Modified microorganisms to increase yield of xylose-derived products

12584151 ยท 2026-03-24

Assignee

Inventors

Cpc classification

International classification

Abstract

Methods and engineered hosts are disclosed that convert a lignocellulosic xylose-containing biomass source into xylonic acid and/or xylonate, which can be further processed into other useful derivatives. In particular, an exemplary engineered Bacidiomycetes, e.g., R. toruloides, host produces/expresses one or more fungal enzymes that convert xylose into xylonic acid/xylonate. Methods of using such hosts to consume pretreated lignocellulosic biomass in combination with certain native promoters and heterologous genes are also described herein.

Claims

1. An engineered organism comprising an engineered host derived from a Basidiomycete organism having a gene with at least 95% sequence identity to SEQ ID NO: 1 in its genome, the engineered host having the gene with 95% or greater sequence identity to SEQ ID NO: 1 deleted from its genome; wherein XylB and XylC are expressed in the engineered host; and the engineered organism is capable of producing xylonic acid, xylonate, or a combination thereof.

2. The engineered organism of claim 1, wherein the engineered host is Rhodosporidium having the gene with 95% or greater sequence identity to SEQ ID NO: 1 deleted from its genome.

3. The engineered organism of claim 2, wherein the engineered host is R, toruloides with the gene with at least 99% sequence identity to SEQ ID NO: 1 deleted from its genome.

4. The engineered organism of claim 1, wherein XylB and XylC are codon optimized for the engineered host.

5. A fermentation broth composition, comprising an energy source comprising xylose and an engineered host, the engineered host being derived from a Basidiomycete organism having a gene with at least 95% sequence identity to SEQ ID A NO: 1 in its genome, and the engineered host having the gene with at least 95% sequence identity to SEQ ID NO: 1 deleted from its genome; wherein XylB and XylC are expressed in the engineered host; and the fermentation is capable of producing xylonate, or a combination thereof.

6. The fermentation broth composition of claim 5, wherein the engineered host is Rhodosporidium having the gene with at least 95% sequence identity to SEQ ID NO: 1 deleted from its genome.

7. The fermentation broth composition of claim 6, wherein the engineered host is R, toruloides having the gene with at least 95% sequence identity to SEQ ID NO: 1 deleted from its genome.

8. The fermentation broth composition of claim 5, wherein the fermentation broth composition has a pH of about 5.5 to about 6.

9. The fermentation broth composition of claim 5, wherein the energy source is a biomass hydrolysate.

10. The fermentation broth composition of claim 5, wherein gene sequences XylB and XylC are codon optimized for the engineered host.

11. The fermentation broth composition of claim 5, wherein the energy source is a corn stover hydrolysate.

12. A method of making a xylose-derived product via a fermentation broth, comprising: expressing XylB and XylC in the fermentation broth via introducing promoter sequences for expressing XylB and XylC in an engineered host: combining an energy source comprising xylose and the engineered host, the engineered host being derived from a Basidiomycete organism having a gene with at least A 95% sequence identity to SEQ ID NO: 1 in its genome, and the engineered host A having the gene with at least 95% sequence identity to SEQ ID NO: 1 deleted from its genome; and the method produces xylonic acid, xylonate, or a combination thereof.

13. The method of claim 12, wherein the energy source is a biomass hydrolysate.

14. The method of claim 12, wherein the energy source is deacetylated mechanically refined corn stover.

15. The method of claim 12, wherein the engineered host is derived from Rhodosporidium.

16. The method of claim 12, wherein the engineered host is R, toruloides having SEQ ID NO: 1 deleted from its genome.

17. The method of claim 12, further comprising adding a nitrogen source to the fermentation broth.

18. The method of claim 12, wherein the fermentation broth has a pH of about 5.5 to about 6.

19. The method of claim 12, wherein the method yields 80% to 99% by weight of theoretical yield of xylonic acid, xylonate, or a combination thereof.

20. The method of claim 12, wherein XylB and XylC are codon optimized for the engineered host.

Description

BRIEF DESCRIPTION OF THE DRAWINGS

(1) FIG. 1 is reaction scheme showing a pentose utilization pathway in R. toruloides in contact with a xylose-containing source.

(2) FIG. 2 is a series of graphs showing gene expression, protein expression, and fitness scores for pentose utilization pathway genes.

(3) FIG. 3 is a reaction scheme showing the native metabolic pathway for R. toruloides and the non-native metabolic pathway that is believed to take place when the RT04_9774 gene is deleted from R. toruloides with the addition of heterologous genes.

(4) FIG. 4 is a graph showing a growth experiment of wild-type R. toruloides versus the engineered host.

(5) FIG. 5 is a graph showing the effect of addition of urea to DMR to improve xylonic acid titers.

(6) FIG. 6 is a graph showing xylonate titers over time as described in Example 3.

(7) FIG. 7 lists SEQ ID NO: 1.

(8) FIG. 8 lists SEQ ID NOs: 2 and 3.

(9) FIG. 9 lists SEQ ID NOs: 4 and 5.

(10) FIG. 10 lists SEQ ID NOs: 6 and 7.

DETAILED DESCRIPTION OF THE INVENTION

(11) The present disclosure relates, in part, to methods and compositions (e.g., engineered hosts) for use in converting xylose-containing lignocellulosic biomass. In particular embodiments, the methods include use of an engineered Rhodosporidium yeast, such as R. toruloides, the engineered R. toruloides having the RT04_9774 Uniprot ID: AOAOK3CLY8 (SEQ ID NO: 1)(FIG. 7) gene deleted from its genome combined with a xylose-containing medium such as a biomass. XylB and XylC are also incorporated into the reaction mixture (or fermentation broth by addition to the R. toruloides genome via agrobacterium-mediated transformation).

(12) As a result of employing a high throughput method to probe strain fitness of a barcoded library of Rhodosporidium mutants on various conditions (RB-TDNAseq), as well as looking at enzymology and expression data, it was concluded that RTO4_9774 is the major xylose reductase expressed in R. toruloides. The RB-TDNAseq method is described in more detail by Coradetti, S. T., et al., Functional genomics of lipid metabolism in the oleaginous yeast Rhodosporidium toruloides, eLife 7 (2018) doi:10.7554/eLife.321 10, incorporated herein by reference. In order to produce xylose-derived bioproducts (e.g., xylonic acid) that directly compete with native metabolism for xylose found in lignocellulosic biomass hydrolysates at high yields, it was determined that native activity in R. toruloides catabolizing xylose toward cellular growth should be diminished or abolished. As disclosed herein, the inventors identified and successfully deleted RT04_9774 from the R. toruloides genome. Although minimal growth on xylose-containing medium still occurs with this engineered R. toruloides, it is at a much slower pace compared to wild type.

(13) This gene-deletion strain was integrated with a two-step pathway, by addition of XylB and XylC, thereby converting d-xylose into xylonic acid from Caulobacter vibriodes CB15. After medium optimization, near theoretical maximum production of xylonic acid from xylose was obtained.

(14) Data indicates that RT04_9774 is the first step in xylose metabolism in R. toruloides. It was determined that RT04_9774 is likely the major xylose reductase gene acting in R. toruloides based on several pieces of information. Under xylose conditions, RT04_9774 is highly upregulated (more than other putative xylose reductases RT04_13562 and RT04_11882) and RT04_9774 has some sequence similarity to known xylose reductases. Additionally, it has been reported that the purified enzyme has dehydrogenase activity on xylose, arabinose, glyceraldehyde and other carbon sources (Protzko et al. 2019). Lastly, as shown herein, deletion of RT04_9774 was confirmed to slow growth on xylose considerably.

(15) FIG. 1 discloses a pentose utilization pathway in R. toruloides in contact with a xylose-containing source. Pentose sugars and alcohols are converted to D-ribulose-5-phosphate via D-arabinitol dehydrogenases before entering the pentose phosphate pathway.

(16) FIG. 2 shows gene expression, protein expression, and fitness scores for pentose utilization pathway genes (exp means exponential phase; trans means transition phase; stat means stationary phase) (Kim, J., et al., Multi-Omics Driven Metabolic Network Reconstruction and Analysis of Lignocellulosic Carbon Utilization in Rhodosporidium toruloides, Front. Bioeng. Biotechnol. 8, 612832. (2020) doi:10.3389/fbioe.2020.612832). The darker areas indicate more relative transcripts vs the control or reference condition (i.e., for RNA-seq), more absolute peptide counts (i.e., for proteomics), and lesser growth/lower fitness score relative to the time-zero population (i.e., for RB-TDNA-seq) for the experimental conditions listed at the bottom of the three graphs. The protein IDs on the left of the graphs correspond to the same numbers listed in the reaction pathway shown in FIG. 1.

(17) Thus, deletion of the RT04_9774 gene was attempted and successfully completed. The engineered R. toruloides dramatically slowed the pathway to xylose conversion to biomass compared to wild type R. toruloides. While glucose continued to be processed as normal to be converted to biomass, a large percentage of xylose was converted to xylonic acid.

(18) FIG. 3 shows the native metabolic pathway for R. toruloides and the non-native metabolic pathway that is believed to take place when the RT04_9774 gene is deleted from R. toruloides. The non-native metabolic pathway is aided by heterologous gene additions of XylB and XylC. XylB converts D-xylose to D-xylono-1,5.fwdarw.lactone, and XylC converts D-xylono-1,5-lactone to D-Xylonic acid. Depending on pH, xylonate may be present as well (as determined by its pKa). Depicted is the modified xylose pathway of pGAPDH-XylB pTEF1-XylC (i.e., RT04_9774 deletion strain with strong native promoters, pGAPDH and pTEF1 (SEQ ID NO: 6 and 7, respectively, disclosed in FIG. 10), driving high expression of XylB and XylC). It was determined that in order to produce xylonic acid at high yields, the first step of xylose conversion to biomass (i.e., through RT04_9774) should be removed or suppressed. It was determined that deleting the RT04_9774 gene would accomplish that purpose.

(19) As shown in FIG. 3, other bioproducts of interest can be ultimately derived from xylose via the new pathway to xylonic acid.

(20) Engineered microbial hosts disclosed herein can be derived from a Eukaryote microorganism, including yeast, such as a Basidiomycete yeast. The terms cell, microbial cells, and microbes are used interchangeably with the term microorganism. The term host refers not only to the particular subject cell but to the progeny or potential progeny of such a cell. Because certain modifications may occur in succeeding generations due to either mutation or environmental influences, such progeny may not, in fact, be identical to the parent cell, but are still included within the scope of the term as used herein.

(21) In an embodiment, the microbial host is a Rhodosporidium microorganism. It has been reported that these yeast cells are globose, ovoid, or elongate, and that budding is multilateral or polar. Ballistoconidia do not form. Carotenoid pigments are visible and the cultures are pink to orange in color. Some species are heterothallic, and others are self-fertile. See Jos6 Paulo Sampaio, in The Yeasts (Fifth Edition), 2011 (publisher summary).

(22) The genus Rhodosporidium includes, for example, R. toruloides, R. azoricum, R. fluviale, R. lusitaniae, R. babjevae, R. diobovatumn., R. paludigenun, R. sphaerocarpum. and R. krawochvilovae. Such hosts can be transformed to provide an engineered host. R. toruloides, in particular, is an attractive host, as it is compatible with many hydrolysates (i.e., tolerant to various biomass hydrolysate inhibitors), has naturally high concentration of AcCoA used to form lipid droplets (i.e., TAGs) as a form of energy storage that can be exploited for fatty acid-like products and terpenes. Tends to grow well over a wide range medium pHs, is genetically tractable, can consume a wide variety of carbon sources, including p-coumarate from lignin degradation present is biomass hydrolysates.

(23) In an embodiment, the engineered host can be derived from any Basidiomycete organism so long as the Basidiomycete has a gene with 70% or greater sequence identity to RT04_9774 in its genome, such as, for example, 73% or greater, 80% or greater, 90% or greater, or 98% or greater sequence identity to RT04_9774 in its genome. Being derived from in this context means that the organism is subjected to the gene deletion described herein. The engineered host has the gene with 80% or greater, 90% or greater, 95% or greater, or 98% or greater sequence identity to the RT04_9774 gene deleted from its genome. The base Basidiomycete organism from which the engineered organism is derived can be selected from Rhodosporodium and any members thereof that contain the gene with 70% or greater sequence identity to RT04_9774 gene, such as, for example, 73% or greater, 80% or greater, 90% or greater, or 98% or greater sequence identity to RT04_9774 in its genome.

(24) Exemplary methods of engineering of the base organism include, for example, gene deletion or heterologous gene integration via lithium acetate or CRISPR-Cas9-mediated transformations (Otoupal, P. B., et al., Multiplexed CRISPR-Cas9-Based Genome Editing of Rhodosporidium toruloides, MSphere 4 (2019) incorporated herein by reference), or AtMT (Zhuang, X., et al. Monoterpene production by the carotenogenic yeast Rhodosporidium toruloides, Microb. Cell Fact. 18, 54 (2019) incorporated herein by reference.)

(25) Exemplary sources of xylose include a lignocellulosic xylose-containing material, such as are found in various biomass or biomass-derived materials. The lignin of the lignocellulosic material may, e.g., be formed from a combination of one or more monomers, such as a monolignol monomer, a p-coumaryl alcohol or an alkoxyl form thereof (e.g., a methoxylated form, including mono- and di-methoxylated forms), a coniferyl alcohol or an alkoxyl form thereof (e.g., a methoxylated form), a coumaryl alcohol of an alkoxyl form thereof (e.g., a methoxylated form), and a sinapyl alcohol or an alkoxyl form thereof (e.g., a methoxylated form). In other embodiments, lignin or a lignin derivative can be characterized by the presence of one or more aromatic functional groups, such as a p-hydroxyphenyl group, a guaiacyl group, and/or a syringyl group.

(26) Lignin can have different compositions depending on the plant material from which the lignin is derived. Exemplary lignin can include softwood lignin (e.g., derived from softwood and including of from about 25% to about 30% (w/w) of lignin), compression wood lignin (e.g., derived from compression wood and including of from about 35% to about 40% (w/w) of lignin), typical hardwood lignin (e.g., derived from hardwood and including of from about 20% to about 25% (w/w) of lignin), tropical hardwood lignin (e.g., derived from tropical hardwood and including of from about 30% to about 40% (w/w) of lignin), tension wood lignin (e.g., derived from tension wood and including of from about 20% to about 25% (w/w) of lignin), wheat lignin (e.g., derived from wheat, including any useful part of plant, such as the root, leaves, shoots, and/or stems), maize lignin (e.g., derived from maize, including any useful part of plant, such as the root, leaves, shoots, and/or stems; and including of from about 20% to 75% (w/w) of lignin), mixed grasses lignin (e.g., derived from mixed grasses, including any useful part of plant, such as the root, leaves, shoots, and/or stems).

(27) The xylose-containing source can include various monosaccharides other than xylose, such as, e.g., pectin-derived monosaccharides, dextrose, fructose, galactose, glucose, or maltose, oligosaccharides, polysaccharides (e.g., cellulose, hemicellulose, or starch), cellulosic material, fatty acids (e.g., saturated or unsaturated fatty acids), biomass hydrolysates, metabolic intermediates (e.g., acetate, lactate, or succinate), alcohols and sugar alcohols (e.g., ethanol, ethylene glycol, glycerol, inositol, malitol, mannitol, sorbitol, or xylitol), lignin and lignin compounds (as discussed above), plants and plant products (e.g., corn, liquefied corn meal, corn steep liquor (a byproduct of corn wet milling process that contains nutrients leached out of corn during soaking), corn stover, corn fiber, rice straw, woody plants, herbaceous plants, molasses, etc., which can be found in, for example, in the stems, leaves, hulls, husks, and cobs of plants; or in the leaves, branches, and wood of trees), herbaceous material, agricultural residues, forestry residues, municipal solid wastes, waste paper, as well as pulp and paper mill residues, or mixtures thereof.

(28) In an embodiment, the two enzymes XylB (from Caulobacter vibrioides CB15 encoding D-xylose dehydrogenase) and/or XylC (from Caulobacter vibrioides CB15 encoding D-xylono-1,5-lacoine lactonasc) are introduced and incorporated into the fermentation strain. These can be incorporated at the same time or in a step-wise manner. These enzymes induce xylose catabolism in the process. Sequences for the unoptimized (i.e., native Caulobacter vibrioides CB15 sequences) XylB and XylC are disclosed in FIG. 8 as SEQ ID NOs: 2 and 3, respectively.

(29) After successful deletion of RT04_9774 from the yeast to make an engineered host, codon-optimized sequences of XylB (Uniprot ID: Q9A9Z0) and XylC (Uniprot ID: Q9A9Z1) from the bacterium Caulobacter vibrioides CB15 were integrated onto the R. toruloides genome via agrobacterium-mediated transformation (i.e., randomly inserted throughout the genome with varying copy number. This can be performed as described in in Zhuang, X., et al., Monoterpene production by the carotenogenic yeast Rhodosporidium toruloides, Microb. Cell Fact. 18, 54 (2019) incorporated herein by reference).

(30) After integration of heterologous XylB and XylC into R. toruloides, individual transformants were screened for xylonic acid titers in a lignocellulosic hydrolysate described in Chen, et al., DMR (deacetylation and mechanical refining) processing of corn stover achieves high monomeric sugar concentrations (230 g L.sup.1) during enzymatic hydrolysis and high ethanol concentrations (>10% v/v) during fermentation without hydrolysate purification or concentration, Energy Environ. Sci. 9, 1237-1245 (2016). doi:10.1039/C5EE03718B.

(31) In an embodiment, the xylose-derived product, xylonic acid or xylonate, may be excreted from R. toruloides into the hydrolysate supernatant and was measured by HPLC using a BioRad Aminex 87-C column at 0.6 mL/min with water as the eluant and quantified with a refractive index detector with peak areas converted to concentrations using an external standard curve of known xylonate concentrations.

(32) In an embodiment, large scale processing can involve vessels on the order or thousands of liters and will utilize a method of cell separation coupled to purification and crystallization of xylonate by means of ion-exchange resins, activated charcoal, pH adjustment, chromatographic fractionation, liquid-liquid extraction, precipitation, or a combination thereof.

(33) In an embodiment, the fermentation broth has a pH of 2 to 7.5, such as about 5 to about 7, or about 5.5 to about 6. Buffers may be added to the broth to maintain the pH in these ranges. It was determined that the engineered organism works best in these ranges.

(34) In accordance with methods disclosed herein, yields were obtained near theoretical yield levels, such as 80% to 99%, 85% to 98%, or 90% to 96% by weight of theoretical yield of xylonic acid, xylonate, or a combination of these.

(35) In an embodiment, to further optimize the process and materials for increasing yield of the xylose derived product, additional steps can be taken. For example, the XylB and XylC enzymes can be codon optimized for the engineered host. The sequences for codon-optimized XylB and XylC are disclosed in FIG. 9 as SEQ ID NOS. 4 and 5, respectively. Codon optimization was performed using a R. toruloides-specific codon usage table that tallied the frequency of codon usage for all protein-encoding sequences in the genome. Using this table, XylB and XylC were codon optimized by choosing the most frequently used codons for each of the amino acids present in XylB and XylC.

(36) In an embodiment, the biomass hydrolysate is nitrogen deficient and is supplemented with a nitrogen source. Two sources, for example, urea and ammonium sulfate are used in culturing the R. toruloides and, upon assimilation, the pH typically increases and decreases, respectively. Therefore, when producing an acidic product (e.g., xylonic acid), addition of urea to the biomass hydrolysate provides the nitrogen while also acting as a buffer to the acidic product. This increases yields because the fermentation is able to reach complete sugar utilization within growth-permitting pH range. Similar results can likely be achieved by addition of another base coupled with a pH-neutral nitrogen source such as yeast extract. Such nitrogen sources coupled with buffers or other pH control mechanism should reach relatively high titers.

EXAMPLES

Example 1: Xylose-Containing Source Material

(37) Corn stover (INL LOT #6) from Hurley County, South Dakota was processed by the method disclosed in Chen, et al., DMR (deacetylation and mechanical refining) processing of corn stover achieves high monomeric sugar concentrations (230 g L.sup.1) during enzymatic hydrolysis and high ethanol concentrations (>10% v/v) during fermentation without hydrolysate purification or concentration, Energy Environ. Sci. 9, 1237-1245 (2016). doi:10.1039/C5EE03718B, incorporated herein by reference. This resulted in deacetylated mechanically refined corn stover hydrolysate starting material with a high monomeric sugar concentration: 160 g/L glucose and 80 g/L xylose.

Example 2: Engineered Host

(38) Rhodosporidium toruloides strain IFO 0880 (a.k.a. NBRC 0880) was obtained from the Biological Resource Center, NITE (NBRC), Japan. An R. toruloides was engineered to remove the RT04_9774 gene by homologous recombination (i.e., full deletion mutant) achieved by transforming R. toruloides with linearized DNA by a lithium acetate transformation protocol as described in (Otoupal et al., 2019). The linearized DNA was composed of a gene sequence encoding resistance to a fungal antibiotic, G418, flanked by 45 bp homology arms to RT04_9774. DNA oligos used to create this linear DNA fragment were:

(39) TABLE-US-00001 (SEQIDNO:8) 5- 9774.LHF.F CCCGCTCGCTCGCTGAAAAAGTGCGCTGGGGCTG CTTGATCGATGtcgctcgtcttgttt-3 (SEQIDNO:9) 5- 9774.RHF.R TCTCGACGGGCCTCTCCTCGCTCTCACGTCTCCC AAACTCGCCCAgagccgacggagaac-3

(40) After integration of the linear DNA, transformants were screened for the deletion of RT04_9774 using primers:

(41) TABLE-US-00002 (SEQIDNO:10) 5TGAGCGTGTCGAGCTTCGCGACGTTCGGTA LHF.162B.F2 3 (SEQIDNO:11) 5AGCGGGTCAGTGAGCGGGTCTGGTGGG LHF.162B.R2 3 (SEQIDNO:12) 5tcgcgcgcccacttgtagccgtagaggtc LHF2.162B.R2 3

(42) The engineered R. toruloides with RT04_9774 gene deletion was further modified with R. toruloides native promoters for expressing XylB and XylC, pGAPDH-XylB and pTEF1-XylC (SEQ ID NOs: 4 and 5) (i.e., engineered strain with strong native promoters, pGAPDH & pTEF1 (SEQ ID NOs: 6 and 7), driving high expression of XylB and XylC) and was then grown in batch cultures of DMR biomass hydrolysate (i.e., corn stover hydrolysate) of Example 1.

Example 3: Experiments with Engineered Host and Xylose-containing Source Material and Comparisons

(43) A comparison test of the engineered host of Example 2 versus the wild-type R. toruloides was performed by comparing the growth of wild-type R. toruloides versus Example 2 on xylose minimal medium.

(44) The full recipe for the xylonate titers presented here was: DMR hydrolysate (160 g/L glucose+80 g/L xylose) 9 g/L urea 100 M FeSO4 400 g/L thiamine hydrochloride 400 g/L pyridoxine hydrochloride 1 mM Na.sub.2SO.sub.4 120 mM KH.sub.2PO.sub.4 80 mM K.sub.2HPO.sub.4; final medium pH 6

(45) FIG. 4 shows the growth over time. OD 600 is a measure of biomass concentration via absorbance of light at 600 nm. (The engineered host of Example 2 is denoted as KO 9774 on FIG. 4.)

(46) After some minor medium optimization, including switching the nitrogen source from ammonium sulfate to urea, titers of 86 g/L xylonic acid were achieved at 96% of the maximum theoretical yield from xylose present in the DMR source. When producing an acidic product (e.g., xylonic acid), addition of urea to biomass hydrolysate provides the necessary nitrogen while also acting as a buffer to the acidic product. This increases yields because the fermentation is able to reach complete sugar utilization within growth-permitting pH range. FIG. 5 shows the effect of addition of urea to DMR to improve xylonic acid titers.

(47) Finally, FIG. 6 shows the productivity of a top xylonic acid-producing strain of Example 2 on the DMR source of Example 1. Again, the engineered host here is the R. toruloides with 9774 deleted gene from Example 2. Samples were taken periodically throughout the culture to measure increasing xylonate titers. R. toruloides undergoes diauxic growth, preferentially consuming glucose first, then xylose. This is reflected in FIG. 6 with low rates of xylonate productivity until 96h (while mainly glucose is consumed), followed by a sharp increase in productivity>96h (while mainly xylose is consumed). Since only xylose can be converted to xylonate, FIG. 6 indicates that glucose in the culture is converted solely to biomass for approximately the first 96h, and after 96 h, the same biomass in the culture converts nearly all the xylose to xylonate or xylonic acid.

(48) All publications, patents, patent applications, and accession no. entries mentioned in this specification are incorporated herein by reference to the same extent as if each independent publication or patent application was specifically and individually indicated to be incorporated by reference.

(49) What has been described above includes examples of one or more embodiments. It is, of course, not possible to describe every conceivable modification and alteration of the above devices or methodologies for purposes of describing the aforementioned aspects, but one of ordinary skill in the art can recognize that many further modifications and permutations of various aspects are possible. Accordingly, the described aspects are intended to embrace all such alterations, modifications, and variations that fall within the spirit and scope of the appended claims. Furthermore, to the extent that the term includes is used in either the detailed description or the claims, such term is intended to be inclusive in a manner similar to the term comprising as comprising is interpreted when employed as a transitional word in a claim. The term consisting essentially as used herein means the specified materials or steps and those that do not materially affect the basic and novel characteristics of the material or method. Unless the context indicates otherwise, all percentages and averages are by weight. If not specified above, the properties mentioned herein may be determined by applicable ASTM standards, or if an ASTM standard does not exist for the property, the most commonly used standard known by those of skill in the art may be used. The articles a, an, and the should be interpreted to mean one or more unless the context indicates the contrary.