PSEUDOMONAS RECOMBINANT PROTEIN EXPRESSION SYSTEM
20260085338 ยท 2026-03-26
Inventors
Cpc classification
C12N9/127
CHEMISTRY; METALLURGY
C12N2830/002
CHEMISTRY; METALLURGY
C12Y207/07048
CHEMISTRY; METALLURGY
International classification
Abstract
The invention relates to a Pseudomonas sp. strain for use in the production of a recombinant protein characterised in that said strain comprises a nucleotide sequence encoding a phi15 RNA polymerase. The invention further relates to a plasmid, capable of integrating or replicating in Pseudomonas sp., comprising a phi15 promoter sequence operably linked to a nucleotide comprising one or more restriction sites for the insertion of a nucleotide sequence encoding a recombinant protein, or operably linked to a nucleotide sequence encoding a recombinant protein.
Claims
1-35. (canceled)
36. A Pseudomonas sp. strain comprising a nucleotide sequence encoding a phi15 RNA polymerase.
37. The Pseudomonas sp. strain according to claim 36, wherein the phi15 RNA polymerase is under control of an inducible promoter.
38. The Pseudomonas sp. strain according to claim 37, wherein the inducible promoter is XylS/pM promoter/regulator.
39. The Pseudomonas sp. strain according to claim 36, wherein the phi15 RNA polymerase has a protein sequence of accession number YP_004286187.1.
40. The Pseudomonas sp. strain according to claim 39, wherein the phi15 RNA polymerase comprises a R630S mutation relative to the protein sequence of accession number YP 004286187.1.
41. The Pseudomonas sp. strain according to claim 37, wherein the inducible promoter is XylS/pM promoter/regulator.
42. The Pseudomonas sp. strain according to claim 36, wherein the nucleotide sequence encoding the phi15 RNA polymerase is integrated into the genome of the Pseudomonas sp. strain.
43. The Pseudomonas sp. strain according to claim 42, wherein the nucleotide sequence encoding the phi15 RNA polymerase is integrated in a PP13 (gyrB) locus of the Pseudomonas sp. strain.
44. The Pseudomonas sp. strain according to claim 36, wherein the Pseudomonas sp. strain is Pseudomonas putida.
45. The Pseudomonas sp. strain according to claim 36, wherein the strain comprises a weak ribosome binding sequence selected from SEQ ID NO: 1 or SEQ ID NO: 2.
46. The Pseudomonas sp. strain according to claim 36, further comprising a nucleotide sequence encoding a phi15 lysozyme.
47. The Pseudomonas sp. strain according to claim 46, wherein the nucleotide sequence encoding the phi15 lysozyme is integrated into the genome of the Pseudomonas sp. strain.
48. The Pseudomonas sp. strain according to claim 47, wherein the phi15 lysozyme is integrated in a PP4305 locus of the genome of Pseudomonas putida strain KT2440.
49. The Pseudomonas sp. strain according to claim 46, wherein the phi15 lysozyme is comprised in a plasmid vector.
50. The Pseudomonas sp. strain according to claim 46, wherein the phi15 lysozyme is under control of an inducible promoter comprising a RhaRS/P.sub.rhaBAD promotor/regulator.
51. The Pseudomonas sp. strain according to claim 46, wherein the phi15 lysozyme is under control of a constitutive promoter comprising p14c.
52. The Pseudomonas sp. strain according to claim 46, wherein the phi15 lysozyme has a protein sequence of accession number YP_004286199.1 or has a G3RQ mutation relative to the protein sequence of accession number YP_004286199.1, wherein glycine at position 3 is replaced by the dipeptide arginine-glutamine.
53. The Pseudomonas sp. strain according to claim 46, wherein the phi15 lysozyme sequence comprises a BCD22 ribosome binding site.
54. The Pseudomonas sp. strain according to claim 46, further comprising a nucleotide sequence encoding a phi15 GP16 RNA polymerase inhibitor having the sequence of accession number YP_004286194.1.
55. The Pseudomonas sp. strain according to claim 36, further comprising a plasmid capable of integrating or replicating in the Pseudomonas sp. strain, the plasmid comprising a phi15 promoter sequence operably linked to: a nucleotide comprising one or more restriction sites for insertion of a nucleotide sequence encoding a recombinant protein; or a nucleotide sequence encoding the recombinant protein.
56. A method of producing a recombinant protein, the method comprising administering an agent that induces transcription and translation of the phi15 RNA polymerase to the Pseudomonas sp. strain of claim 55 comprising the nucleotide sequence encoding the recombinant protein.
Description
DETAILED DESCRIPTION
Figure Legends
[0071]
[0072] The T7 RNAP is stably integrated into the host genome with an IPTG-inducible expression cassette. In the absence of IPTG, the system is considered off, while upon addition of IPTG, usually 0.1-1 mM IPTG, the T7 RNAP is expressed from the LacI/Plac system. The T7 RNAP drives expression of a gene of interest, here depicted as an msfGFP, from its putative T7 promoter on any pET vector. To express toxic proteins, alternative hosts are available, carrying the pLys vector for expression of the T7 lysozyme, which inhibits transcriptional activity of the T7 RNAP in uninduced conditions. IPTG: isopropyl--D-thiogalactopyranoside, T7 RNAP: T7 RNA polymerase, msfGFP: monomeric superfolder green fluorescent protein.
[0073]
[0076]
[0080]
[0081] All 25 combinations of RNAPs and Phage promoter-msfGFP reporter constructs were introduced in P. putida KT2440 and induced with 0.3 mM 3 mBz overnight. The fluorescent intensity was normalized for the OD and expressed as an equivalent 5(6)-FAM concentration (nM). Values represent the mean normalized fluorescence intensity after overnight induction of four biological replicates.
[0082]
[0083] Confirmed promoter regions of the T7 promoter and 5 UTR, namely the AT-rich recognition loop, specificity loop, unwinding region, Shine-Dalgarno sequence, and start codon, are projected on the promoters of the other phages.
[0084]
[0087]
[0091]
[0092] For T7-like phages T7, phi15, PPPL-1, Pf-10 and 67PfluR64PP, their confirmed promoter was paired with different 5UTRs: 1) the full 5UTR of the corresponding phage's major capsid protein (MCP), 2) the standardized UTR BCD2, linked to the promoter by GGGCAG, 3) BCD2, linked to the promoter by the first two nucleotides of the corresponding phage's MCP and GCAG, 4) BCD2, linked to the promoter by the first thirteen nucleotides of the corresponding phage's MCP and GCAG. The combinations were cloned into pBGDes and introduced in P. putida KT2440 together with pSTDes3 carrying the corresponding phage RNAP. Bars represent the mean fluorescent intensity of four biological replicates after 6 h of induction with 0.3 3 mBz, expressed as equivalent 5(6)-FAM concentration and normalized for OD.sub.600. Error bars represent the standard error.
[0093]
[0094] Based on this tree, the phages can be subdivided into eleven different clades, indicated by different lines.
[0095]
[0099]
[0103]
[0107]
[0108] P. putida strains pA0RA0 (T7 (lys)) and pA0RA0LA0 (T7 (+lys)) were induced with 0-20 mM Rha for 12 h. Bars and error bars represent the mean 5(6)-FAM/OD.sub.600 value and standard error of three technical replicates.
[0109]
[0110] P. putida strains pXRXLX (negative control) and pB0RB0LB0 (phi15) were induced with 0-100 mM Rha for 12 h. Bars and error bars represent the mean 5(6)-FAM/OD.sub.600 value and standard error of four biological replicates.
[0111]
[0115]
[0118]
[0119] The performance of five different expression systems (XyIS/Pm, AraC/ParaBAD, RhaRS/PrhaBAD, LacI/PlacUV5 and aresponsive riboswitch) was evaluated while expressing either msfgfp (RNAP) or phi15rnap (+RNAP) in LB medium and M9 minimal medium with different inducer concentrations. When phi15rnap was cloned under control of the expression system, an additional reporter construct with Pphi15 and msfgfp was introduced in the cell. All samples were grown to OD.sub.6000.1 before induction with the relevant inducer concentration. Induced samples were incubated for 12 h before endpoint measurements of OD.sub.600 and fluorescence were performed. Bars and error bars indicated the mean normalized fluorescence (5(6)-FAM/OD.sub.600) and standard error of four biological replicates. Fold induction (FI) represents the ratio of the maximal and minimum msfGFP output.
[0120]
[0124]
[0127]
[0131]
[0132] Fluorescence intensity assay to analyze the growth-decoupling effect of different phage ORFs on P. putida. P. putida strains pB0RB0GD0 (negative control), pB0RB0GD1 (LUZ24 gp9 (Igy)), pB0RB0GD2 (LUZ19 gp28 (Rac)) and pB0RB0GD3 (phi15 gp16) were induced with 10 mM Rha and 0.3 mM 3 mBz at OD 600 0.1, after which the fluorescence intensity and cell growth is monitored every half hour for 12 h. Datapoints represent the mean OD.sub.600 values (top) and mean 5(6)-FAM/OD.sub.600 values (bottom) of four biological replicates. Error bars represent the standard error.
[0133]
[0134] The phi15 lysozyme (G3RQ) reduces basal expression and improves the dynamic range of the phi15 expression system. P. putida SEM11 without phi15 RNAP (NC), with the phi15 RNAP in PP13 with either RBS-C(RBS-C-lys) or RBS-D (RBS-Dlys) and with the phi15 lysozyme (G3RQ) in locus PP4305 or PP5388 (RBS-D+lys (PP4,305) and RBS-D+lys (PP5,388) were induced with 0.3 mM 3 mBz at OD 600 0.1, after which the fluorescence intensity and cell growth is monitored every half hour for 12 h. Datapoints and error bars represent the mean OD.sub.600 and 5(6)-FAM/OD.sub.600 values and standard error of four biological replicates.
[0135]
[0136]
[0137] All optimization steps to create vector pPUT. P. putida SEM11 P15 strains with pBGDes.P.sub.phi15-msfgfp, pBGDes.LUZ7T50-P.sub.phi15-msfgfp, pBGDes.P.sub.phi15-BCD05-msfgfp, pBGDes. Pphi15-msfgfp-phi15T5-phi15T1 and pPUT.msfGFP (top to bottom) were induced with 0.3 mM 3 mBz at OD.sub.6000.1, after which the fluorescence intensity and cell growth is monitored every half hour for 12 h. Datapoints and error bars represent the mean and standard error of 5(6)-FAM/OD.sub.600 values of four biological replicates. Fold induction (FI) represents the ratio of 5(6)-FAM/OD.sub.600 levels with and without induction
[0138]
[0139] Fluorescence intensity assay to analyze the effect of plasmid copy number of P.sub.phi15,MCP-msfGFP on cell growth and fluorescence intensity in P. putida. P. putida strains pB0RB0 (pSTDesX), G1pB0 (PP13pBGDes), G1pB0v2 (PP13-pSEVA621), G2pB0 (PP5,322), G2pB0v2 (PP5,322-pSEVA621), G3pB0 (PP5,042), G3pB0v2 (PP5,042-pSEVA621), G3pB0v3 (PP5,042-pSEVA631) and G3pB0v5 (PP5,042-pSEVA651) were induced with 0.3 mM 3 mBz at OD.sub.6000.1, after which the fluorescence intensity and cell growth is monitored every half hour for 12 h. Datapoints represent the mean OD.sub.600 values (top), mean 5(6)-FAM values (middle) and mean 5(6)-FAM/OD.sub.600 values (bottom) of four biological replicates. Error bars represent the standard error.
[0140]
[0143]
[0147]
[0152] Despite the widespread applications of the T7 transcriptional machinery in E. coli, its implementation in the Pseudomonas species has remained restricted due to the troublesome cytotoxicity of the T7 RNAP in this genus, as observed in this study as well. In the present invention, we mined four viral RNAPs from T7-related Pseudomonas phages, phi15, PPPL-1, Pf-10, and 67PfluR64PP, of which none impacted the fitness of SynBio host P. putida. In addition, these RNAPs displayed a broad range of transcriptional activity, a high level of orthogonality towards each other, and orthogonality to the host RNAP. This is in contrast to minor T7 promoter recognition that was observed for the host machinery. Two of the phage RNAPS, phi15 and PPPL-1 RNAP, also showed significant activity in P. aeruginosa, while no transcriptional activity was observed from the Pf-10 and 67PfluR64PP RNAPs in this host. The reason for this inactivity remains unclear but could potentially be due to improper expression of the RNAP genes, as they were not codon-optimized to the host.
[0153] Although the T7-like RNAPs did not display the same extremely high transcriptional activity as the T7 RNAP control, this is not considered a disadvantage. Their non-toxicity, full host orthogonality, and more balanced activity allow easier cloning and flexibility toward different experimental setups compared to their T7 counterpart [Kushwaha et al. (2014) Nat. Commun. 6, 7832; Liang et al. (2018) ACS Synth. Biol. 7, 1424-1435]. Furthermore, this mini orthogonal RNAP library enables a considered selection of an RNAP for a specific application, in which phi15 and PPPL-1 RNAP are more suited towards applications that require high-yield of the gene of interest, while Pf-10 and 67PluR64PP RNAP enable more tightly-regulated and balanced expression of toxic intermediates or end products. For example, high amounts of the fluorinase enzyme are required for in vivo biofluorination with P. putida, whereas overexpression of the glycolate oxidase enzyme in P. putida allows efficient ethylene glycol conversion into polyhydroxyalkanoates. On the other hand, tight expression control is preferred for endolysin expression for the controlled cell lysis of putida [Martnez et al. (2011) Microb. Biotechnol. 4, 533-547] and the study of toxic phage proteins in P. aeruginosa [Ceyssens et al. (2020) Viruses 12, 976].
[0154] Furthermore, the orthogonal RNAP library allows the creation of various AND gates, OR gates, and resource allocators. Due to the modularity of the T7-like RNAPs, these enzymes can be split into an enzymatic module and a promoter-recognition module. An AND gate is created by placing the two modules under the control of different inducible promoters and the desired output under the phage promoter, which only yields the output when both inducers are present. In addition, the enzymatic module of one RNAP can be paired with the promoter-recognition module of other phage RNAPs, thus enabling the creation of multiple AND gates in parallel, which all rely on the same core module. This concept was coined as a resource allocator, as the total amount of output solely depends on the core module and does not increase and overburden the cell when multiple promoter-recognition modules are expressed simultaneously. Thirdly, the T7 and phi15 RNAPs can be assembled into an AND gate in combination with the T7 promoter. When either the T7 or the phi15 RNAP are expressed, the desired output will be producedthough in lower amounts by the phi15 RNAP.
[0155] The remarkable transcriptional activity of viral RNAPs often leads to high levels of leaky expression of the gene of interest under uninduced conditions. This was addressed by introducing the corresponding phage lysozymes in the expression hosts, mirroring the proven strategy of the T7 system. While the phage RNAPS showed high specificity towards their native phage promoter, the phage lysozymes proved to be much more promiscuous. Indeed, the Pf-10 lysozyme reduced leakiness from the phi15 RNAP by 84%, whereas the native phi15 lysozyme only showed a 30% reduction in leaky msfGFP expression. These results inspired a directed mutation analysis of the phi15 lysozyme for improved RNAP inhibition, leading to the engineering of the high-performant, non-toxic phi15 lysozyme (G3RQ) mutant. In addition, the performance of the 67PfluR64PP and PPPL-1 lysozymes could be improved to reduce the basal expression from their corresponding RNAPs. Furthermore, the toxicity observed upon overexpression of the phage lysozymes can be alleviated by knocking out the amidase activity of these enzymes, as this activity is the likely source of the observed toxicity. Overall, the present invention provides a set of non-toxic, orthogonal viral RNAPs with well-defined promoter sequences and lysozyme-based RNAP repressors for the Pseudomonas species to expand the SynBio toolbox of this genus and allow the design of a plethora of synthetic genetic circuitry. Further improvements include increased genomic stability with genomic integration of the phage RNAP and an optimized and standardized reporter construct with reliable promoter variants and potent transcriptional terminators.
T7-Like Pseudomonas Phage Genomes Encode Putative RNA Polymerases, Lysozymes, and Phage-Specific Promoters
[0156] Previous work has shown that the T7 RNAP causes significant growth deficits in Pseudomonas cultures upon expression. To reduce this cytotoxicity for Pseudomonas, one could employ two strategies: (1) optimize the T7 RNAP with directed evolution for Pseudomonas or (2) identify novel and optimized phage RNAPs from Pseudomonas phages. In the present invention, the latter option was chosen and focused on exploring the existing diversity of RNAPs among Pseudomonas phages for reduced cytotoxicity and increased transcriptional activity. While all Autographiviridae phages typically encode a viral RNAP, our analysis focused on T7-like phages, as they generally encode a small, single-subunit RNAP with clearly delineated promoter recognition sequences. To date, 36 T7-like Pseudomonas phages have been isolated and fully sequenced (
Screening Non-Toxic Phage RNA Polymerases and their Transcriptional Activity
[0157] First, the four phage RNAPs were screened for low cytotoxicity in P. putida and P. aeruginosa, compared to the T7 reference model. As the Pseudomonas phages co-evolved with their host, their early-expressed RNAP would have prime efficient production of viral particles and not trigger the host's toxicity. To confirm this, the RNAP from the selected Pseudomonas phages, Pf-10, phi15, PPPL-1, and 67PfluR64PP, were cloned into pSTDesX, introduced in either P. putida or P. aeruginosa and induced with 1 mM 3 mBz from the XyIS/Pm expression system. This expression system is considered the golden standard for P. putida and has successfully driven T7 RNAP expression in previous research to circumvent LacI-related regulatory issues in Pseudomonas [Herrero et al. cited above, Beentjes et al. cited above]. As anticipated, the T7-like RNAPs did not significantly reduce the final OD.sub.600 of the host after 12 h of induction, with the exception of some limited growth reduction induced by the expression of the 67PfluR64PP RNAP in P. aeruginosa (Tukey HSD, p<0.001) (
[0158] To include the T7 RNAP as a positive control in further assays, its inducer concentration is reduced from 1 mM to 0.3 mM 3 mBz in subsequent experiments to limit the toxic effect. Next, the transcriptional activity of the RNAPs was assessed indirectly by measuring the level of the msfGFP (monomeric superfolder green fluorescent protein) fluorescence from a phage promoter-msfGFP reporter construct. The predicted phage promoters and 5 untranslated regions (UTRs) from the phages' major capsid protein (MCP) are shown in
[0159] Next, all of the phage RNAPs were introduced in the corresponding reporter strains, and msfGFP expression was monitored for 12 h in the absence and presence of 0.3 mM of a 3 mBz inducer. All of the tested phage RNAPs displayed significant transcriptional activity in P. putida after 12 h of induction (pairwise Wilcoxon, p<0.001), whereas only T7, phi15, and PPPL-1 RNAP produced significant msfGFPs in P. aeruginosa (pairwise Student's t-test, p<0.05 (T7, phi15) and p>0.05 (PPPL-1); individual Student's t-tests for PPPL-1 vs. NC, p<0.05) (
[0160] Looking back at the MCP promoter region of the phages (
Phages Phi15, PPPL-1, Pf-10, and 67PfluR64PP Encode Short, 17 bp Promoters
[0161] The T7 promoter is a well-characterized 17 bp sequence with an N-terminal AT-rich recognition loop (17-13), a specificity loop of 5 bp (11-7), and an unwinding region (4-1) (
[0162] The capping-RACE experiment confirmed the start sites of the predicted promoters of phi15, PPPL-1, Pf-10, and 67PfluR64PP. Overall, these T7-like promoters showed a canonical length of 17 bp (18 bp for P.sub.pf-10) and two AT-rich regions flanking the presumed recognition loop (
[0163] These standardized bicistronic UTRs are of specific interest for the use of these phage promoters in synthetic circuitry. Indeed, BDC2 and other bicistronic designs have the advantage of circumventing the well-known problem of secondary structure formation between the RBS and the downstream gene of interest, potentially inhibiting proper translation. This allows the user to reliably reuse the expression construct in a standardized design for different genes of interest without the need for individually optimized 5 UTRs for each construct.
T7-Like Phage Lysozymes Inhibit Transcriptional Activity of Their Corresponding Phage RNAP
[0164] Due to the strong transcriptional activity of T7-like phage RNAPs, a limited production of the phage RNAP can rapidly lead to significant expression levels of the reporter gene in uninduced conditions. This observation can also be made for the uninduced P. putida samples from the previous assay, where all strains except the 67PfluR64PP RNAP produced msfGFP in significantly higher concentrations compared to the negative control (Tukey HSD, p<0.05) (
[0165] Next, the inhibitory effect of the lysozymes on the phage RNAP was analyzed in P. putida and P. aeruginosa by introducing the phage lysozyme, RNAP, and phage promoter-msfgGFP reporter construct in the host and monitoring the msfGFP output after induction with 4 mM Rha. Upon the induction of lysozyme expression, all P. putida samples showed a significantly reduced msfGFP output compared to their uninduced counterparts (
T7-Like Phage Lysozymes Efficiently Inhibit Phage RNAPs from Related T7-Like Phages
[0166] The viral RNAP from the phage phi15 resulted in high expression levels in P. putida and P. aeruginosa (
[0167] While the phi15 lysozyme mutants (G3Q), (K5Q), and (K7N,E8K) did not improve the inhibitory activity of the lysozyme (
[0168] The results also indicate that the third position in the amino acid sequence plays an important role in RNAP inhibition and that a charged amino acid (R,Q) is preferred over the small glycine residue in the phi15 lysozyme sequence to create a strong interaction with the phi15 RNAP. These results correspond to previous work where point mutations in the N-terminal region of the T7 lysozyme caused a lack of RNAP inhibition, thus showing that even single point mutations can significantly impact the lysozyme-RNAP interaction [Jeruzalmi et al. (1998) EMBO 35 J. 17, 4101-4113]. Lastly, it can be noted that there are also large differences in the msfGFP output between the strains in the uninduced condition (
Flow Cytometry-Based Quantitative Assessment of the Phi15 Expression System
[0169] The phi15 RNAP and phi15 lysozyme (G3RQ) form a stringent expression system in P. putida and P. aeruginosa together with the phi15 promoter (
TABLE-US-00002 TABLE 1 Flow cytometry data of the phi15 expression system in P. putida and P. aeruginosa. Wild-type P. putida KT2440 and P. aeruginosa PAO1 strains (wild-types), P. putida and P. aeruginosa with the phi15 RNAP, phi15 reporter construct, and phi15 lysozyme (phi15), and P. putida and P. aeruginosa with the phi15 RNAP, phi15 reporter construct, and phi15 lysozyme (G3RQ) mutant (phi15(G3RQ)) were induced overnight with 5 mM Rha (+lys) or 0.3 mM 3mBz (+RNAP), after which 5000 cells were analysed with flow cytometry for FITC-A, as described in the methods' section. Cells with a FITC-A level above 10.sup.4 are considered induced, whereas cells below 10.sup.4 are uninduced. Column FITC-A depicts the median FITC-A value of the entire cell population, and column induced (%) depicts the percentage of cells of the entire population that have a FITC-A value above 10.sup.4. Complete histograms of the corresponding data are available in FIG. 17. P. putida P. putida P. putida Wild-Type phi15 phi15 (G3RQ) Induced Induced Induced FITC-A (%) FITC-A (%) FITC-A (%) RNAP +lys 44 0.16 17,803 80.00 12,730 66.66 RNAP lys 70 0.12 15,270 74.74 32,128 78.50 +RNAP lys 99 0.30 72,956 95.40 122,739 92.82 Fold 2.25 4.10 9.64 induction* P. aeruginosa P. aeruginosa P. aeruginosa Wild-Type phi15 phi15 (G3RQ) Induced Induced Induced FITC-A (%) FITC-A (%) FITC-A (%) RNAP +lys 647 3.22 33,429 77.52 527 5.94 RNAP lys 692 6.18 7820 47.74 18,672 81.10 +RNAP lys 559 3.22 245,893 90.98 68,392 74.58 Fold 0.86 7.36 129.78 induction* *Fold induction is the ratio of FITC-A of the (RNAP, +lys) sample and the (+RNAP, lys) sample.
[0170] All of the P. putida and P. aeruginosa samples displayed single, homogenous populations, indicating that most of the cells responded to the presence of the inducers in a similar manner, with a limited occurrence of escapers. In addition, the wild-type controls showed very little response to the inducers in terms of the FITC-A (related to msfGFP expression). This allowed us to determine the threshold of the background FITC-A for P. putida and P. aeruginosa in this experiment, which was set at 10.sup.4. The results of the phi15 wild-type and phi15 (G3RQ) strains support the observations made in the previous spectrophotometric data (
Phage Promoters and their Native 5UTR are Co-Evolved to Yield High Expression Levels
[0171] To validate the expression levels of the phage RNAPs and promoters in combination with BCD2, all phage promoters were connected to BCD2 by a GGGCAG linker and cloned together with msfGFP into pBGDes. The GGGCAG linker contains the GCAG position tag required for SEVAtile shuffling and a double G directly following the TSS of the promoter. This is known to be important for proper transcription initiation of the T7 promoter (
[0172] To test this hypothesis, the GGGCAG linker from the previous construct was replaced by the two first nucleotides of the corresponding phage MCP 5UTR followed by GCAG. In this way, all phage promoter-UTR constructs contain four consecutive A/T nucleotides, which will potentially increase the fluorescent output. This trend could indeed be observed for Pf-10 and 67PfluR64PP, but the msfGFP levels still remain about fourfold lower than the levels observed for the full MCP 5UTR (
[0173] When analyzing the MCP 5UTR further, it can be observed that all T7-like phage promoter regions in this paper contain a 13-nt stretch without any thymidine residue directly downstream of the TSS. The conservation of this T-less stretch in diverse T7-like phages could indicate that this region is important for efficient transcription by the phage RNAP. Therefore, the previous linkers are now extended with the thirteen first nucleotides of the corresponding phage's MCP 5UTR to include the T-less stretch. The addition of the T-less stretch has a marked influence on the msfGFP expression levels of Pf-10 and 67PfluR64PP, while the effect on T7, phi15 and PPPL-1 is much less pronounced (
The Transcriptional Machinery of Phage Phi15 Shows Potential as a Phage-Based Expression System for P. putida
[0174] T7-like Pseudomonas phage phi15 encodes a single-subunit RNAP which generates high levels of transcription in Pseudomonas hosts from a short, 17 bp promoter (5-TAAAAACCCACACAATA-3) [SEQ ID NO: 5] with a negligible burden on cell fitness. Even with the high transcriptional activity of the phi15 RNAP, high stringency can be obtained by inhibition of the phi15 RNAP by phi15 lysozyme (G3RQ) in uninduced conditions.
[0175] The phi15 transcriptional system has been validated in P. putida KT2440 and P. aeruginosa POA1 in previous work, by combining a genomically-integrated Pphi15-msfgfp reporter construct with vector-borne expression of the RNAP and lysozyme (G3RQ) through the XyIS/Pm and RhaRS/P.sub.rhaBAD systems, respectively (
Balanced, Single-Copy Expression of Phi15 RNAP Improves the Dynamic Range of the System
[0176] The phi15 RNAP amplifies expression levels from traditional expression systems. The phi15 transcriptional system requires expression of phi15 RNAP by a host RNAP-driven expression system. The choice for a specific system is not trivial, as it will determine the homogeneity, stringency, dose-response and maximal expression levels of our final phi15-based expression system. As such, five different expression systems (XyIS/Pm, AraC/ParaBAD, RhaRS/PrhaBAD, LacI/PlacUV5 and anresponsive riboswitch) were selected to drive phi15 RNAP expression in P. putida KT2440 and analyzed in different conditions, namely rich LB medium and M9 minimal medium with five different inducer concentrations relevant to each system. The phi15 RNAP will then on its turn initiate msfGFP expression from the phi15 promoter. For comparison, control constructs where the expression systems directly drive msfGFP expression instead of phi15 RNAP were constructed and analyzed in parallel.
[0177] Overall, the results show that phi15 RNAP is successfully expressed from all five selected systems and increases the fluorescent output of the system compared to the corresponding msfGFP control (
Stable Genomic Integration of Phi15 RNAP in Pseudomonas putida.
[0178] Due to the exceptional transcriptional activity of phi15 RNAP, small basal amounts of this enzyme immediately result in significant expression of the gene of interest even in uninduced conditions (
[0179] To analyze the performance of these strains, a phi15 reporter construct was introduced into the hosts (Tn7attB::P.sub.phi15-msfgfp) and both the OD.sub.600 and msfGFP output were monitored for 12 h in uninduced and induced conditions (0.3 mM 3 mBz). None of the genomic integrations caused a significant effect on cell fitness in comparison to wildtype P. putida KT2440 and SEM11 (Tukey HSD, P>0.05) (
[0180] Interestingly, all three genomic loci generate a different level of fluorescence intensity upon induction of the phi15 RNAP with 3 mBz. The highest levels can be observed for locus PP13, which is located closest to the origin of replication and yields 344 nM 5(6)-FAM/OD.sub.600, an amount that is almost 50% higher than the pSTDesX-based system (234 nM 5(6)-FAM/OD.sub.600) in P. putida KT2440 (Tukey HSD, P<0.05). It is surprising that a single-copy construct is outperforming the vector-based system in terms of expression levels, which could in part be explained by the reduced cell burden of phi15 RNAP overexpression. Locus PP5322 generates similar fluorescence levels as from the strain carrying pSTDesX.phi15 (226 nM 5(6)-FAM/OD.sub.600), while the levels of locus PP5042 are slightly lower (184 nM 5(6)-FAM/OD.sub.600). Depending on the application, different expression levels of the gene of interest could be desirable and one could prefer a different genomic integration locus. In the P. putida SEM11 host, similar trends can be observed, but this strain shows overall higher expression levels in comparison to his KT2440 counterpart. As such, in this work we will focus our efforts on further optimizing the P. putida SEM11 PP13::phi15rnap strain, as it generates the highest expression levels without metabolic burden on the host (
[0181] However, the initial aim of this experiment was improving the dynamic range and stringency of the system by reducing the copy number of the phi15 RNAP encoding construct, but no major improvements of the fold-induction levels or the basal expression levels were observed upon genomic integration of the phi15 RNAP. Therefore, another strategy was employed, where the RBS driving phi15 RNAP translation was replaced by two weaker variants (RBS-C and RBS-D), accompanied by the alternative GTG startcodon (
Introduction of Phi15 Lysozyme (G3RQ) Results in a Stringent Expression System
[0182] The genomic integration of phi15 RNAP in combination with a degenerate RBS and GTG startcodon already reduced leakiness of the system significantly and resulted in a higher dynamic range (
[0183] Upon integration of the phi15 lysozyme (G3RQ) in PP4305 or PP5388, the dynamic range of the system increased from 33 to 107- and 70-fold, respectively. Furthermore, the basal expression levels of these strains were indistinguishable from the negative control (Tukey HSD, P<0.05), showing that the phi15 lysozyme (G3RQ) significantly improves the tightness of the phi15 expression system. Due to the continuous expression of the phi15 lysozyme (G3RQ), also a reduction of expression levels in the induced state are observed, which are threefold less compared to the strain without lysozyme. As such, we will continue with both the strain without lysozyme (P. putida SEM11 PP0013::phi15rnap (RBS-D)) for non-toxic genes-of-interest and the strain with lysozyme (P. putida SEM11 PP13::phi15rnap (RBS-D) PP4305::phi15lysozyme (G3RQ)) for genes-of-interest or applications requiring tight regulatory control. These strains will further be called P. putida P15 and P. putida P15-L, respectively.
Optimized Expression Vector pPUT Enables High Production Levels of the Gene-of-Interest
[0184] A single-copy expression construct leads to healthy cells and maximal msfGFP output. In order to obtain high yields of the desired protein with minimal cell burden, it is important to integrate the phi15 promoter and gene-of-interest in the optimal genetic background, to ensure proper insulation from its surroundings and avoid the formation of secondary mRNA structures obstructing the RBS from binding to the ribosome. In the previous assays, the msfGFP reporter constructs were always genomically integrated in the host as a single copy. To determine the impact of the copy number on msfGFP production, the reporter construct P.sub.phi15-msfgfp is integrated in identical vectors with different origins of replication: pSEVA621 (RK2low copy number), pSEVA631 (pBBR1medium copy number), pSEVA641 (pR01600/ColE1high copy number) and pSEVA651 (RSF1010high copy number) and compared to the original single-copy construct (
[0185] Overall, the single-copy construct shows the least impact on cell growth, while still enabling very high absolute and normalized msfGFP expression levels. For higher copy number backbones, either no viable cells were obtained or cells showed severely reduced cell growth upon induction, resulting in low absolute msfGFP levels (
Transcriptional Terminators Flanking the Expression Construct Ensure Genetic Insulation and Improve Expression Output.
[0186] Besides the vector copy number, efficient transcription termination and genetic insulation is also known to play a crucial role in circuit performance. Therefore, the expression construct is flanked with upstream and downstream terminators for proper insulation and termination of the phi15 RNAP. Terminator T50 from phage LUZ7 is placed upstream from the expression construct, as it is a strong, bidirectional terminator. It insulates the construct while causing minimal impact on the expression levels of the phi15 reporter construct in comparison to the control construct without additional terminators (
[0187] Within the leader peptide, a second RBS is encoded, which will yield translation of the gene of interest. During translation of the leader peptide, any downstream mRNA structures involving the second RBS are dissolved, thus ensuring efficient translation of the desired gene, a proven and popular concept in synthetic biology. Previous research showed that the phi15 promoter can successfully be combined with the strong bicistronic 5UTR BCD2, but expression levels are below those obtained with the native 5UTR of the phi15 major capsid protein (MCP). Building on this knowledge, we attempted to combine the translational strength of the phage MCP 5UTR with the standardized performance of BCD2 by creating novel BCDs based on the phages' MCP 5UTR sequence. More specifically, we created five different BCDs for the phi15 system by ligating the phi15 promoter, phi15 MCP 5UTR and the first 17 codons of the phi15 MCP gene, in which we introduced the second RBS and linker to the startcodon in five different ways (
[0188] As displayed in
T7 gp2 Homologue Phi15 gp16 Inhibits the Host RNA Polymerase and Allows Growth Decoupling
[0189] In industrial set-ups, the concept of growth-decoupling is gaining popularity as it optimizes the use of resources in two phases, the growth phase and production phase, respectively. In the first phase, all resources go towards cell growth to acquire a healthy cell population. Next, cell growth is blocked and the production of the desired product is started, ensuring maximum use of the resources towards product formation. In E. coli, this concept has successfully been put into practice with the use of T7 gp2, an inhibitor of the host RNA polymerase. To recreate this concept in Pseudomonas, three different phage ORF (open reading frames) were cloned into pSTDesR, namely LUZ24 gp24 (Igy), a DNA gyrase inhibitor of P. aeruginosa, LUZ19 gp28 (Rac), a host RNAP inhibitor in P. aeruginosa and phi15 gp16, a homologue to T7 gp2 and a potential inhibitor of P. putida RNA polymerase. The phage ORFs were paired with phi15 RNAP and phi15 reporter construct in P. putida and the OD.sub.600 and msfGFP output were monitored for 12 h post induction (
Vector Backbone of Expression Vector
[0190] Multiple factors can influence the expression of the construct, such as the plasmid copy number and proper insulation from upstream and downstream sequences. So far, the msfGFP reporter constructs have been genomically integrated in the host as a single copy. To determine the impact of the copy number on msfGFP production, the reporter construct Pphi15, MCP-msfgfp is integrated in identical vectors with different origins of replication: pSEVA621 (RK2-low copy number), pSEVA631 (pBBR1-medium copy number), pSEVA641 (pR01600/ColE1-high copy number) and pSEVA651 (RSF1010-high copy number). When introducing the vectors in P. putida carrying pSTDesX.phi15RNAP none of the transformants contained the desired vector. This result is in line with the work of several other research groups, who did not succeed to support both a T7-like phage RNAP and the corresponding promoter on DNA vectors. Therefore, we attempted to introduce the vectors in P. putida where the phi15 RNAP is genomically integrated in PP13, PP5322 and PP5042, respectively. All of the strains were able to tolerate and replicate pSEVA621.Pphi15, MCP-msfGFP, while no transformants were obtained for the pSEVA641 backbone. Furthermore, only P. putida PP5042::phi15rnap was electroporated successfully with pSEVA631. Pphi15, MCP-msfGFP and pSEVA651. Pphi15, MCP-msfGFP.
[0191] The OD.sub.600 and fluorescence intensity of all obtained transformants were measured for 12 h after induction with 0.3 mM 3 mBz and displayed in
Upstream Terminator
[0192] Nine strong, validated terminators of phages LUZ7 and LUZ100 were screened as potential upstream insulators of the expression construct. All terminators were individually placed directly upstream of the phi15 promoter driving msfGFP expression. Upon integration of the reporter constructs in the host' Tn7 attB site, the basal fluorescence level of the resulting strains was measured in absence of the phi15 RNAP, to assess potential readthrough of neighboring sequences. As a negative control, a reporter construct without upstream terminator and the P. putida KT2440 wildtype strain were included in the assay. The constructs with terminators LUZ7 T7 and LUZ7 T60 showed a msfGFP output that was significantly higher than the wildtype strain (Tukey HSD, P<0.05) (Error! Reference source not found.28A). It is unclear whether this increased msfGFP level is caused by the terminator sequence itself or another factor, but nevertheless these two terminators will not be considered as upstream insulators.
[0193] Apart from the basal fluorescence level, we confirmed that the tested terminators did not impact the msfGFP expression levels upon induction of the phi15 RNAP (Error! Reference source not found.28B). After introduction of the phi15 RNAP on pSTDesX, the msfGFP levels of all strains were monitored in induced and uninduced conditions. None of the terminators showed a significant impact on msfGFP output in comparison to a terminatorless control, except for LUZ100 T6 (Tukey HSD, P<0.05). Based on these results, terminator LUZ7 T50 is selected as an upstream insulator, as it does not influence the performance of the expression system and has been characterized as strong, bidirectional terminator.
BCD Design
[0194] Building on this knowledge, we attempted to combine the translational strength of the phage MCP 5UTR with the standardized performance of BCD2 by creating novel BCDs based on the phages' MCP 5UTR sequence. More specifically, we created five different BCDs for the phi15 system by ligating the phi15 promoter, phi15 MCP 5UTR and the first 17 codons of the phi15 MCP gene, in which we introduced the second RBS and linker to the startcodon in five different ways (
[0195] As displayed in
Downstream Terminator
[0196] Efficient transcription termination is known to play a crucial role in circuit performance. Therefore, eleven phage terminators were screened for efficient transcription termination of the phi15 RNAP using the SEVAtile terminator trap (Error! Reference source not found). In this trap, a terminator is placed in between msfGFP and mCherry, such that low mCherry are indicative for transcriptional termination, while the msfGFP output can be related to increased or decreased mRNA stability by the terminator sequence. The terminator efficiency of all tested terminators was significantly higher than the terminator-less control construct (P<0.05) (Error! Reference source not found). Moreover, terminators phi15 T1 and phi15 T5 outperformed all other terminators with an efficiency of 96.1% and 94.5%, respectively. Interestingly, not only was the normalized mCherry level of the phi15 T1 sample 15-fold lower than the control, the msfGFP levels were also twice as high compared to the control (Error! Reference source not found).
[0197] To increase the termination even more, terminators phi15 T1 and phi15 T5 were placed in tandem in both possible orders. For the phi15 T5+T1 construct, a terminator efficiency of 99.5% was observed, which was 2% higher than the phi15 T1+T5 combination. As such, the terminator pair phi15 T5+T1 is selected for placement downstream of the reporter construct, to efficiently terminate the phi15 RNAP.
EXAMPLES
Example 1. Materials and Methods
Bacteriophage Genomes
[0198] All bacteriophage sequences used in the present invention originated from phages that were isolated, sequenced, and annotated in previous research, as shown in Table 2.
TABLE-US-00003 TABLE 2 List of bacteriophage genomes used in the present invention. Bacteriophage Accession Number Reference Phi15 FR823298.1 Cornelissen et al. Pf-10 NC_027292.1 Unpublished PPPL-1 NC_028661.1 Park et al. 67PfluR64PP MH179478.2 Kazimierczak et al. Cornelissen (2011) PLoS ONE 6, e18597; Park et al. (2018) J. Microbiol. Biotechnol. 28, 1542-1546; Kazimierczak et al. (2019) Virol. J. 16, 4.
Bacterial Manipulation
[0199] In this study, two E. coli strains were used for vector cloning purposes, i.e., E. coli TOP10 as a main host and E. coli PIR2 for pBGDes-derived vectors carrying the R6K origin. The characterization and optimization of phage-based elements were performed in P. putida KT2440 or P. aeruginosa PAO1. All strains were cultured overnight in a sterile LB medium or LB agar, supplemented with antibiotics as required: Amp.sup.100, Kan.sup.50, Gm.sup.10 (E. coli and P. putida) or Gm.sup.30 (P. aeruginosa), Tc.sup.10 (E. coli and P. putida) or Tc.sup.60 (P. aeruginosa), and Sp.sup.50 and Sm.sup.200. E. coli and P. aeruginosa were incubated at 37 C., whereas P. putida was standardly incubated at 30 C. Plasmid vectors were introduced in all strains by transformation. E. coli was transformed using rubidium chloride, whereas P. putida and P. aeruginosa were electroporated. The pBGDes vectors were always co-electroporated with a helper plasmid, pTNS2, to ensure genomic integration of pBGDes in the Tn7 attB site of the host.
Vector Construction
[0200] To screen the selected phage RNAPs, promoters, and lysozymes to create a tailored pET system for P. putida, the SEVAtile vector set was used, which enables rapid and standardized assembly of genetic circuits. As a positive control, the T7-based pET system was recreated with the SEVAtile vectors in P. putida and P. aeruginosa, as shown previously, with the T7 RNAP in pSTDesX, the T7 lysozyme in pSTDesR, and a reporter construct with P.sub.T7,MCP-msfGFP integrated into the Tn7 attB site using pBGDes. To screen phage RNAPs, promoters, and lysozymes from T7-related phages in a similar setup, all necessary vectors were assembled using SEVAtile-shuffling by first amplifying the phage-encode parts with a tail-PCR to add the required overhangs for SEVAtile-shuffling. Gibson assembly was used for vector assembly in case the phage genes contained one or multiple BsaI recognition sites. Assembled vectors were introduced in E. coli TOP10 or E. coli PIR2 for pBGDes-derived vectors, and the correct insertion of phage-encoded genes was verified by Sanger sequencing (Eurofins Genomics, Ebersberg, Germany).
Toxicity Evaluation by Growth Curve Monitoring
[0201] To assess the potential cytotoxicity of recombinantly expressed phage RNAPs and lysozymes on P. putida and P. aeruginosa, 12 h growth curves of all relevant cultures were prepared. First, overnight cultures of four biological replicates were diluted 20-fold in a fresh growth medium in a 96-well plate with the appropriate antibiotics and incubated for 3 h while shaking at the appropriate temperature. At this time point, every cell culture was split in an uninduced and induced fraction by adding the appropriate inducer to the latter. For RNAP toxicity, a final concentration of 1 mM 3-methylbenzoate (3-mBz) was introduced, while for lysozyme toxicity, 10 mM L-rhamnose was supplied to the culture. Culture plates were directly placed in a CLARIOstar Plus Microplate Reader (BMG Labtech, Ortenberg, Germany), where OD.sub.600 measurements were performed every 30 min for a total period of 12 h while incubating at the appropriate temperature with intermittent shaking. The resulting data were corrected for blank values (sterile growth medium) and statistically analyzed using JMP 16 Pro (JMP, Version 16. SAS Institute Inc., Cary, NC, USA, 1989-2021). Multiple comparisons of the mean values were performed on the final timepoint by first confirming the normality of the data for each sample (Shapiro-Wilk test, =0.05), followed by the Tukey HSD (honest significant difference) test, with correction for multiple comparisons (=0.05).
Fluorescence Intensity Assays
[0202] To verify the performance of the phage elements in both P. putida KT2440 and P. aeruginosa PAO1, fluorescent expression assays were performed. Overnight cultures of four biological replicates of P. putida KT2440 or P. aeruginosa PAO1 carrying the appropriate vectors were prepared in an M9 minimal medium containing 1M9 salts (BD Biosciences, Franklin Lakes, NJ, USA), 0.2% citrate (Sigma Aldrich, St. Louis, MO, USA), 2 mM MgSO.sub.4 (Sigma Aldrich), 0.1 mM CaCl.sub.2) (Sigma Aldrich), 0.5% casein amino acids (LabM; Neogen Company, Lansing, MI, USA), and the appropriate antibiotics. Each overnight culture was diluted 20-fold in a fresh M9 medium in a Corning) 96-Well Black Polystyrene Microplate with a Clear Flat Bottom and incubated for 2 h in shaking conditions. At this point, the cell cultures were split in two to create an uninduced and induced sample, to which the required inducer(s) was added. Next, the fluorescence intensity and OD 600 levels were monitored every 30 min for 12 h on a CLARIOstar) Plus Microplate Reader while incubating at 30 C. or 37 C. for P. putida KT2440 or P. aeruginosa PAO1, respectively. The fluorescent intensity of the msfGFP was measured at a 485 nm excitation wavelength and 528 nm emission wavelength with the enhanced dynamic range setting of the apparatus. All relative fluorescent measurements were blank-corrected for a sterile medium and normalized for cell growth by dividing by the corresponding OD.sub.600 value. To convert the relative fluorescence units of the msfGFP to absolute units, a calibration curve was added to each experiment. More specifically, 0, 375, 750, and 1500 nM of 5(6)-carboxyfluorescein (5(6)-FAM) (Sigma Aldrich) in phosphate-buffered saline was added to each plate in duplicate. All (normalized) fluorescent measurements of the msfGFP were subsequently converted to the equivalent 5(6)-FAM concentration. The data were analyzed, visualized, and verified for statistical significance using JMP 16 Pro. Statistical significance assays were performed on the final timepoint by first confirming the normality of the data for each sample (Shapiro-Wilk), followed by an appropriate mean (multiple) comparisons test. In particular, if the data were normally distributed, a (pairwise) Student's t-test (=0.05) was performed, while for non-normally distributed data, a (pairwise) Wilcoxon assay (=0.05) was employed. No corrections for multiple comparisons were made due to large differences in variance between samples, except for the lysozyme optimization assays for inhibition of the phi15 RNAP, where variances were equal (Tukey HSD test, =0.05).
Transcription Start Site Determination with 5-Capping-RACE
[0203] The transcription start site (TSS) of each phage promoter was determined using 5-capping-RACE (Rapid Amplification of cDNA Ends). First, the total RNA fraction of P. putida strains, pA0RA0, pB0RB0, pC0RC0, pD0RD0, and pE0RE0, was harvested as follows. Overnight cultures were diluted 100-fold in a fresh LB medium with appropriate antibiotics and incubated at 30 C. in shaking conditions. Once the cells reached OD.sub.6000.3, cultures were induced with 0.3 mM 3 mBz and incubated for 3 h upon harvesting at OD.sub.600 4. The harvested cells were subjected to hot phenol/lysozyme to extract total RNA, followed by DNase I treatment. Next, CDNA was generated with the primers listed in Table 2. The resulting cDNA products were cloned into pSTEntry with SapI restriction-ligation and transformed to E. coli TOP10. Five transformants of each sample were treated with a GeneJET Plasmid Miniprep kit (Thermo Scientific) to isolate the pSTEntry.phage-cDNA vectors and Sanger sequenced with SEVA_PS1 and SEVA_PS2 primers.
TABLE-US-00004 TABLE2 Primersusedtodeterminethetranscriptionstartsiteofphagepromoters with5-capping-RACE. Name Sequence TSS_TSO ACACTCTTTCCCTACACGACGCTCTTCCGATCTrGrGrG[SEQIDNO:6] TSS_outerprimer AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTC TTCCGATCT[SEQIDNO:7] TSS_innerprimer ATAGCTCTTCTAGACTACACGACGCTCTTCCGATCT[SEQIDNO:8] TSS_GSP1 TCAGTTTACCGTTGGTTGCATCACCTTCACCTTCACCACGAACAGAGAA TTTGTGGCC[SEQIDNO:9] TSS_GSP2 TAGGCTCTTCTCTTCGAACAGAGAATTTGTGGCC[SEQIDNO:10]
Flow Cytometry
[0204] Single-cell fluorescent data of strains were obtained by flow cytometry. First, overnight cultures were prepared in duplo, which was diluted 20-fold in a fresh M9 medium the following day in a clear 96-well plate with a flat bottom and incubated for 2 h in shaking conditions. At this point, the cell cultures were split in two to create an uninduced and induced sample, to which the required inducer(s) was added. After overnight induction, samples were diluted tenfold in 200 L of a PBS medium (pH 7.4, filter-sterilized (0.22 m)) and analyzed on a CytoFLEXS Flow Cytometry machine (Beckman, San Jose, CA, USA). Then, 5000 events (i.e., individual cells) were screened for FSC-A (gain 165), SSC-A (gain 400), and FITC-A (gain 10), with a maximal flow rate of 1000 events/L. The FITC-A channel detected msfGFP fluorescence of single cells, where a value above 10.sup.4 was considered positive for msfGFP fluorescence.
TABLE-US-00005 TABLE 3 Connecting letters report of a pairwise Student's t-test of the cross-recognition assay between phage promoters and RNAPs. Levels not connected by same letter are different. Promoter RNAP Mean T7 T7 A 2060.566 phi15 phi15 B 660.3784 PPPL-1 PPPL-1 C 245.7189 Pf-10 Pf-10 C D 189.0884 T7 phi15 D E 85.7572 67PfluR64PP T7 E 41.8903 T7 PPPL-1 E 40.0312 Pf-10 PPPL-1 E 36.1123 PPPL-1 T7 E 29.5002 Pf-10 phi15 E 29.4009 Pf-10 67PfluR64PP E 25.9146 T7 67PfluR64PP E 22.6429 67PfluR64PP 67PfluR64PP E 22.1996 T7 Pf-10 E 21.0388 PPPL-1 phi15 E 15.8159 67PfluR64PP Pf-10 E 15.3239 phi15 T7 E 12.4631 PPPL-1 Pf-10 E 10.3922 Pf-10 T7 E 8.5055 67PfluR64PP phi15 E 7.5807 phi15 67PfluR64PP E 7.239 PPPL-1 67PfluR64PP E 7.1203 67PfluR64PP PPPL-1 E 3.9164 phi15 PPPL-1 E 2.1663 phi15 Pf-10 E 2.134