells, counterstaining with DAPI and fluorescence microscopy analysis.

(98) Samples were incubated overnight at 55° C. with the probe dissolved in hybridization buffer in a humidified atmosphere. As blocking reagents, salmon DNA and yeast tRNA were added to the mixture. After extensive washes (3×20 min) in hybridization buffer and DEPC-treated PBS (lx 15 min) to remove non-hybridized molecular beacon, EGFP immunofluorescence staining was performed. Finally, DAPI staining was performed (excitation at 358 nm/emission at 461 nm) for visualization of the nuclei using Fluoroshield with DAPI mounting medium (Sigma-Aldrich).

(99) Protein Extraction and Western Blot Analysis

(100) In order to isolate total protein from cardiac tissue, a piece of the left ventricle was cut, briefly washed with NaCl to remove blood residuals, and then treated with 300 μL complete RIPA buffer at 0-4° C. Afterwards, a Dounce homogenizer was used to disrupt the tissue. Protein lysates were snap frozen and maintained at −80° C. before further analysis. To this end, 30 μg of protein were denatured by incubation at 95° C. for 10 min with 4× sample buffer (Roth, Karlsrue, Germany) and loaded onto 12% polyacrylamide gels with SDS. A pre-stained protein standard (Bio Rad, Munich, Germany) was used for molecular weight estimation. Separated proteins were transferred onto a methanol pre-activated PVDF (polyvinylidene difluoride) membrane (Merck Millipore, Darmstadt, Germany) with a pore size of 0.45 μm. Ponceau S (Roth, Karlsrue, Germany) staining was used to document equal loading of protein samples. The membranes were then digitized using a Lexmark scanner. Prior to further processing, the membranes were completely destained by washing with TBS.

(101) Blocking was made using 5% nonfat dry milk diluted in TBS-T for one hour, followed by overnight incubation at 4° C. under continuous shaking with the primary antibodies; 3-actin was used as a loading control. After washing, membranes were incubated with the corresponding horseradish-peroxidase labeled secondary antibodies for 1 hour at ambient temperature. Membranes were developed with the chemoluminescent substrates Luminata Classico (Merck, Darmstadt) for β-actin and Luminata Forte (Merck) for phospholamban detection for 3 min. Afterwards, membranes were imaged using the ImageQuant LAS 4000 mini system (GE Healthcare Life Sciences, Munich, Germany). The band intensities were analyzed and related to β-actin using ImageJ software.

(102) ELISA

(103) ELISA (enzyme-linked immunosorbent assay) was used for the assessment of BNP concentration in left ventricular protein extracts and in plasma. For this purpose, a Brain Natriuretic Peptide EIA Kit (Sigma-Aldrich) was used according to the manufacturer's instructions. The absorbance was read using a colorimetric microtiter plate reader (BioTek, Bad Friedrichshall, Germany). Absorbance of the samples and standards was measured in duplicate. A standard curve for the target protein (provided by the manufacturer) was plotted in each experiment. The amount of BNP protein was normalized to the total protein content of the sample, as determined by using the Bradford method.

(104) Immunohistochemistry

(105) Cardiac tissue was collected and washed in NaCl to remove blood residuals. Next, tissue was embedded into TissueTek (Leica Biosystems, Wetzlar, Germany) and snap-frozen by immersion into liquid nitrogen. A cryotome (Leica, Mannheim, Germany) was used to section the frozen tissue (temperature −21° C.) into 5-μm thick cryosections that were fixed with Zinc fixative and blocked with PBS containing 3% BSA and 0.05% Triton-X100 for 1 hour. Primary antibodies against the proteins of interest were diluted in blocking buffer and incubated overnight at 4° C. in a humidified atmosphere. As secondary antibodies, compatible Cy3 or Cy5 labeled IgGs were used, diluted in blocking buffer. Nuclei were visualized by DAPI counterstaining and images were recorded by confocal microscopy (Leica TCS SP8, Leica Microsystems, Mannheim). Relative mean fluorescence intensity was measured using ImageJ as previously described (Jensen E C (2013) Quantitative analysis of histological staining and fluorescence using ImageJ. The Anatomical Record 296: 378-381) and related to the corresponding controls.

(106) SUnSET Assay

(107) The SUnSET (surface sensing of translation) assay was used for measurement of total protein translation rate as previously described (Schmidt E K, Clavarino G, Ceppi M, Pierre P (2009) SUnSET, a nonradioactive method to monitor protein synthesis. Nature Methods 6: 275-277). To this end, 5-μm cardiac cryosections were incubated with 10 μmol/L puromycin for 30 min followed by fixation with p-formaldehyde. Then the anti-puromycin antibody diluted in blocking buffer was added to fixed sections and incubated overnight at 4° C. After 3 steps of washing with PBS, a Cy5-labeled secondary antibody was incubated with the tissue sections followed by monitoring of the ensuing red fluorescence signal using the confocal microscope and analysis of relative mean values using ImageJ software.

(108) Cell Size Measurement

(109) WGA (Wheat Germ Agglutinin) staining is an already established method for analysis of cell size in cardiac tissue. Left ventricles embedded in TissueTek medium were sectioned (5 μm) and the cell orientation was observed. The analysis was made on both short and long axis. Cryosections were fixed with PFA 4% for 5 min and stained with WGA-Alexa Fluor 594 (Thermo Fischer Scientific, Darmstadt, Germany, 1:400 diluted in PBS). The incubation with the dye was performed at room temperature, for 10 min. Afterwards, tissues were briefly washed with PBS and mounted. Images were taken using confocal microscopy and cell diameter was analyzed using ImageJ.

(110) T-Tubule Analysis

(111) After wheat germ agglutinin staining, T-tubule organization was assessed using ImageJ, as previously described (Wei S, Guo A, Chen B, Kutschke W, Xie Y P, Zimmerman K, Weiss R M, Anderson M E, Cheng H, Song L S (2010) T-tubule remodeling during transition from hypertrophy to heart failure. Novelty and significance. Circulation Research 107:520-531). In brief, cardiomyocytes in the tissue sections were analyzed individually by application of fast Fourier transformation (FFT). This method allowed the identification of repetitive patterns and the frequency with which they appear (T-power). The peak corresponding to the 2-μm distance was further analyzed. In addition, the percentage of cell area occupied by T-tubules (T-index) was calculated by using threshold method deter-mined in ImageJ. This parameter was defined as the area above-threshold divided by cell cross-sectional area. Cardiomyocytes presenting with a T-index above 2% were considered to be tubulated. The level of tubularization was defined as the percentage of tubulated cells in each treatment group.

(112) Masson's Trichrome Staining

(113) Hearts were fixed in 4% p-formaldehyde overnight at 4° C. and embedded in paraffin prior to histological assessment. For visualization of collagen fibers, sections were subjected to Masson's Trichrome staining according to standard protocols. Images were taken in random areas of the left ventricle using a brightfield microscope with 20× magnification (Leica DM500, Leica Microsystems, Mannheim, Germany). Collagen was stained blue, muscle and cytoplasm appeared red and nuclei were visualized as being dark brown to black. Both perivascular and interstitial fibrosis were analyzed using a quantification software written in QT/C++ based on image processing and segmentation libraries. In a first step, interfering background of all images was masked out by subsequently applying threshold and erosion filters. Further, the fibrotic area was determined using hsv-thresholding with a 10% tolerance on the hue component, followed by numerical quantification of the percentage area covered.

(114) Hematoxylin-Eosin Staining

(115) Cardiomyocyte architecture was assessed by hematoxylin-eosin staining of paraffin-embedded tissue sections according to standard protocols. Stained tissue sections were visualized using a brightfield microscope (Leica DM500, Leica Microsystems). Following the procedure, nuclei appeared blue, while cardiac tissue was stained pink. Cardiomyocytes were identified according to their specific shape and their area on the long axis was measured using ImageJ and normalized to the cell size of sham operated mice.

(116) Animal Model

(117) All animal experiments were carried out under the approval of the regional animal ethics committee (Regierungspräsidium Karlsruhe, permit number G180/12, and Ministry of Environmental and Agricultural Affairs of Schleswig-Holstein, permit number V312-7224.121-4); applicant Prof. Dr. Oliver Müller). Animals were kept in the Interfaculty Biomedical Facility (IBF), Heidelberg or the Zentrale Tierhaltung, Universitätsklinikum Schleswig-Holstein, Campus Kiel, under standard conditions with 12-hour light and 12-hour night cycle; water and food was offered ad libitum.

(118) Transverse Aortic Constriction and Echocardiography

(119) Transverse aortic constriction was performed in 10 weeks old C57BL/6N mice for inducing heart hypertrophy which develops into heart failure, as previously described (Lehmann L H, Rostosky J S, Buss S J, Kreusser M M, Krebs J, Mier W, Enseleit F, Spiger K, Hardt S E, Wieland T, Haass M, Lüscher T F, Schneider M D, Parlato R, Gröne H J, Haberkorn U, Yanagisawa M, Katus H A, Backs J (2014) Essential role of sympathetic endothelin A receptors for adverse cardiac remodeling. Proceedings of the National Academy of Sciences 111: 13499-13504). The substrain choice was made due to the findings published by Garcia-Menderez et al. (Garcia-Menendez L, Karamanlidis G, Kolwicz S, Tian R (2013) Substrain specific response to cardiac pressure overload in C57BL/6 mice. Am J Physiol Heart Circ Physiol 305: H397-H402) who showed that C57BL/6N mice are a better animal model for TAC-induced cardiac hypertrophy than other commonly used substrains, such as C57BL/6J. A 27-gauge needle was used for inducing the stenosis. Successful ligation was confirmed by measuring the right carotid/left carotid flow velocity ratio. Changes in heart function were determined every 2 weeks by echocardiography in non-anesthetized mice using the VisualSonics Vevo 2100 imaging system and the 55 MHz MS-550D micro scan transducer. The measurements were performed by an experimenter blinded to the treatment. Long axis and M-mode short axis cine loops were recorded. EF (ejection fraction), FS (fractional shortening) and left ventricular mass were determined using the VisualSonics software. The mice were sacrificed by CO.sub.2 asphyxiation 6 weeks after surgery. Heart weight/tibia length ratio was measured as a marker of cardiac hypertrophy as well as lung weight/tibia length ratio for monitoring heart failure induced lung edema. Furthermore, body weight was tracked as well every week.

(120) Statistical Data Analysis

(121) The statistical data evaluation was made using GraphPad InStat 3.06 software. Differences between 3 or more different groups were assessed using One-way ANOVA followed by a Tukey's multiple comparison test for particular pairs of groups. Mann-Whitney U test was used to compare two groups. A p value <0.05 was considered significant. The mean fluorescence intensity of at least 20 images/group was analyzed in the immunohistochemistry experiments using ImageJ (FiJi version 1.51p). Western blot data were evaluated as well using ImageJ. Data are presented as mean±SD of n individual experiments. Graphs were generated using GraphPad Prism 7 (San Diego, Calif., USA).

NON-STANDARD LITERATURE CITED

(122) Bourajjaj M, Armand A S, da Costa Martins P A, Weijts B, van der Nagel R, Heeneman S, Wehrens X H, De Windt L J (2008) NFATc2 is a necessary mediator of calcineurin-dependent cardiac hypertrophy and heart failure. Journal of Biological Chemistry 283:22295-22303 Flanagan W M, Corthesy B, Bram R J, Crabtree G R (1991) Nuclear association of a T-cell transcription factor blocked by FK-506 and cyclosporine A. Nature 352:803-807 Garcia-Menendez L, Karamanlidis G, Kolwicz S, Tian R (2013) Substrain specific response to cardiac pressure overload in C57BL/6 mice. Am J Physiol Heart Circ Physiol 305: H397-H402 Goldberg L R. In the clinic. Heart failure. Ann Intern Med. 2010 Jun. 1; 152(11):ITC61-15 Hannan R, Jenkins A, Jenkins A, Brandenburger Y (2003) Cardiac hypertrophy: A matter of translation. Clinical and Experimental Pharmacology and Physiology 30: 517-527 Hecker M, Wagner S, Henning S W, Wagner A H. Decoy oligodeoxynucleotides to treat inflammatory diseases. (book chapter) In: Therapeutic Oligonucleotides 2008; (ed. Kurreck J) RSC Publishing, Cambridge, U.K., pp. 163-188 Inagaki K, Fuess S, Storm T A, Gibson G A, Mctiernan C F, Kay M A, Nakai H (2006) Robust systemic transduction with AAV9 vectors in mice: Efficient global cardiac gene transfer superior to that of AAV8. Mol Ther 14: 45-53) Kuriyama M, Matsushita M, Tateishi A, Moriwaki A, Tomizawa K, Ishino K, Sano S, Matsui H (2006) A cell-permeable NFAT inhibitor peptide prevents pressure-overload cardiac hypertrophy. Chemical Biology and Drug Design 67:238-243 Laupacis A, Keown P A, Ulan R A, McKenzie N, Stiller C R (1982) Cyclosporin A: a powerful immunosuppressant. Canadian Medical Association Journal 126: 1041-1046 Lehmann L H, Rostosky J S, Buss S J, Kreusser M M, Krebs J, Mier W, Enseleit F, Spiger K, Hardt S E, Wieland T, Haass M, Lüscher T F, Schneider M D, Parlato R, Gröne H J, Haberkorn U, Yanagisawa M, Katus H A, Backs J (2014) Essential role of sympathetic endothelin A receptors for adverse cardiac remodeling. Proceedings of the National Academy of Sciences 111: 13499-13504 Mak M C, Lam K M, Chan P K, Lau Y B, Tang W H, Yeung P K K, Ko B C B, Chung S M S, Chung S K (2011) Embryonic lethality in mice lacking the nuclear factor of activated T cells 5 protein due to impaired cardiac development and function. PLOS One 6: 1-8 Molkentin J D, Lu J R, Antos C L, Markham B, Richardson J, Robbins J, Grant S R, Olson E N (1998). A calcineurin-dependent transcriptional pathway for cardiac hypertrophy. Cell 93:215-228 Parra V, Rothermel B A (2017) Calcineurin signaling in the heart: The importance of time and place. J Mol Cell Cardiol 103:121-136 Pfaff M W (2001) A new mathematical model for relative quantification in real-time RT PCR. Nucleic Acids Res 29: 2003-2007 Wei S, Guo A, Chen B, Kutschke W, Xie Y P, Zimmerman K, Weiss R M, Anderson M E, Cheng H, Song L S (2010) T-tubule remodeling during transition from hypertrophy to heart failure. Novelty and significance. Circulation Research 107:520-531 Wile B M, Ban K, Yoon Y S, Bao G (2014) Molecular beacon-enabled purification of living cells by targeting cell type-specific mRNAs. Nature Protocols 9: 2411-2424 Wilkins B J, Dai Y S, Bueno O F, Parsons S A, Xu J, Plank D M, Jones F, Kimball T R, Molkentin J D (2004) Calcineurin/NFAT coupling participates in pathological, but not physiological cardiac hypertrophy. Circulation Research 94:110-118