METHOD OF TREATING NEONATES WITH IGF-1 COMPLEX
20260083823 · 2026-03-26
Inventors
- Galen John CAREY (Lexington, MA, US)
- Norman Walter BARTON (Phoenix, MD, US)
- David Charles Reginald LEY (Lund, SE)
- Claes Per EKSTRÖM (Lund, SE)
- Magnus Göran GRAM (Lund, SE)
- Niklas Emanuel ORTENLÖF (Lund, SE)
Cpc classification
A61K38/30
HUMAN NECESSITIES
International classification
Abstract
The present disclosure relates to treatment of subpopulation of neonates for reducing the risk of IVH and/or severe IVH, such as grade 3 or 4 IVH by administering a therapeutic amount of a composition comprising IGF-1 and an IGF binding protein (such as IGFBP-3), for example as a complex, at a dose of 200-500 g/Kg/day. In a further aspect there is provided stabilisation of vital functions when hyperosmolarity occurs and/or protection from circulatory collapse.
Claims
1.-17. (canceled)
18. A method of treatment for prevention of intraventricular haemorrhage (IVH) and prevention/reduction of mortality for all causes in a preterm infant at a gestational age of 23 to 26 weeks comprising administering a complex of IGF-1 and IGFBP-3 via continuous infusion at a dose of 350-500 g/Kg/day, for a period of at least 7 days, such that plasma levels of IGF-1 are maintained within the therapeutic range 28 g/L to 109 g/L during the treatment period, wherein after exclusion of baseline assessment timepoint more than 60% of those infants receiving treatment are IVH free, and pathological fluctuations in blood osmolarity are stabilised.
19. A method according to claim 18, wherein the preterm infant is 23 to 25 weeks gestational age.
20. A method according to claim 18, wherein 87.5% of the treated patient population of 26 weeks gestational age are IVH free.
21. A method according to claim 18, wherein a treated preterm has stabilisation of vital functions in the presence of hyperosmolarity.
22. A method according to claim 21, wherein the vital function is breathing, heart rate, or blood pressure.
23. A method according to claim 18, wherein the preterm infants are treated for at least 2 to 6 weeks.
24. A method according to claim 18, wherein treatment is continued until 32, 33, or 34 weeks gestational age.
25. A method of preventing IVH and prevention/reduction of mortality for all causes in a preterm infant at a gestational age of 23 to 26 weeks by administering via continuous infusion a composition comprising a complex of IGF-1 and IGFBP-3, at a dose of 350-500 g/Kg/day, for a period of at least 7 days, such that plasma levels of IGF-1 are maintained within the therapeutic range 28 g/L to 109 g/L during the treatment period, wherein after exclusion of baseline assessment timepoint more than 60% of those infants receiving treatment are IVH free.
26. A method according to claim 25, wherein the preterm infant is 23 to 25 weeks gestational age.
27. A method according to claim 25, wherein 87.5% of the treated patient population of 26 weeks gestational age are IVH free.
28. A method according to claim 25, wherein a treated preterm has stabilisation of vital functions in the presence of hyperosmolarity.
29. A method according to claim 28, wherein the vital function is breathing, heart rate, or blood pressure.
30. A method according to claim 25, wherein the preterm infants are treated for at least 2 to 6 weeks.
31. A method according to claim 25, wherein treatment is continued until 32, 33, or 34 weeks gestational age.
Description
SUMMARY OF THE FIGURES
[0068]
[0069]
[0070]
[0071]
[0072]
[0073]
[0074]
[0075]
[0076]
[0077]
[0078]
[0079]
[0080]
[0081]
[0082]
[0083]
[0084]
[0085]
[0086]
[0087]
[0088]
[0089]
[0090]
[0091]
[0092]
[0093]
[0094]
[0095]
[0096]
[0097]
EXAMPLES
Example 1 Neonate Phase II Study Findings Relative to IVH
[0098] A phase II trial in which infants less than 28 weeks gestational age were randomly allocated to rhIGF-1/rhIGFBP-3 (50 g/ml solution) or standard of care (SOC). Serial cranial ultrasounds were performed between birth and term-equivalent age. Presence of germinal matrix haemorrhage and intraventricular haemorrhage (GMH-IVH), periventricular haemorrhagic infarction (PHI), post-haemorrhagic ventricular dilatation (PHVD), and white matter injury (WMI) were scored by two independent masked readers.
[0099] Eligible infants had a gestational age (GA) at birth ranging from 23 weeks+0 days to 27 weeks+6 days. Exclusion criteria included detectable gross malformation, known or suspected chromosomal abnormality, clinically significant neurological disease, GMH-IVH grade II or III, or PHI (infants with grade I GMH-IVH were included).
[0100] Infants in the active treatment group received a standardized dosage of 250 g/kg per day of rhIGF-1/rhIGFBP-3 via continuous intravenous infusion in addition to SOC from 24 hours of birth until a postmenstrual age (PMA) of 29 weeks+6 days.
[0101] Infants in the control group received SOC based on their individual medical needs and according to local protocols.
[0102] A post-hoc analysis was conducted to further explore the phase II study findings relative to IVH.
TABLE-US-00001 Table 1 is analysis of those infants that received treatment within the required therapeutic range Treated IGF-1/IGFBP-3* Control i.e. standard of care Gestational No PHI Age n bleed Grade1 Grade 2 Grade 3 (Grade 4) 23 8 2 3 2 0 1 3* 1* 0* 2* 0* 0* 24 14 9 0 1 1 3 17* 11* 5* 0* 0* 1* 25 9 1 4 3 0 1 13* 8* 1* 2* 0* 2*
TABLE-US-00002 Out of 23 treated infants: Out of 21 untreated infants: PHI = 12.5% 16% had PHI Grade 3 IVH = 0% 3% had grade 3 Grade 2 IVH = 12% 19.4% had grade 2 Grade 1 IVH = 18% 21% had grade 1 No IVH = 60% 38.7% No IVH No IVH and grade 1 for No IVH and grade 1 for treated = 78% untreated = 59.7% Grade 3 and PHI =12.5% Grade 3 and PHI = 19%
TABLE-US-00003 TABLE 2 Treated IGF-1/IGFBP-3* Control i.e. standard of care Gestational Age n No bleed Grade 1 Grade 2 Grade 3 Grade 4 26 15 11 0 1 1 2 16* 14* 0* 1* 0* 1*
TABLE-US-00004 Out of 16 treated infants: Out of 15 untreated infants: PHI = 6.25% 13.3% had PHI Grade 3 IVH = 0% 6.6% had grade 3 Grade 2 IVH = 6.25% 6.6%% had grade 2 Grade 1 IVH = 0% 0% had grade 1 No IVH = 87.5% 73.3% No IVH No IVH and grade 1 for No IVH and grade 1 for treated = 87.5% untreated = 73.3% Grade 3 and PHI = 6.25% Grade 3 and PHI = 19.9%
[0103] This data shows that treatment of infants with low gestational age 23 to 25 weeks are more protected from incidences of IVH than those infants who receive only the standard of care 60% vs 38.7% respectively, and incidence of grade 2, 3 and 4 IVH is also reduced in the patient population.
[0104] Infants born at 26 weeks were protected against grade 3 and grade 4 incidences of IVH by treatment with IGF-1/IGFBP-3 (6.25% vs 19.9%).
GMH-IVH Graded According to Volpe Method
TABLE-US-00005 Severity Description Grade I GMH with no or minimal IVH (<10% of ventricular area on parasagittal view) Grade II IVH in 10-50% of ventricular area on parasagittal view Grade III IVH in >50% of ventricular area on parasagittal view; usually distends lateral ventricle Grade IV (IVH and PHI) IVH compounded by haemorrhagic venous infarction in the periventricular white matter
Example 2 Summary
Pre-Term Rabbit Pups Treatment with IGF-1/IGFBP-3
[0105] Preterm rabbit pups were delivered by caesarean section on E29 (term 32 days). IVH was induced by an i.p. administration of a 50% glycerol solution at 6 to 24-hours post-partum and verified by high-frequency ultrasound (HFU) at 24 hours. IVH initiating hyperosmolarity was induced by i.p. administration of a 50% glycerol at 6-hours post-partum. IGF-1/IGFBP-3 (8 mg/kg) (n=38) or vehicle (n=39) were s.c. administered from 3 hours of age and every 12 hours onwards, see
[0106] The rate of induced IVH was highest at 6 hours post-delivery (66%) with a decreasing incidence at 12-24 hours, which is why it was selected, see Table 4.
[0107] Plasma osmolarity increase without treatment is shown in
[0108] Heart rate, oxygen saturation and breathing rate data without treatment is shown in
[0109] The data on IVH shows a numerical trend that treatment may provide protection against IVH about 48 hours post-glycerol-administration is initiated, see Table 3.
TABLE-US-00006 TABLE 3 Treatment group/Number of animals IVH incidence administered with after 24 h IVH incidence after 48 h glycerol (n=) (n/n and %) (n/n and %) rhIGF-1/rhIGFBP-3, 8/38 21% 8/38 21% n = 38 Vehicle, n = 39 10/39 25.6% 11/39 28.2%
Materials and Methods
Animals
[0110] Animal studies were conducted in accordance with and approved by the Swedish Animal Ethics Committee in Lund, Sweden. Reporting follows the ARRIVE guidelines. A well-established rabbit model for preterm birth, using a half-breed between New Zealand White and Lop rabbits (Lberd, Sweden), with glycerol-induced intraventricular hemorrhage (IVH) were used as previously described.
[0111] Briefly, the experiments were performed on a total of 139 rabbit pups from 20 litters delivered via caesarean section (c.s.) after the does were anesthetized with i.v. propofol (5 mg/kg, Primen Pharmaceuticals Oy, Helsinki, Finland) on day 29 (full term=31-32 days). After delivery, the pups were handled, fed and nursed for by highly experienced animal laboratory staff. The pups were dried and placed in an infant incubator set to a temperature of 30 C. and 60% humidity.
Experimental Setup:
[0112] Following preterm birth, animals were marked and randomized to experimental groups, treatment regimens, and termination time-points with equal distribution based on their bodyweights and litter. The experimental setup of experiments (A) and (B) are shown in detail in
A. Investigation on the IVH-Induction Window
[0113] In Experiment A, the animals were subcutaneously (s.c.) injected after birth with a single bolus (100 uL) of sterile isotonic saline (0.9% NaCl, B Braun, Melsungen, Germany). At approximately 5 hours after birth, animals were monitored with high-frequency ultrasound (HFU, Vevo 2100, VisualSonics Inc., Toronto, ON, Canada) with a MS-550D 40 MHz transducer to scan for any spontaneous cranial bleedings as described previously. All non-bleeding animals received a single bolus of 50% (v/v) sterile glycerol solution (6.5 g/kg, Teknova, Hollister, US) given as an intraperitoneal injection (i.p.) at 6, 12, 18 or 24 hours after birth depending on the allocated experimental group. Two consecutive ultrasound scans were performed at 12 and 24 hours post-glycerol administration. Animals were terminated 24 hours post-glycerol administration, corresponding to a postnatal age of 30 (6 hour glycerol administration group), 36 (12 hour glycerol administration group), 42 (18 hour glycerol administration group) or 48 (24 hour glycerol administration group) hours, respectively.
B. Preventive Effect of rhIGF-1/rhIGFBP-3 on Glycerol-Induced IVH
[0114] In Experiment B, the animals were s.c. administered with recombinant human (rh) IGF-1/rhIGFBP-3 (supplied, formulated and prepared in vehicle solution as described by Takeda Pharmaceutical Company Ltd, Boston, MA, USA) at 8 mg/kg or saline vehicle (0.9% NaCl, B Braun) at approximately 3 hours of age, and thereafter every 12 hours at an additional 4 consecutive time-points (for a total of 5 administrations). A single i.p. bolus of 50% glycerol solution (6.5 g/kg) was administered at 6 hours of age, 3 hours after the first rhIGF-1/rhIGFBP-3 administration. HFU scans were performed as described above every 24 hours post-glycerol administration to monitor the severity of the IVH. Pups with severe IVH on the ultrasound were assigned to the IVH group (
Tissue Collection and Processing
[0115] Animals were euthanized by decapitation at respective end-point (as determined by the experimental groups). Blood was collected from gravitation in Li-Heparin and Serum tubes (Microvette, Sarstedt. Germany), centrifuged and subsequently plasma and serum were immediately frozen and stored at 80 C. An ear biopsy (for sex determinations) was collected, snap frozen and stored at 80 C.
[0116] Following termination, brains were excised from the skull and immersion fixated for 24 hours in freshly prepared 4% paraformaldehyde solution (PFA, in 0.1 M phosphate buffer, pH 7.4). A change to fresh PFA was done after 3-6 hours and brains were immersed for a total of 24 hours, at 4 C. Brains were then cryo-protected by sequential immersion in 15% sucrose (diluted in phosphate buffer saline, PBS, 0.1 M, pH 7.4) for 6 hours and in 25% sucrose (diluted in PBS) for another 6 hours. Brains were mounted in TissueTec (Sakura Finetek, Torrance, CA, USA) and frozen (at around 60 C.) in cryomolds, on dry ice in isopentane (2-methylbutane, Sigma-Aldrich, St. Louis, MO, USA). Sections (12 m) were cut on a cryotome (Microm, HM 5000M, Microm Laborgeraete GmbH, Walldorf, Germany). Sections, were collected on SuperFrost plus slides (Menzel, Braunschweig, Germany). The brains were cryo-sectioned by coronal dissection in three blocks (forebrain, midbrain and hindbrain) and stored at 20 C.
Hematoxylin-Eosin
[0117] To define the brain neuroanatomy and thereby enable macroscopic evaluation, sections were stained with hematoxylin-eosin (HE). The HE staining procedure was performed as follows: Sections were air-dried, at room temperature (RT) or 37 C., for 20-30 minutes, rinsed in PBS, 25 minutes, followed by a rinse in dH.sub.2O for 1 minute. Sections were immersed in Mayers Hematoxylin (Histolab, Gothenburg, Sweden), for 2 minutes, followed by three fast 1 minute rinses in dH.sub.2O. Sections were then immersed in sodium bicarbonate (0.1%), for 1 minute followed by immersion in dH.sub.2O for 21 minute. Sections were immersed in 70% ethanol for 2 minutes, in Eosin (Histolab, 0.2% diluted in 70% ethanol acidified with glacial acetic acid) for 3 minutes. Sections were dehydrated in alcohol (96% 2 and 100% 2 for 3 minutes in each solution), and in xylene (100% for >10 minutes). Sections were mounted in Pertex (Histolab) and cover slipped.
Peroxidase Histochemistry
[0118] To detect peroxidase (PO) activity, and increase thereof by Hb, and to be able to determine its distribution in the brains of all animal groups we performed an adapted protocol of the enhanced peroxidase reaction of cryosections. Briefly, sections were air-dried, at RT or 37 C., for 20-30 minutes, rinsed in PBS 210 minutes. The peroxidase reaction was performed in a solution containing 3,3-diaminobenzidine (DAB, 0.5 mg/ml diluted in PBS, Sigma-Adrich) containing 0.015% H.sub.2O.sub.2 (Merck, USA), for 10 minutes at RT. Sections were then rinsed in PBS 35 min, and in H.sub.2O for 1 minute. Counterstaining was performed with hematoxylin (HTX, Mayers, Histolab), via immersion of sections in HTX for 2 minutes, and rinses in dH.sub.2O followed for 31 minute. Sections were then dehydrated in alcohol (70% for 1 minute, 96% for 25 minutes and 100% for 27 minutes), and in xylene (100% for 25 min). Sections were mounted in Pertex (Histolab) and cover slipped.
Histology Evaluations
[0119] Histological evaluations of the degree of IVH were undertaken to compare and validate the HFU examination. The evaluations were made in three steps. First starting with an overall image analysis with macroscopic morphological assessment for the locality of any bleeding. Thereafter the whole brain was visually evaluated in the extent of any arachnoidal, parenchymal, ventricular, cerebellar or brainstem located bleeding. Subsequently evaluation of the degree of ventricular dilatation, findings of any tissue atrophy or necrosis and an overall scoring of bleeding in the three sectioned blocks. In the next step the different sections were stained with Hematoxylin/Eosin for determination of hemoglobin (Hb) leakage from erythrocytes and free Hb content, thereafter immunohistochemical labelling of PO for quantification of Hb in adjacent sections. The image analysis and scoring were performed blinded for the operator.
Serum IGF-1 Levels
[0120] The serum concentration of IGF-1 was determined using a human IGF-1 ELISA kit (Mediagnost, Reutlingen, Germany). The analysis was performed according to the manufacturer's instructions which states that the assay is applicable for rabbit serum samples.
Sex Determinations
[0121] Determinations of rabbit sex was done by confirming the presence of the sex determining region Y gene (gene ID: 100328958) in the rabbit genome using PCR and gel electrophoresis visualization as described before (1). Briefly, DNA was extracted using DNeasy Blood and Tissue Kit (Qiagen, Hilden, Germany) according to the manufacturer's instructions. One (1) ul of DNA was used in respective PCR reaction (30 cycles at 57 C.) with the following primers: Sense: TGCAATACAGGAGGAACACG, Antisense: AGCAAACTGTCGCTCTTCTG. Presence of a band at approx. 299 bp was determined as male, and correspondingly no visual band was determined as female.
Statistical Power Determination and Data Analysis
[0122] Based on the prevalence of IVH in Experiment A, a power estimation was made to calculate the group size for Experiment B. The aim was to obtain a treatment effect of 50%, and the calculations was based on numbers reported in randomized control clinical trial reported by Ley et al. (6). Calculations were made with power of (1=0.80) and Type I error of (=0.05) generating the number of subjects and group size (see sample size in Results).
[0123] Statistical significance was calculated with a One-way ANOVA corrected for multiple comparisons (Bonferroni) or mixed effects analysis with a Two-way ANOVA using Dunnett's multiple comparisons test. Comparison of treatment group versus control group was evaluated using Student's t-test. Categorical outcome analysis was done on contingency data with Fischer's exact test with p-value and the difference between proportions as attributable risk in percent (%). When possible, animals that died or were euthanized prior to scheduled termination were included in the statistical analysis. P-values <0.05 were considered significant. Statistical analyses were performed using GraphPad Prism (GraphPad Prism 9; GraphPad, San Diego, US). Results
Rate of IVH Induction
[0124] In Experiment A, the incidence of developing an IVH in preterm rabbit pups after i.p. administration of a 50% glycerol solution was highest when administered at 6 hours after birth reaching an incidence of 66% (n=4 out of 6, see Table 4). At later time-points of induction (18 and 24 hours) the incidence decreased linearly (33%, n=2 out of 6; and 14%, n=1 out of 7, see Table 4). No animals in the group receiving glycerol at 12 hours (0%, n=0 out of 5, see Table 4) of age develop IVH in this experiment. Based on these results, a glycerol administration time-point of 6 hours post-birth was selected as the time-point for induction of IVH in Experiment B.
TABLE-US-00007 TABLE 4 Administration group/ IVH incidence after 24 h Glycerol administered (n) (n/n and %) 6 hours (6) 4/6 66% 12 hours (5) 0/5 0% 18 hours (6) 2/6 33% 24 hours (7) 1/7 14%
[0125] The incidence of IVH (%) in Experiment A (n=5-7). Animals were i.p. administered a 50% glycerol bolus (6.5 g/kg) at 6, 12, 18 or 24 hours after birth. The extent of bleeding were assessed by high-frequency ultrasound 24 hours after glycerol admin. Cranial bleeding were scored as severe IVH or no IVH. i.p., intraperitoneal; IVH, intraventricular haemorrhage.
Incidence of IVH and Sex Distribution.
[0126] In Experiment B, a numerical trend towards reduced occurrence of severe IVH could be observed in the rhIGF-1/rhIGFBP-3 group as compared to the Vehicle control group at 48 hours (21% vs. 28.2%, p-value 0.598). Of notice, the difference in rate of severe IVH was observed to increase between the rhIGF-1/IGFBP-3 and Vehicle group at 48 vs. 24 hours (7.2% vs. 4.6% respectively) (Table 3). Distribution of sex was found to be evenly distributed in the rhIGF-1/IGFBP-3 group, whereas there was a slightly uneven distribution, with a reduced number of males, in the Vehicle group (Table 5).
TABLE-US-00008 TABLE 5 Treatment Distribution No. of IVH Distribution animals IVH incidence Distribution, IVH incidence after 24 h, IVH after administered after 24 h M/F after 48 h M/F 48 h, M/F glycerol (n=) (n/n and %) (n) (n/n and %) (n) (n) rhIGF-1/ 8/38 21% 17/21 8/38 21% 5/3 5/3 rhIGFBP-3, n = 38 Vehicle, n = 39 10/39 25.6% 17/22 11/39 28.2% 2/8 3/8
[0127] Group size, incidence of IVH (%) and sex distribution in Experiment B, at 24 and 48 hours after glycerol administration in animals receiving either rhIGF-1/rhIGFBP-3 at 8 mg/kg (n=38) or Vehicle (n=39). p-values from Fischer's exact test rhIGF-1, recombinant human (rh) insulin-like growth factor-1/rh insulin-like growth factor binding protein-3; IVH, intraventricular haemorrhage.
Histological Analysis Confirms Ultrasound Evaluations
[0128] To validate the ultrasound examinations in the detection of IVH, or presence of additional bleedings within the parenchyma, brain tissue was evaluated by histological analysis. Macroscopic histomorphological evaluation displayed no bleedings in animals scored as no IVH in the ultrasound examination, as exemplified in
rhIGF-1/IGFBP-3 Increase Survival
[0129] The survival at 48 hours following IVH was observed to be approximately 63.6% (n=7 out of 11) in the vehicle administered group, and 87.5% (n=7 out of 8) in the rhIGF-1/rhIGFBP-3 administered group (
TABLE-US-00009 TABLE 6 Mortality at 54 H Mortality at 54 H Overall mortality Treatment group in IVH animals in no IVH animals (IVH and no IVH) (n=) (n/n and %) (n/n and %) at 54 H (n/n and %) rhIGF- 1/8 12.5% 0/30 0% 1/38 2.6 1/rhIGFBP-3, n = 38 Vehicle, n = 39 3/11 27.3% 2/28 7.1% 5/39 12.8
Serum Levels of IGF-1
[0130] Circulating levels of endogenous IGF-1 in Experiment A display a significant decline in concentration after birth in the preterm rabbit pup (
[0131] Endogenous serum levels of IGF-1 in preterm rabbit pups (A) from Experiment A, after administration of 50% glycerol. Blood were collected at decapitation at 30, 36, 42 or 48 hours after C-section. n=2-5. Boxplot with min and max values. *p<0.05.
[0132] Serum levels of IGF-1 (B) in preterm rabbit pups with IVH (n=9) or no IVH (n=4) at 30-48 hrs after C-section. Boxplot with min and max values. (C) Serum levels at 54 hours after birth of IGF-1 after rhIGF-1/rhIGFBP-3 (8 mg/kg) or Vehicle administration in Experiment B. Boxplot with min and max values. Unpaired t-test ***p<0.001. No significant difference comparing both administration groups (p=0.30 and 0.18; rhIGF-1/rhIGFBP-3 and Vehicle groups respectively). C-section, Caesarean section; IVH, intraventricular haemorrhage; IGF-1, Insulin-like growth factor-1. rhIGF-1/rhIGFBP-3, recombinant human (rh) insulin-like growth factor-1/rh insulin-like growth factor binding protein-3.
Example 3
[0133] Preterm rabbit pups (E29) were subjected to subcutaneous administration of labelled (FITC, biotin or Alexa Fluor-647) or unlabelled IGF-1/IGFBP-3 (8 mg/kg) and followed for 5 and 24 hours. Brains were perfused and investigated for presence of IGF-1 and interaction with the IGF-1R using confocal-, electron-, and light sheet microscopy. In addition, the CP was collected and analysed for IGF-1R activation using western blot
[0134] IGF-1/IGFBP-3, conjugated with Alexa Fluor-647 or biotin, was detected in the CP, the subfornical organ and the subarachnoid space five hours post-administration (
[0135] Western blot analysis displayed an increased activation, i.e. phosphorylation, of the IGF-1R downstream pathways MAP kinase (as shown by p.ERK) and PI 3-kinase (as shown by p.PKB) following exposure to IGF-1/IGFBP-3 (
[0136] Blood-borne exposure of IGF-1/IGFBP-3 binds to and translocates across the CP as well as activates its IGF-1 receptor i the preterm rabbit brain.
[0137] This indicates potential impact of systemically administered IGF-1/IGFBP-3 on the development of the immature brain.
Example 4 Choroid Plexus Extracellular Vesicle Transport of Blood Borne Insulin-Like Growth Factor 1 to the Hippocampus of the Immature Brain
Materials & Methods
Preterm Rabbit Pups
[0138] The animal protocols were approved by the Swedish Animal Ethics Committee in Lund (Dnr: 5.8.18-06020/2019). We used the well-established preterm rabbit pup model in accordance with the previous description (42). The New Zealand White was used (Egle Kergiene, Lundsbrunn, Sweden). Briefly, the experiments were performed on a total of 9 rabbit pups from 7 litters (4 females and 4 males) delivered via cesarean section (c.s.) after the does were anesthetized with intravenous Propofol-Lipuro (20 mg/ml i.v., B. Braun Melsungen AG, Melsungen, Germany) on day 29 (term 31-32 days). After delivery, the pups were handled and nursed by the animal laboratory staff. The pups were dried and placed in an infant incubator set to 30 C. and 60% humidity. At approximately. 1-2 hours of age, the pups were weighed, marked, and hand-fed with bovine colostrum (100 ml/kg/day, Biodane Pharma, Gesten, Denmark) using a 4 French feeding tube (Vygon, Ecouven, France). At 12 hours of age, the pups received a mixture (1:1, v/v) of bovine colostrum and Fox Valley 30/50 (Melk voor Dieren, Rotterdam, the Netherlands). From 24 hours and onwards, pups received only Fox Valley 30/50. The administered amount of Fox Valley 30/50 was increased every 24 hours by 10 ml/kg/day. Feeding at 12, 36 and 60 hours of age were reduced to half of the previous corresponding dose, i.e., 50 ml/kg at 12 hours of age (corresponding to half of 100 ml/kg given at birth) etc. Pups were gently cleaned once or twice a day, as required to maintain hygiene.
Preterm Piglets
[0139] All animal procedures were performed in accordance with the Danish National Committee on Animal Experimentation (license no. 2014-15-0201-00418). Preterm piglets were delivered by cesarian section at 106 day of gestation (full term=117 days), housed in individual incubators and reared to either 5 (P5) or 9 days (P9) as previously described in L. I. Christiansen et al., Insulin-Like Growth Factor-1 Supplementation Promotes Brain Maturation in Preterm Pigs. eNeuro 10 (2023) . . . . Pigs were treated with either vehicle (control group) or recombinant human (rh) IGF-1/rhIGFBP-3 complex (2.25 mg/kg/d; mecasermin rinfabate, Takeda) as continuous systemic infusion either via an intra-arterial catheter until P5 and subcutaneously three times per day until P9. Detailed feeding regiment and physiological, behavior and clinical responses to IGF-1 treatment, including brain, gut, metabolic, and immune effects are reported in separate articles (In Christiansen et al. above & K. Holgersen et al., Clinical outcome and gut development after insulin-like growth factor-1 supplementation to preterm pigs. Front Pediatr 10, 868911 (2022). P9 pigs (used in this study) were anesthetized and then sacrificed with intracardiac injection of sodium pentobarbital followed by immediate collection of CSF by suboccipital puncture. The CSF was centrifuged at 2500g at 4 C. for 10 min, visually inspected for stick bleedings (to exclude blood contamination) and stored at 80 C.
Primary ChPE Cell Cultures
[0140] The animal protocols were approved by the Swedish Animal Ethics Committee in Lund, Sweden (Dnr. 5.8.18-12,930/2019). Primary murine ChPE cell culture studies were performed as previously described (17). In brief, brains from 3-8-day old pups (C57BI/6Ncrl, Scanbur, Karlslunde, Denmark) were isolated. ChP from lateral and fourth ventricle were isolated under a dissection microscope
[0141] (Nikon SMZ800N Stereomicroscope, Tokyo, Minato, Japan). The cells were further dissociated by the enzymatic reaction of 2 mg/ml pronase (isolated from Streptomyces griseus, Merck, Burlington, MA, USA). The reaction was terminated by the addition of excess complete DMEM-F12 cell culture medium (Gibco, Waltham, MA, USA) containing 10% fetal bovine serum (FBS, Gibco) and 1% Antibiotic-Antimycotic (Gibco). The cells were then centrifuged 1000g for 2 minutes, resuspended in DMEM-F12 culture medium and plated (105 cells/well) on a 12-well transwell system (CLS3460-48EA, Sigma). Cells were incubated at 37 C. in 5% CO2 for 8-9 days. To eliminate fibroblast contamination, cell culture media were changed after 48 hours to complete DMEM-F12 culture media containing cytosine arabinoside (Ara-C, Merck). The complete DMEM-F12 culture medium was thereafter changed every 48 hours. Functional characteristics of the ChPE cells were ascertained by positive labeling for TTR and ZO-1, absent labeling for fibroblast markers (S100A4 and Hsp47) and an increasing TEER during culture (described in more details in Transepithelial electric resistance (TEER)).
Transepithelial Electric Resistance (TEER)
[0142] TEER analysis was performed to ensure that ChPE cells retained/established blood barrier function and was conducted using the EVOM2 (World Precision Instruments, Sarasota, FL, USA). The probes were sterilized by incubating for 15 seconds to 1 minute in 70% ethanol and washed with phosphate buffered saline (PBS, pH 7.4). Identical sterilization steps were performed between every TEER measurement. TEER measurement of wells containing only complete DMEM-F12 cell culture medium was used as blanks and the obtained reading was subtracted from all measurements. The filter membrane diameter was multiplied to all blank subtracted measurement and the electric resistance was expressed as .Math.cm2.
IGF-1 Exposure of ChPE Cell Cultures
[0143] After 8-10 days of culturing of the ChPE cells, the cells reached electrical resistance readings of 80-110 .Math.cm2 and was considered ready for experimental exposure (14). The cell culture media was changed to complete DMEM-F12 containing 10% Exosome-Depleted FBS (Gibco) and the culture was maintained for 24 hours. Thereafter, 4 hours before IGF-1 exposure, the cell culture media was changed to DMEM-F12 containing 2% Exosome-Depleted FBS. 40, 100 or 250 ng/ml human IGF-1 (R&D systems, 291-G1, Minneapolis, MN, USA) was added to the basolateral area (corresponding to the circulatory/blood compartment), and the ChPE cell culture was exposed for 24 hours. Subsequently, the apical supernatant (corresponding to the CSF compartment) as well as the basolateral supernatant was collected and stored at 80 C. until subsequent EV preparation and analysis (see EV preparation for further details).
Diffusion Assay
[0144] ChPE cell cultures were prepared as described in Primary ChPE cell cultures. Next, transwell were transferred to a new multi-well plate and 800 l phenol red-free MEM (Gibco) was added to the basolateral compartment. The cell culture medium of the apical compartment (MEM) was replaced with 250 l of 1 mg/ml 20 kDa FITC-Dextran solution (Merck). The ChPE cells were incubated, protected from light, at room temperature for 20 minutes. Subsequently, the basolateral media was collected and 100 l aliquots transferred to a 96-well microtiter plate in triplicates and the plate was read at 490 (excitation) and 520 nm (emission) using a VICTOR3 plate reader (Perkin Elmer, Waltham, MA, USA).
EV Preparation
[0145] To prepare EVs from ChPE cell culture supernatant, the miRCURY exosome kit (Qiagen, Hilden, North Rhine-Westphalia, Germany) was used according to the manufacturer's instructions. In brief, samples were centrifuged for 8 minutes at 3000g to remove debris. Precipitation media (0.4) was added to the supernatant and incubated over-night at 4 C. The precipitation solution was centrifuged at 10 000g, 20 C. and the supernatant was carefully aspirated and stored at 80 C. The EV pellet was resuspended in 40-100 l of provided suspension media and stored at 80 C. or further prepared for NTA. For subsequent MS analysis, the pellets were directly stored at 80 C.
EV Number and Size Measurements
[0146] To determine EV size and concentration, NTA was used. In brief, EVs were prepared as described above, diluted 1/10 in PBS and injected into NanoSight (LM14C, Malvern Panalytical, Malvern, U.K.). All samples were recorded for 90 seconds in triplicates with camera level 15 and detection threshold 5. Absolute numbers were calculated with the acquisition software (NTA version 3.3, Malvern Panalytical).
Immunofluorescence Microscopy and Image Analysis
[0147] Primary ChPE cells were fixed in 4% buffered paraformaldehyde (PFA prepared in PBS, pH 7.4) for 15 minutes and washed three times with PBS. The cells were thereafter permeabilized with 0.1% TritonX-100 (0.1% in PBS, Invitrogen, Waltham, MA, USA) for 10 minutes, subsequently blocked with 10% FBS for 1 hour, and incubated with primary and secondary antibodies (as described below) over-night at 4 C. and 1 hour room temperature, respectively. The following primary antibodies were used: Hsp47 (1:200, Rabbit anti-Mouse, ab109117, Abcam, Cambridge, UK), S100A4 (1:250, Rabbit anti-Mouse; ab197896, Abcam), IGF-1 (1:100, rabbit-anti-Mouse, bs-0014R, Bioss, Woburn, MA, USA), IGF-1 (1:100, Goat anti-Mouse, AF791, R&D systems), IGF-1R (1:20, Goat anti-Mouse, AF-305-NA, R&D systems), ZO-1 (1:50, Rabbit anti-Mouse, 61-7300, Thermo Fisher Scientific, Waltham, MA, USA), Donkey anti-Goat 647 (1:500, A-21447, Thermo Fisher Scientific), TTR (1:50, Sheep anti-Mouse ab9015, Abcam), CD63 (1:100, Rabbit anti-Mouse, ab217345, Abcam). The following secondary antibodies were used with the corresponding primary antibody: Donkey-anti-Goat 488 (1:500, A-11015, Thermo Fisher Scientific), Goat anti-Rabbit 488 (1:500, ab150077, Abcam), Goat anti-Rabbit 568 (1:500, ab175471, Abcam) and Donkey anti-Sheep 488 (1:400, A-11015, Thermo Fisher Scientific). The membranes were counterstained with Hoechst (1:10 000 in DMSO, H1398, Invitrogen) for 5 minutes at room temperature and mounted using mounting media (Merck). To visualize the samples, a Nikon Confocal A1RHD confocal (Nikon, Minato, Tokyo Japan) microscope was used.
Electron Microscopy
[0148] ChPE derived EVs were prepared as described in EV preparation. 30 l of an EV preparation was fixed with 30 l 4% PFA for 30 minutes at room temperature. A drop (approx. 5 l) of fixed EV suspension was placed on Formvar-carbon coated electron microscopy grid to air dry for 20 minutes at room temperature. Next, to wash the samples, the grid was placed to float over a drop of 100 l PBS, placed on clean parafilm surface. All subsequent steps were performed in the same manner.
[0149] The grids were blocked with 1% bovine serum albumin (BSA, diluted in PBS), incubated with primary antibody against IGF-1 (1:100, Rabbit anti-Mouse, bs-0014R, Bioss) and Flotillin 2 (5 g/ml, Rabbit anti-Mouse, ab96507, Abcam) for 120 minutes at room temperature. Incubation with secondary antibody, Goat anti-rabbit IgG (H+L) 10 nm gold conjugate (17010-1, Ted Pella, Redding, CA, USA) was performed for 60 minutes at room temperature.
[0150] ChPE cells cultured as described in Primary ChPE cell cultures was prefixed with 4% PFA for 1 hour and subsequently rinsed several times with Sorensen phosphate buffer (0.1 M). Cells were thereafter dehydrated with acetone in distilled water in a 6-step series with increased acetone concentration per step (30-100%). Time per step were 5-10 minutes. Cells were then impregnated over night with a 1/1 mixture if acetone and Epon (Agar Scientific Ltd, Stansted, Essex England). Next, the cells were embedded in Epon and then polymerized in Epon for 48 hours at 60 C. and ultra sectioned to 60 nm thick sections. Blocking was subsequently conducted for 1 hour using 1% BSA in distilled water and subsequently cells were incubated with primary antibodies against IGF-1 (1:100, Goat anti-Mouse, AF791, R&D systems) (1:100, Goat anti-Human, AF291, R&D systems) and Flotillin 2 (10 g/ml, Rabbit anti-Mouse, ab96507, Abcam) overnight at 4 C. Incubation with secondary antibody, Rabbit anti-goat IgG (H+L) 10 nm gold conjugate (1/20, 17410-1, Ted Pella, Redding, CA, USA) and Goat anti-rabbit IgG (H+L) 10 nm gold conjugate (1/20, 17010-1, Ted Pella, Redding, CA, USA) was performed for 60 minutes at room temperature. The sections were stained with uranyl acetate (4%, Agar scientific) for 20 minutes at 38 C. All samples including EVs and ChPE cells were examined in a FEI Technai Biotwin 120 kv TEM operated at 100 kV accelerating voltage. Images were recorded with side-mounted Olympus Veleta camera with a resolution of 20482048 pixels (FEI, Hillsboro, OR, USA).
Liquid Chromatography-Mass Spectrometry
[0151] 100 L Ripa buffer (R0278, Sigma-Aldrich) was added to samples prepared as described in EV preparation and subsequently sonicated using a Bioruptor (Diagenode), 40 cycles (15 sec on, 15 sec off). Samples were reduced with dithiothreitol to a final concentration of 10 mM and heated at 56 C. for 30 min followed by alkylation with iodoacetamide to a final of 20 mM for 30 min at room temperature in dark. Samples were precipitated with ice cold ethanol (final concentration of ethanol 90%) overnight at 20 C followed by centrifugation at 14 000g for 10 min. The pellets were air dried and resuspended with 50 L of 100 mM ammonium bicarbonate and sonicated using a Bioruptor (Diagenode), 40 cycles (15 sec on, 15 sec off). Protein concentration was measured at 280 nm using a NanoDrop (DeNovix DS-11, DeNovix Inc; Wilmington, DE, USA). Digestion was performed by adding trypsin in a ratio of 1:50 (Sequencing Grade Modified Trypsin, Part No. V511A, Promega) to the samples and incubated overnight at 37 C. The digestion was stopped by 5 L 10% trifluoroacetic acid. The samples were Speed Vac to dryness and resolved in 2% ACN, 0.1%. Peptides extracted were analyzed on an Exploris 480 mass spectrometer (Thermo Fischer Scientific) coupled with a Vanquish Neo UHPLC system (Thermo Fischer Scientific). Two-column setup was used on the HPLC system and peptides were loaded into an Acclaim PepMap 100 C18 precolumn (75 m2 cm, Thermo Scientific, Waltham, MA) and then separated on an EASY spray column (75 m25 cm, C18, 2 m, 100 , ES902) with the flow rate of 300 nL/min. The column temperature was set 45 C. Solvent A (0.1% FA in water) and solvent B (0.1% FA in 80% ACN) were used to create a 90 min nonlinear gradient from 5 to 25% of solvent B for 75 min and increased 32% for 9 min and the increased to 45% for 6 min to elute the peptides.
[0152] The samples were analyzed with a data-dependent acquisition (DDA) in positive mode. The full mass spectrometry spectra 1 (MS1) resolution were set to 120,000 at m/z 200 and the normalized AGC target was set to 300% with the maximum injection time of 45 ms. The full mass range was set 375-1500 m/z. Precursors were isolated with the isolation window of 1.3 m/z and fragmented by HCD with the normalized collision energy of 30. The full mass spectrometry spectra 2 (MS2) was detected in the Orbitrap with the resolution of 15,000. The normalized AGC target and the maximum injection time were set to 100% and custom, respectively. The intensity threshold for precursor selection was set to 1e4 and 40s dynamic exclusion was applied.
Data Analysis of Mass Spectrometry Data
[0153] The raw DDA data were analyzed with Proteome Discoverer 2.5 Software (Thermo Scientific, Waltham, Massachusetts, USA), and the peptides were identified using SEQUEST HT against UniProtKB Mouse canonical database (UP000000589) and fasta files for the human IGF1 (P05019). The search was performed with the f following parameters applied: carbamidomethylation. of cysteine as static modification; and N-terminal acetylation and methionine oxidation as dynamic modification. Precursor tolerance was set to 10 ppm and fragment tolerance was set to 0.02 ppm. Up to 2 missed cleavages were allowed and Percolator was used for peptide validation at a q-value of maximum 0.01. Extracted peptides were used to identify and quantify them by label-free relative quantification. The extracted chromatographic intensities were used to compare peptide abundance across samples.
[0154] Protein abundancies were submitted to the online tool Proteomill (https://proteomill.com) (44). Missing values were set to that each protein had a minimum of four 6 values in each group. Enrichment analysis was performed by searching the GO, David and Metascape databases for Reactome pathways and GO terms (24-26, 45).
In Vivo Intraventricular Brain Injections
[0155] EVs prepared as described in IGF-1 exposure of CPE cell cultures and EV preparation were stained with PKH26 Red Fluorescent Cell Linker Mini Kit for General Cell Membrane Labeling (Merck, MINI26) as described by the manufacturer. Briefly, 400 l of ChPE supernatant were mixed with PBS and PKH26 (1:200) in a total volume of 800 l and subsequently let to incubate for 20 minutes at room temperature. This was followed by exosome isolation as described in EV preparation and pellet resuspension in 50 l PBS. By guidance with a high-resolution ultrasoundRU (Vevo 2100, VisualSonics Inc., ON, Canada) with a MS-550D 40 MHz transducer, non-sedated preterm rabbit pups with the postnatal age of 24 hours, received an i.c.v. injection of 25 l stained EVs using a BD Microfine+0.3 ml (30 gauge). The preterm rabbit pups were followed for 4.5 hours and anaesthetized with an intramuscular (i.m.) injection of Ketaminol vet. (50 mg/ml, Intervet AB, Stockholm, Sweden) and Rompun vet. (20 mg/ml, Bayer Animal Health, Leverkusen, Germany) in combination with isoflurane inhalation (Attane vet, 1000 mg/g, VM Pharma AB, Stockholm, Sweden). Following sedation, the pups were transcardially perfused with freshly prepared PBS (containing heparin 1000 IU/ml), followed by perfusion with freshly prepared 4% paraformaldehyde (PFA, VWR Chemicals, Leuven, Belgium, buffered with PBS, pH 7.4). After fixation, the brains were extracted from the skull and post-fixed by immersion in 4% PFA. A change to fresh PFA was performed after 6-8 hours and brains were then immersed in PFA for a total of 24 hours at 4 C. and transferred to PBS for further processing as described in Histological detection of administrated EVs in the brain of rabbit pups below.
Histological Detection of Administrated EVs in the Brain of Rabbit Pups
[0156] Brains were excised and were immersed whole in PFA (4% in PBS, pH 7.4; PFA) for 16 hours at 4 C. Brains were subsequently divided in two pieces, coronally in the midbrain (close to the location of the subfornical organ, that were incubated in PFA for 4 hours at room temperature. Next, brains were rinsed in PBS, pH 7.4, for 8 hours at 4 C., embedded in OCT cryomount (Histolab, Sweden) and frozen on dry ice in isopentane (approximately at 60 C.). Sections were cut (10 m thick) through the midbrain with a cryostat and sections holding the lateral and central ventricles with the choroid plexus and the hippocampus were collected on SuperFrost Plus slides (Thermo Scientific/Gerhard Menzel B.V. & Co., Braunschweig, Germany). Following rinses in PBS (25 min) and sections (3-6 per animal) were incubated in 4,6-diamidino-2-phenylindole (DAPI) for 15 minutes at room temperature and were subsequently mounted and cover slipped in Fluoroshield (Abcam) anti-fade mounting media. Analyses were performed with a confocal laser scanning microscope (Zeiss LSM 800, ZEIZZ, Oberkochen, Germany). Detection was performed of PKH26 (stained vesicles), set for excitation maxima at 551 nm and emission maxima at 567 nm. Sequential scanning was performed of PKH26 and DAPI for analyses of the distribution and location of PKH26 fluorescence, primarily in the ChP, ventricular brain ependyma and the parenchyma of the hippocampus. Both hemispheres were analyzed. Threshold detection level of PKH26 was set in brain sections from animals that received only the dye (no vesicles). Representative images were grabbed and converted to TIFF format for illustrations.
In Vitro EV Uptake Experiment with Hippocampal Neurons
[0157] Wistar rats were obtained from Charles River (Sulzfeld, Germany) and handled in accordance with the Danish Animal Welfare Act approved by the Department of Experimental Medicine at the University of Copenhagen (Copenhagen, Denmark).
[0158] Primary hippocampal neurons were isolated from embryonic day 19 Wistar rat embryos in accordance with (46). Dissected hippocampi were chopped in ice-cold Krebs-Ringer buffer (KRB, Invitrogen) and treated with 0.1% (w/v) trypsin for 6-7 minutes at 37 C., followed by incubation with 0.052% (v/w) trypsin inhibitor and 0.008% (v/w) DNase I diluted in KRB. Undissociated tissue was pelleted by centrifugation, and the neurons were resuspended in KRB containing 0.13 mM Ca2+ and 2.4 mM Mg2+ (Invitrogen). Cells were pelleted by centrifugation and resuspended in Neurobasal medium supplemented with 2% (v/v) B27, 100 U/ml penicillin and 100 g/ml streptomycin (all from Invitrogen). Neurons were then plated at density 5104 cells/cm.sup.2 in eight-well LabTek Permanox chamber slides (Nunc, Roskilde, Denmark) pre-coated with 20 g/ml poly-L-lysine and cultured for 8-10 days with half medium exchange at the second and seventh days in vitro.
[0159] For the uptake experiment, ChPE derived EVs were stained with PKH67 Green Fluorescent Cell Linker Mini Kit for General Cell Membrane Labeling (Merck, MINI67) as described by the manufacturer. Briefly, 400 l of ChPE supernatant were mixed with PBS and PKH67 (1:200) in a total volume of 800 l and subsequently let to incubate for 20 minutes at room temperature. This was followed by exosome isolation as described in EV preparation and pellet resuspension in 300 l PBS. Subsequently, neurons were stimulated for 2 hours with the PKH67-stained EVs. For each slide, a well with unstimulated cells was used as control and wells with only PKH67-stained supernatant with no cells were used as negative control.
[0160] Cells were then washed with PBS, fixed with 4% PFA for 20 minutes, blocked with 5% BSA and labeled with polyclonal Rabbit anti-rat growth-associated-protein-43 (GAP-43) antibody (1:1000; Millipore) over-night at 4 C. followed by incubation with secondary Goat anti-Mouse Alexa Fluor 546-conjugated antibodies (1:1000; Invitrogen). For visualization of nuclear morphology, cells were counterstained with Hoechst 33258 (1:1000; Invitrogen) and slides were mounted with antifade mounting medium (Dako, Glostrup, Denmark). Images were recorded in systematic series of fields of view across the whole area of a well using a ZEIZZ confocal laser scanning microscope (ZEIZZ LSM800, ZEIZZ, Oberkochen, Germany).
[0161] For PKHK67 fluorescence analysis, slides were scanned manually due to the unavailability to scan the plastic membranes. Focus was set manually for each image required. To obtain digital images, a wide-field epi-fluorescence microscope (Olympus IX70, Tokyo, Japan) equipped with a digital detector (DP80, Olympus) were used under fixed lighting conditions and regions of interest (ROI) were manually annotated. Images were exported as TIFF and imported to Fiji. Quantification of green signal (PHKH67) per number of nuclei was used to determine fluorescence. Nuclei were calculated with Fiji by the default auto threshold segmentation method and watershed separation following primary smoothing or were manually counted if the separation of cells was not achieved. Small objects, not of nuclei body size, were removed.
Sex Determination
[0162] Determinations of rabbit sex were performed by confirming the presence of the sex-determining region Y gene (gene ID: 100,328,958) in the rabbit genome using PCR and gel electrophoresis visualization as described in A. Hellstrm et al., Insulin-like growth factor 1 has multisystem effects on foetal and preterm infant development. Acta Paediatr 105, 576-586 (2016). Briefly, DNA was extracted from an ear biopsy using DNeasy Blood and Tissue Kit (Qiagen) according to the manufacturer's instructions. One ul of DNA (range: 100-200 ng/l) was used in the PCR reaction (30 cycles at 57 C.) with the following primers: Sense: TGCAATACAGGAGGAACACG, Antisense: AGCAAACTGTCGCTCTTCTG. Presence of a band at approximately 299 bp determined the animal as male, and no corresponding band determined the animal as female.
Statistics
[0163] Statistical significance was calculated using one-way ANOVA with a post hoc Tukey for multiple comparisons of means, or Student's t-test for pair-wise comparisons. P-values <0.05 were considered significant. Data is presented as meansSD. Statistical analyses were performed using R version 4.3.1.
Results
TABLE-US-00010 TABLE 7 Top 20 of the top 100 proteins that are often identified in EVs (http://microvesicles.org/index.html) Preterm Numbers piglet ChPE of times CSF EVs EVs Annotation identified PDCD6IP PDCD6IP Programmed cell death 399 6-interacting protein GAPDH GAPDH Glyceraldehyde-3-phosphate 377 dehydrogenase HSPA8 HSPA8 Heat shock cognate 71 kDa 363 protein ANXA2 ANXA2 Annexin A2 350 CD9 CD9 antigen 337 PKM PKM Pyruvate kinase PKM 328 HSP90AA1 HSP90AA1 Heat shock protein HSP 327 90-alpha ENO1 ENO1 Alpha-enolase 327 ANXA5 ANXA5 Annexin A5 327 HSP90AB1 HSP90AB1 Heat shock protein HSP 90-beta 313 CD63 CD63 antigen 306 YWHAZ YWHAZ 14-3-3 protein zeta/delta 306 YWHAE 14-3-3 protein epsilon 301 EEF1A1 EEF1A1 Elongation factor 1-alpha 1 300 PGK1 PGK1 Phosphoglycerate kinase 1 295 CLTC CLTC Clathrin heavy chain 1 291 PPIA PPIA Peptidyl-prolyl cis-trans 283 isomerase A, N-terminally processed SDCBP SDCBP Syntenin-1 278 ALDOA ALDOA Fructose-bisphosphate 277 aldolase A
IGF-1 is Localized in Intracellular Vesicles in a Neonatal Primary Murine ChPE Transwell Cell Culture Model
[0164] To characterize how circulating human IGF-1 (hIGF-1) affects neonatal ChPE cell secretion of EVs, and its content, we established a transwell in vitro cell culture system using postnatal day 3-8 primary murine ChPE cells. In this system, exposure from the circulation can be mimicked from the basal side, whereas the CSF-side is represented by the apical side, see schematic illustration in
ChPE Cells Secrete IGF-1 Positive EVs Upon hIGF-1 Stimulation
[0165] Next, we aimed to evaluate if hIGF-1 is transported from the ChPE cells in intracellular vesicles to the extracellular space. The neonatal primary murine ChPE cells were exposed to hIGF-1 (40, 100 and 250 ng/ml) at the basal side for 24 hours, and the supernatant at the apical side was collected for subsequent EV preparation and analysis. Successful preparation of EVs were verified by TEM analysis, and confirmed presence of exosomes, by showing positive labeling for the exosomal marker flotillin-2, in the ChPE cell secreted supernatant (
Proteomic Analysis Reveals Presence of hIGF-1 in ChPE Derived EVs Upon hIGF-1 Stimulation
[0166] Next, we asked if the proteome, obtained by mass spectrometry (MS) analysis, of EVs, purified from ChPE cell supernatant, would alter following hIGF-1 exposure. Overall, hIGF-1 induced marginal effects when the significant criteria was set to adjusted p-value (Benjamini-Hochberg-corrected p-value0.05) (
EV Proteomes are Similar Between ChPE Supernatant and Preterm Piglet CSF
[0167] To expand our understanding of the impact of systemic hIGF-1 on the ChP secreted EVs, we investigated if the hIGF-1 exposed ChPE cell derived EV proteome share similarities with that of EVs derived from preterm piglets CSF. Preterm piglets, delivered by cesarian section at a gestational age of 106 days (full term=117 days), were exposed to recombinant hIGF-1 (in complex with IGF-1 binding protein 3 and henceforth referred to as hIGF-1, 2.25 mg/kg/day via a continuous infusion), or the corresponding vehicle solution (Control group) for 9 days, and CSF were collected at termination. Analysis of the proteome, using MS-analysis with significance criteria set to adjusted p-value (Benjamini-Hochberg-corrected p-value0.05), displayed a similar pattern as the ChPE cell derived EVs with only minor changes in the proteome following hIGF-1 exposure (
ChPE Derived EVs Penetrates into the Hippocampus of the Preterm Rabbit Brain
[0168] We aimed to investigate if there is a delivery of hIGF-1 stimulated ChPE derived EVs into a targeted subcortical structure. Thus, utilizing a preterm rabbit pup model, we investigated the distribution of purified and labeled ChPE cell derived EVs in the immature brain following intracerebroventricular (i.e.v.) injection. EVs prepared from hIGF-1 stimulated or control neonatal primary murine ChPE cells in vitro were stained with PKH26, and subsequently i.e.v. injected
(ultrasound guided) into the lateral ventricles of non-sedated preterm rabbit pups (Table 7,
ChPE Cell Derived EVs are Internalized by Hippocampal Neurons In Vitro
[0169] To further characterize the EV mediated interaction between the ChP and the hippocampus, we performed an EV uptake experiment in vitro. Primary rat hippocampal neurons were incubated with purified neonatal primary murine ChPE cell derived EVs labeled with the membrane label PKH67 (green). Following exposure for two hours, the neurons were fixed, labeled with GAP-43 (red) and analyzed by confocal microscopy, see
DISCUSSION
[0170] The ChP is regarded as the gateway to the brain. Here, we describe the ChP as a passage for blood born IGF-1 into deep parts of parenchyma of the developing brain, including the hippocampus. We show that the transportation of IGF-1 appears to be via ChPE-derived EVs. In addition, our experiments indicate that IGF-1 influences the secretion of ChPE-derived EVs, both increasing the amount of EVs secreted, as well as the cargo carried.
[0171] The receptor of growth factor IGF-1 is abundantly expressed across the ChP, providing a possible ligand-receptor interaction of IGF-1 at the blood-CSF-barrier that enables interaction both from the CSF and the blood side. Interestingly, it was shown by Pulford et al. that the uptake of IGF-1 from circulation is non-IGF-1R or binding protein dependent, and we have observed an abundance of the IGF-1R on the CSF facing side of the ChP rather than the blood side. Consequently, we hypothesized that the transport of IGF-1 from the circulation to the immature brain may involve uptake of IGF-1 via endocytosis in the ChP, and a subsequent EV secretion into the CSF. The transport of IGF-1 from the blood to the brain, via interaction with the ChP, has been studied previously. For instance, Carro et al. showed that the ChP is the main route of uptake from blood to the parenchyma in an adult mice exercise model. However, to the best of our knowledge, our study is the first that investigates the effects of IGF-1 on EV formation and secretion from the ChP in the context of the immature brain. By stimulating the ChPE cells in our transwell in vitro model with IGF-1 on the basal side i.e. corresponding to the blood side, we observed an uptake and accumulation in membrane enclosed vesicles of IGF-1 in the ChPE cells. We further observed a translocation of IGF-1 through the ChPE via intracellular vesicles to the apical supernatant that was followed by a secretion of IGF-1 positive EVs into the apical culture medium, i.e. corresponding to the CSF. Interestingly, we also observed that intracellular vesicles carrying IGF-1, displayed positive immunolabeling for the IGF-1R, indicating packaging of IGF-1 may occur together with its receptor. To investigate the relevance of the relevance of the in vitro EV-IGF-1 transportation findings, we characterized the proteome content of the ChPE cell derived EVs and compared it to that of the proteome of preterm piglets CSF derived EVs, following systemic exposure to hIGF-1. Encouragingly, the analysis displayed large similarities between the two data sets, including that 60% of the proteomes were identical, and the pathway of vesicle mediated transport were enriched in both data sets. Although globally we observed only minor differences in the proteome of both data sets, when comparing hIGF-1 stimulation vs. non stimulated one major finding was that hIGF-1 was enriched in EVs derived from hIGF-1 stimulated ChPE cells, thus proving further evidence of IGF-1 transport in EVs through the blood-CSF barrier.
[0172] Based on the observation that IGF-1 encapsulated EVs are secreted into the apical supernatant, i.e. into a compartment corresponding to the CSF, we hypothesized that they are destined for transportation of IGF-1 to recipient cells beyond the ventricular ependyma. Previous studies have in fact shown that ChP derived EVs penetrate the ependymal lining of the ventricles followed by an uptake in astrocytes and microglia. For instance, Grapp et al. and Balusu et al. showed that in a murine adult brain, the ChPE secretes EVs into the CSF which penetrates the ependymal protective cells of the parenchyma, thus enabling delivery of molecules from the ChP to the brain. Grapp et al. further showed how the secretion of EVs from the ChPE to the CNS provides nutrients from the blood to the CNS. In addition, Balusu et al. showed that certain systemic stimuli, such as inflammation, enhanced the EV formation and secretion from the ChPE. However, to the best of our knowledge, a potential distribution of the ChPE-derived EVs to a specific subcortical structure has not been investigated. Importantly, previous studies have, as far as we know, utilized adult murine models to investigate the ChP derived EV penetration of the brain parenchyma. In addition, previous studies investigating distribution of intraventricularly injected EVs have used sedated animals. Sedation is, however, well known to significantly affects circulation and perfusion of the brain. In this study, we therefore performed i.e.v. injection ultrasound guided, of ChPE derived EVs in non-sedated preterm rabbit pups, a model highly suitable and widely used for studies of the immature brain. Surprisingly, we found presence of EVs deep into the hippocampus, and to a certain extent in the deeper layers of the pyramidal and molecular layer of the CA2-CA3 region. To further substantiate and characterize this finding, we investigated the ability of primary hippocampal neurons to take up purified ChPE derived EVs in an in vitro setting. Interestingly, hippocampal neurons displayed an extensive uptake of EVs purified from ChPE cells, and EVs were observed both in the cytoplasm and in the neurites. Altogether, this might suggest a targeted delivery of the ChP derived EVs to the hippocampus of the immature brain. The effect of this delivery has not been studied here, however, considering the change in proteome of the ChP derived EVs following IGF-1 exposure, it might be speculated that it could induce enhanced hippocampal neurodevelopment. In fact, Christiansen et al recently observed that preterm piglets exposed to systemic IGF-1 displayed an increased hippocampus neurodevelopment. Moreover, preterm birth causes delayed maturation of the hippocampus in preterm rabbit pups. This clearly warrants further studies on the impact and relevance of IGF-1 mediated communication between ChP and the developing brain.
[0173] In summary, this study suggests a mechanism for an EV-encapsulated IGF-1 transportation through the blood-CSF barrier and beyond the ependymal lining into the hippocampus in the developing brain (as depicted in